ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart10h01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK068446.1| Oryza sativa (japonica cultivar-group) cDNA clon... 234 2e-58
2dbj|AK067450.1| Oryza sativa (japonica cultivar-group) cDNA clon... 234 2e-58
3ref|XM_463672.1| Oryza sativa (japonica cultivar-group), predic... 170 3e-39
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 170 3e-39
5dbj|AP004332.3| Oryza sativa (japonica cultivar-group) genomic D... 170 3e-39
6dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic D... 170 3e-39
7dbj|AP003262.3| Oryza sativa (japonica cultivar-group) genomic D... 170 3e-39
8gb|AC157500.1| Oryza sativa (japonica cultivar-group) BAC clone ... 62 2e-06
9dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 60 7e-06
10gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 60 7e-06
11emb|AL731763.1|CNS07YQA Oryza sativa chromosome 12, . BAC OSJNBa... 60 7e-06
12gb|AC159811.2| Mus musculus BAC clone RP24-127J13 from chromosom... 58 3e-05
13gb|AC157998.2| Mus musculus BAC clone RP23-27L18 from chromosome... 58 3e-05
14gb|AY103772.1| Zea mays PCO133091 mRNA sequence 54 5e-04
15ref|XM_480192.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
16gb|AC112662.7| Mus musculus chromosome 5, clone RP23-467F2, comp... 52 0.002
17dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
18dbj|AP004698.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
19dbj|AK065294.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
20gb|AC121959.3| Mus musculus BAC clone RP24-247N18 from chromosom... 48 0.028
21emb|AL645784.20| Mouse DNA sequence from clone RP23-11C7 on chro... 48 0.028
22gb|AC153586.7| Mus musculus 6 BAC RP23-88E13 (Roswell Park Cance... 48 0.028
23gb|AC153983.7| Mus musculus 6 BAC RP24-479J14 (Roswell Park Canc... 48 0.028
24ref|XM_463543.1| Oryza sativa (japonica cultivar-group), predic... 46 0.11
25ref|NM_186352.2| Oryza sativa (japonica cultivar-group), mRNA 46 0.11
26gb|AC132485.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.11
27gb|AC121939.3| Mus musculus BAC clone RP24-208M2 from chromosome... 46 0.11
28gb|AC121835.2| Mus musculus BAC clone RP24-72L18 from 8, complet... 46 0.11
29emb|BX901956.4| Zebrafish DNA sequence from clone CH211-284C12 i... 46 0.11
30gb|AC169370.4| Sorghum bicolor clone SB_BBc0011I20, complete seq... 46 0.11
31gb|AC007158.10|AC007158 Homo sapiens, clone RP11-90A1, complete ... 46 0.11
32gb|AY742218.1| Saccharum officinarum NAC23 mRNA, complete cds 46 0.11
33dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
34dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
35gb|AF254558.1|AF254558 Oryza sativa NAC6 (NAC6) gene, complete cds 46 0.11
36emb|AL845547.18| Mouse DNA sequence from clone RP23-296A4 on chr... 46 0.11
37gb|AC007092.4| Homo sapiens BAC clone RP11-90D1 from 2, complete... 46 0.11
38dbj|AP003561.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
39dbj|AP005167.4| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
40dbj|AP003932.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
41dbj|AP003866.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.11
42ref|XM_319846.2| Anopheles gambiae str. PEST ENSANGP00000016605 ... 46 0.11
43dbj|AK068606.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.11
44dbj|AK068392.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.11
45dbj|AK063406.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.11
46emb|AL935200.9| Zebrafish DNA sequence from clone CH211-237I5, c... 46 0.11
47dbj|AB028185.1| Oryza sativa mRNA for OsNAC6 protein, complete cds 46 0.11
48gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 44 0.44
49ref|XM_506578.1| PREDICTED Oryza sativa (japonica cultivar-group... 44 0.44
50ref|XM_479577.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.44
51gb|AC122159.30| Mus musculus strain 129/Sv clone ct7-575j15 map ... 44 0.44
52gb|AC115714.14| Mus musculus chromosome 12, clone RP23-477C24, c... 44 0.44
53gb|AC112956.12| Mus musculus chromosome 9, clone RP23-412P4, com... 44 0.44
54emb|CT009556.7| Mouse DNA sequence from clone RP23-87H19 on chro... 44 0.44
55gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosom... 44 0.44
56gb|AC124576.4| Mus musculus BAC clone RP23-162H6 from chromosome... 44 0.44
57gb|AC126550.3| Mus musculus BAC clone RP24-405L5 from chromosome... 44 0.44
58gb|AC127246.3| Mus musculus BAC clone RP24-424L20 from chromosom... 44 0.44
59gb|AC108949.4| Mus musculus BAC clone RP23-451K2 from 6, complet... 44 0.44
60gb|AC104889.10| Mus musculus chromosome 5, clone RP23-201D22, co... 44 0.44
61gb|AC133139.23| Medicago truncatula clone mth1-8d23, complete se... 44 0.44
62gb|AC122727.24| Medicago truncatula clone mth2-13b8, complete se... 44 0.44
63gb|AC128353.6| Rattus norvegicus 13 BAC CH230-148A5 (Children's ... 44 0.44
64gb|AC158934.4| Mus musculus chromosome 3, clone RP23-218L17, com... 44 0.44
65gb|BT009047.1| Triticum aestivum clone wdk9n.pk001.k24:fis, full... 44 0.44
66emb|BX842628.1| Neurospora crassa DNA linkage group I BAC clone ... 44 0.44
67emb|AL606521.24| Mouse DNA sequence from clone RP23-280J3 on chr... 44 0.44
68emb|AJ010830.1|TSP010830 Triticum sp. mRNA for GRAB2 protein 44 0.44
69emb|AL589735.12| Mouse DNA sequence from clone RP23-211M15 on ch... 44 0.44
70gb|AC103579.10| Mus Musculus Strain C57BL6/J Chromosome 14 BAC C... 44 0.44
71gb|AC079904.31| Homo sapiens 12 BAC RP11-84J24 (Roswell Park Can... 44 0.44
72gb|DP000057.1| Dasypus novemcinctus target 117 genomic scaffold 44 0.44
73gb|AC106752.3| Homo sapiens chromosome 5 clone RP11-166J22, comp... 44 0.44
74gb|AY752663.1| Schizorchis sp. LMW-2004 18S ribosomal RNA gene, ... 44 0.44
75gb|AY752648.1| Mosgovoyia pectinata isolate N4 18S ribosomal RNA... 44 0.44
76gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple... 44 0.44
77gb|AC153375.3| Mus musculus 6 BAC RP23-353E9 (Roswell Park Cance... 44 0.44
78dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.44
79gb|AC066611.6|AC066611 Homo sapiens chromosome 15 clone RP11-348... 44 0.44
80gb|AC093843.2| Homo sapiens BAC clone RP11-444B5 from 2, complet... 44 0.44
81dbj|AP002842.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.44
82dbj|AK105645.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
83dbj|AK073876.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
84dbj|AK064178.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.44
85gb|AY104770.1| Zea mays PCO074909 mRNA sequence 44 0.44
86gb|AC102377.14| Mus musculus chromosome 18, clone RP23-416I22, c... 44 0.44
87dbj|AP005621.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.44
88emb|AJ851868.2| Mus musculus immunoglobulin heavy chain locus co... 44 0.44
89gb|AC102620.11| Mus musculus chromosome 5, clone RP23-429E19, co... 44 0.44
90emb|AL732317.13| Mouse DNA sequence from clone RP23-139F8 on chr... 44 0.44
91emb|AL831790.3| Mouse DNA sequence from clone RP23-334I5 on chro... 44 0.44
92emb|AL844487.3| Mouse DNA sequence from clone RP23-162L23 on chr... 44 0.44
93emb|AL606914.9| Mouse DNA sequence from clone RP23-169H13 on chr... 44 0.44
94gb|AC170752.2| Mus musculus BAC clone RP23-116B8 from chromosome... 44 0.44
95gb|AC118132.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.7
96gb|AC123684.8| Mus musculus chromosome 3, clone RP23-297F14, com... 42 1.7
97gb|AC102381.12| Mus musculus chromosome 8, clone RP24-180I19, co... 42 1.7
98gb|AC139131.19| Mus musculus chromosome 7, clone RP23-301N20, co... 42 1.7
99gb|AC113121.27| Mus musculus chromosome 8, clone RP23-347G12, co... 42 1.7
100gb|AC161519.11| Mus musculus chromosome 18, clone RP24-83L9, com... 42 1.7
101ref|NM_020265.3| Mus musculus dickkopf homolog 2 (Xenopus laevis... 42 1.7
102gb|AC099607.6| Mus musculus chromosome 5, clone RP23-361G20, com... 42 1.7
103gb|AC151846.3| Mus musculus BAC clone RP23-13B8 from chromosome ... 42 1.7
104gb|AC163295.2| Mus musculus BAC clone RP23-132K20 from chromosom... 42 1.7
105gb|AC159266.3| Mus musculus BAC clone RP24-64D24 from chromosome... 42 1.7
106ref|XM_483299.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.7
107gb|AC099707.14| Mus musculus chromosome 1, clone RP23-329C7, com... 42 1.7
108gb|AC153147.7| Mus musculus BAC clone RP23-205D14 from chromosom... 42 1.7
109gb|AC132905.13| Mus musculus chromosome 13, clone RP24-295E18, c... 42 1.7
110gb|BT019155.1| Zea mays clone Contig818.F mRNA sequence 42 1.7
111gb|AC165380.3| Colobus guereza clone CH272-85C5, complete sequence 42 1.7
112gb|AC121309.10| Mus musculus chromosome 3, clone RP24-303N8, com... 42 1.7
113gb|AC124659.10| Mus musculus chromosome 15, clone RP24-167K18, c... 42 1.7
114gb|AC100180.12| Mus musculus chromosome 1, clone RP23-53J14, com... 42 1.7
115gb|AC117682.11| Mus musculus chromosome 1, clone RP23-436K7, com... 42 1.7
116gb|AF073777.1| Neisseria meningitidis arginyl-tRNA-synthetase (a... 42 1.7
117gb|AF236328.1| Chondropython viridis microsatellite MV1009 sequence 42 1.7
118gb|AF236327.1| Chondropython viridis microsatellite MV1008 sequence 42 1.7
119gb|AF236326.1| Chondropython viridis microsatellite MV1007 sequence 42 1.7
120gb|AF236325.1| Chondropython viridis microsatellite MV1006 sequence 42 1.7
121gb|AF236324.1| Chondropython viridis microsatellite MV1005 sequence 42 1.7
122gb|AF236323.1| Chondropython viridis microsatellite MV1004 sequence 42 1.7
123gb|AF236322.1| Chondropython viridis microsatellite MV1003 sequence 42 1.7
124gb|AF236321.1| Chondropython viridis microsatellite MV1002 sequence 42 1.7
125gb|AF236320.1| Chondropython viridis microsatellite MV1001 sequence 42 1.7
126gb|AC005742.1| Mus musculus chromosome 11, BAC clone CT7-111I18 ... 42 1.7
127gb|AC158141.8| Mus musculus chromosome 5, clone RP23-281M20, com... 42 1.7
128gb|AC121142.12| Mus musculus chromosome 10, clone RP23-479G23, c... 42 1.7
129gb|AC102499.10| Mus musculus chromosome 1, clone RP24-151M13, co... 42 1.7
130gb|AC119878.7| Mus musculus chromosome 3, clone RP24-329A3, comp... 42 1.7
131gb|AC161262.2| Mus musculus BAC clone RP23-325G1 from chromosome... 42 1.7
132gb|AC161375.4| Mus musculus BAC clone RP23-297A22 from chromosom... 42 1.7
133gb|AC159260.3| Mus musculus BAC clone RP24-85M18 from chromosome... 42 1.7
134gb|AC154494.2| Mus musculus BAC clone RP24-111G24 from chromosom... 42 1.7
135gb|AC165245.2| Mus musculus BAC clone RP24-376N22 from chromosom... 42 1.7
136gb|AC164096.3| Mus musculus BAC clone RP23-356H17 from chromosom... 42 1.7
137gb|AC102154.9| Mus musculus chromosome 1, clone RP23-333I7, comp... 42 1.7
138gb|AC151486.1| Pan troglodytes chromosome X clone PTB-029D14 map... 42 1.7
139gb|AC120863.9| Mus musculus chromosome 7, clone RP23-84H3, compl... 42 1.7
140gb|AC131079.11| Mus musculus chromosome 14, clone RP23-434L17, c... 42 1.7
141gb|AC133457.6| Mus musculus chromosome 3, clone RP24-493E2, comp... 42 1.7
142gb|S42568.1| ribulose-1,5-bisphosphate carboxylase small subunit... 42 1.7
143gb|AC129162.5| Rattus norvegicus 9 BAC CH230-108L13 (Children's ... 42 1.7
144gb|AC138290.9| Mus musculus chromosome 10, clone RP23-245C15, co... 42 1.7
145gb|AC102229.7| Mus musculus chromosome 15, clone RP24-70F9, comp... 42 1.7
146gb|AC135568.3| Oryza sativa (japonica cultivar-group) chromosome... 42 1.7
147gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, co... 42 1.7
148gb|AC119982.6| Mus musculus chromosome 19, clone RP24-498L9, com... 42 1.7
149gb|AC120002.24| Mus musculus chromosome 12, clone RP24-147D14, c... 42 1.7
150gb|AC106830.11| Mus musculus chromosome 15, clone RP24-402C20, c... 42 1.7
151gb|AC114674.10| Mus musculus chromosome 9, clone RP24-209N21, co... 42 1.7
152gb|AC141477.4| Mus musculus BAC clone RP23-386J14 from chromosom... 42 1.7
153gb|AC183761.3| Pan troglodytes BAC clone CH251-710C5 from chromo... 42 1.7
154ref|XM_322511.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.7
155gb|AC146241.4| Pan troglodytes BAC clone RP43-31L17 from 7, comp... 42 1.7
156ref|XM_951597.1| Neurospora crassa OR74A hypothetical protein (N... 42 1.7
157gb|AC168278.2| Mus musculus BAC RP24-83C9 (Roswell Park Cancer ... 42 1.7
158gb|AC148472.1| Pan troglodytes fosmid clone CH1251-124C12 from Y... 42 1.7
159gb|AC141647.3| Mus musculus BAC clone RP23-64E12 from chromosome... 42 1.7
160gb|AC145589.3| Mus musculus BAC clone RP24-174M10 from chromosom... 42 1.7
161gb|AC132307.5| Mus musculus BAC clone RP24-291H9 from chromosome... 42 1.7
162gb|AC147621.3| Mus musculus BAC clone RP24-315M14 from chromosom... 42 1.7
163gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosom... 42 1.7
164gb|AC140223.3| Mus musculus BAC clone RP24-477G22 from chromosom... 42 1.7
165gb|AC131694.4| Mus musculus BAC clone RP23-393L24 from chromosom... 42 1.7
166gb|AC134458.2| Mus musculus BAC clone RP23-358B17 from chromosom... 42 1.7
167gb|AC102135.12| Mus musculus chromosome 18, clone RP23-253J5, co... 42 1.7
168gb|AC158794.4| Mus musculus chromosome 1, clone RP23-306I10, com... 42 1.7
169gb|AC126421.12| Mus musculus chromosome 1, clone RP23-167H24, co... 42 1.7
170gb|AC158652.5| Mus musculus 6 BAC RP23-238I17 (Roswell Park Canc... 42 1.7
171gb|AC110566.17| Mus musculus chromosome 5, clone RP23-300A10, co... 42 1.7
172gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 1.7
173gb|AC166990.3| Mus musculus BAC clone RP24-173K24 from chromosom... 42 1.7
174gb|AC121525.7| Mus musculus chromosome 5, clone RP23-359D12, com... 42 1.7
175gb|AC125064.6| Mus musculus BAC clone RP23-430F7 from chromosome... 42 1.7
176gb|AC160114.2| Mus musculus BAC clone RP24-70J8 from chromosome ... 42 1.7
177gb|AC158379.5| Mus musculus BAC clone RP24-497L12 from chromosom... 42 1.7
178gb|AC163444.3| Mus musculus chromosome 1, clone RP23-85E22, comp... 42 1.7
179gb|AC114404.12| Mus musculus chromosome 7, clone RP24-350D24, co... 42 1.7
180gb|BC031765.1| Mus musculus dickkopf homolog 2 (Xenopus laevis),... 42 1.7
181gb|AC137108.12| Mus musculus chromosome 9, clone RP23-277J20, co... 42 1.7
182gb|AC115357.5| Mus musculus BAC clone RP23-81J4 from chromosome ... 42 1.7
183gb|AC123038.3| Mus musculus BAC clone RP24-527G2 from chromosome... 42 1.7
184gb|AC133089.4| Mus musculus BAC clone RP24-165M3 from chromosome... 42 1.7
185gb|AC113244.19| Mus musculus chromosome 19, clone RP23-172E2, co... 42 1.7
186gb|AC102087.12| Mus musculus chromosome 13, clone RP23-166D15, c... 42 1.7
187ref|XM_853349.1| PREDICTED: Canis familiaris similar to calcium ... 42 1.7
188ref|XM_853310.1| PREDICTED: Canis familiaris similar to calcium ... 42 1.7
189ref|XM_853271.1| PREDICTED: Canis familiaris similar to calcium ... 42 1.7
190ref|XM_853230.1| PREDICTED: Canis familiaris similar to calcium ... 42 1.7
191ref|XM_853191.1| PREDICTED: Canis familiaris similar to calcium ... 42 1.7
192ref|XM_535438.2| PREDICTED: Canis familiaris similar to calcium ... 42 1.7
193gb|AC004905.2| Homo sapiens PAC clone RP5-845I21 from 7, complet... 42 1.7
194gb|AC117686.10| Mus musculus chromosome 16, clone RP23-440B15, c... 42 1.7
195gb|AC126217.3| Rattus norvegicus 1 BAC CH230-9L4 (Children's Hos... 42 1.7
196gb|AC127317.3| Mus musculus BAC clone RP23-227H18 from chromosom... 42 1.7
197emb|CR759954.9| Human DNA sequence from clone DAAP-101P24 on chr... 42 1.7
198emb|CT009734.9| Mouse DNA sequence from clone RP23-182E3 on chro... 42 1.7
199emb|CR974429.7| Mouse DNA sequence from clone RP23-177B9 on chro... 42 1.7
200emb|AJ833968.1| Zea mays partial mRNA for hypothetical protein (... 42 1.7
201emb|CT009719.10| Mouse DNA sequence from clone RP23-65P17 on chr... 42 1.7
202emb|CR974427.5| Mouse DNA sequence from clone RP24-319N23 on chr... 42 1.7
203gb|AC137749.11| Mus musculus chromosome 6, clone RP23-69C16, com... 42 1.7
204emb|CT010430.6| Mouse DNA sequence from clone RP23-335P18 on chr... 42 1.7
205emb|CR974434.12| Pig DNA sequence from clone CH242-241E19 on chr... 42 1.7
206gb|AC131757.3| Mus musculus BAC clone RP24-210I7 from chromosome... 42 1.7
207gb|AC132367.3| Mus musculus BAC clone RP23-465K21 from chromosom... 42 1.7
208gb|AC126668.3| Mus musculus BAC clone RP24-370N20 from chromosom... 42 1.7
209gb|AC134323.3| Mus musculus BAC clone RP24-512P7 from chromosome... 42 1.7
210gb|AC129019.4| Mus musculus BAC clone RP24-541L1 from chromosome... 42 1.7
211gb|AC122184.4| Mus musculus BAC clone RP23-16C12 from chromosome... 42 1.7
212gb|AC129020.4| Mus musculus BAC clone RP23-234A5 from chromosome... 42 1.7
213gb|AC122809.4| Mus musculus BAC clone RP23-272E5 from chromosome... 42 1.7
214gb|AC129601.4| Mus musculus BAC clone RP23-444N1 from chromosome... 42 1.7
215gb|AC002331.1|HUAC002331 Homo sapiens Chromosome 16 BAC clone CI... 42 1.7
216gb|AC125316.4| Mus musculus BAC clone RP24-250N3 from chromosome... 42 1.7
217gb|AC125138.4| Mus musculus BAC clone RP24-324N8 from chromosome... 42 1.7
218gb|AC127260.3| Mus musculus BAC clone RP24-315I3 from chromosome... 42 1.7
219gb|AC127421.3| Mus musculus BAC clone RP24-314F1 from chromosome... 42 1.7
220gb|AC124407.4| Mus musculus BAC clone RP24-389C22 from chromosom... 42 1.7
221gb|AC117386.4| Homo sapiens 3 BAC RP11-167H9 (Roswell Park Cance... 42 1.7
222gb|AC124366.4| Mus musculus BAC clone RP24-541E9 from chromosome... 42 1.7
223gb|AC128661.3| Mus musculus BAC clone RP24-567N23 from chromosom... 42 1.7
224gb|AC121982.3| Mus musculus BAC clone RP24-291D6 from chromosome... 42 1.7
225gb|AC127254.3| Mus musculus BAC clone RP24-290D19 from chromosom... 42 1.7
226gb|AC121967.3| Mus musculus BAC clone RP24-268P11 from chromosom... 42 1.7
227gb|AC080158.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 42 1.7
228gb|AC125080.3| Mus musculus BAC clone RP24-68P23 from chromosome... 42 1.7
229gb|AC122266.2| Mus musculus BAC clone RP23-213K18 from 8, comple... 42 1.7
230gb|AC125037.4| Mus musculus BAC clone RP23-332H20 from chromosom... 42 1.7
231gb|AC125039.4| Mus musculus BAC clone RP23-335C3 from chromosome... 42 1.7
232gb|AC132600.3| Mus musculus BAC clone RP24-134A5 from chromosome... 42 1.7
233gb|AC104095.4| Mus musculus BAC clone RP23-403G12 from chromosom... 42 1.7
234gb|AC121791.3| Mus musculus BAC clone RP23-401H19 from chromosom... 42 1.7
235gb|AE014308.1| Homo sapiens chromosome 13q34 schizophrenia regio... 42 1.7
236gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 42 1.7
237gb|AC116998.3| Mus musculus BAC clone RP23-16F6 from 18, complet... 42 1.7
238gb|AC122936.3| Mus musculus BAC clone RP23-20H6 from 5, complete... 42 1.7
239gb|AC123058.3| Mus musculus BAC clone RP23-188J8 from 19, comple... 42 1.7
240gb|AC122814.3| Mus musculus BAC clone RP23-234A12 from 6, comple... 42 1.7
241gb|AC123065.3| Mus musculus BAC clone RP23-239F13 from 9, comple... 42 1.7
242gb|AC122292.4| Mus musculus BAC clone RP23-256J8 from 10, comple... 42 1.7
243gb|AC122880.4| Mus musculus BAC clone RP23-77F18 from 8, complet... 42 1.7
244gb|AC122202.4| Mus musculus BAC clone RP23-68P6 from 19, complet... 42 1.7
245gb|AC084392.1| Mus musculus BAC clone GS1-182G5 from UL, complet... 42 1.7
246gb|AC116576.3| Mus musculus BAC clone RP23-263J19 from 3, comple... 42 1.7
247emb|CR753651.10| Human DNA sequence from clone DADB-91F17 on chr... 42 1.7
248gb|AC098725.3| Mus musculus BAC clone RP23-3D20 from 3, complete... 42 1.7
249gb|AC104479.3| Sus scrofa clone RP44-321O22, complete sequence 42 1.7
250gb|AC116772.6| Mus musculus chromosome 8, clone RP23-428C21, com... 42 1.7
251gb|AC113068.9| Mus musculus chromosome 1, clone RP23-269F19, com... 42 1.7
