Clone Name | bart09e09 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_467654.1| Oryza sativa (japonica cultivar-group), mRNA Length = 985 Score = 240 bits (121), Expect = 3e-60 Identities = 199/225 (88%) Strand = Plus / Plus Query: 221 ggcgagctggaggtgctggtgatcagctcgcaaaaggggcacggcatgatgttccccaag 280 |||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 180 ggcgagatggaggtgctggtgatcacgtcgcagaaggggcacggcatgatgttccccaag 239 Query: 281 ggcgggtgggagctggacgagtccatggacgacgcggcccggcgcgaggccctcgaggag 340 |||||||||||||| ||||||||||||||||| || ||||| |||||||| ||||||||| Sbjct: 240 ggcgggtgggagctcgacgagtccatggacgaggccgcccgccgcgaggcgctcgaggag 299 Query: 341 gccggcgtcagcggggacatgggcaaggtgctcggctgctggcactaccagagccgccgc 400 ||||||||| |||| |||| | | | |||||||||||| ||||| ||||||||||| Sbjct: 300 gccggcgtccgcggcgacaccgagacgtccctcggctgctggtactacaagagccgccgc 359 Query: 401 taccagaccacctacgagggcatcatgtaccccctccgcgtcacc 445 ||| | ||||||||||||||| |||||| ||| |||||||||||| Sbjct: 360 tacgacaccacctacgagggcttcatgttccctctccgcgtcacc 404 Score = 115 bits (58), Expect = 1e-22 Identities = 90/100 (90%), Gaps = 3/100 (3%) Strand = Plus / Plus Query: 106 gatggccgttcttgtggcgaggcaggggcgcgagctgcagcggtacagcgcgagcaccgg 165 ||||||||| || ||||||||||||||||| |||||||||||||||| ||||| |||| Sbjct: 77 gatggccgtgctggtggcgaggcaggggcgggagctgcagcggtaca---cgagcgccgg 133 Query: 166 cgggcgcatcgtggtggggtgcatcccgtaccgggtgcgc 205 || |||||||||||||| ||||||||||||||||||||| Sbjct: 134 gggccgcatcgtggtgggttgcatcccgtaccgggtgcgc 173
>ref|XM_506958.1| PREDICTED Oryza sativa (japonica cultivar-group), P0643A10.49 mRNA Length = 1063 Score = 240 bits (121), Expect = 3e-60 Identities = 199/225 (88%) Strand = Plus / Plus Query: 221 ggcgagctggaggtgctggtgatcagctcgcaaaaggggcacggcatgatgttccccaag 280 |||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 183 ggcgagatggaggtgctggtgatcacgtcgcagaaggggcacggcatgatgttccccaag 242 Query: 281 ggcgggtgggagctggacgagtccatggacgacgcggcccggcgcgaggccctcgaggag 340 |||||||||||||| ||||||||||||||||| || ||||| |||||||| ||||||||| Sbjct: 243 ggcgggtgggagctcgacgagtccatggacgaggccgcccgccgcgaggcgctcgaggag 302 Query: 341 gccggcgtcagcggggacatgggcaaggtgctcggctgctggcactaccagagccgccgc 400 ||||||||| |||| |||| | | | |||||||||||| ||||| ||||||||||| Sbjct: 303 gccggcgtccgcggcgacaccgagacgtccctcggctgctggtactacaagagccgccgc 362 Query: 401 taccagaccacctacgagggcatcatgtaccccctccgcgtcacc 445 ||| | ||||||||||||||| |||||| ||| |||||||||||| Sbjct: 363 tacgacaccacctacgagggcttcatgttccctctccgcgtcacc 407 Score = 115 bits (58), Expect = 1e-22 Identities = 90/100 (90%), Gaps = 3/100 (3%) Strand = Plus / Plus Query: 106 gatggccgttcttgtggcgaggcaggggcgcgagctgcagcggtacagcgcgagcaccgg 165 ||||||||| || ||||||||||||||||| |||||||||||||||| ||||| |||| Sbjct: 80 gatggccgtgctggtggcgaggcaggggcgggagctgcagcggtaca---cgagcgccgg 136 Query: 166 cgggcgcatcgtggtggggtgcatcccgtaccgggtgcgc 205 || |||||||||||||| ||||||||||||||||||||| Sbjct: 137 gggccgcatcgtggtgggttgcatcccgtaccgggtgcgc 176
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 240 bits (121), Expect = 3e-60 Identities = 199/225 (88%) Strand = Plus / Plus Query: 221 ggcgagctggaggtgctggtgatcagctcgcaaaaggggcacggcatgatgttccccaag 280 |||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 30644343 ggcgagatggaggtgctggtgatcacgtcgcagaaggggcacggcatgatgttccccaag 30644402 Query: 281 ggcgggtgggagctggacgagtccatggacgacgcggcccggcgcgaggccctcgaggag 340 |||||||||||||| ||||||||||||||||| || ||||| |||||||| ||||||||| Sbjct: 30644403 ggcgggtgggagctcgacgagtccatggacgaggccgcccgccgcgaggcgctcgaggag 