252gb|AC093376.5| Homo sapiens BAC clone RP11-147A22 from 7, comple... 42 1.7
253gb|AC104863.12| Mus musculus chromosome 6, clone RP23-109C11, co... 42 1.7
254gb|AC036121.11| Mus musculus chromosome 6, clone RP23-158O9, com... 42 1.7
255gb|AC164955.2| Mus musculus BAC clone RP24-233H9 from chromosome... 42 1.7
256gb|AC102590.9| Mus musculus chromosome 12, clone RP23-335D14, co... 42 1.7
257gb|AC146104.3| Pan troglodytes BAC clone RP43-21M20 from 7, comp... 42 1.7
258gb|AC140950.1| Pan troglodytes BAC clone RP43-58I22 from 7, comp... 42 1.7
259gb|AC113463.8| Mus musculus chromosome 1, clone RP23-40O18, comp... 42 1.7
260gb|AC068913.22| Mus musculus strain 129/Sv clone ct7-362c13 map ... 42 1.7
261gb|AC159224.6| Mus musculus chromosome 8, clone RP24-180O7, comp... 42 1.7
262gb|AC161049.2| Mus musculus BAC clone RP24-94D6 from chromosome ... 42 1.7
263emb|CR339051.6| Zebrafish DNA sequence from clone DKEY-223N8 in ... 42 1.7
264gb|AC163391.4| Mus musculus chromosome 3, clone RP23-173N16, com... 42 1.7
265gb|AC158362.5| Mus musculus BAC clone RP23-214K5 from chromosome... 42 1.7
266gb|AC157929.6| Mus musculus chromosome 5, clone RP24-122G17, com... 42 1.7
267emb|Z95889.1|HS211A9 Human DNA sequence from clone CTA-211A9 on ... 42 1.7
268emb|BX470194.8| Human DNA sequence from clone DASS-263B11 on chr... 42 1.7
269emb|BX537254.7| Human DNA sequence from clone RP6-74O6 on chromo... 42 1.7
270emb|AL844539.5| Human DNA sequence from clone DAQB-239N17 on chr... 42 1.7
271emb|AL901607.1| Human DNA sequence from clone XXbac-419D21 on ch... 42 1.7
272emb|AL672294.10| Human DNA sequence from clone XX-53 on chromoso... 42 1.7
273emb|AL662890.3| Human DNA sequence from clone XXbac-308K3 on chr... 42 1.7
274emb|AL591885.11| Human DNA sequence from clone RP11-655L13 on ch... 42 1.7
275gb|CP000318.1| Polaromonas sp. JS666 plasmid 2, complete sequence 42 1.7
276emb|AL391499.11| Human DNA sequence from clone RP11-162E8 on chr... 42 1.7
277emb|AL365254.14| Human DNA sequence from clone RP11-420H21 on ch... 42 1.7
278gb|AC101711.7| Mus musculus, clone RP23-279K17, complete sequence 42 1.7
279emb|AL356956.11| Human DNA sequence from clone RP11-538A16 on ch... 42 1.7
280emb|AL356419.10| Human DNA sequence from clone RP11-99L6 on chro... 42 1.7
281emb|AL356269.10| Human DNA sequence from clone RP11-420J12 on ch... 42 1.7
282emb|AL356004.9| Human DNA sequence from clone RP11-94I2 on chrom... 42 1.7
283emb|AL162495.18| Human DNA sequence from clone RP11-233O7 on chr... 42 1.7
284emb|AL161901.18| Human DNA sequence from clone RP11-521H3 on chr... 42 1.7
285emb|AL139083.15| Human DNA sequence from clone RP11-270C18 on ch... 42 1.7
286emb|AL157700.13| Human DNA sequence from clone RP6-201G10 on chr... 42 1.7
287gb|AC107294.7| Homo sapiens 3 BAC RP11-329B9 (Roswell Park Cance... 42 1.7
288emb|AL133258.16| Human DNA sequence from clone RP1-207F6 on chro... 42 1.7
289emb|AL035697.19|HS45F6 Human DNA sequence from clone RP1-45F6 on... 42 1.7
290emb|AL049591.12|HSJ878I13 Human DNA sequence from clone RP5-878I... 42 1.7
291gb|AC157587.7| Mus musculus BAC clone RP24-199E1 from chromosome... 42 1.7
292emb|AL031733.3|HS455J7 Human DNA sequence from clone RP3-455J7 o... 42 1.7
293emb|AL023753.1|HS1198H6 Human DNA sequence from clone RP5-1198H6... 42 1.7
294emb|AL021920.1|HS163M9 Human DNA sequence from clone RP1-163M9 o... 42 1.7
295gb|AC018635.10| Homo sapiens chromosome 7 clone RP11-62J1, compl... 42 1.7
296gb|AC091762.27| Mus musculus strain C57BL/6J clone rp23-151n4 ma... 42 1.7
297gb|DQ133471.1| Gorilla gorilla ribosomal RNA intergenic spacer, ... 42 1.7
298gb|AC099399.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.7
299emb|BX908807.1| Neurospora crassa DNA linkage group III BAC cont... 42 1.7
300gb|AC164558.2| Mus musculus BAC clone RP23-238F5 from chromosome... 42 1.7
301gb|AC165282.2| Mus musculus BAC clone RP24-465P22 from chromosom... 42 1.7
302gb|AC151282.3| Mus musculus BAC clone RP23-461H1 from chromosome... 42 1.7
303emb|BX000351.17| Mouse DNA sequence from clone RP23-313I4 on chr... 42 1.7
304gb|AC160133.2| Mus musculus BAC clone RP23-186M2 from chromosome... 42 1.7
305gb|AC153837.4| Mus musculus 6 BAC RP23-192D5 (Roswell Park Cance... 42 1.7
306gb|AC162038.6| Mus musculus 6 BAC RP24-576J4 (Roswell Park Cance... 42 1.7
307emb|AL772364.20| Mouse DNA sequence from clone RP23-242C19 on ch... 42 1.7
308emb|AL669988.1|NCB23H20 Neurospora crassa DNA linkage group II B... 42 1.7
309emb|AL627237.44| Mouse DNA sequence from clone RP23-269N23 on ch... 42 1.7
310emb|AL645966.30| Mouse DNA sequence from clone DN-144H19 on chro... 42 1.7
311emb|AL645950.13| Mouse DNA sequence from clone RP23-13C17 on chr... 42 1.7
312emb|AL162756.2|NMA5Z2491 Neisseria meningitidis serogroup A stra... 42 1.7
313emb|AL353821.2|NC68B2 Neurospora crassa DNA linkage group V Cosm... 42 1.7
314gb|AC155276.3| Mus musculus BAC clone RP23-26E18 from chromosome... 42 1.7
315gb|AC153567.6| Mus musculus 10 BAC RP23-187C5 (Roswell Park Canc... 42 1.7
316gb|AC159656.11| Mus musculus 6 BAC RP24-85F2 (Roswell Park Cance... 42 1.7
317gb|AC160977.2| Mus musculus BAC clone RP23-446C11 from chromosom... 42 1.7
318gb|AC117806.11| Mus musculus chromosome 15, clone RP24-566D14, c... 42 1.7
319emb|AL596095.18| Mouse DNA sequence from clone RP23-188H3 on chr... 42 1.7
320gb|AC096645.2| Homo sapiens chromosome 1 clone RP11-450D21, comp... 42 1.7
321emb|AL603708.13| Mouse DNA sequence from clone RP23-381C21 on ch... 42 1.7
322emb|AL662792.21| Mouse DNA sequence from clone RP23-52L14 on chr... 42 1.7
323emb|AL662839.15| Mouse DNA sequence from clone RP23-472O5 on chr... 42 1.7
324emb|AL645741.15| Mouse DNA sequence from clone RP23-239O19 on ch... 42 1.7
325emb|AL713921.15| Mouse DNA sequence from clone RP23-475A8 on chr... 42 1.7
326emb|AL713924.12| Mouse DNA sequence from clone RP23-443J11 on ch... 42 1.7
327emb|AL670472.7| Mouse DNA sequence from clone RP23-26M1 on chrom... 42 1.7
328emb|AL596204.8| Mouse DNA sequence from clone RP23-180B18 on chr... 42 1.7
329emb|AL954241.1| Pan troglodytes chromosome 22 clone RP43-181I17 ... 42 1.7
330emb|BX088573.4| Mouse DNA sequence from clone RP23-78N10 on chro... 42 1.7
331emb|BX640475.3| Mouse DNA sequence from clone RP23-377F5 on chro... 42 1.7
332emb|AL627326.16| Mouse DNA sequence from clone RP23-20A22 on chr... 42 1.7
333emb|CR855878.5| Human DNA sequence from clone RP13-469P20 on chr... 42 1.7
334gb|AC090396.9| Homo sapiens chromosome 18, clone RP11-868G15, co... 42 1.7
335emb|CR352330.14| Mouse DNA sequence from clone RP23-374F1 on chr... 42 1.7
336emb|AL845340.11| Mouse DNA sequence from clone RP23-169D3 on chr... 42 1.7
337emb|AL714011.12| Mouse DNA sequence from clone RP23-380O17 on ch... 42 1.7
338emb|BX927236.8| Zebrafish DNA sequence from clone DKEY-104G13 in... 42 1.7
339gb|AC108910.18| Mus musculus chromosome 18, clone RP24-550O15, c... 42 1.7
340gb|AC155270.3| Mus musculus BAC clone RP23-195H19 from chromosom... 42 1.7
341gb|AC159256.2| Mus musculus BAC clone RP24-109N11 from chromosom... 42 1.7
342gb|AC159301.2| Mus musculus BAC clone RP23-213B1 from chromosome... 42 1.7
343gb|AC162943.2| Mus musculus BAC clone RP23-76K9 from chromosome ... 42 1.7
344gb|AC008759.9| Homo sapiens chromosome 19 clone CTD-3116E22, com... 42 1.7
345gb|AC101973.7| Mus musculus chromosome 3, clone RP24-280A2, comp... 42 1.7
346gb|AC069064.18| Homo sapiens 3 BAC RP11-436P4 (Roswell Park Canc... 42 1.7
347gb|AC116648.4| Homo sapiens BAC clone RP11-764M6 from 4, complet... 42 1.7
348gb|AF355797.1| Homo sapiens BTBD2 protein mRNA, complete cds 42 1.7
349emb|AL645593.20| Mouse DNA sequence from clone RP23-57I15 on chr... 42 1.7
350gb|AC008891.7| Homo sapiens chromosome 19 clone CTD-2226J19, com... 42 1.7
351gb|AC108050.5| Homo sapiens BAC clone RP11-331M18 from 4, comple... 42 1.7
352dbj|BS000652.2| Pan troglodytes chromosome Y clone: PTBY-013L08,... 42 1.7
353gb|AC020903.7| Homo sapiens chromosome 5 clone CTB-40D4, complet... 42 1.7
354gb|AC137843.15| Mus musculus chromosome 9, clone RP23-413J12, co... 42 1.7
355gb|AC117385.3| Homo sapiens 3 BAC RP11-13I22 (Roswell Park Cance... 42 1.7
356emb|BX510936.5| Zebrafish DNA sequence from clone DKEYP-15C6 in ... 42 1.7
357gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 42 1.7
358gb|AC068911.38| Mus musculus strain 129/Sv chromosome 2 clone ct... 42 1.7
359gb|AC022706.7| Homo sapiens chromosome , clone RP11-47L3, comple... 42 1.7
360emb|BX548064.12| Zebrafish DNA sequence from clone CH211-51L17 i... 42 1.7
361gb|AC079439.26| Mus musculus strain 129/Sv chromosome 2 clone ct... 42 1.7
362gb|AC069218.13| Homo sapiens 3 BAC RP11-393N4 (Roswell Park Canc... 42 1.7
363gb|AC079766.7| Homo sapiens BAC clone RP11-188P17 from 4, comple... 42 1.7
364gb|AC083904.27| Homo sapiens 3 BAC RP11-262M14 (Roswell Park Can... 42 1.7
365gb|AC069220.11| Homo sapiens 3 BAC RP11-115B16 (Roswell Park Can... 42 1.7
366emb|AL954375.6| Mouse DNA sequence from clone RP23-16F14 on chro... 42 1.7
367gb|DQ403225.1| Camallanus cotti clone YC 18S ribosomal RNA gene,... 42 1.7
368gb|DQ403224.1| Camallanus cotti clone SJ 18S ribosomal RNA gene,... 42 1.7
369gb|DQ403223.1| Camallanus cotti clone QY 18S ribosomal RNA gene,... 42 1.7
370gb|DQ403222.1| Camallanus cotti clone QZ 18S ribosomal RNA gene,... 42 1.7
371gb|DQ403221.1| Camallanus cotti clone NYU 18S ribosomal RNA gene... 42 1.7
372gb|DQ403220.1| Camallanus cotti clone HY 18S ribosomal RNA gene,... 42 1.7
373gb|DQ403219.1| Camallanus cotti clone HQYB 18S ribosomal RNA gen... 42 1.7
374gb|DQ403218.1| Camallanus cotti clone ZXH 18S ribosomal RNA gene... 42 1.7
375gb|DQ403217.1| Camallanus cotti clone YP 18S ribosomal RNA gene,... 42 1.7
376gb|DQ403216.1| Camallanus cotti clone YJ 18S ribosomal RNA gene,... 42 1.7
377gb|DQ403215.1| Camallanus cotti clone WL 18S ribosomal RNA gene,... 42 1.7
378gb|DQ403214.1| Camallanus cotti clone TL 18S ribosomal RNA gene,... 42 1.7
379gb|DQ403213.1| Camallanus cotti clone NY 18S ribosomal RNA gene,... 42 1.7
380gb|DQ403212.1| Camallanus cotti clone NYY 18S ribosomal RNA gene... 42 1.7
381gb|DQ403211.1| Camallanus cotti clone MG 18S ribosomal RNA gene,... 42 1.7
382gb|DQ403209.1| Camallanus cotti clone KQ 18S ribosomal RNA gene,... 42 1.7
383gb|DQ403208.1| Camallanus cotti clone HS 18S ribosomal RNA gene,... 42 1.7
384gb|DQ403207.1| Camallanus cotti clone GY 18S ribosomal RNA gene,... 42 1.7
385gb|DQ403206.1| Camallanus cotti clone DXJ 18S ribosomal RNA gene... 42 1.7
386gb|DQ403205.1| Camallanus cotti clone DQH 18S ribosomal RNA gene... 42 1.7
387gb|DQ403204.1| Camallanus cotti clone CHZ 18S ribosomal RNA gene... 42 1.7
388gb|DQ403203.1| Camallanus cotti clone CY 18S ribosomal RNA gene,... 42 1.7
389gb|AC015656.9| Homo sapiens, clone RP11-81K2, complete sequence 42 1.7
390gb|AC078785.22| Homo sapiens 3 BAC RP11-572M11 (Roswell Park Can... 42 1.7
391gb|AC103834.2| Homo sapiens chromosome 8, clone RP11-1081K18, co... 42 1.7
392gb|AY057108.2| Hypocrea jecorina QM9414 transcriptional adaptor-... 42 1.7
393gb|AC112193.2| Homo sapiens chromosome 5 clone RP11-373F8, compl... 42 1.7
394gb|AC164576.4| Mus musculus 10 BAC RP23-50F14 (Roswell Park Canc... 42 1.7
395gb|AC022021.10| Homo sapiens chromosome 10 clone RP11-351M16, co... 42 1.7
396gb|AC105273.2| Homo sapiens chromosome 1 clone RP4-716B13, compl... 42 1.7
397gb|AC107463.5| Homo sapiens BAC clone RP11-553P9 from 4, complet... 42 1.7
398dbj|AK142002.1| Mus musculus 12 days embryo spinal ganglion cDNA... 42 1.7
399gb|AC023395.8| Homo sapiens chromosome 18, clone RP11-484N16, co... 42 1.7
400gb|AC110004.2| Homo sapiens chromosome 5 clone RP11-265I24, comp... 42 1.7
401dbj|AK134472.1| Mus musculus 11 days embryo head cDNA, RIKEN ful... 42 1.7
402gb|AC092793.5| Homo sapiens 12p BAC RP11-74N9 (Roswell Park Canc... 42 1.7
403gb|AC114648.25| Mus musculus chromosome 8, clone RP24-144H17, co... 42 1.7
404gb|AC091180.20| Homo sapiens chromosome 17, clone RP11-1079K10, ... 42 1.7
405gb|AC091784.8| Genomic sequence for Mus musculus, clone RP23-213... 42 1.7
406gb|AC090354.8| Homo sapiens chromosome 18, clone RP11-735P10, co... 42 1.7
407gb|AC024094.28| Homo sapiens 4 RP11-193M13 (Roswell Park Cancer ... 42 1.7
408gb|AC010370.5| Homo sapiens chromosome 3 clone CTD-2049J23, comp... 42 1.7
409gb|AC003061.1| Mouse Chromosome 6 BAC Clone b245c12, complete se... 42 1.7
410gb|AC073563.3| Mus musculus strain C57BL/6J chromosome 12 clone ... 42 1.7
411gb|AC079090.4| Homo sapiens chromosome 15, clone RP11-268O3, com... 42 1.7
412gb|AC008911.6| Homo sapiens chromosome 5 clone CTD-2268J5, compl... 42 1.7
413gb|AC072051.8| Homo sapiens chromosome , clone RP11-79D21, compl... 42 1.7
414gb|AC022916.11| Homo sapiens chromosome 17, clone RP11-799D4, co... 42 1.7
415dbj|AK150147.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 42 1.7
416gb|AC079389.2| Rattus norvegicus strain Brown Norway chromosome ... 42 1.7
417gb|AC092325.2| Homo sapiens chromosome 16 clone RP11-14K3, compl... 42 1.7
418gb|AC092042.2| Homo sapiens chromosome 3 clone RP11-136C24, comp... 42 1.7
419gb|DP000053.1| Oryctolagus cuniculus target 126 genomic scaffold 42 1.7
420emb|AL732483.8| Mouse DNA sequence from clone RP23-70K10 on chro... 42 1.7
421dbj|AK164810.1| Mus musculus 16 days neonate heart cDNA, RIKEN f... 42 1.7
422gb|AC102465.11| Mus musculus chromosome 3, clone RP24-333O23, co... 42 1.7
423gb|AC158618.5| Mus musculus 10 BAC RP23-280M4 (Roswell Park Canc... 42 1.7
424gb|AC152397.6| Mus musculus chromosome 18, clone RP23-307D12, co... 42 1.7
425gb|DP000005.1| Macaca mulatta target 1 genomic scaffold 42 1.7
426gb|AC158299.7| Mus musculus chromosome 7, clone RP24-271L24, com... 42 1.7
427gb|AC010655.7| Homo sapiens chromosome 7 clone RP11-155G14, comp... 42 1.7
428gb|AC022163.5| Homo sapiens chromosome 5 clone RP11-454F19, comp... 42 1.7
429gb|AC159037.2| Pan troglodytes BAC clone CH251-277G20 from chrom... 42 1.7
430gb|AC157498.2| Pan troglodytes BAC clone CH251-412M6 from chromo... 42 1.7
431gb|AC020939.7| Homo sapiens chromosome 5 clone CTD-2311D2, compl... 42 1.7
432gb|AC008685.8| Homo sapiens chromosome 5 clone CTB-59H21, comple... 42 1.7
433gb|AC159320.3| Mus musculus BAC clone RP23-51A12 from chromosome... 42 1.7
434gb|AC137524.4| Mus musculus BAC clone RP23-55M20 from chromosome... 42 1.7
435gb|AC154839.3| Mus musculus BAC clone RP23-61L24 from chromosome... 42 1.7
436gb|AC092357.2| Homo sapiens chromosome 16 clone RP11-332P24, com... 42 1.7
437gb|AC026421.4| Homo sapiens chromosome 5 clone CTD-2127O16, comp... 42 1.7
438emb|AL512583.11| Mouse DNA sequence from clone RP23-444H3 on chr... 42 1.7
439gb|AC155301.2| Mus musculus BAC clone RP24-216J21 from chromosom... 42 1.7
440gb|AC159628.2| Mus musculus BAC clone RP24-206C4 from chromosome... 42 1.7
441gb|AC156017.2| Mus musculus BAC clone RP24-239B9 from chromosome... 42 1.7
442gb|AC159808.2| Mus musculus BAC clone RP24-357G23 from chromosom... 42 1.7
443gb|AC158388.2| Mus musculus BAC clone RP24-545I9 from chromosome... 42 1.7
444dbj|AK029229.1| Mus musculus 0 day neonate head cDNA, RIKEN full... 42 1.7
445gb|AC008965.6| Homo sapiens chromosome 5 clone CTD-2364L17, comp... 42 1.7
446gb|AC000054.10| Homo sapiens chromosome 3 clone p856 map 3q26, c... 42 1.7
447emb|BX511021.9| Zebrafish DNA sequence from clone DKEY-16P21 in ... 42 1.7
448gb|BC096448.1| Mus musculus dickkopf homolog 2 (Xenopus laevis),... 42 1.7
449dbj|AK034369.1| Mus musculus adult male diencephalon cDNA, RIKEN... 42 1.7
450gb|AC160946.6| Mus musculus 10 BAC RP23-175G6 (Roswell Park Canc... 42 1.7
451gb|AC175825.2| Pan troglodytes BAC clone CH251-171E12 from chrom... 42 1.7
452dbj|AK082647.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 42 1.7
453dbj|AK047893.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 42 1.7
454gb|AC115695.11| Mus musculus chromosome 5, clone RP24-229D18, co... 42 1.7
455gb|AC153485.9| Mus musculus 10 BAC RP23-319B13 (Roswell Park Can... 42 1.7
456gb|AC153917.6| Mus musculus 10 BAC RP23-283D8 (Roswell Park Canc... 42 1.7
457gb|AC156949.9| Mus musculus 10 BAC RP24-347J14 (Roswell Park Can... 42 1.7
458gb|AC153881.4| Mus musculus 10 BAC RP23-257B9 (Roswell Park Canc... 42 1.7
459gb|AC159476.5| Mus musculus 10 BAC RP23-53O16 (Roswell Park Canc... 42 1.7
460emb|BX929339.2| Gallus gallus finished cDNA, clone ChEST184h18 42 1.7
461gb|AE002098.2| Neisseria meningitidis MC58, complete genome 42 1.7
462dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
463dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
464dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
465gb|AC020911.9| Homo sapiens chromosome 19 clone CTD-2562J15, com... 42 1.7
466dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
467gb|AC115914.6| Mus musculus chromosome 8, clone RP24-487J5, comp... 42 1.7
468gb|AC073436.62| Mus musculus strain C57BL/6J chromosome 2 clone ... 42 1.7
469gb|AC084020.17|AC084020 Mus musculus 11 BAC RP23-301I12 (Roswell... 42 1.7
470gb|DQ022843.1| Triticum aestivum NAC domain transcription factor... 42 1.7
471gb|DQ022842.1| Triticum aestivum NAC domain transcription factor... 42 1.7
472gb|AC131212.6| Homo sapiens 12 BAC RP13-554M15 (Rowsell Park Can... 42 1.7
473emb|BX908720.10| Human DNA sequence from clone DAMA-184I15 on ch... 42 1.7
474gb|AC121324.5| Homo sapiens chromosome 15, clone RP11-959E3, com... 42 1.7
475gb|AC092581.2| Homo sapiens BAC clone RP11-16I14 from 4, complet... 42 1.7
476gb|AC008756.9| Homo sapiens chromosome 16 clone CTD-3028M10, com... 42 1.7
477gb|DP000026.1| Pongo pygmaeus target 1 genomic scaffold 42 1.7
478gb|AC105253.3| Homo sapiens BAC clone RP11-557C16 from 2, comple... 42 1.7
479gb|AC104807.5| Homo sapiens BAC clone RP11-616I24 from 2, comple... 42 1.7
480gb|AC008507.11| Homo sapiens chromosome 19 clone CTC-448F2, comp... 42 1.7
481gb|AC146031.4| Pan troglodytes BAC clone RP43-124G6 from chromos... 42 1.7
482gb|AC157276.2| Mus musculus BAC clone RP23-426N20 from chromosom... 42 1.7
483gb|AC156792.2| Mus musculus BAC clone RP24-160P13 from chromosom... 42 1.7
484gb|AC154825.2| Mus musculus BAC clone RP24-540E16 from chromosom... 42 1.7
485dbj|AP000043.1| Homo sapiens genomic DNA, chromosome 21q22.1, se... 42 1.7
486gb|AC155816.3| Mus musculus BAC clone RP23-435J8 from chromosome... 42 1.7
487gb|AC153613.9| Mus musculus 10 BAC RP23-23C9 (Roswell Park Cance... 42 1.7
488gb|AC026333.28| Homo sapiens 12 BAC RP11-324E6 (Roswell Park Can... 42 1.7
489gb|AC112131.7| Homo sapiens 3 BAC RP11-2J10 (Roswell Park Cancer... 42 1.7
490gb|AC093509.3| Homo sapiens chromosome 16 clone CTD-2337L2, comp... 42 1.7
491gb|AC007281.3| Homo sapiens BAC clone RP11-457F14 from 2, comple... 42 1.7
492gb|AC107075.4| Homo sapiens BAC clone RP11-452N17 from 2, comple... 42 1.7
493gb|AC016647.7| Homo sapiens chromosome 16 clone RP11-89G14, comp... 42 1.7
494dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 1.7
495gb|AC025420.26| Homo sapiens 12 BAC RP11-491C17 (Roswell Park Ca... 42 1.7
496gb|AC126412.21| Mus musculus chromosome 3, clone RP24-267M22, co... 42 1.7
497gb|AC092874.2| Sus scrofa clone RP44-326F1, complete sequence 42 1.7
498gb|AF463769.1| Mus musculus strain C57BL/6J cytokine gene cluste... 42 1.7
499gb|AC124091.16| Homo sapiens chromosome 15, clone RP11-640H21, c... 42 1.7
500emb|BX901906.3| Mouse DNA sequence from clone RP23-328F9 on chro... 42 1.7

>dbj|AK068446.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013153H06, full
           insert sequence
          Length = 904

 Score =  234 bits (118), Expect = 2e-58
 Identities = 178/198 (89%)
 Strand = Plus / Plus

                                                                       
Query: 251 tgccgatcgggttccggttccggcccaccgacgaggagctgctgctgcactacctgcgcc 310
           |||||||||| ||||||||||| ||||||||||||||||| ||||| |||||||| ||||
Sbjct: 178 tgccgatcggtttccggttccgacccaccgacgaggagctcctgctccactacctccgcc 237

                                                                       
Query: 311 gcaaggccctctcctgccccctccccgccgacatcatccccgtcgccgacctcgcgcgcc 370
           |||||| | | ||  ||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 238 gcaaggtcatgtcgcgccccctccccgccgacgtcatccccgtcgccgacctcgcccgcc 297

                                                                       
Query: 371 tccacccatgggacctgccaggcgaggccgacggcgagcggtacttcttccacctgccgg 430
           |||| ||||||||||| ||||||||||  ||||||||| |||||||||||||||||||||
Sbjct: 298 tccatccatgggaccttccaggcgagggagacggcgagaggtacttcttccacctgccgg 357

                             
Query: 431 ccacggggtgctggcgga 448
           | ||| | ||||||||||
Sbjct: 358 cgacgagctgctggcgga 375



to top

>dbj|AK067450.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106M04, full
           insert sequence
          Length = 1059

 Score =  234 bits (118), Expect = 2e-58
 Identities = 178/198 (89%)
 Strand = Plus / Plus

                                                                       
Query: 251 tgccgatcgggttccggttccggcccaccgacgaggagctgctgctgcactacctgcgcc 310
           |||||||||| ||||||||||| ||||||||||||||||| ||||| |||||||| ||||
Sbjct: 178 tgccgatcggtttccggttccgacccaccgacgaggagctcctgctccactacctccgcc 237

                                                                       
Query: 311 gcaaggccctctcctgccccctccccgccgacatcatccccgtcgccgacctcgcgcgcc 370
           |||||| | | ||  ||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 238 gcaaggtcatgtcgcgccccctccccgccgacgtcatccccgtcgccgacctcgcccgcc 297

                                                                       
Query: 371 tccacccatgggacctgccaggcgaggccgacggcgagcggtacttcttccacctgccgg 430
           |||| ||||||||||| ||||||||||  ||||||||| |||||||||||||||||||||
Sbjct: 298 tccatccatgggaccttccaggcgagggagacggcgagaggtacttcttccacctgccgg 357

                             
Query: 431 ccacggggtgctggcgga 448
           | ||| | ||||||||||
Sbjct: 358 cgacgagctgctggcgga 375



to top

>ref|XM_463672.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 780

 Score =  170 bits (86), Expect = 3e-39
 Identities = 128/142 (90%)
 Strand = Plus / Plus

                                                                       
Query: 251 tgccgatcgggttccggttccggcccaccgacgaggagctgctgctgcactacctgcgcc 310
           |||||||||| ||||||||||| ||||||||||||||||| ||||| |||||||| ||||
Sbjct: 62  tgccgatcggtttccggttccgacccaccgacgaggagctcctgctccactacctccgcc 121

                                                                       
Query: 311 gcaaggccctctcctgccccctccccgccgacatcatccccgtcgccgacctcgcgcgcc 370
           |||||| | | ||  ||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 122 gcaaggtcatgtcgcgccccctccccgccgacgtcatccccgtcgccgacctcgcccgcc 181

                                 
Query: 371 tccacccatgggacctgccagg 392
           |||| ||||||||||| |||||
Sbjct: 182 tccatccatgggaccttccagg 203



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                       
Query: 389 caggcgaggccgacggcgagcggtacttcttccacctgccggccacggggtgctggcgga 448
           |||||||||  ||||||||| |||||||||||||||||||||| ||| | ||||||||||
Sbjct: 293 caggcgagggagacggcgagaggtacttcttccacctgccggcgacgagctgctggcgga 352



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  170 bits (86), Expect = 3e-39
 Identities = 128/142 (90%)
 Strand = Plus / Plus

                                                                            
Query: 251      tgccgatcgggttccggttccggcccaccgacgaggagctgctgctgcactacctgcgcc 310
                |||||||||| ||||||||||| ||||||||||||||||| ||||| |||||||| ||||
Sbjct: 40565357 tgccgatcggtttccggttccgacccaccgacgaggagctcctgctccactacctccgcc 40565416

                                                                            
Query: 311      gcaaggccctctcctgccccctccccgccgacatcatccccgtcgccgacctcgcgcgcc 370
                |||||| | | ||  ||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 40565417 gcaaggtcatgtcgcgccccctccccgccgacgtcatccccgtcgccgacctcgcccgcc 40565476

                                      
Query: 371      tccacccatgggacctgccagg 392
                |||| ||||||||||| |||||
Sbjct: 40565477 tccatccatgggaccttccagg 40565498



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                            
Query: 389      caggcgaggccgacggcgagcggtacttcttccacctgccggccacggggtgctggcgga 448
                |||||||||  ||||||||| |||||||||||||||||||||| ||| | ||||||||||
Sbjct: 40565588 caggcgagggagacggcgagaggtacttcttccacctgccggcgacgagctgctggcgga 40565647



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                               
Query: 259      gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
                |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 38394598 gggttccggttccacccgacggacgaggagctggtgatgcactacct 38394552



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                        
Query: 277      accgacgaggagctgctgctgcactacctgcgccgcaagg 316
                ||||||||||||||  || ||||||||||  |||||||||
Sbjct: 34687443 accgacgaggagctcgtggtgcactacctctgccgcaagg 34687404



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 142      cttgcttgcttgcttgcttg 161
                ||||||||||||||||||||
Sbjct: 27072071 cttgcttgcttgcttgcttg 27072090



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 142      cttgcttgcttgcttgcttg 161
                ||||||||||||||||||||
Sbjct: 12475119 cttgcttgcttgcttgcttg 12475138



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 198     gaggcgggcggaggaggcggcggg 221
               ||||||||||||||||| ||||||
Sbjct: 9224459 gaggcgggcggaggaggaggcggg 9224436



to top

>dbj|AP004332.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
            clone:OSJNBa0093F16
          Length = 160925

 Score =  170 bits (86), Expect = 3e-39
 Identities = 128/142 (90%)
 Strand = Plus / Plus

                                                                        
Query: 251  tgccgatcgggttccggttccggcccaccgacgaggagctgctgctgcactacctgcgcc 310
            |||||||||| ||||||||||| ||||||||||||||||| ||||| |||||||| ||||
Sbjct: 7335 tgccgatcggtttccggttccgacccaccgacgaggagctcctgctccactacctccgcc 7394

                                                                        
Query: 311  gcaaggccctctcctgccccctccccgccgacatcatccccgtcgccgacctcgcgcgcc 370
            |||||| | | ||  ||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 7395 gcaaggtcatgtcgcgccccctccccgccgacgtcatccccgtcgccgacctcgcccgcc 7454

                                  
Query: 371  tccacccatgggacctgccagg 392
            |||| ||||||||||| |||||
Sbjct: 7455 tccatccatgggaccttccagg 7476



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                        
Query: 389  caggcgaggccgacggcgagcggtacttcttccacctgccggccacggggtgctggcgga 448
            |||||||||  ||||||||| |||||||||||||||||||||| ||| | ||||||||||
Sbjct: 7566 caggcgagggagacggcgagaggtacttcttccacctgccggcgacgagctgctggcgga 7625



to top

>dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1033B05
          Length = 138882

 Score =  170 bits (86), Expect = 3e-39
 Identities = 128/142 (90%)
 Strand = Plus / Plus

                                                                          
Query: 251    tgccgatcgggttccggttccggcccaccgacgaggagctgctgctgcactacctgcgcc 310
              |||||||||| ||||||||||| ||||||||||||||||| ||||| |||||||| ||||
Sbjct: 126981 tgccgatcggtttccggttccgacccaccgacgaggagctcctgctccactacctccgcc 127040

                                                                          
Query: 311    gcaaggccctctcctgccccctccccgccgacatcatccccgtcgccgacctcgcgcgcc 370
              |||||| | | ||  ||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 127041 gcaaggtcatgtcgcgccccctccccgccgacgtcatccccgtcgccgacctcgcccgcc 127100

                                    
Query: 371    tccacccatgggacctgccagg 392
              |||| ||||||||||| |||||
Sbjct: 127101 tccatccatgggaccttccagg 127122



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                          
Query: 389    caggcgaggccgacggcgagcggtacttcttccacctgccggccacggggtgctggcgga 448
              |||||||||  ||||||||| |||||||||||||||||||||| ||| | ||||||||||
Sbjct: 127212 caggcgagggagacggcgagaggtacttcttccacctgccggcgacgagctgctggcgga 127271



to top

>dbj|AP003262.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0482D04
          Length = 144583

 Score =  170 bits (86), Expect = 3e-39
 Identities = 128/142 (90%)
 Strand = Plus / Plus

                                                                         
Query: 251   tgccgatcgggttccggttccggcccaccgacgaggagctgctgctgcactacctgcgcc 310
             |||||||||| ||||||||||| ||||||||||||||||| ||||| |||||||| ||||
Sbjct: 45372 tgccgatcggtttccggttccgacccaccgacgaggagctcctgctccactacctccgcc 45431

                                                                         
Query: 311   gcaaggccctctcctgccccctccccgccgacatcatccccgtcgccgacctcgcgcgcc 370
             |||||| | | ||  ||||||||||||||||| |||||||||||||||||||||| ||||
Sbjct: 45432 gcaaggtcatgtcgcgccccctccccgccgacgtcatccccgtcgccgacctcgcccgcc 45491

                                   
Query: 371   tccacccatgggacctgccagg 392
             |||| ||||||||||| |||||
Sbjct: 45492 tccatccatgggaccttccagg 45513