30644462 Query: 341 gccggcgtcagcggggacatgggcaaggtgctcggctgctggcactaccagagccgccgc 400 ||||||||| |||| |||| | | | |||||||||||| ||||| ||||||||||| Sbjct: 30644463 gccggcgtccgcggcgacaccgagacgtccctcggctgctggtactacaagagccgccgc 30644522 Query: 401 taccagaccacctacgagggcatcatgtaccccctccgcgtcacc 445 ||| | ||||||||||||||| |||||| ||| |||||||||||| Sbjct: 30644523 tacgacaccacctacgagggcttcatgttccctctccgcgtcacc 30644567 Score = 115 bits (58), Expect = 1e-22 Identities = 90/100 (90%), Gaps = 3/100 (3%) Strand = Plus / Plus Query: 106 gatggccgttcttgtggcgaggcaggggcgcgagctgcagcggtacagcgcgagcaccgg 165 ||||||||| || ||||||||||||||||| |||||||||||||||| ||||| |||| Sbjct: 30644240 gatggccgtgctggtggcgaggcaggggcgggagctgcagcggtaca---cgagcgccgg 30644296 Query: 166 cgggcgcatcgtggtggggtgcatcccgtaccgggtgcgc 205 || |||||||||||||| ||||||||||||||||||||| Sbjct: 30644297 gggccgcatcgtggtgggttgcatcccgtaccgggtgcgc 30644336 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 21016301 tcttcttcttcttgttgttg 21016282 Score = 40.1 bits (20), Expect = 6.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 323 cgcgaggccctcgaggaggccggcgtca 350 ||||||||| | |||||||||||||||| Sbjct: 18957975 cgcgaggccatggaggaggccggcgtca 18957948 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttg 62 |||||||||||||||||||| Sbjct: 5217671 tcatcatcttcttcttcttg 5217690
>dbj|AP005319.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0643A10 Length = 187931 Score = 240 bits (121), Expect = 3e-60 Identities = 199/225 (88%) Strand = Plus / Plus Query: 221 ggcgagctggaggtgctggtgatcagctcgcaaaaggggcacggcatgatgttccccaag 280 |||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 156351 ggcgagatggaggtgctggtgatcacgtcgcagaaggggcacggcatgatgttccccaag 156410 Query: 281 ggcgggtgggagctggacgagtccatggacgacgcggcccggcgcgaggccctcgaggag 340 |||||||||||||| ||||||||||||||||| || ||||| |||||||| ||||||||| Sbjct: 156411 ggcgggtgggagctcgacgagtccatggacgaggccgcccgccgcgaggcgctcgaggag 156470 Query: 341 gccggcgtcagcggggacatgggcaaggtgctcggctgctggcactaccagagccgccgc 400 ||||||||| |||| |||| | | | |||||||||||| ||||| ||||||||||| Sbjct: 156471 gccggcgtccgcggcgacaccgagacgtccctcggctgctggtactacaagagccgccgc 156530 Query: 401 taccagaccacctacgagggcatcatgtaccccctccgcgtcacc 445 ||| | ||||||||||||||| |||||| ||| |||||||||||| Sbjct: 156531 tacgacaccacctacgagggcttcatgttccctctccgcgtcacc 156575 Score = 115 bits (58), Expect = 1e-22 Identities = 90/100 (90%), Gaps = 3/100 (3%) Strand = Plus / Plus Query: 106 gatggccgttcttgtggcgaggcaggggcgcgagctgcagcggtacagcgcgagcaccgg 165 ||||||||| || ||||||||||||||||| |||||||||||||||| ||||| |||| Sbjct: 156248 gatggccgtgctggtggcgaggcaggggcgggagctgcagcggtaca---cgagcgccgg 156304 Query: 166 cgggcgcatcgtggtggggtgcatcccgtaccgggtgcgc 205 || |||||||||||||| ||||||||||||||||||||| Sbjct: 156305 gggccgcatcgtggtgggttgcatcccgtaccgggtgcgc 156344
>dbj|AK104571.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-G07, full insert sequence Length = 985 Score = 240 bits (121), Expect = 3e-60 Identities = 199/225 (88%) Strand = Plus / Plus Query: 221 ggcgagctggaggtgctggtgatcagctcgcaaaaggggcacggcatgatgttccccaag 280 |||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 180 ggcgagatggaggtgctggtgatcacgtcgcagaaggggcacggcatgatgttccccaag 239 Query: 281 ggcgggtgggagctggacgagtccatggacgacgcggcccggcgcgaggccctcgaggag 340 |||||||||||||| ||||||||||||||||| || ||||| |||||||| ||||||||| Sbjct: 240 ggcgggtgggagctcgacgagtccatggacgaggccgcccgccgcgaggcgctcgaggag 299 Query: 341 gccggcgtcagcggggacatgggcaaggtgctcggctgctggcactaccagagccgccgc 