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                         
Query: 389   caggcgaggccgacggcgagcggtacttcttccacctgccggccacggggtgctggcgga 448
             |||||||||  ||||||||| |||||||||||||||||||||| ||| | ||||||||||
Sbjct: 45603 caggcgagggagacggcgagaggtacttcttccacctgccggcgacgagctgctggcgga 45662



to top

>gb|AC157500.1| Oryza sativa (japonica cultivar-group) BAC clone OSJNBb0056O04, from
             chromosome 4, complete sequence
          Length = 90825

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                            
Query: 259   gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
             |||||||||||||  |||||||||||||||||||||||  |||||||
Sbjct: 11767 gggttccggttccaccccaccgacgaggagctgctgctctactacct 11721



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                      
Query: 259      gggttccggttccggcccaccgacgaggagctgctgctgcactacctgcgccgc 312
                |||||| ||||| |||||||||||||||||||  || |||||||||| ||||||
Sbjct: 17432379 gggttcaggttcaggcccaccgacgaggagcttgtggtgcactacctccgccgc 17432432



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 204      ggcggaggaggcggcgggagtggg 227
                |||||||||||||| |||||||||
Sbjct: 23327450 ggcggaggaggcggggggagtggg 23327473



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 195      ggagaggcgggcggaggagg 214
                ||||||||||||||||||||
Sbjct: 19240457 ggagaggcgggcggaggagg 19240476



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 278     ccgacgaggagctgctgctg 297
               ||||||||||||||||||||
Sbjct: 5423888 ccgacgaggagctgctgctg 5423907



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 207     ggaggaggcggcgggagtgg 226
               ||||||||||||||||||||
Sbjct: 1184758 ggaggaggcggcgggagtgg 1184739



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                      
Query: 259      gggttccggttccggcccaccgacgaggagctgctgctgcactacctgcgccgc 312
                |||||| ||||| |||||||||||||||||||  || |||||||||| ||||||
Sbjct: 17386750 gggttcaggttcaggcccaccgacgaggagcttgtggtgcactacctccgccgc 17386803



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 204      ggcggaggaggcggcgggagtggg 227
                |||||||||||||| |||||||||
Sbjct: 23255641 ggcggaggaggcggggggagtggg 23255664



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 195      ggagaggcgggcggaggagg 214
                ||||||||||||||||||||
Sbjct: 19166684 ggagaggcgggcggaggagg 19166703



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 278     ccgacgaggagctgctgctg 297
               ||||||||||||||||||||
Sbjct: 5423877 ccgacgaggagctgctgctg 5423896



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 207     ggaggaggcggcgggagtgg 226
               ||||||||||||||||||||
Sbjct: 1184758 ggaggaggcggcgggagtgg 1184739



to top

>emb|AL731763.1|CNS07YQA Oryza sativa chromosome 12, . BAC OSJNBa0090O14 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 129619

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                    
Query: 259    gggttccggttccggcccaccgacgaggagctgctgctgcactacctgcgccgc 312
              |||||| ||||| |||||||||||||||||||  || |||||||||| ||||||
Sbjct: 100027 gggttcaggttcaggcccaccgacgaggagcttgtggtgcactacctccgccgc 99974



to top

>gb|AC159811.2| Mus musculus BAC clone RP24-127J13 from chromosome 9, complete sequence
          Length = 134895

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                          
Query: 142   cttgcttgcttgcttgcttgggttgggtt 170
             |||||||||||||||||||||||||||||
Sbjct: 15032 cttgcttgcttgcttgcttgggttgggtt 15060



to top

>gb|AC157998.2| Mus musculus BAC clone RP23-27L18 from chromosome 9, complete sequence
          Length = 253762

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                          
Query: 142   cttgcttgcttgcttgcttgggttgggtt 170
             |||||||||||||||||||||||||||||
Sbjct: 31911 cttgcttgcttgcttgcttgggttgggtt 31883



to top

>gb|AY103772.1| Zea mays PCO133091 mRNA sequence
          Length = 1141

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 259 gggttccggttccggcccaccgacgaggagctgctgctgcactacctgcgccgcaaggc 317
           |||||||||||||  ||||| ||||| |||||| ||  |||||||||| ||||||||||
Sbjct: 255 gggttccggttccaccccacagacgacgagctggtggagcactacctgtgccgcaaggc 313



to top

>ref|XM_480192.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2829

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 249 gctgccgatcgggttccggttccggcccaccgacgaggagct 290
           ||||||| |||||||| ||||||  |||||||||||||||||
Sbjct: 134 gctgccgctcgggttcaggttccaccccaccgacgaggagct 175



to top

>gb|AC112662.7| Mus musculus chromosome 5, clone RP23-467F2, complete sequence
          Length = 200679

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 142    cttgcttgcttgcttgcttgggttgg 167
              ||||||||||||||||||||||||||
Sbjct: 129269 cttgcttgcttgcttgcttgggttgg 129244



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                         
Query: 249     gctgccgatcgggttccggttccggcccaccgacgaggagct 290
               ||||||| |||||||| ||||||  |||||||||||||||||
Sbjct: 3386873 gctgccgctcgggttcaggttccaccccaccgacgaggagct 3386832



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                             
Query: 246      cgggctgccgatcgggttccggttccggcccaccgacgaggagct 290
                ||||||||||   |||||| ||||||  |||||||||||||||||
Sbjct: 25346443 cgggctgccgccggggttcaggttccaccccaccgacgaggagct 25346399



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 204      ggcggaggaggcggcgggag 223
                ||||||||||||||||||||
Sbjct: 21693448 ggcggaggaggcggcgggag 21693429



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 259      gggttccggttccggcccaccgacgaggagct 290
                ||||||||||||   |||||||||||||||||
Sbjct: 21020648 gggttccggttcttccccaccgacgaggagct 21020617



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 142      cttgcttgcttgcttgcttg 161
                ||||||||||||||||||||
Sbjct: 11522656 cttgcttgcttgcttgcttg 11522637



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 189     gccggcggagaggcgggcgg 208
               ||||||||||||||||||||
Sbjct: 3371565 gccggcggagaggcgggcgg 3371546



to top

>dbj|AP004698.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0498E12
          Length = 153523

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                       
Query: 249   gctgccgatcgggttccggttccggcccaccgacgaggagct 290
             ||||||| |||||||| ||||||  |||||||||||||||||
Sbjct: 20292 gctgccgctcgggttcaggttccaccccaccgacgaggagct 20251



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 189  gccggcggagaggcgggcgg 208
            ||||||||||||||||||||
Sbjct: 4984 gccggcggagaggcgggcgg 4965



to top

>dbj|AK065294.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002N10, full
           insert sequence
          Length = 2830

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 249 gctgccgatcgggttccggttccggcccaccgacgaggagct 290
           ||||||| |||||||| ||||||  |||||||||||||||||
Sbjct: 134 gctgccgctcgggttcaggttccaccccaccgacgaggagct 175



to top

>gb|AC121959.3| Mus musculus BAC clone RP24-247N18 from chromosome 3, complete sequence
          Length = 187416

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 142    cttgcttgcttgcttgcttgggtt 165
              ||||||||||||||||||||||||
Sbjct: 114483 cttgcttgcttgcttgcttgggtt 114506



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 114479 cttgcttgcttgcttgcttg 114498



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 114475 cttgcttgcttgcttgcttg 114494



to top

>emb|AL645784.20| Mouse DNA sequence from clone RP23-11C7 on chromosome 11 Contains a zinc
              finger protein pseudogene, a chaperonin subunit 7 (eta)
              (Cct7) pseudogene, a novel pseudogene and a CpG island,
              complete sequence
          Length = 217352

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 142    cttgcttgcttgcttgcttgggtt 165
              ||||||||||||||||||||||||
Sbjct: 117583 cttgcttgcttgcttgcttgggtt 117606



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 117579 cttgcttgcttgcttgcttg 117598



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 117575 cttgcttgcttgcttgcttg 117594



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 117571 cttgcttgcttgcttgcttg 117590



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 117567 cttgcttgcttgcttgcttg 117586



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 117563 cttgcttgcttgcttgcttg 117582



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 117559 cttgcttgcttgcttgcttg 117578



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 117555 cttgcttgcttgcttgcttg 117574



to top

>gb|AC153586.7| Mus musculus 6 BAC RP23-88E13 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 188553

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 143   ttgcttgcttgcttgcttgggttgggttgtgt 174
             |||||||||||||||||||| |||| ||||||
Sbjct: 20492 ttgcttgcttgcttgcttggtttggtttgtgt 20461



to top

>gb|AC153983.7| Mus musculus 6 BAC RP24-479J14 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 178303

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 143   ttgcttgcttgcttgcttgggttgggttgtgt 174
             |||||||||||||||||||| |||| ||||||
Sbjct: 36787 ttgcttgcttgcttgcttggtttggtttgtgt 36818



to top

>ref|XM_463543.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 912

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 259 gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
           |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 34  gggttccggttccacccgacggacgaggagctggtgatgcactacct 80



to top

>ref|NM_186352.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1817

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 259 gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
           |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 174 gggttccggttccacccgacggacgaggagctggtggtgcactacct 220



to top

>gb|AC132485.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0022D06,
             complete sequence
          Length = 142068

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 200   ggcgggcggaggaggcggcgggagtgggcgg 230
             |||||| ||||||||||||||| ||||||||
Sbjct: 18510 ggcgggaggaggaggcggcgggcgtgggcgg 18540



to top

>gb|AC121939.3| Mus musculus BAC clone RP24-208M2 from chromosome 2, complete sequence
          Length = 153093

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 142   cttgcttgcttgcttgcttgggt 164
             |||||||||||||||||||||||
Sbjct: 81327 cttgcttgcttgcttgcttgggt 81305



to top

>gb|AC121835.2| Mus musculus BAC clone RP24-72L18 from 8, complete sequence
          Length = 225065

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 142    cttgcttgcttgcttgcttgggt 164
              |||||||||||||||||||||||
Sbjct: 105591 cttgcttgcttgcttgcttgggt 105613



to top

>emb|BX901956.4| Zebrafish DNA sequence from clone CH211-284C12 in linkage group 3,
             complete sequence
          Length = 197042

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 142   cttgcttgcttgcttgcttgggttggg 168
             ||||||||||||||||||||| |||||
Sbjct: 90406 cttgcttgcttgcttgcttggtttggg 90432



to top

>gb|AC169370.4| Sorghum bicolor clone SB_BBc0011I20, complete sequence
          Length = 135209

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 259  gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
            |||||||||||||  ||||| |||||||||||| |  ||||||||||
Sbjct: 3885 gggttccggttccaccccactgacgaggagctgatcgtgcactacct 3839



to top

>gb|AC007158.10|AC007158 Homo sapiens, clone RP11-90A1, complete sequence
          Length = 201299

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 134    agagttatcttgcttgcttgcttgctt 160
              ||||||| |||||||||||||||||||
Sbjct: 113603 agagttagcttgcttgcttgcttgctt 113577



to top

>gb|AY742218.1| Saccharum officinarum NAC23 mRNA, complete cds
          Length = 891

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 259 gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
           |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 37  gggttccggttccacccgacggacgaggagctggtgatgcactacct 83



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                               
Query: 259      gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
                |||||||||||||  || || |||||||||||| | |||||||||||
Sbjct: 28932370 gggttccggttccacccgacggacgaggagctgatcctgcactacct 28932416



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                               
Query: 259      gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
                |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 22703800 gggttccggttccacccgacggacgaggagctggtggtgcactacct 22703754



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 259      gggttccggttccggcccaccgacgaggag 288
                |||||||||||||  |||||||||||||||
Sbjct: 28988461 gggttccggttccaccccaccgacgaggag 28988432



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 30/32 (93%), Gaps = 1/32 (3%)
 Strand = Plus / Plus

                                                
Query: 189      gccggcggagaggcgggcggaggaggcggcgg 220
                ||||||||||||| || |||||||||||||||
Sbjct: 24443929 gccggcggagaggagg-cggaggaggcggcgg 24443959



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 274     cccaccgacgaggagctgctgctgcactacct 305
               |||||||||||||||||| ||  |||||||||
Sbjct: 7000286 cccaccgacgaggagctggtggcgcactacct 7000317



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 142     cttgcttgcttgcttgcttg 161
               ||||||||||||||||||||
Sbjct: 3220955 cttgcttgcttgcttgcttg 3220974



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 142     cttgcttgcttgcttgcttg 161
               ||||||||||||||||||||
Sbjct: 3220951 cttgcttgcttgcttgcttg 3220970



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 141     tcttgcttgcttgcttgctt 160
               ||||||||||||||||||||
Sbjct: 1216516 tcttgcttgcttgcttgctt 1216497



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                               
Query: 200      ggcgggcggaggaggcggcgggagtgggcgg 230
                |||||| ||||||||||||||| ||||||||
Sbjct: 25283906 ggcgggaggaggaggcggcgggcgtgggcgg 25283936



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 201      gcgggcggaggaggcggcgg 220
                ||||||||||||||||||||
Sbjct: 16524028 gcgggcggaggaggcggcgg 16524047



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 20       gccaaccactctctctctcc 39
                ||||||||||||||||||||
Sbjct: 14788931 gccaaccactctctctctcc 14788912



to top

>gb|AF254558.1|AF254558 Oryza sativa NAC6 (NAC6) gene, complete cds
          Length = 4817

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 259  gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
            |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 2184 gggttccggttccacccgacggacgaggagctggtgatgcactacct 2230



to top

>emb|AL845547.18| Mouse DNA sequence from clone RP23-296A4 on chromosome 2, complete
              sequence
          Length = 187738

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 142    cttgcttgcttgcttgcttgggt 164
              |||||||||||||||||||||||
Sbjct: 143023 cttgcttgcttgcttgcttgggt 143001



to top

>gb|AC007092.4| Homo sapiens BAC clone RP11-90D1 from 2, complete sequence
          Length = 157176

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 134   agagttatcttgcttgcttgcttgctt 160
             ||||||| |||||||||||||||||||
Sbjct: 59236 agagttagcttgcttgcttgcttgctt 59262



to top

>dbj|AP003561.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1065E10
          Length = 183580

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 259    gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
              |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 155423 gggttccggttccacccgacggacgaggagctggtgatgcactacct 155377



to top

>dbj|AP005167.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0060O17
          Length = 180015

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                            
Query: 259   gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
             |||||||||||||  || || |||||||||||| | |||||||||||
Sbjct: 49907 gggttccggttccacccgacggacgaggagctgatcctgcactacct 49953



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 259    gggttccggttccggcccaccgacgaggag 288
              |||||||||||||  |||||||||||||||
Sbjct: 105998 gggttccggttccaccccaccgacgaggag 105969



to top

>dbj|AP003932.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1773_H01
          Length = 146543

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 259    gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
              |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 121698 gggttccggttccacccgacggacgaggagctggtggtgcactacct 121652



to top

>dbj|AP003866.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1092_A07
          Length = 137081

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 259   gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
             |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 23142 gggttccggttccacccgacggacgaggagctggtggtgcactacct 23096



to top

>ref|XM_319846.2| Anopheles gambiae str. PEST ENSANGP00000016605 (ENSANGG00000014116),
            partial mRNA
          Length = 1386

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 142  cttgcttgcttgcttgcttgggttggg 168
            |||||||||||||||||||||| ||||
Sbjct: 1108 cttgcttgcttgcttgcttgggctggg 1082



to top

>dbj|AK068606.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013157G23, full
           insert sequence
          Length = 1650

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 259 gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
           |||||||||||||  || || |||||||||||| | |||||||||||
Sbjct: 147 gggttccggttccacccgacggacgaggagctgatcctgcactacct 193



to top

>dbj|AK068392.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013149P14, full
           insert sequence
          Length = 1529

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 259 gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
           |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 145 gggttccggttccacccgacggacgaggagctggtgatgcactacct 191



to top

>dbj|AK063406.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-115-A08, full
           insert sequence
          Length = 1817

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 259 gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
           |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 174 gggttccggttccacccgacggacgaggagctggtggtgcactacct 220



to top

>emb|AL935200.9| Zebrafish DNA sequence from clone CH211-237I5, complete sequence
          Length = 160710

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 142    cttgcttgcttgcttgcttgggttggg 168
              ||||||||||||||||||||| |||||
Sbjct: 153328 cttgcttgcttgcttgcttggtttggg 153302



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 153336 cttgcttgcttgcttgcttg 153317



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 153332 cttgcttgcttgcttgcttg 153313



to top

>dbj|AB028185.1| Oryza sativa mRNA for OsNAC6 protein, complete cds
          Length = 1423

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 259 gggttccggttccggcccaccgacgaggagctgctgctgcactacct 305
           |||||||||||||  || || |||||||||||| || ||||||||||
Sbjct: 145 gggttccggttccacccgacggacgaggagctggtgatgcactacct 191



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 191     cggcggagaggcgggcggaggaggcggcgg 220
               |||||| ||||||||||| |||||||||||
Sbjct: 2035581 cggcggggaggcgggcggcggaggcggcgg 2035552



to top

>ref|XM_506578.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBa0060O17.21
           mRNA
          Length = 1644

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 259 gggttccggttccggcccaccgacgaggag 288
           |||||||||||||  |||||||||||||||
Sbjct: 260 gggttccggttccaccccaccgacgaggag 289



to top

>ref|XM_479577.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1477

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 259 gggttccggttccggcccaccgacgaggag 288
           |||||||||||||  |||||||||||||||
Sbjct: 89  gggttccggttccaccccaccgacgaggag 118



to top

>gb|AC122159.30| Mus musculus strain 129/Sv clone ct7-575j15 map 10, complete sequence
          Length = 183491

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 198    gaggcgggcggaggaggcggcgggag 223
              ||||||||||||||||| ||||||||
Sbjct: 114519 gaggcgggcggaggaggaggcgggag 114494



to top

>gb|AC115714.14| Mus musculus chromosome 12, clone RP23-477C24, complete sequence
          Length = 164272

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 318   cctctcctgccccctccccgcc 339
             ||||||||||||||||||||||
Sbjct: 55630 cctctcctgccccctccccgcc 55651



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 145885 cttgcttgcttgcttgcttg 145904



to top

>gb|AC112956.12| Mus musculus chromosome 9, clone RP23-412P4, complete sequence
          Length = 197841

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 140   atcttgcttgcttgcttgcttg 161
             ||||||||||||||||||||||
Sbjct: 49832 atcttgcttgcttgcttgcttg 49853



to top

>emb|CT009556.7| Mouse DNA sequence from clone RP23-87H19 on chromosome 14, complete
              sequence
          Length = 227368

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 142    cttgcttgcttgcttgcttggg 163
              ||||||||||||||||||||||
Sbjct: 168332 cttgcttgcttgcttgcttggg 168353



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 168328 cttgcttgcttgcttgcttg 168347



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 168324 cttgcttgcttgcttgcttg 168343



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 168320 cttgcttgcttgcttgcttg 168339



to top

>gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosome 7, complete sequence
          Length = 152908

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 140    atcttgcttgcttgcttgcttg 161
              ||||||||||||||||||||||
Sbjct: 109716 atcttgcttgcttgcttgcttg 109695



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109710 cttgcttgcttgcttgcttg 109691



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109706 cttgcttgcttgcttgcttg 109687



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109702 cttgcttgcttgcttgcttg 109683



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109698 cttgcttgcttgcttgcttg 109679



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109694 cttgcttgcttgcttgcttg 109675



to top

>gb|AC124576.4| Mus musculus BAC clone RP23-162H6 from chromosome 16, complete sequence
          Length = 233527

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 144    tgcttgcttgcttgcttgggtt 165
              ||||||||||||||||||||||
Sbjct: 135605 tgcttgcttgcttgcttgggtt 135584



to top

>gb|AC126550.3| Mus musculus BAC clone RP24-405L5 from chromosome 17, complete sequence
          Length = 171820

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 142    cttgcttgcttgcttgcttgggttgggttg 171
              ||||||||||||||||||||  ||||||||
Sbjct: 128440 cttgcttgcttgcttgcttgcattgggttg 128469



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128436 cttgcttgcttgcttgcttg 128455



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128432 cttgcttgcttgcttgcttg 128451



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128428 cttgcttgcttgcttgcttg 128447



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128424 cttgcttgcttgcttgcttg 128443



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128420 cttgcttgcttgcttgcttg 128439



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128416 cttgcttgcttgcttgcttg 128435



to top

>gb|AC127246.3| Mus musculus BAC clone RP24-424L20 from chromosome 16, complete sequence
          Length = 181475

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 144    tgcttgcttgcttgcttgggtt 165
              ||||||||||||||||||||||
Sbjct: 166893 tgcttgcttgcttgcttgggtt 166914



to top

>gb|AC108949.4| Mus musculus BAC clone RP23-451K2 from 6, complete sequence
          Length = 181571

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 140   atcttgcttgcttgcttgcttg 161
             ||||||||||||||||||||||
Sbjct: 18762 atcttgcttgcttgcttgcttg 18741



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 18756 cttgcttgcttgcttgcttgg 18736



to top

>gb|AC104889.10| Mus musculus chromosome 5, clone RP23-201D22, complete sequence
          Length = 196086

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 142   cttgcttgcttgcttgcttgggttgg 167
             ||||||||||||||||||| ||||||
Sbjct: 41806 cttgcttgcttgcttgctttggttgg 41781



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 41838 cttgcttgcttgcttgcttg 41819



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 41834 cttgcttgcttgcttgcttg 41815



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 41830 cttgcttgcttgcttgcttg 41811



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 41826 cttgcttgcttgcttgcttg 41807



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 41822 cttgcttgcttgcttgcttg 41803



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 41818 cttgcttgcttgcttgcttg 41799



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 41814 cttgcttgcttgcttgcttg 41795



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 41810 cttgcttgcttgcttgcttg 41791



to top

>gb|AC133139.23| Medicago truncatula clone mth1-8d23, complete sequence
          Length = 121016

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 249   gctgccgatcgggttccggttccggcccaccgacgaggagct 290
             ||||||| | ||||||||||||||||| || || ||||||||
Sbjct: 52019 gctgccgttagggttccggttccggcctactgatgaggagct 52060



to top

>gb|AC122727.24| Medicago truncatula clone mth2-13b8, complete sequence
          Length = 128564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 249   gctgccgatcgggttccggttccggcccaccgacgaggagct 290
             ||||||| | ||||||||||||||||| || || ||||||||
Sbjct: 76548 gctgccgttagggttccggttccggcctactgatgaggagct 76507



to top

>gb|AC128353.6| Rattus norvegicus 13 BAC CH230-148A5 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 207556

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 140   atcttgcttgcttgcttgcttg 161
             ||||||||||||||||||||||
Sbjct: 93897 atcttgcttgcttgcttgcttg 93876



to top

>gb|AC158934.4| Mus musculus chromosome 3, clone RP23-218L17, complete sequence
          Length = 194631

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 142    cttgcttgcttgcttgcttggg 163
              ||||||||||||||||||||||
Sbjct: 142986 cttgcttgcttgcttgcttggg 143007



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 142982 cttgcttgcttgcttgcttg 143001



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 142978 cttgcttgcttgcttgcttg 142997



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 142974 cttgcttgcttgcttgcttg 142993



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 142970 cttgcttgcttgcttgcttg 142989



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 142966 cttgcttgcttgcttgcttg 142985



to top

>gb|BT009047.1| Triticum aestivum clone wdk9n.pk001.k24:fis, full insert mRNA
           sequence
          Length = 1226

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 237 ggtgccgggcgggctgccgatcgggt 262
           ||||||||||| ||||||||||||||
Sbjct: 626 ggtgccgggcgtgctgccgatcgggt 651



to top

>emb|BX842628.1| Neurospora crassa DNA linkage group I BAC clone B23L4
          Length = 61971

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 142   cttgcttgcttgcttgcttggg 163
             ||||||||||||||||||||||
Sbjct: 11431 cttgcttgcttgcttgcttggg 11452



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 11427 cttgcttgcttgcttgcttg 11446



to top

>emb|AL606521.24| Mouse DNA sequence from clone RP23-280J3 on chromosome 11 Contains the 5'
              end of the Mtmr3 gene for myotubularin related protein 3,
              two novel genes, the gene for a novel protein similar to
              human ASC-1 complex subunit P100, the gene for a novel
              protein similar to human ubiquinol-cytochrome C reductase
              complex 7.2 kDa protein UQCR10, the Cabp7 gene for calcium
              binding protein 7, the 3' end of the Nf2 gene for
              neurofibromatosis 2 and two CpG islands, complete sequence
          Length = 233997

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 143    ttgcttgcttgcttgcttgggt 164
              ||||||||||||||||||||||
Sbjct: 177457 ttgcttgcttgcttgcttgggt 177436



to top

>emb|AJ010830.1|TSP010830 Triticum sp. mRNA for GRAB2 protein
          Length = 1295

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 259 gggttccggttccggcccaccgacgaggag 288
           |||||||||||||  |||||||||||||||
Sbjct: 172 gggttccggttccaccccaccgacgaggag 201



to top

>emb|AL589735.12| Mouse DNA sequence from clone RP23-211M15 on chromosome 13 contains the
             gene for a novel protein similar to human RU2S or
             KIAA1154, a ribosomal protein L35A (RPL35A) pseudogene and
             two CpG islands, complete sequence
          Length = 199957

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 142   cttgcttgcttgcttgcttgggttgg 167
             ||||||||||||||||||||| ||||
Sbjct: 62641 cttgcttgcttgcttgcttggcttgg 62666



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 138670 cttgcttgcttgcttgcttg 138689



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 138666 cttgcttgcttgcttgcttg 138685



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 138662 cttgcttgcttgcttgcttg 138681



to top

>gb|AC103579.10| Mus Musculus Strain C57BL6/J Chromosome 14 BAC Clone RP23-145J23,
             Complete Sequence, complete sequence
          Length = 227361

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 142   cttgcttgcttgcttgcttggg 163
             ||||||||||||||||||||||
Sbjct: 79706 cttgcttgcttgcttgcttggg 79685



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 79718 cttgcttgcttgcttgcttg 79699



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 79714 cttgcttgcttgcttgcttg 79695



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 79710 cttgcttgcttgcttgcttg 79691



to top

>gb|AC079904.31| Homo sapiens 12 BAC RP11-84J24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 197964

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 136    agttatcttgcttgcttgcttgcttg 161
              |||| |||||||||||||||||||||
Sbjct: 195094 agttttcttgcttgcttgcttgcttg 195069



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 195084 cttgcttgcttgcttgcttg 195065



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 195080 cttgcttgcttgcttgcttg 195061



to top

>gb|DP000057.1| Dasypus novemcinctus target 117 genomic scaffold
          Length = 444202

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 314   aggccctctcctgccccctccccgcc 339
             |||||||| |||||||||||||||||
Sbjct: 17226 aggccctcacctgccccctccccgcc 17201



to top

>gb|AC106752.3| Homo sapiens chromosome 5 clone RP11-166J22, complete sequence
          Length = 95926

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 140   atcttgcttgcttgcttgcttg 161
             ||||||||||||||||||||||
Sbjct: 48036 atcttgcttgcttgcttgcttg 48015



to top

>gb|AY752663.1| Schizorchis sp. LMW-2004 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, complete sequence; and
           5.8S ribosomal RNA gene, partial sequence
          Length = 733

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 142 cttgcttgcttgcttgcttggg 163
           ||||||||||||||||||||||
Sbjct: 223 cttgcttgcttgcttgcttggg 244



to top

>gb|AY752648.1| Mosgovoyia pectinata isolate N4 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, complete
           sequence; and 5.8S ribosomal RNA gene, partial sequence
          Length = 607

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 142 cttgcttgcttgcttgcttggg 163
           ||||||||||||||||||||||
Sbjct: 184 cttgcttgcttgcttgcttggg 205



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 180 cttgcttgcttgcttgcttg 199



to top

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 200   ggcgggcggaggaggcggcggg 221
             ||||||||||||||||||||||
Sbjct: 80172 ggcgggcggaggaggcggcggg 80151



to top

>gb|AC153375.3| Mus musculus 6 BAC RP23-353E9 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 198876

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 140    atcttgcttgcttgcttgcttg 161
              ||||||||||||||||||||||
Sbjct: 120316 atcttgcttgcttgcttgcttg 120295



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 120310 cttgcttgcttgcttgcttgg 120290



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
              complete sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                        
Query: 250    ctgccgatcgggttccggttccggcccaccgacgaggagctg 291
              |||||| | |||||||| |||||||| || ||||||||||||
Sbjct: 155505 ctgccggtggggttccgtttccggccgacggacgaggagctg 155464



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 142      cttgcttgcttgcttgcttg 161
                ||||||||||||||||||||
Sbjct: 29811410 cttgcttgcttgcttgcttg 29811429



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 191    cggcggagaggcgggcggag 210
              ||||||||||||||||||||
Sbjct: 513889 cggcggagaggcgggcggag 513870



to top

>gb|AC066611.6|AC066611 Homo sapiens chromosome 15 clone RP11-348P16 map 15q21.3, complete
              sequence
          Length = 184355

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 136    agttatcttgcttgcttgcttgcttg 161
              |||| |||||||||||||||||||||
Sbjct: 170892 agttttcttgcttgcttgcttgcttg 170917



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 170906 cttgcttgcttgcttgcttg 170925



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 170902 cttgcttgcttgcttgcttg 170921



to top

>gb|AC093843.2| Homo sapiens BAC clone RP11-444B5 from 2, complete sequence
          Length = 86897

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 141   tcttgcttgcttgcttgcttgg 162
             ||||||||||||||||||||||
Sbjct: 81526 tcttgcttgcttgcttgcttgg 81547



to top

>dbj|AP002842.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0075G19
          Length = 163558

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 250   ctgccgatcgggttccggttccggcccaccgacgaggagctg 291
             |||||| | |||||||| |||||||| || ||||||||||||
Sbjct: 20401 ctgccggtggggttccgtttccggccgacggacgaggagctg 20360



to top

>dbj|AK105645.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-200-F06, full
           insert sequence
          Length = 1475

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 259 gggttccggttccggcccaccgacgaggag 288
           |||||||||||||  |||||||||||||||
Sbjct: 89  gggttccggttccaccccaccgacgaggag 118



to top

>dbj|AK073876.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033072L16, full
           insert sequence
          Length = 1644

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 259 gggttccggttccggcccaccgacgaggag 288
           |||||||||||||  |||||||||||||||
Sbjct: 260 gggttccggttccaccccaccgacgaggag 289



to top

>dbj|AK064178.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-104-B01, full
           insert sequence
          Length = 2281

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 250 ctgccgatcgggttccggttccggcccaccgacgaggagctg 291
           |||||| | |||||||| |||||||| || ||||||||||||
Sbjct: 114 ctgccggtggggttccgtttccggccgacggacgaggagctg 155



to top

>gb|AY104770.1| Zea mays PCO074909 mRNA sequence
          Length = 3628

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 198 gaggcgggcggaggaggcggcg 219
           ||||||||||||||||||||||
Sbjct: 179 gaggcgggcggaggaggcggcg 158



to top

>gb|AC102377.14| Mus musculus chromosome 18, clone RP23-416I22, complete sequence
          Length = 188005

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 140    atcttgcttgcttgcttgcttg 161
              ||||||||||||||||||||||
Sbjct: 103354 atcttgcttgcttgcttgcttg 103333



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 103348 cttgcttgcttgcttgcttg 103329



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 103344 cttgcttgcttgcttgcttg 103325



to top

>dbj|AP005621.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0681G01, complete sequence
          Length = 184118

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 250   ctgccgatcgggttccggttccggcccaccgacgaggagctg 291
             |||||| | |||||||| |||||||| || ||||||||||||
Sbjct: 65037 ctgccggtggggttccgtttccggccgacggacgaggagctg 65078



to top

>emb|AJ851868.2| Mus musculus immunoglobulin heavy chain locus constant region and partial
              variable region, strain 129/Sv
          Length = 1382053

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 136    agttatcttgcttgcttgcttgcttg 161
              |||| |||||||||||||||||||||
Sbjct: 331956 agttttcttgcttgcttgcttgcttg 331981



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 136    agttatcttgcttgcttgcttgcttg 161
              |||| |||||||||||||||||||||
Sbjct: 269998 agttttcttgcttgcttgcttgcttg 270023



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 143    ttgcttgcttgcttgcttgg 162
              ||||||||||||||||||||
Sbjct: 278275 ttgcttgcttgcttgcttgg 278294



to top

>gb|AC102620.11| Mus musculus chromosome 5, clone RP23-429E19, complete sequence
          Length = 208435

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 142    cttgcttgcttgcttgcttgggttgg 167
              ||||||||||||||||||| ||||||
Sbjct: 204459 cttgcttgcttgcttgctttggttgg 204434



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 204491 cttgcttgcttgcttgcttg 204472



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 204487 cttgcttgcttgcttgcttg 204468



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 204483 cttgcttgcttgcttgcttg 204464



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 204479 cttgcttgcttgcttgcttg 204460



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 204475 cttgcttgcttgcttgcttg 204456



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 204471 cttgcttgcttgcttgcttg 204452



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 204467 cttgcttgcttgcttgcttg 204448



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 204463 cttgcttgcttgcttgcttg 204444



to top

>emb|AL732317.13| Mouse DNA sequence from clone RP23-139F8 on chromosome 2, complete
             sequence
          Length = 222471

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 140   atcttgcttgcttgcttgcttg 161
             ||||||||||||||||||||||
Sbjct: 82966 atcttgcttgcttgcttgcttg 82945



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 82960 cttgcttgcttgcttgcttg 82941



to top

>emb|AL831790.3| Mouse DNA sequence from clone RP23-334I5 on chromosome 4, complete
              sequence
          Length = 206074

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 140    atcttgcttgcttgcttgcttg 161
              ||||||||||||||||||||||
Sbjct: 196311 atcttgcttgcttgcttgcttg 196332



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 196333 cttgcttgcttgcttgcttg 196352



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 196329 cttgcttgcttgcttgcttg 196348



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 196325 cttgcttgcttgcttgcttg 196344



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 196321 cttgcttgcttgcttgcttg 196340



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 196317 cttgcttgcttgcttgcttg 196336



to top

>emb|AL844487.3| Mouse DNA sequence from clone RP23-162L23 on chromosome X, complete
              sequence
          Length = 221023

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 142    cttgcttgcttgcttgcttgggttgg 167
              ||||||||||||||||||||| ||||
Sbjct: 197599 cttgcttgcttgcttgcttggcttgg 197574



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 197619 cttgcttgcttgcttgcttg 197600



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 197615 cttgcttgcttgcttgcttg 197596



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 197611 cttgcttgcttgcttgcttg 197592



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 197607 cttgcttgcttgcttgcttg 197588



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 197603 cttgcttgcttgcttgcttg 197584



to top

>emb|AL606914.9| Mouse DNA sequence from clone RP23-169H13 on chromosome 4, complete
              sequence
          Length = 197061

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 142    cttgcttgcttgcttgcttggg 163
              ||||||||||||||||||||||
Sbjct: 154151 cttgcttgcttgcttgcttggg 154130



to top

>gb|AC170752.2| Mus musculus BAC clone RP23-116B8 from chromosome 10, complete sequence
          Length = 194054

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 198    gaggcgggcggaggaggcggcgggag 223
              ||||||||||||||||| ||||||||
Sbjct: 115865 gaggcgggcggaggaggaggcgggag 115890



to top

>gb|AC118132.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone
            OSJNBa0003A09, complete sequence
          Length = 167222

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 151  ttgcttgcttgggttgggttg 171
            |||||||||||||||||||||
Sbjct: 5032 ttgcttgcttgggttgggttg 5012



to top

>gb|AC123684.8| Mus musculus chromosome 3, clone RP23-297F14, complete sequence
          Length = 200566

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 183522 cttgcttgcttgcttgcttgg 183502



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 183462 cttgcttgcttgcttgcttgg 183442



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 168613 tcttgcttgcttgcttgcttg 168593



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 183526 cttgcttgcttgcttgcttg 183507



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 183482 cttgcttgcttgcttgcttg 183463



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 183478 cttgcttgcttgcttgcttg 183459



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 183474 cttgcttgcttgcttgcttg 183455



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 183470 cttgcttgcttgcttgcttg 183451



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 183466 cttgcttgcttgcttgcttg 183447



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 168608 cttgcttgcttgcttgcttg 168589



to top

>gb|AC102381.12| Mus musculus chromosome 8, clone RP24-180I19, complete sequence
          Length = 190298

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 77249 cttgcttgcttgcttgcttgg 77229



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 186895 cttgcttgcttgcttgcttg 186914



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 186891 cttgcttgcttgcttgcttg 186910



to top

>gb|AC139131.19| Mus musculus chromosome 7, clone RP23-301N20, complete sequence
          Length = 230772

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 200909 cttgcttgcttgcttgcttgg 200889



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 200929 cttgcttgcttgcttgcttg 200910



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 200925 cttgcttgcttgcttgcttg 200906



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 200921 cttgcttgcttgcttgcttg 200902



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 200917 cttgcttgcttgcttgcttg 200898



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 200913 cttgcttgcttgcttgcttg 200894



to top

>gb|AC113121.27| Mus musculus chromosome 8, clone RP23-347G12, complete sequence
          Length = 192877

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 144   tgcttgcttgcttgcttgggttggg 168
             ||||||||||||||||||| |||||
Sbjct: 35943 tgcttgcttgcttgcttggtttggg 35919



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109309 cttgcttgcttgcttgcttg 109290



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109305 cttgcttgcttgcttgcttg 109286



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109301 cttgcttgcttgcttgcttg 109282



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109297 cttgcttgcttgcttgcttg 109278



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109293 cttgcttgcttgcttgcttg 109274



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109289 cttgcttgcttgcttgcttg 109270



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109285 cttgcttgcttgcttgcttg 109266



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109281 cttgcttgcttgcttgcttg 109262



to top

>gb|AC161519.11| Mus musculus chromosome 18, clone RP24-83L9, complete sequence
          Length = 233631

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 129923 cttgcttgcttgcttgcttgg 129943



to top

>ref|NM_020265.3| Mus musculus dickkopf homolog 2 (Xenopus laevis) (Dkk2), mRNA
          Length = 3713

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 141  tcttgcttgcttgcttgcttg 161
            |||||||||||||||||||||
Sbjct: 3057 tcttgcttgcttgcttgcttg 3037



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 3052 cttgcttgcttgcttgcttg 3033



to top

>gb|AC099607.6| Mus musculus chromosome 5, clone RP23-361G20, complete sequence
          Length = 204179

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 16963 tcttgcttgcttgcttgcttg 16943



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 16958 cttgcttgcttgcttgcttg 16939



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 16954 cttgcttgcttgcttgcttg 16935



to top

>gb|AC151846.3| Mus musculus BAC clone RP23-13B8 from chromosome 10, complete sequence
          Length = 252639

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 165771 cttgcttgcttgcttgcttgg 165751



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 165783 cttgcttgcttgcttgcttg 165764



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 165779 cttgcttgcttgcttgcttg 165760



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 165775 cttgcttgcttgcttgcttg 165756



to top

>gb|AC163295.2| Mus musculus BAC clone RP23-132K20 from chromosome 14, complete
             sequence
          Length = 212576

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 43102 tcttgcttgcttgcttgcttg 43082



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 43097 cttgcttgcttgcttgcttg 43078



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 43093 cttgcttgcttgcttgcttg 43074



to top

>gb|AC159266.3| Mus musculus BAC clone RP24-64D24 from chromosome 8, complete sequence
          Length = 212727

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 104964 tcttgcttgcttgcttgcttg 104944



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 121398 cttgcttgcttgcttgcttg 121379



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 121394 cttgcttgcttgcttgcttg 121375