400 ||||||||| |||| |||| | | | |||||||||||| ||||| ||||||||||| Sbjct: 300 gccggcgtccgcggcgacaccgagacgtccctcggctgctggtactacaagagccgccgc 359 Query: 401 taccagaccacctacgagggcatcatgtaccccctccgcgtcacc 445 ||| | ||||||||||||||| |||||| ||| |||||||||||| Sbjct: 360 tacgacaccacctacgagggcttcatgttccctctccgcgtcacc 404 Score = 115 bits (58), Expect = 1e-22 Identities = 90/100 (90%), Gaps = 3/100 (3%) Strand = Plus / Plus Query: 106 gatggccgttcttgtggcgaggcaggggcgcgagctgcagcggtacagcgcgagcaccgg 165 ||||||||| || ||||||||||||||||| |||||||||||||||| ||||| |||| Sbjct: 77 gatggccgtgctggtggcgaggcaggggcgggagctgcagcggtaca---cgagcgccgg 133 Query: 166 cgggcgcatcgtggtggggtgcatcccgtaccgggtgcgc 205 || |||||||||||||| ||||||||||||||||||||| Sbjct: 134 gggccgcatcgtggtgggttgcatcccgtaccgggtgcgc 173
>dbj|AK059780.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-204-C03, full insert sequence Length = 1063 Score = 240 bits (121), Expect = 3e-60 Identities = 199/225 (88%) Strand = Plus / Plus Query: 221 ggcgagctggaggtgctggtgatcagctcgcaaaaggggcacggcatgatgttccccaag 280 |||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||| Sbjct: 183 ggcgagatggaggtgctggtgatcacgtcgcagaaggggcacggcatgatgttccccaag 242 Query: 281 ggcgggtgggagctggacgagtccatggacgacgcggcccggcgcgaggccctcgaggag 340 |||||||||||||| ||||||||||||||||| || ||||| |||||||| ||||||||| Sbjct: 243 ggcgggtgggagctcgacgagtccatggacgaggccgcccgccgcgaggcgctcgaggag 302 Query: 341 gccggcgtcagcggggacatgggcaaggtgctcggctgctggcactaccagagccgccgc 400 ||||||||| |||| |||| | | | |||||||||||| ||||| ||||||||||| Sbjct: 303 gccggcgtccgcggcgacaccgagacgtccctcggctgctggtactacaagagccgccgc 362 Query: 401 taccagaccacctacgagggcatcatgtaccccctccgcgtcacc 445 ||| | ||||||||||||||| |||||| ||| |||||||||||| Sbjct: 363 tacgacaccacctacgagggcttcatgttccctctccgcgtcacc 407 Score = 115 bits (58), Expect = 1e-22 Identities = 90/100 (90%), Gaps = 3/100 (3%) Strand = Plus / Plus Query: 106 gatggccgttcttgtggcgaggcaggggcgcgagctgcagcggtacagcgcgagcaccgg 165 ||||||||| || ||||||||||||||||| |||||||||||||||| ||||| |||| Sbjct: 80 gatggccgtgctggtggcgaggcaggggcgggagctgcagcggtaca---cgagcgccgg 136 Query: 166 cgggcgcatcgtggtggggtgcatcccgtaccgggtgcgc 205 || |||||||||||||| ||||||||||||||||||||| Sbjct: 137 gggccgcatcgtggtgggttgcatcccgtaccgggtgcgc 176
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 117 bits (59), Expect = 3e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 267 tgatgttccccaagggcgggtgggagctggacgagtccatggacgacgcggcccggcgcg 326 |||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||| | Sbjct: 8080513 tgatgttccccaagggcgggtgggagctggacgagtccgtggacgaggcggcgcggcggg 8080454 Query: 327 aggccctcgaggaggccgg 345 ||||||| ||||||||||| Sbjct: 8080453 aggccctggaggaggccgg 8080435 Score = 71.9 bits (36), Expect = 2e-09 Identities = 72/84 (85%) Strand = Plus / Minus Query: 119 gtggcgaggcaggggcgcgagctgcagcggtacagcgcgagcaccggcgggcgcatcgtg 178 ||||||||||||||| | ||||||||| ||||||||| | ||| || ||| | || ||| Sbjct: 8080670 gtggcgaggcaggggagggagctgcagaggtacagcgacaacacgggggggaggatggtg 8080611 Query: 179 gtggggtgcatcccgtaccgggtg 202 |||||||||||||||||| ||||| Sbjct: 8080610 gtggggtgcatcccgtacagggtg 8080587 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgtt 64 |||||||||||||||||||||| Sbjct: 29646887 tcatcatcttcttcttcttgtt 29646866 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttcttg 62 ||||||||||||||||||||| Sbjct: 24855474 ctcatcatcttcttcttcttg 24855454 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 385 ctaccagagccgccgctaccagaccacctacgagggc 421 ||||| ||||||||||||| | |||||||||||||| Sbjct: 8080395 ctaccggagccgccgctacgacgccacctacgagggc 8080359 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 8442369 tcttcttcttcttgttgttg 8442388 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 265915 tcttcttcttcttgttgttg 265896