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 104959 cttgcttgcttgcttgcttg 104940



to top

>ref|XM_483299.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1023

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 246 cgggctgccgatcgggttccggttccggcccaccgacgaggagct 290
           ||||||||||   |||||| ||||||  |||||||||||||||||
Sbjct: 69  cgggctgccgccggggttcaggttccaccccaccgacgaggagct 113



to top

>gb|AC099707.14| Mus musculus chromosome 1, clone RP23-329C7, complete sequence
          Length = 204557

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 101489 tcttgcttgcttgcttgcttg 101509



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 101494 cttgcttgcttgcttgcttg 101513



to top

>gb|AC153147.7| Mus musculus BAC clone RP23-205D14 from chromosome 12, complete
             sequence
          Length = 206281

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 84454 tcttgcttgcttgcttgcttg 84474



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 84463 cttgcttgcttgcttgcttg 84482



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 84459 cttgcttgcttgcttgcttg 84478



to top

>gb|AC132905.13| Mus musculus chromosome 13, clone RP24-295E18, complete sequence
          Length = 187116

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 165685 tcttgcttgcttgcttgcttg 165705



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 165702 cttgcttgcttgcttgcttg 165721



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 165698 cttgcttgcttgcttgcttg 165717



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 165694 cttgcttgcttgcttgcttg 165713



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 165690 cttgcttgcttgcttgcttg 165709



to top

>gb|BT019155.1| Zea mays clone Contig818.F mRNA sequence
          Length = 1093

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 141  tcttgcttgcttgcttgcttg 161
            |||||||||||||||||||||
Sbjct: 1010 tcttgcttgcttgcttgcttg 1030



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 1019 cttgcttgcttgcttgcttg 1038



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 1015 cttgcttgcttgcttgcttg 1034



to top

>gb|AC165380.3| Colobus guereza clone CH272-85C5, complete sequence
          Length = 199248

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 65504 tcttgcttgcttgcttgcttg 65484



to top

>gb|AC121309.10| Mus musculus chromosome 3, clone RP24-303N8, complete sequence
          Length = 179337

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 31422 tcttgcttgcttgcttgcttg 31402



to top

>gb|AC124659.10| Mus musculus chromosome 15, clone RP24-167K18, complete sequence
          Length = 180859

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 137   gttatcttgcttgcttgcttgcttg 161
             |||| ||||||||||||||||||||
Sbjct: 92162 gttaacttgcttgcttgcttgcttg 92186



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 92203 cttgcttgcttgcttgcttg 92222



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 92199 cttgcttgcttgcttgcttg 92218



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 92195 cttgcttgcttgcttgcttg 92214



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 92191 cttgcttgcttgcttgcttg 92210



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 92187 cttgcttgcttgcttgcttg 92206



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 92183 cttgcttgcttgcttgcttg 92202



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 92179 cttgcttgcttgcttgcttg 92198



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 92175 cttgcttgcttgcttgcttg 92194



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 92171 cttgcttgcttgcttgcttg 92190



to top

>gb|AC100180.12| Mus musculus chromosome 1, clone RP23-53J14, complete sequence
          Length = 188055

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 15983 cttgcttgcttgcttgcttgg 16003



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 15979 cttgcttgcttgcttgcttg 15998



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 15975 cttgcttgcttgcttgcttg 15994



to top

>gb|AC117682.11| Mus musculus chromosome 1, clone RP23-436K7, complete sequence
          Length = 212395

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 197238 tcttgcttgcttgcttgcttg 197218



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 197233 cttgcttgcttgcttgcttg 197214



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 197229 cttgcttgcttgcttgcttg 197210



to top

>gb|AF073777.1| Neisseria meningitidis arginyl-tRNA-synthetase (argS) gene,
           tetranucleotide repeat associated locus (rep1) gene,
           partial cds
          Length = 1765

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 142 cttgcttgcttgcttgcttgg 162
           |||||||||||||||||||||
Sbjct: 644 cttgcttgcttgcttgcttgg 624



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 668 cttgcttgcttgcttgcttg 649



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 664 cttgcttgcttgcttgcttg 645



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 660 cttgcttgcttgcttgcttg 641



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 656 cttgcttgcttgcttgcttg 637



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 652 cttgcttgcttgcttgcttg 633



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 648 cttgcttgcttgcttgcttg 629



to top

>gb|AF236328.1| Chondropython viridis microsatellite MV1009 sequence
          Length = 285

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 141 tcttgcttgcttgcttgcttg 161
           |||||||||||||||||||||
Sbjct: 93  tcttgcttgcttgcttgcttg 73



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 88  cttgcttgcttgcttgcttg 69



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 84  cttgcttgcttgcttgcttg 65



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 80  cttgcttgcttgcttgcttg 61



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 76  cttgcttgcttgcttgcttg 57



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 72  cttgcttgcttgcttgcttg 53



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 68  cttgcttgcttgcttgcttg 49



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 64  cttgcttgcttgcttgcttg 45



to top

>gb|AF236327.1| Chondropython viridis microsatellite MV1008 sequence
          Length = 309

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 141 tcttgcttgcttgcttgcttg 161
           |||||||||||||||||||||
Sbjct: 113 tcttgcttgcttgcttgcttg 93



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 108 cttgcttgcttgcttgcttg 89



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 104 cttgcttgcttgcttgcttg 85



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 100 cttgcttgcttgcttgcttg 81



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 96  cttgcttgcttgcttgcttg 77



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 92  cttgcttgcttgcttgcttg 73



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 88  cttgcttgcttgcttgcttg 69



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 84  cttgcttgcttgcttgcttg 65



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 80  cttgcttgcttgcttgcttg 61



to top

>gb|AF236326.1| Chondropython viridis microsatellite MV1007 sequence
          Length = 313

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 141 tcttgcttgcttgcttgcttg 161
           |||||||||||||||||||||
Sbjct: 113 tcttgcttgcttgcttgcttg 93



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 108 cttgcttgcttgcttgcttg 89



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 104 cttgcttgcttgcttgcttg 85



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 100 cttgcttgcttgcttgcttg 81



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 96  cttgcttgcttgcttgcttg 77



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 92  cttgcttgcttgcttgcttg 73



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 88  cttgcttgcttgcttgcttg 69



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 84  cttgcttgcttgcttgcttg 65



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 80  cttgcttgcttgcttgcttg 61



to top

>gb|AF236325.1| Chondropython viridis microsatellite MV1006 sequence
          Length = 317

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 141 tcttgcttgcttgcttgcttg 161
           |||||||||||||||||||||
Sbjct: 89  tcttgcttgcttgcttgcttg 69



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 84  cttgcttgcttgcttgcttg 65



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 80  cttgcttgcttgcttgcttg 61



to top

>gb|AF236324.1| Chondropython viridis microsatellite MV1005 sequence
          Length = 321

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 141 tcttgcttgcttgcttgcttg 161
           |||||||||||||||||||||
Sbjct: 121 tcttgcttgcttgcttgcttg 101



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 116 cttgcttgcttgcttgcttg 97



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 112 cttgcttgcttgcttgcttg 93



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 108 cttgcttgcttgcttgcttg 89



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 104 cttgcttgcttgcttgcttg 85



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 100 cttgcttgcttgcttgcttg 81



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 96  cttgcttgcttgcttgcttg 77



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 92  cttgcttgcttgcttgcttg 73



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 88  cttgcttgcttgcttgcttg 69



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 84  cttgcttgcttgcttgcttg 65



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 80  cttgcttgcttgcttgcttg 61



to top

>gb|AF236323.1| Chondropython viridis microsatellite MV1004 sequence
          Length = 349

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 141 tcttgcttgcttgcttgcttg 161
           |||||||||||||||||||||
Sbjct: 121 tcttgcttgcttgcttgcttg 101



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 116 cttgcttgcttgcttgcttg 97



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 112 cttgcttgcttgcttgcttg 93



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 108 cttgcttgcttgcttgcttg 89



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 104 cttgcttgcttgcttgcttg 85



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 100 cttgcttgcttgcttgcttg 81



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 96  cttgcttgcttgcttgcttg 77



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 92  cttgcttgcttgcttgcttg 73



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 88  cttgcttgcttgcttgcttg 69



to top

>gb|AF236322.1| Chondropython viridis microsatellite MV1003 sequence
          Length = 357

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 141 tcttgcttgcttgcttgcttg 161
           |||||||||||||||||||||
Sbjct: 121 tcttgcttgcttgcttgcttg 101



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 116 cttgcttgcttgcttgcttg 97



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 112 cttgcttgcttgcttgcttg 93



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 108 cttgcttgcttgcttgcttg 89



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 104 cttgcttgcttgcttgcttg 85



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 100 cttgcttgcttgcttgcttg 81



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 96  cttgcttgcttgcttgcttg 77



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 92  cttgcttgcttgcttgcttg 73



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 88  cttgcttgcttgcttgcttg 69



to top

>gb|AF236321.1| Chondropython viridis microsatellite MV1002 sequence
          Length = 369

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 141 tcttgcttgcttgcttgcttg 161
           |||||||||||||||||||||
Sbjct: 125 tcttgcttgcttgcttgcttg 105



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 120 cttgcttgcttgcttgcttg 101



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 116 cttgcttgcttgcttgcttg 97



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 112 cttgcttgcttgcttgcttg 93



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 108 cttgcttgcttgcttgcttg 89



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 104 cttgcttgcttgcttgcttg 85



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 100 cttgcttgcttgcttgcttg 81



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 96  cttgcttgcttgcttgcttg 77



to top

>gb|AF236320.1| Chondropython viridis microsatellite MV1001 sequence
          Length = 312

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 141 tcttgcttgcttgcttgcttg 161
           |||||||||||||||||||||
Sbjct: 113 tcttgcttgcttgcttgcttg 93



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 108 cttgcttgcttgcttgcttg 89



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 104 cttgcttgcttgcttgcttg 85



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 100 cttgcttgcttgcttgcttg 81



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 96  cttgcttgcttgcttgcttg 77



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 92  cttgcttgcttgcttgcttg 73



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 88  cttgcttgcttgcttgcttg 69



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 cttgcttgcttgcttgcttg 161
           ||||||||||||||||||||
Sbjct: 84  cttgcttgcttgcttgcttg 65



to top

>gb|AC005742.1| Mus musculus chromosome 11, BAC clone CT7-111I18 (LBNL M01), complete
             sequence
          Length = 159500

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 86453 tcttgcttgcttgcttgcttg 86473



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 86470 cttgcttgcttgcttgcttg 86489



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 86466 cttgcttgcttgcttgcttg 86485



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 86462 cttgcttgcttgcttgcttg 86481



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 86458 cttgcttgcttgcttgcttg 86477



to top

>gb|AC158141.8| Mus musculus chromosome 5, clone RP23-281M20, complete sequence
          Length = 220396

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 219669 cttgcttgcttgcttgcttgg 219649



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 219697 cttgcttgcttgcttgcttg 219678



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 219693 cttgcttgcttgcttgcttg 219674



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 219689 cttgcttgcttgcttgcttg 219670



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 219685 cttgcttgcttgcttgcttg 219666



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 219681 cttgcttgcttgcttgcttg 219662



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 219677 cttgcttgcttgcttgcttg 219658



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 219673 cttgcttgcttgcttgcttg 219654



to top

>gb|AC121142.12| Mus musculus chromosome 10, clone RP23-479G23, complete sequence
          Length = 203838

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 10351 tcttgcttgcttgcttgcttg 10371



to top

>gb|AC102499.10| Mus musculus chromosome 1, clone RP24-151M13, complete sequence
          Length = 184760

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 25969 tcttgcttgcttgcttgcttg 25949



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 25936 cttgcttgcttgcttgcttg 25917



to top

>gb|AC119878.7| Mus musculus chromosome 3, clone RP24-329A3, complete sequence
          Length = 132644

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 46762 tcttgcttgcttgcttgcttg 46742



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 46757 cttgcttgcttgcttgcttg 46738



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 46753 cttgcttgcttgcttgcttg 46734



to top

>gb|AC161262.2| Mus musculus BAC clone RP23-325G1 from chromosome 9, complete sequence
          Length = 204750

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 124824 tcttgcttgcttgcttgcttg 124804



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 124819 cttgcttgcttgcttgcttg 124800



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 124815 cttgcttgcttgcttgcttg 124796



to top

>gb|AC161375.4| Mus musculus BAC clone RP23-297A22 from chromosome 14, complete
             sequence
          Length = 211662

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 19991 cttgcttgcttgcttgcttgg 19971



to top

>gb|AC159260.3| Mus musculus BAC clone RP24-85M18 from chromosome 3, complete sequence
          Length = 208348

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 59039 tcttgcttgcttgcttgcttg 59019



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 143   ttgcttgcttgcttgcttggg 163
             |||||||||||||||||||||
Sbjct: 13209 ttgcttgcttgcttgcttggg 13189



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59034 cttgcttgcttgcttgcttg 59015



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59030 cttgcttgcttgcttgcttg 59011



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59026 cttgcttgcttgcttgcttg 59007



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59022 cttgcttgcttgcttgcttg 59003



to top

>gb|AC154494.2| Mus musculus BAC clone RP24-111G24 from chromosome 9, complete sequence
          Length = 182959

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 27382 tcttgcttgcttgcttgcttg 27402



to top

>gb|AC165245.2| Mus musculus BAC clone RP24-376N22 from chromosome 9, complete sequence
          Length = 217074

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 56459 cttgcttgcttgcttgcttgg 56479



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56455 cttgcttgcttgcttgcttg 56474



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56451 cttgcttgcttgcttgcttg 56470



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56447 cttgcttgcttgcttgcttg 56466



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56443 cttgcttgcttgcttgcttg 56462



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56439 cttgcttgcttgcttgcttg 56458



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56435 cttgcttgcttgcttgcttg 56454



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56431 cttgcttgcttgcttgcttg 56450



to top

>gb|AC164096.3| Mus musculus BAC clone RP23-356H17 from chromosome 8, complete
            sequence
          Length = 229851

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 142  cttgcttgcttgcttgcttgg 162
            |||||||||||||||||||||
Sbjct: 2791 cttgcttgcttgcttgcttgg 2811



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 2787 cttgcttgcttgcttgcttg 2806



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 2783 cttgcttgcttgcttgcttg 2802



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 2779 cttgcttgcttgcttgcttg 2798



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 2775 cttgcttgcttgcttgcttg 2794



to top

>gb|AC102154.9| Mus musculus chromosome 1, clone RP23-333I7, complete sequence
          Length = 195954

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 143949 tcttgcttgcttgcttgcttg 143929



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 143944 cttgcttgcttgcttgcttg 143925



to top

>gb|AC151486.1| Pan troglodytes chromosome X clone PTB-029D14 map human ortholog q28,
             complete sequence
          Length = 154019

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 76897 tcttgcttgcttgcttgcttg 76877



to top

>gb|AC120863.9| Mus musculus chromosome 7, clone RP23-84H3, complete sequence
          Length = 241742

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 110768 cttgcttgcttgcttgcttgg 110748



to top

>gb|AC131079.11| Mus musculus chromosome 14, clone RP23-434L17, complete sequence
          Length = 203276

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 135973 tcttgcttgcttgcttgcttg 135953



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 135960 cttgcttgcttgcttgcttgg 135940



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 135968 cttgcttgcttgcttgcttg 135949



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 135964 cttgcttgcttgcttgcttg 135945



to top

>gb|AC133457.6| Mus musculus chromosome 3, clone RP24-493E2, complete sequence
          Length = 169824

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 88494 cttgcttgcttgcttgcttgg 88474



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 88510 cttgcttgcttgcttgcttg 88491



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 88506 cttgcttgcttgcttgcttg 88487



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 88502 cttgcttgcttgcttgcttg 88483



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 88498 cttgcttgcttgcttgcttg 88479



to top

>gb|S42568.1| ribulose-1,5-bisphosphate carboxylase small subunit {5' region,
           clone rbcSZm3} [corn, Genomic, 541 nt]
          Length = 541

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 144 tgcttgcttgcttgcttgggt 164
           |||||||||||||||||||||
Sbjct: 478 tgcttgcttgcttgcttgggt 458



to top

>gb|AC129162.5| Rattus norvegicus 9 BAC CH230-108L13 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 245677

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 181152 tcttgcttgcttgcttgcttg 181172



to top

>gb|AC138290.9| Mus musculus chromosome 10, clone RP23-245C15, complete sequence
          Length = 151470

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 76971 tcttgcttgcttgcttgcttg 76991



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76992 cttgcttgcttgcttgcttg 77011



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76988 cttgcttgcttgcttgcttg 77007



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76984 cttgcttgcttgcttgcttg 77003



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76980 cttgcttgcttgcttgcttg 76999



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76976 cttgcttgcttgcttgcttg 76995



to top

>gb|AC102229.7| Mus musculus chromosome 15, clone RP24-70F9, complete sequence
          Length = 202156

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 43038 tcttgcttgcttgcttgcttg 43018



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 43033 cttgcttgcttgcttgcttg 43014



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 43029 cttgcttgcttgcttgcttg 43010



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 43025 cttgcttgcttgcttgcttg 43006



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 43021 cttgcttgcttgcttgcttg 43002



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 43017 cttgcttgcttgcttgcttg 42998



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 43013 cttgcttgcttgcttgcttg 42994



to top

>gb|AC135568.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
            OSJNBa0078F08, complete sequence
          Length = 165440

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 193  gcggagaggcgggcggaggaggcgg 217
            ||||||||||||| |||||||||||
Sbjct: 6322 gcggagaggcgggaggaggaggcgg 6298



to top

>gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, complete sequence
          Length = 152414

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 106717 cttgcttgcttgcttgcttgg 106697



to top

>gb|AC119982.6| Mus musculus chromosome 19, clone RP24-498L9, complete sequence
          Length = 177924

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 142   cttgcttgcttgcttgcttgggttg 166
             |||||||||||||||||||| ||||
Sbjct: 90237 cttgcttgcttgcttgcttgtgttg 90261



to top

>gb|AC120002.24| Mus musculus chromosome 12, clone RP24-147D14, complete sequence
          Length = 179305

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 109716 tcttgcttgcttgcttgcttg 109696



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109711 cttgcttgcttgcttgcttg 109692



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109707 cttgcttgcttgcttgcttg 109688



to top

>gb|AC106830.11| Mus musculus chromosome 15, clone RP24-402C20, complete sequence
          Length = 171577

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 71037 cttgcttgcttgcttgcttgg 71017



to top

>gb|AC114674.10| Mus musculus chromosome 9, clone RP24-209N21, complete sequence
          Length = 203120

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 119996 tcttgcttgcttgcttgcttg 120016



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 120009 cttgcttgcttgcttgcttg 120028



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 120005 cttgcttgcttgcttgcttg 120024



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 120001 cttgcttgcttgcttgcttg 120020



to top

>gb|AC141477.4| Mus musculus BAC clone RP23-386J14 from chromosome 10, complete sequence
          Length = 213720

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 164799 tcttgcttgcttgcttgcttg 164779



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 164794 cttgcttgcttgcttgcttg 164775



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 91229 cttgcttgcttgcttgcttg 91210



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 91225 cttgcttgcttgcttgcttg 91206



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 91221 cttgcttgcttgcttgcttg 91202



to top

>gb|AC183761.3| Pan troglodytes BAC clone CH251-710C5 from chromosome 7, complete
              sequence
          Length = 205916

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 114085 tcttgcttgcttgcttgcttg 114065



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 187692 cttgcttgcttgcttgcttg 187673



to top

>ref|XM_322511.1| Neurospora crassa OR74A hypothetical protein (NCU00426.1) partial
            mRNA
          Length = 1080

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 327  ccccctccccgccgacatcatcccc 351
            ||||||||||||| |||||||||||
Sbjct: 1060 ccccctccccgcccacatcatcccc 1036



to top

>gb|AC146241.4| Pan troglodytes BAC clone RP43-31L17 from 7, complete sequence
          Length = 160620