>dbj|AP003490.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0592E11 Length = 153734 Score = 117 bits (59), Expect = 3e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 267 tgatgttccccaagggcgggtgggagctggacgagtccatggacgacgcggcccggcgcg 326 |||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||| | Sbjct: 104282 tgatgttccccaagggcgggtgggagctggacgagtccgtggacgaggcggcgcggcggg 104223 Query: 327 aggccctcgaggaggccgg 345 ||||||| ||||||||||| Sbjct: 104222 aggccctggaggaggccgg 104204 Score = 71.9 bits (36), Expect = 2e-09 Identities = 72/84 (85%) Strand = Plus / Minus Query: 119 gtggcgaggcaggggcgcgagctgcagcggtacagcgcgagcaccggcgggcgcatcgtg 178 ||||||||||||||| | ||||||||| ||||||||| | ||| || ||| | || ||| Sbjct: 104439 gtggcgaggcaggggagggagctgcagaggtacagcgacaacacgggggggaggatggtg 104380 Query: 179 gtggggtgcatcccgtaccgggtg 202 |||||||||||||||||| ||||| Sbjct: 104379 gtggggtgcatcccgtacagggtg 104356 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Minus Query: 385 ctaccagagccgccgctaccagaccacctacgagggc 421 ||||| ||||||||||||| | |||||||||||||| Sbjct: 104164 ctaccggagccgccgctacgacgccacctacgagggc 104128
>dbj|AK064894.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000K23, full insert sequence Length = 781 Score = 117 bits (59), Expect = 3e-23 Identities = 74/79 (93%) Strand = Plus / Plus Query: 267 tgatgttccccaagggcgggtgggagctggacgagtccatggacgacgcggcccggcgcg 326 |||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||| | Sbjct: 289 tgatgttccccaagggcgggtgggagctggacgagtccgtggacgaggcggcgcggcggg 348 Query: 327 aggccctcgaggaggccgg 345 ||||||| ||||||||||| Sbjct: 349 aggccctggaggaggccgg 367 Score = 71.9 bits (36), Expect = 2e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 119 gtggcgaggcaggggcgcgagctgcagcggtacagcgcgagcaccggcgggcgcatcgtg 178 ||||||||||||||| | ||||||||| ||||||||| | ||| || ||| | || ||| Sbjct: 132 gtggcgaggcaggggagggagctgcagaggtacagcgacaacacgggggggaggatggtg 191 Query: 179 gtggggtgcatcccgtaccgggtg 202 |||||||||||||||||| ||||| Sbjct: 192 gtggggtgcatcccgtacagggtg 215 Score = 42.1 bits (21), Expect = 1.5 Identities = 33/37 (89%) Strand = Plus / Plus Query: 385 ctaccagagccgccgctaccagaccacctacgagggc 421 ||||| ||||||||||||| | |||||||||||||| Sbjct: 407 ctaccggagccgccgctacgacgccacctacgagggc 443
>ref|XM_630358.1| Dictyostelium discoideum hypothetical protein (DDB0189209), partial mRNA Length = 675 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgttg 68 |||||||||||||||||||||||||| Sbjct: 662 tcatcatcttcttcttcttgttgttg 637
>ref|XM_711837.1| Candida albicans SC5314 putative ER/nuclear membrane ubiquitin-protein ligase E3 (CaO19_12642), mRNA Length = 3420 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgtt 67 ||||||||||||||||||||||||| Sbjct: 1031 tcatcatcttcttcttcttgttgtt 1007
>ref|XM_883802.1| Candida albicans SC5314 hypothetical protein (CaJ7.0325) partial mRNA Length = 3420 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgtt 67 ||||||||||||||||||||||||| Sbjct: 1031 tcatcatcttcttcttcttgttgtt 1007
>ref|XM_711904.1| Candida albicans SC5314 ER/nuclear membrane ubiquitin-protein ligase E3 (SSM4) partial mRNA Length = 3420 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgtt 67 ||||||||||||||||||||||||| Sbjct: 1031 tcatcatcttcttcttcttgttgtt 1007
>dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, complete sequence Length = 949626 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgttgtt 67 ||||||||||||||||||||||||| Sbjct: 620039 tcatcatcttcttcttcttgttgtt 620063
>ref|XM_635698.1| Dictyostelium discoideum RNA-directed RNA polymerase (DDB0216193), partial mRNA Length = 6858 Score = 46.1 bits (23), Expect = 0.098 Identities = 23/23 (100%) Strand = Plus / Minus Query: 47 catcttcttcttcttgttgttgc 69 ||||||||||||||||||||||| Sbjct: 5806 catcttcttcttcttgttgttgc 5784 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 1070 tcttcttcttcttgttgttg 1051
>emb|BX294027.1|NCB8G12 Neurospora crassa DNA linkage group V BAC contig B8G12 Length = 154038 Score = 46.1 bits (23), Expect = 0.098 Identities = 23/23 (100%) Strand = Plus / Minus Query: 29 catccatccatctctcatcatct 51 ||||||||||||||||||||||| Sbjct: 67207 catccatccatctctcatcatct 67185
>emb|AL935253.1| Lactobacillus plantarum strain WCFS1 complete genome; segment 2/11 Length = 324050 Score = 46.1 bits (23), Expect = 0.098 Identities = 23/23 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgcaa 71 ||||||||||||||||||||||| Sbjct: 322056 tcttcttcttcttgttgttgcaa 322034
>gb|AF117611.1|AF117611 Dictyostelium discoideum DosA protein (dosA) gene, complete cds Length = 4978 Score = 46.1 bits (23), Expect = 0.098 Identities = 23/23 (100%) Strand = Plus / Minus Query: 47 catcttcttcttcttgttgttgc 69 ||||||||||||||||||||||| Sbjct: 2721 catcttcttcttcttgttgttgc 2699
>ref|XM_637027.1| Dictyostelium discoideum hypothetical protein (DDB0204418), partial mRNA Length = 6198 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgttg 68 |||||||| ||||||||||||||||| Sbjct: 5822 tcatcatcctcttcttcttgttgttg 5797
>ref|XM_635650.1| Dictyostelium discoideum hypothetical protein (DDB0204153), partial mRNA Length = 6504 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgttg 68 |||||||||||||||| ||||||||| Sbjct: 3962 tcatcatcttcttcttgttgttgttg 3937
>ref|XM_480919.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2865 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 333 tcgaggaggccggcgtcagcggggac 358 |||||||||| ||||||||||||||| Sbjct: 533 tcgaggaggcgggcgtcagcggggac 508
>ref|NM_183763.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1257 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgtt 64 |||||||||||||||||||||| Sbjct: 39 tcatcatcttcttcttcttgtt 60
>ref|XM_711660.1| Candida albicans SC5314 putative Ran guanine nucleotide release factor Mog1p (CaO19_3446), mRNA Length = 615 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgttg 68 |||| ||||||||||||||||||||| Sbjct: 311 tcattatcttcttcttcttgttgttg 286
>ref|XM_711601.1| Candida albicans SC5314 putative Ran guanine nucleotide release factor Mog1p (CaO19_10950), mRNA Length = 615 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgttg 68 |||| ||||||||||||||||||||| Sbjct: 311 tcattatcttcttcttcttgttgttg 286
>gb|AY247121.1| Ropalidia revolutionalis microsatellite Rrev250 sequence Length = 530 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 40 ctctcatcatcttcttcttctt 61 |||||||||||||||||||||| Sbjct: 247 ctctcatcatcttcttcttctt 268
>emb|AL513210.32| Human DNA sequence from clone RP11-35J6 on chromosome 6 Contains six CpG islands, complete sequence Length = 157572 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 30 atccatccatctctcatcatct 51 |||||||||||||||||||||| Sbjct: 6176 atccatccatctctcatcatct 6155