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 41546 tcttgcttgcttgcttgcttg 41566



to top

>ref|XM_951597.1| Neurospora crassa OR74A hypothetical protein (NCU00426.1) partial
            mRNA
          Length = 1080

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 327  ccccctccccgccgacatcatcccc 351
            ||||||||||||| |||||||||||
Sbjct: 1060 ccccctccccgcccacatcatcccc 1036



to top

>gb|AC168278.2| Mus musculus  BAC RP24-83C9 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 247493

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 51552 tcttgcttgcttgcttgcttg 51572



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 51557 cttgcttgcttgcttgcttg 51576



to top

>gb|AC148472.1| Pan troglodytes fosmid clone CH1251-124C12 from Y, complete sequence
          Length = 33310

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 30485 tcttgcttgcttgcttgcttg 30465



to top

>gb|AC141647.3| Mus musculus BAC clone RP23-64E12 from chromosome 10, complete sequence
          Length = 217745

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 130668 tcttgcttgcttgcttgcttg 130688



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 130685 cttgcttgcttgcttgcttg 130704



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 130681 cttgcttgcttgcttgcttg 130700



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 130677 cttgcttgcttgcttgcttg 130696



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 130673 cttgcttgcttgcttgcttg 130692



to top

>gb|AC145589.3| Mus musculus BAC clone RP24-174M10 from chromosome Y, complete sequence
          Length = 152506

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 140259 tcttgcttgcttgcttgcttg 140239



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140254 cttgcttgcttgcttgcttg 140235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140250 cttgcttgcttgcttgcttg 140231



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140246 cttgcttgcttgcttgcttg 140227



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140242 cttgcttgcttgcttgcttg 140223



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140238 cttgcttgcttgcttgcttg 140219



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140234 cttgcttgcttgcttgcttg 140215



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140230 cttgcttgcttgcttgcttg 140211



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140226 cttgcttgcttgcttgcttg 140207



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140222 cttgcttgcttgcttgcttg 140203



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140218 cttgcttgcttgcttgcttg 140199



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140214 cttgcttgcttgcttgcttg 140195



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140210 cttgcttgcttgcttgcttg 140191



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140206 cttgcttgcttgcttgcttg 140187



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140202 cttgcttgcttgcttgcttg 140183



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140198 cttgcttgcttgcttgcttg 140179



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 140194 cttgcttgcttgcttgcttg 140175



to top

>gb|AC132307.5| Mus musculus BAC clone RP24-291H9 from chromosome 18, complete sequence
          Length = 179465

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 142703 cttgcttgcttgcttgcttgg 142683



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 142655 cttgcttgcttgcttgcttgg 142635



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 142711 cttgcttgcttgcttgcttg 142692



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 142707 cttgcttgcttgcttgcttg 142688



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 142663 cttgcttgcttgcttgcttg 142644



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 142659 cttgcttgcttgcttgcttg 142640



to top

>gb|AC147621.3| Mus musculus BAC clone RP24-315M14 from chromosome Y, complete sequence
          Length = 166529

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 33085 tcttgcttgcttgcttgcttg 33065



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33080 cttgcttgcttgcttgcttg 33061



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33076 cttgcttgcttgcttgcttg 33057



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33072 cttgcttgcttgcttgcttg 33053



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33068 cttgcttgcttgcttgcttg 33049



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33064 cttgcttgcttgcttgcttg 33045



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33060 cttgcttgcttgcttgcttg 33041



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33056 cttgcttgcttgcttgcttg 33037



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33052 cttgcttgcttgcttgcttg 33033



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33048 cttgcttgcttgcttgcttg 33029



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33044 cttgcttgcttgcttgcttg 33025



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33040 cttgcttgcttgcttgcttg 33021



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33036 cttgcttgcttgcttgcttg 33017



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33032 cttgcttgcttgcttgcttg 33013



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33028 cttgcttgcttgcttgcttg 33009



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33024 cttgcttgcttgcttgcttg 33005



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 33020 cttgcttgcttgcttgcttg 33001



to top

>gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosome 16, complete
             sequence
          Length = 198296

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 45357 cttgcttgcttgcttgcttgg 45377



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 45353 cttgcttgcttgcttgcttg 45372



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 45349 cttgcttgcttgcttgcttg 45368



to top

>gb|AC140223.3| Mus musculus BAC clone RP24-477G22 from chromosome Y, complete sequence
          Length = 189728

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 93668 tcttgcttgcttgcttgcttg 93648



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93663 cttgcttgcttgcttgcttg 93644



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93659 cttgcttgcttgcttgcttg 93640



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93655 cttgcttgcttgcttgcttg 93636



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93651 cttgcttgcttgcttgcttg 93632



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93647 cttgcttgcttgcttgcttg 93628



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93643 cttgcttgcttgcttgcttg 93624



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93639 cttgcttgcttgcttgcttg 93620



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93635 cttgcttgcttgcttgcttg 93616



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93631 cttgcttgcttgcttgcttg 93612



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93627 cttgcttgcttgcttgcttg 93608



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93623 cttgcttgcttgcttgcttg 93604



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 93619 cttgcttgcttgcttgcttg 93600



to top

>gb|AC131694.4| Mus musculus BAC clone RP23-393L24 from chromosome 6, complete sequence
          Length = 187925

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 77693 tcttgcttgcttgcttgcttg 77673



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 77688 cttgcttgcttgcttgcttg 77669



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 77684 cttgcttgcttgcttgcttg 77665



to top

>gb|AC134458.2| Mus musculus BAC clone RP23-358B17 from chromosome 18, complete
             sequence
          Length = 179314

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 95215 cttgcttgcttgcttgcttgg 95235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95211 cttgcttgcttgcttgcttg 95230



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95207 cttgcttgcttgcttgcttg 95226



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95203 cttgcttgcttgcttgcttg 95222



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95199 cttgcttgcttgcttgcttg 95218



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95195 cttgcttgcttgcttgcttg 95214



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95191 cttgcttgcttgcttgcttg 95210



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95187 cttgcttgcttgcttgcttg 95206



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95183 cttgcttgcttgcttgcttg 95202



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95179 cttgcttgcttgcttgcttg 95198



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95175 cttgcttgcttgcttgcttg 95194



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95147 cttgcttgcttgcttgcttg 95166



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95143 cttgcttgcttgcttgcttg 95162



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95139 cttgcttgcttgcttgcttg 95158



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95135 cttgcttgcttgcttgcttg 95154



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95131 cttgcttgcttgcttgcttg 95150



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 95127 cttgcttgcttgcttgcttg 95146



to top

>gb|AC102135.12| Mus musculus chromosome 18, clone RP23-253J5, complete sequence
          Length = 204286

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 155416 cttgcttgcttgcttgcttgg 155436



to top

>gb|AC158794.4| Mus musculus chromosome 1, clone RP23-306I10, complete sequence
          Length = 239904

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 51449 cttgcttgcttgcttgcttgg 51429



to top

>gb|AC126421.12| Mus musculus chromosome 1, clone RP23-167H24, complete sequence
          Length = 218458

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 142  cttgcttgcttgcttgcttgg 162
            |||||||||||||||||||||
Sbjct: 1280 cttgcttgcttgcttgcttgg 1260



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 1296 cttgcttgcttgcttgcttg 1277



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 1292 cttgcttgcttgcttgcttg 1273



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 1288 cttgcttgcttgcttgcttg 1269



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 1284 cttgcttgcttgcttgcttg 1265



to top

>gb|AC158652.5| Mus musculus 6 BAC RP23-238I17 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 217046

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 176311 cttgcttgcttgcttgcttgg 176331



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 176307 cttgcttgcttgcttgcttg 176326



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 176303 cttgcttgcttgcttgcttg 176322



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 176299 cttgcttgcttgcttgcttg 176318



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 176295 cttgcttgcttgcttgcttg 176314



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 176291 cttgcttgcttgcttgcttg 176310



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 176287 cttgcttgcttgcttgcttg 176306



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 176283 cttgcttgcttgcttgcttg 176302



to top

>gb|AC110566.17| Mus musculus chromosome 5, clone RP23-300A10, complete sequence
          Length = 175471

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 56870 tcttgcttgcttgcttgcttg 56850



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 151     ttgcttgcttgggttgggttg 171
               |||||||||||||||||||||
Sbjct: 1966271 ttgcttgcttgggttgggttg 1966251



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 142      cttgcttgcttgcttgcttg 161
                ||||||||||||||||||||
Sbjct: 34800362 cttgcttgcttgcttgcttg 34800343



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 141     tcttgcttgcttgcttgctt 160
               ||||||||||||||||||||
Sbjct: 7322855 tcttgcttgcttgcttgctt 7322836



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 259     gggttccggttccggcccaccgacgaggagct 290
               |||||| ||||||  |||||||||||||||||
Sbjct: 1511286 gggttcaggttccaccccaccgacgaggagct 1511255



to top

>gb|AC166990.3| Mus musculus BAC clone RP24-173K24 from chromosome 12, complete
             sequence
          Length = 144985

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 10862 tcttgcttgcttgcttgcttg 10882



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 10867 cttgcttgcttgcttgcttg 10886



to top

>gb|AC121525.7| Mus musculus chromosome 5, clone RP23-359D12, complete sequence
          Length = 188700

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 80761 tcttgcttgcttgcttgcttg 80781



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 80770 cttgcttgcttgcttgcttg 80789



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 80766 cttgcttgcttgcttgcttg 80785



to top

>gb|AC125064.6| Mus musculus BAC clone RP23-430F7 from chromosome 14, complete sequence
          Length = 188477

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 82053 tcttgcttgcttgcttgcttg 82033



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 82048 cttgcttgcttgcttgcttg 82029



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 82044 cttgcttgcttgcttgcttg 82025



to top

>gb|AC160114.2| Mus musculus BAC clone RP24-70J8 from chromosome 13, complete sequence
          Length = 237699

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 197594 cttgcttgcttgcttgcttgg 197574



to top

>gb|AC158379.5| Mus musculus BAC clone RP24-497L12 from chromosome 5, complete sequence
          Length = 209526

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 36058 tcttgcttgcttgcttgcttg 36078



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 191138 cttgcttgcttgcttgcttg 191157



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 191134 cttgcttgcttgcttgcttg 191153



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 191130 cttgcttgcttgcttgcttg 191149



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 36071 cttgcttgcttgcttgcttg 36090



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 36067 cttgcttgcttgcttgcttg 36086



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 36063 cttgcttgcttgcttgcttg 36082



to top

>gb|AC163444.3| Mus musculus chromosome 1, clone RP23-85E22, complete sequence
          Length = 225533

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 43551 tcttgcttgcttgcttgcttg 43571



to top

>gb|AC114404.12| Mus musculus chromosome 7, clone RP24-350D24, complete sequence
          Length = 188585

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 29077 cttgcttgcttgcttgcttgg 29057



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 29097 cttgcttgcttgcttgcttg 29078



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 29093 cttgcttgcttgcttgcttg 29074



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 29089 cttgcttgcttgcttgcttg 29070



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 29085 cttgcttgcttgcttgcttg 29066



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 29081 cttgcttgcttgcttgcttg 29062



to top

>gb|BC031765.1| Mus musculus dickkopf homolog 2 (Xenopus laevis), mRNA (cDNA clone
            IMAGE:3483699), containing frame-shift errors
          Length = 1805

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 141  tcttgcttgcttgcttgcttg 161
            |||||||||||||||||||||
Sbjct: 1791 tcttgcttgcttgcttgcttg 1771



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 1786 cttgcttgcttgcttgcttg 1767



to top

>gb|AC137108.12| Mus musculus chromosome 9, clone RP23-277J20, complete sequence
          Length = 204108

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 76093 cttgcttgcttgcttgcttgg 76113



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 102150 cttgcttgcttgcttgcttg 102169



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 102146 cttgcttgcttgcttgcttg 102165



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76089 cttgcttgcttgcttgcttg 76108



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76085 cttgcttgcttgcttgcttg 76104



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76081 cttgcttgcttgcttgcttg 76100



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76077 cttgcttgcttgcttgcttg 76096



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76073 cttgcttgcttgcttgcttg 76092



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76069 cttgcttgcttgcttgcttg 76088



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76065 cttgcttgcttgcttgcttg 76084



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 76061 cttgcttgcttgcttgcttg 76080



to top

>gb|AC115357.5| Mus musculus BAC clone RP23-81J4 from chromosome 14, complete sequence
          Length = 233685

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 59380 cttgcttgcttgcttgcttgg 59360



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59404 cttgcttgcttgcttgcttg 59385



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59400 cttgcttgcttgcttgcttg 59381



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59396 cttgcttgcttgcttgcttg 59377



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59392 cttgcttgcttgcttgcttg 59373



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59388 cttgcttgcttgcttgcttg 59369



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59384 cttgcttgcttgcttgcttg 59365



to top

>gb|AC123038.3| Mus musculus BAC clone RP24-527G2 from chromosome 3, complete sequence
          Length = 144150

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 133   cagagttatcttgcttgcttgcttgcttg 161
             |||||||  ||||||||||||||||||||
Sbjct: 60853 cagagtttgcttgcttgcttgcttgcttg 60825



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 60840 cttgcttgcttgcttgcttg 60821



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 60836 cttgcttgcttgcttgcttg 60817



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 60832 cttgcttgcttgcttgcttg 60813



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 60828 cttgcttgcttgcttgcttg 60809



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 60824 cttgcttgcttgcttgcttg 60805



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 60820 cttgcttgcttgcttgcttg 60801



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 60816 cttgcttgcttgcttgcttg 60797



to top

>gb|AC133089.4| Mus musculus BAC clone RP24-165M3 from chromosome 19, complete sequence
          Length = 149637

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 20098 tcttgcttgcttgcttgcttg 20118



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 89774 cttgcttgcttgcttgcttg 89793



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 89770 cttgcttgcttgcttgcttg 89789



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 89766 cttgcttgcttgcttgcttg 89785



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 89762 cttgcttgcttgcttgcttg 89781



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 89758 cttgcttgcttgcttgcttg 89777



to top

>gb|AC113244.19| Mus musculus chromosome 19, clone RP23-172E2, complete sequence
          Length = 224351

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 37048 tcttgcttgcttgcttgcttg 37068



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 37073 cttgcttgcttgcttgcttg 37092



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 37069 cttgcttgcttgcttgcttg 37088



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 37065 cttgcttgcttgcttgcttg 37084



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 37061 cttgcttgcttgcttgcttg 37080



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 37057 cttgcttgcttgcttgcttg 37076



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 37053 cttgcttgcttgcttgcttg 37072



to top

>gb|AC102087.12| Mus musculus chromosome 13, clone RP23-166D15, complete sequence
          Length = 221034

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 200165 cttgcttgcttgcttgcttgg 200145



to top

>ref|XM_853349.1| PREDICTED: Canis familiaris similar to calcium binding protein P22,
            transcript variant 6 (LOC478264), mRNA
          Length = 2686

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 142  cttgcttgcttgcttgcttgg 162
            |||||||||||||||||||||
Sbjct: 2260 cttgcttgcttgcttgcttgg 2280



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 2256 cttgcttgcttgcttgcttg 2275



to top

>ref|XM_853310.1| PREDICTED: Canis familiaris similar to calcium binding protein P22,
            transcript variant 5 (LOC478264), mRNA
          Length = 2679

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 142  cttgcttgcttgcttgcttgg 162
            |||||||||||||||||||||
Sbjct: 2253 cttgcttgcttgcttgcttgg 2273



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 2249 cttgcttgcttgcttgcttg 2268



to top

>ref|XM_853271.1| PREDICTED: Canis familiaris similar to calcium binding protein P22,
            transcript variant 4 (LOC478264), mRNA
          Length = 2526

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 142  cttgcttgcttgcttgcttgg 162
            |||||||||||||||||||||
Sbjct: 2100 cttgcttgcttgcttgcttgg 2120



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 2096 cttgcttgcttgcttgcttg 2115



to top

>ref|XM_853230.1| PREDICTED: Canis familiaris similar to calcium binding protein P22,
            transcript variant 3 (LOC478264), mRNA
          Length = 2633

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 142  cttgcttgcttgcttgcttgg 162
            |||||||||||||||||||||
Sbjct: 2207 cttgcttgcttgcttgcttgg 2227



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 2203 cttgcttgcttgcttgcttg 2222



to top

>ref|XM_853191.1| PREDICTED: Canis familiaris similar to calcium binding protein P22,
            transcript variant 2 (LOC478264), mRNA
          Length = 2419

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 142  cttgcttgcttgcttgcttgg 162
            |||||||||||||||||||||
Sbjct: 1993 cttgcttgcttgcttgcttgg 2013



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 1989 cttgcttgcttgcttgcttg 2008



to top

>ref|XM_535438.2| PREDICTED: Canis familiaris similar to calcium binding protein P22,
            transcript variant 1 (LOC478264), mRNA
          Length = 2780

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 142  cttgcttgcttgcttgcttgg 162
            |||||||||||||||||||||
Sbjct: 2354 cttgcttgcttgcttgcttgg 2374



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 2350 cttgcttgcttgcttgcttg 2369



to top

>gb|AC004905.2| Homo sapiens PAC clone RP5-845I21 from 7, complete sequence
          Length = 134350

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 10991 tcttgcttgcttgcttgcttg 11011



to top

>gb|AC117686.10| Mus musculus chromosome 16, clone RP23-440B15, complete sequence
          Length = 210851

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 21820 tcttgcttgcttgcttgcttg 21800



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 21815 cttgcttgcttgcttgcttg 21796



to top

>gb|AC126217.3| Rattus norvegicus 1 BAC CH230-9L4 (Children's Hospital Oakland Research
             Institute) complete sequence
          Length = 243051

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 137   gttatcttgcttgcttgcttgcttg 161
             |||| ||||||||||||||||||||
Sbjct: 59139 gttagcttgcttgcttgcttgcttg 59163



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 94394 cttgcttgcttgcttgcttg 94413



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 94390 cttgcttgcttgcttgcttg 94409



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 94386 cttgcttgcttgcttgcttg 94405



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59176 cttgcttgcttgcttgcttg 59195



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59172 cttgcttgcttgcttgcttg 59191



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59168 cttgcttgcttgcttgcttg 59187



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59164 cttgcttgcttgcttgcttg 59183



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59160 cttgcttgcttgcttgcttg 59179



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59156 cttgcttgcttgcttgcttg 59175



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59152 cttgcttgcttgcttgcttg 59171



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 59148 cttgcttgcttgcttgcttg 59167



to top

>gb|AC127317.3| Mus musculus BAC clone RP23-227H18 from chromosome 7, complete sequence
          Length = 180376

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 86321 cttgcttgcttgcttgcttgg 86301



to top

>emb|CR759954.9| Human DNA sequence from clone DAAP-101P24 on chromosome 6, complete
             sequence
          Length = 94061

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 28361 tcttgcttgcttgcttgcttg 28341



to top

>emb|CT009734.9| Mouse DNA sequence from clone RP23-182E3 on chromosome 14, complete
              sequence
          Length = 202398

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 109850 tcttgcttgcttgcttgcttg 109830



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109845 cttgcttgcttgcttgcttg 109826



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 109841 cttgcttgcttgcttgcttg 109822



to top

>emb|CR974429.7| Mouse DNA sequence from clone RP23-177B9 on chromosome 12, complete
             sequence
          Length = 212593

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 41788 cttgcttgcttgcttgcttgg 41808



to top

>emb|AJ833968.1| Zea mays partial mRNA for hypothetical protein (cuc3 gene), and 3'
           UTR
          Length = 1300

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 259 gggttccggttccggcccaccgacgaggagctg 291
           ||||| |||||||  ||||||||||||||||||
Sbjct: 37  gggtttcggttccaccccaccgacgaggagctg 69



to top

>emb|CT009719.10| Mouse DNA sequence from clone RP23-65P17 on chromosome 17, complete
             sequence
          Length = 205369

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 69981 tcttgcttgcttgcttgcttg 69961



to top

>emb|CR974427.5| Mouse DNA sequence from clone RP24-319N23 on chromosome 17, complete
              sequence
          Length = 180395

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 178628 tcttgcttgcttgcttgcttg 178608



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 178623 cttgcttgcttgcttgcttg 178604



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 178619 cttgcttgcttgcttgcttg 178600



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 178615 cttgcttgcttgcttgcttg 178596



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 178611 cttgcttgcttgcttgcttg 178592



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 178607 cttgcttgcttgcttgcttg 178588



to top

>gb|AC137749.11| Mus musculus chromosome 6, clone RP23-69C16, complete sequence
          Length = 293695

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 196838 cttgcttgcttgcttgcttgg 196858



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 196834 cttgcttgcttgcttgcttg 196853



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 196830 cttgcttgcttgcttgcttg 196849



to top

>emb|CT010430.6| Mouse DNA sequence from clone RP23-335P18 on chromosome 17, complete
              sequence
          Length = 156683

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 115273 tcttgcttgcttgcttgcttg 115253



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 115268 cttgcttgcttgcttgcttgg 115248



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 115300 cttgcttgcttgcttgcttg 115281



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 115296 cttgcttgcttgcttgcttg 115277



to top

>emb|CR974434.12| Pig DNA sequence from clone CH242-241E19 on chromosome 7, complete
              sequence
          Length = 186072

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 116727 tcttgcttgcttgcttgcttg 116747



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 116736 cttgcttgcttgcttgcttg 116755



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 116732 cttgcttgcttgcttgcttg 116751



to top

>gb|AC131757.3| Mus musculus BAC clone RP24-210I7 from chromosome 3, complete sequence
          Length = 161869

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 143   ttgcttgcttgcttgcttggg 163
             |||||||||||||||||||||
Sbjct: 75081 ttgcttgcttgcttgcttggg 75101



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 29251 tcttgcttgcttgcttgcttg 29271



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 29268 cttgcttgcttgcttgcttg 29287



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 29264 cttgcttgcttgcttgcttg 29283



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 29260 cttgcttgcttgcttgcttg 29279



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 29256 cttgcttgcttgcttgcttg 29275



to top

>gb|AC132367.3| Mus musculus BAC clone RP23-465K21 from chromosome 17, complete sequence
          Length = 192971

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 181585 tcttgcttgcttgcttgcttg 181565



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 181580 cttgcttgcttgcttgcttg 181561



to top

>gb|AC126668.3| Mus musculus BAC clone RP24-370N20 from chromosome 7, complete sequence
          Length = 179246

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 86562 tcttgcttgcttgcttgcttg 86542



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 56047 cttgcttgcttgcttgcttgg 56067



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 86557 cttgcttgcttgcttgcttg 86538



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 86553 cttgcttgcttgcttgcttg 86534



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 86529 cttgcttgcttgcttgcttg 86510



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 86525 cttgcttgcttgcttgcttg 86506



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56043 cttgcttgcttgcttgcttg 56062



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56039 cttgcttgcttgcttgcttg 56058



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56035 cttgcttgcttgcttgcttg 56054



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56031 cttgcttgcttgcttgcttg 56050



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 56027 cttgcttgcttgcttgcttg 56046



to top

>gb|AC134323.3| Mus musculus BAC clone RP24-512P7 from chromosome 8, complete sequence
          Length = 176667

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 44888 tcttgcttgcttgcttgcttg 44908



to top

>gb|AC129019.4| Mus musculus BAC clone RP24-541L1 from chromosome 13, complete sequence
          Length = 190792

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 35026 cttgcttgcttgcttgcttgg 35006



to top

>gb|AC122184.4| Mus musculus BAC clone RP23-16C12 from chromosome 7, complete sequence
          Length = 222122

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 195437 tcttgcttgcttgcttgcttg 195417



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 195432 cttgcttgcttgcttgcttg 195413



to top

>gb|AC129020.4| Mus musculus BAC clone RP23-234A5 from chromosome 16, complete sequence
          Length = 192668

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 84396 tcttgcttgcttgcttgcttg 84376



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 84391 cttgcttgcttgcttgcttg 84372



to top

>gb|AC122809.4| Mus musculus BAC clone RP23-272E5 from chromosome 7, complete sequence
          Length = 205725

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 169327 tcttgcttgcttgcttgcttg 169347



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 169332 cttgcttgcttgcttgcttg 169351



to top

>gb|AC129601.4| Mus musculus BAC clone RP23-444N1 from chromosome 16, complete sequence
          Length = 173054

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 150705 tcttgcttgcttgcttgcttg 150685



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 150700 cttgcttgcttgcttgcttg 150681



to top

>gb|AC002331.1|HUAC002331 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-A-218C7, complete
             sequence
          Length = 139480

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 49350 tcttgcttgcttgcttgcttg 49330



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 49345 cttgcttgcttgcttgcttg 49326



to top

>gb|AC125316.4| Mus musculus BAC clone RP24-250N3 from chromosome 3, complete sequence
          Length = 138128

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 72140 tcttgcttgcttgcttgcttg 72120



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 72135 cttgcttgcttgcttgcttg 72116



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 72131 cttgcttgcttgcttgcttg 72112



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 72127 cttgcttgcttgcttgcttg 72108



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 72123 cttgcttgcttgcttgcttg 72104



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 72119 cttgcttgcttgcttgcttg 72100



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 72115 cttgcttgcttgcttgcttg 72096



to top

>gb|AC125138.4| Mus musculus BAC clone RP24-324N8 from chromosome 5, complete sequence
          Length = 171978

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 128944 cttgcttgcttgcttgcttgg 128964



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128940 cttgcttgcttgcttgcttg 128959



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128936 cttgcttgcttgcttgcttg 128955



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128932 cttgcttgcttgcttgcttg 128951



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128928 cttgcttgcttgcttgcttg 128947



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128924 cttgcttgcttgcttgcttg 128943



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128920 cttgcttgcttgcttgcttg 128939



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 128916 cttgcttgcttgcttgcttg 128935



to top

>gb|AC127260.3| Mus musculus BAC clone RP24-315I3 from chromosome 3, complete sequence
          Length = 177195

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 170659 tcttgcttgcttgcttgcttg 170639



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 170654 cttgcttgcttgcttgcttg 170635



to top

>gb|AC127421.3| Mus musculus BAC clone RP24-314F1 from chromosome 18, complete sequence
          Length = 170221

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 117324 tcttgcttgcttgcttgcttg 117344



to top

>gb|AC124407.4| Mus musculus BAC clone RP24-389C22 from chromosome 10, complete sequence
          Length = 157929

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 151363 cttgcttgcttgcttgcttgg 151383



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 151359 cttgcttgcttgcttgcttg 151378



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 151355 cttgcttgcttgcttgcttg 151374



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 151351 cttgcttgcttgcttgcttg 151370



to top

>gb|AC117386.4| Homo sapiens 3 BAC RP11-167H9 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 184870

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 157850 tcttgcttgcttgcttgcttg 157870



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 157859 cttgcttgcttgcttgcttg 157878



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 157855 cttgcttgcttgcttgcttg 157874



to top

>gb|AC124366.4| Mus musculus BAC clone RP24-541E9 from chromosome 1, complete
           sequence
          Length = 166555

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 141 tcttgcttgcttgcttgcttg 161
           |||||||||||||||||||||
Sbjct: 948 tcttgcttgcttgcttgcttg 968



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 981  cttgcttgcttgcttgcttg 1000



to top

>gb|AC128661.3| Mus musculus BAC clone RP24-567N23 from chromosome 7, complete sequence
          Length = 151249

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 119353 cttgcttgcttgcttgcttgg 119373



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 119349 cttgcttgcttgcttgcttg 119368



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 119345 cttgcttgcttgcttgcttg 119364



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 119341 cttgcttgcttgcttgcttg 119360



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 119337 cttgcttgcttgcttgcttg 119356



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 119333 cttgcttgcttgcttgcttg 119352



to top

>gb|AC121982.3| Mus musculus BAC clone RP24-291D6 from chromosome 6, complete sequence
          Length = 167409

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 160111 tcttgcttgcttgcttgcttg 160131



to top

>gb|AC127254.3| Mus musculus BAC clone RP24-290D19 from chromosome 9, complete sequence
          Length = 187995

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 17120 cttgcttgcttgcttgcttgg 17140



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 17208 cttgcttgcttgcttgcttg 17227



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 17116 cttgcttgcttgcttgcttg 17135



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 17112 cttgcttgcttgcttgcttg 17131



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 17108 cttgcttgcttgcttgcttg 17127



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 17104 cttgcttgcttgcttgcttg 17123



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 17100 cttgcttgcttgcttgcttg 17119



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 17096 cttgcttgcttgcttgcttg 17115



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 17092 cttgcttgcttgcttgcttg 17111



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 17088 cttgcttgcttgcttgcttg 17107



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 17032 cttgcttgcttgcttgcttg 17051



to top

>gb|AC121967.3| Mus musculus BAC clone RP24-268P11 from chromosome 19, complete sequence
          Length = 185775

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 179414 tcttgcttgcttgcttgcttg 179434



to top

>gb|AC080158.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-311J12, complete
             sequence
          Length = 163722

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 26429 tcttgcttgcttgcttgcttg 26409



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 26424 cttgcttgcttgcttgcttg 26405



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 26420 cttgcttgcttgcttgcttg 26401



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 26416 cttgcttgcttgcttgcttg 26397



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 26412 cttgcttgcttgcttgcttg 26393



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 26408 cttgcttgcttgcttgcttg 26389



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 26404 cttgcttgcttgcttgcttg 26385



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 26400 cttgcttgcttgcttgcttg 26381



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 26396 cttgcttgcttgcttgcttg 26377



to top

>gb|AC125080.3| Mus musculus BAC clone RP24-68P23 from chromosome 16, complete sequence
          Length = 181087

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 89143 tcttgcttgcttgcttgcttg 89163



to top

>gb|AC122266.2| Mus musculus BAC clone RP23-213K18 from 8, complete sequence
          Length = 195246

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 158392 tcttgcttgcttgcttgcttg 158372



to top

>gb|AC125037.4| Mus musculus BAC clone RP23-332H20 from chromosome 3, complete sequence
          Length = 207842

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 100841 tcttgcttgcttgcttgcttg 100861



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 100846 cttgcttgcttgcttgcttg 100865



to top

>gb|AC125039.4| Mus musculus BAC clone RP23-335C3 from chromosome 6, complete sequence
          Length = 222535

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 216894 cttgcttgcttgcttgcttgg 216914



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 201003 cttgcttgcttgcttgcttg 200984



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 176001 cttgcttgcttgcttgcttg 176020



to top

>gb|AC132600.3| Mus musculus BAC clone RP24-134A5 from chromosome 3, complete sequence
          Length = 160339

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 13349 tcttgcttgcttgcttgcttg 13329



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 13344 cttgcttgcttgcttgcttg 13325



to top

>gb|AC104095.4| Mus musculus BAC clone RP23-403G12 from chromosome 19, complete
             sequence
          Length = 187859

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 93565 tcttgcttgcttgcttgcttg 93585



to top

>gb|AC121791.3| Mus musculus BAC clone RP23-401H19 from chromosome 14, complete
             sequence
          Length = 197720

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 99890 tcttgcttgcttgcttgcttg 99910



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99947 cttgcttgcttgcttgcttg 99966



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99943 cttgcttgcttgcttgcttg 99962



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99939 cttgcttgcttgcttgcttg 99958



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99935 cttgcttgcttgcttgcttg 99954



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99931 cttgcttgcttgcttgcttg 99950



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99927 cttgcttgcttgcttgcttg 99946



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99923 cttgcttgcttgcttgcttg 99942



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99919 cttgcttgcttgcttgcttg 99938



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99915 cttgcttgcttgcttgcttg 99934



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99911 cttgcttgcttgcttgcttg 99930



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99907 cttgcttgcttgcttgcttg 99926



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99903 cttgcttgcttgcttgcttg 99922



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99899 cttgcttgcttgcttgcttg 99918



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 99895 cttgcttgcttgcttgcttg 99914



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 87141 cttgcttgcttgcttgcttg 87160



to top

>gb|AE014308.1| Homo sapiens chromosome 13q34 schizophrenia region contig 1 section 5
             of 11 of the complete sequence
          Length = 250029

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 66060 tcttgcttgcttgcttgcttg 66080



to top

>gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-284P20, complete
              sequence
          Length = 203967

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 202155 tcttgcttgcttgcttgcttg 202135



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 158376 cttgcttgcttgcttgcttgg 158356



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 202150 cttgcttgcttgcttgcttg 202131



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 202146 cttgcttgcttgcttgcttg 202127



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 202142 cttgcttgcttgcttgcttg 202123



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 202138 cttgcttgcttgcttgcttg 202119



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 202134 cttgcttgcttgcttgcttg 202115



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 202130 cttgcttgcttgcttgcttg 202111



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 202126 cttgcttgcttgcttgcttg 202107



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 202122 cttgcttgcttgcttgcttg 202103



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 158380 cttgcttgcttgcttgcttg 158361



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 85284 cttgcttgcttgcttgcttg 85265



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 85280 cttgcttgcttgcttgcttg 85261



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 85276 cttgcttgcttgcttgcttg 85257



to top

>gb|AC116998.3| Mus musculus BAC clone RP23-16F6 from 18, complete sequence
          Length = 216959

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 108702 tcttgcttgcttgcttgcttg 108722



to top

>gb|AC122936.3| Mus musculus BAC clone RP23-20H6 from 5, complete sequence
          Length = 234064

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 142  cttgcttgcttgcttgcttgg 162
            |||||||||||||||||||||
Sbjct: 9965 cttgcttgcttgcttgcttgg 9985



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 9961 cttgcttgcttgcttgcttg 9980



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 9957 cttgcttgcttgcttgcttg 9976



to top

>gb|AC123058.3| Mus musculus BAC clone RP23-188J8 from 19, complete sequence
          Length = 194636

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 103273 tcttgcttgcttgcttgcttg 103293



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 186081 cttgcttgcttgcttgcttg 186100



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 186077 cttgcttgcttgcttgcttg 186096



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 186073 cttgcttgcttgcttgcttg 186092



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 186069 cttgcttgcttgcttgcttg 186088



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 186065 cttgcttgcttgcttgcttg 186084



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 186061 cttgcttgcttgcttgcttg 186080



to top

>gb|AC122814.3| Mus musculus BAC clone RP23-234A12 from 6, complete sequence
          Length = 144136

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 116616 cttgcttgcttgcttgcttgg 116636



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 116595 tcttgcttgcttgcttgcttg 116615



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 116612 cttgcttgcttgcttgcttg 116631



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 116608 cttgcttgcttgcttgcttg 116627



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 116604 cttgcttgcttgcttgcttg 116623



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 116600 cttgcttgcttgcttgcttg 116619



to top

>gb|AC123065.3| Mus musculus BAC clone RP23-239F13 from 9, complete sequence
          Length = 158137

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 134936 tcttgcttgcttgcttgcttg 134916



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 134931 cttgcttgcttgcttgcttg 134912



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 134927 cttgcttgcttgcttgcttg 134908



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 134923 cttgcttgcttgcttgcttg 134904



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 134919 cttgcttgcttgcttgcttg 134900



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 134915 cttgcttgcttgcttgcttg 134896



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 134911 cttgcttgcttgcttgcttg 134892



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 134907 cttgcttgcttgcttgcttg 134888



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 134903 cttgcttgcttgcttgcttg 134884



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 134899 cttgcttgcttgcttgcttg 134880



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 134895 cttgcttgcttgcttgcttg 134876



to top

>gb|AC122292.4| Mus musculus BAC clone RP23-256J8 from 10, complete sequence
          Length = 159736

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 51112 tcttgcttgcttgcttgcttg 51092



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 51107 cttgcttgcttgcttgcttg 51088



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 51103 cttgcttgcttgcttgcttg 51084



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 51099 cttgcttgcttgcttgcttg 51080



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 51095 cttgcttgcttgcttgcttg 51076



to top

>gb|AC122880.4| Mus musculus BAC clone RP23-77F18 from 8, complete sequence
          Length = 189549

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 141    tcttgcttgcttgcttgcttg 161
              |||||||||||||||||||||
Sbjct: 169630 tcttgcttgcttgcttgcttg 169650



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 169659 cttgcttgcttgcttgcttg 169678



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 169655 cttgcttgcttgcttgcttg 169674



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 169651 cttgcttgcttgcttgcttg 169670



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 169647 cttgcttgcttgcttgcttg 169666



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 169643 cttgcttgcttgcttgcttg 169662



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 169639 cttgcttgcttgcttgcttg 169658



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 169635 cttgcttgcttgcttgcttg 169654



to top

>gb|AC122202.4| Mus musculus BAC clone RP23-68P6 from 19, complete sequence
          Length = 234448

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 130881 cttgcttgcttgcttgcttgg 130901



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 130877 cttgcttgcttgcttgcttg 130896



to top

>gb|AC084392.1| Mus musculus BAC clone GS1-182G5 from UL, complete sequence
          Length = 142732

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 25177 tcttgcttgcttgcttgcttg 25197



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 25194 cttgcttgcttgcttgcttg 25213



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 25190 cttgcttgcttgcttgcttg 25209



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 25186 cttgcttgcttgcttgcttg 25205



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 25182 cttgcttgcttgcttgcttg 25201



to top

>gb|AC116576.3| Mus musculus BAC clone RP23-263J19 from 3, complete sequence
          Length = 205336

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 141  tcttgcttgcttgcttgcttg 161
            |||||||||||||||||||||
Sbjct: 1989 tcttgcttgcttgcttgcttg 2009



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  cttgcttgcttgcttgcttg 161
            ||||||||||||||||||||
Sbjct: 1994 cttgcttgcttgcttgcttg 2013



to top

>emb|CR753651.10| Human DNA sequence from clone DADB-91F17 on chromosome 6, complete
             sequence
          Length = 124464

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 61112 tcttgcttgcttgcttgcttg 61092



to top

>gb|AC098725.3| Mus musculus BAC clone RP23-3D20 from 3, complete sequence
          Length = 234471

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 142    cttgcttgcttgcttgcttgg 162
              |||||||||||||||||||||
Sbjct: 168885 cttgcttgcttgcttgcttgg 168865



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 168901 cttgcttgcttgcttgcttg 168882



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 168897 cttgcttgcttgcttgcttg 168878



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 168893 cttgcttgcttgcttgcttg 168874



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    cttgcttgcttgcttgcttg 161
              ||||||||||||||||||||
Sbjct: 168889 cttgcttgcttgcttgcttg 168870



to top

>gb|AC104479.3| Sus scrofa clone RP44-321O22, complete sequence
          Length = 117233

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   tcttgcttgcttgcttgcttg 161
             |||||||||||||||||||||
Sbjct: 43711 tcttgcttgcttgcttgcttg 43731



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 43724 cttgcttgcttgcttgcttg 43743



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 43720 cttgcttgcttgcttgcttg 43739



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 43716 cttgcttgcttgcttgcttg 43735



to top

>gb|AC116772.6| Mus musculus chromosome 8, clone RP23-428C21, complete sequence
          Length = 232691

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   cttgcttgcttgcttgcttgg 162
             |||||||||||||||||||||
Sbjct: 78618 cttgcttgcttgcttgcttgg 78598



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 78626 cttgcttgcttgcttgcttg 78607



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 78622 cttgcttgcttgcttgcttg 78603



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 28635 cttgcttgcttgcttgcttg 28654



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 142   cttgcttgcttgcttgcttg 161
             ||||||||||||||||||||
Sbjct: 28631 cttgcttgcttgcttgcttg 28650


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,841,596
Number of Sequences: 3902068
Number of extensions: 8841596
Number of successful extensions: 169178
Number of sequences better than 10.0: 2696
Number of HSP's better than 10.0 without gapping: 2728
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 138923
Number of HSP's gapped (non-prelim): 25757
length of query: 503
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 481
effective length of database: 17,147,199,772
effective search space: 8247803090332
effective search space used: 8247803090332
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top