>emb|AL645792.7| Zebrafish DNA sequence from clone RP71-1D10 in linkage group 14 Contains two novel genes similar to MATR3 (matrin 3), a novel gene similar to PDE6A (cGMP-specific phosphodiesterase 6A alpha (rod)), a novel gene similar to PERC (PGC-1-related estrogen receptor alpha coactivator) and two CpG islands, complete sequence Length = 170221 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgttg 68 |||||||| ||||||||||||||||| Sbjct: 15538 tcatcatcatcttcttcttgttgttg 15513 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgtt 67 |||||||||||||||| |||||||| Sbjct: 15535 tcatcatcttcttcttgttgttgtt 15511
>emb|AJ440216.1|OSA440216 Oryza sativa a5 gene for plasma membrane H+-ATPase Length = 4901 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 333 tcgaggaggccggcgtcagcggggac 358 |||||||||| ||||||||||||||| Sbjct: 1624 tcgaggaggcgggcgtcagcggggac 1599
>ref|XM_679054.1| PREDICTED: Danio rerio similar to Matrin 3 (LOC556290), mRNA Length = 3933 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgttg 68 |||||||| ||||||||||||||||| Sbjct: 2225 tcatcatcatcttcttcttgttgttg 2200 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgtt 67 |||||||||||||||| |||||||| Sbjct: 2222 tcatcatcttcttcttgttgttgtt 2198
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Plus Query: 333 tcgaggaggccggcgtcagcggggac 358 |||||||||| ||||||||||||||| Sbjct: 8611068 tcgaggaggcgggcgtcagcggggac 8611093 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgttgttgcaa 71 ||||||||||||||||||| || |||||| Sbjct: 11717901 tcatcatcttcttcttcttctttttgcaa 11717929 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 27554032 tcttcttcttcttgttgttg 27554051
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgtt 64 |||||||||||||||||||||| Sbjct: 12100642 tcatcatcttcttcttcttgtt 12100663 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 gaaggcgagggcgagctgga 231 |||||||||||||||||||| Sbjct: 23779227 gaaggcgagggcgagctgga 23779208 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 gaaggcgagggcgagctgga 231 |||||||||||||||||||| Sbjct: 595046 gaaggcgagggcgagctgga 595027
>gb|AC114804.5| Homo sapiens BAC clone RP11-1181A2 from 2, complete sequence Length = 94984 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 40 ctctcatcatcttcttcttctt 61 |||||||||||||||||||||| Sbjct: 61756 ctctcatcatcttcttcttctt 61735
>dbj|AP005463.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0712G01 Length = 87056 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgtt 64 |||||||||||||||||||||| Sbjct: 20001 tcatcatcttcttcttcttgtt 19980
>dbj|AP004329.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OJ1663_H12 Length = 125422 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgtt 64 |||||||||||||||||||||| Sbjct: 90472 tcatcatcttcttcttcttgtt 90451
>dbj|AP003414.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1153F04 Length = 158174 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgtt 64 |||||||||||||||||||||| Sbjct: 67582 tcatcatcttcttcttcttgtt 67603
>dbj|AP003921.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0028G04 Length = 159761 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgtt 64 |||||||||||||||||||||| Sbjct: 146306 tcatcatcttcttcttcttgtt 146327
>dbj|AP005249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0087F21 Length = 187401 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Plus Query: 333 tcgaggaggccggcgtcagcggggac 358 |||||||||| ||||||||||||||| Sbjct: 122979 tcgaggaggcgggcgtcagcggggac 123004
>dbj|AK107088.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-121-G08, full insert sequence Length = 2170 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgtt 64 |||||||||||||||||||||| Sbjct: 656 tcatcatcttcttcttcttgtt 677
>dbj|AK106690.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-114-C06, full insert sequence Length = 2127 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Plus Query: 333 tcgaggaggccggcgtcagcggggac 358 |||||||||| ||||||||||||||| Sbjct: 1692 tcgaggaggcgggcgtcagcggggac 1717
>dbj|AK067689.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013117E22, full insert sequence Length = 1675 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgtt 64 |||||||||||||||||||||| Sbjct: 398 tcatcatcttcttcttcttgtt 419
>dbj|AP006427.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT45A23, TM0318, complete sequence Length = 117676 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgca 70 |||||||||||||||||||||| Sbjct: 55900 tcttcttcttcttgttgttgca 55879
>ref|NM_202133.1| Arabidopsis thaliana unknown protein AT1G19180 transcript variant AT1G19180.2 mRNA, complete cds Length = 1507 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 122 tcttcttcttcttgttgttgc 102
>ref|NM_101776.2| Arabidopsis thaliana unknown protein AT1G19180 transcript variant AT1G19180.1 mRNA, complete cds Length = 1329 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 142 tcttcttcttcttgttgttgc 122
>ref|NM_102140.2| Arabidopsis thaliana unknown protein AT1G22930 mRNA, complete cds Length = 3793 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 40 ctctcatcatcttcttcttct 60 ||||||||||||||||||||| Sbjct: 3257 ctctcatcatcttcttcttct 3237
>ref|NM_126078.1| Arabidopsis thaliana unknown protein AT5G66800 mRNA, complete cds Length = 960 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 41 tctcatcatcttcttcttctt 61 ||||||||||||||||||||| Sbjct: 366 tctcatcatcttcttcttctt 386
>ref|XM_632539.1| Dictyostelium discoideum hypothetical protein (DDB0187104), partial mRNA Length = 1659 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 434 tcttcttcttcttgttgttgc 414
>ref|XM_641780.1| Dictyostelium discoideum hypothetical protein (DDB0189958), partial mRNA Length = 1707 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 atcttcttcttcttgttgttg 68 ||||||||||||||||||||| Sbjct: 1497 atcttcttcttcttgttgttg 1477
>ref|XM_493858.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 975 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgt 63 ||||||||||||||||||||| Sbjct: 152 tcatcatcttcttcttcttgt 132
>ref|XM_629991.1| Dictyostelium discoideum hypothetical protein (DDB0184031), partial mRNA Length = 303 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 40 ctctcatcatcttcttcttcttgtt 64 |||||||||| |||||||||||||| Sbjct: 40 ctctcatcattttcttcttcttgtt 64
>gb|DQ216006.1| Taeniopygia guttata clone 0061P0024G09 ribosomal protein L13A-like mRNA, complete sequence Length = 786 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttcttgttgt 66 |||||||||||| |||||||||||| Sbjct: 531 ctcatcatcttcctcttcttgttgt 507
>gb|DQ216005.1| Taeniopygia guttata clone 0058P0011D10 ribosomal protein L13A-like mRNA, complete sequence Length = 798 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttcttgttgt 66 |||||||||||| |||||||||||| Sbjct: 565 ctcatcatcttcctcttcttgttgt 541
>gb|DQ216004.1| Taeniopygia guttata clone 0058P0006F05 ribosomal protein L13A-like mRNA, complete sequence Length = 804 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttcttgttgt 66 |||||||||||| |||||||||||| Sbjct: 565 ctcatcatcttcctcttcttgttgt 541
>gb|DQ216003.1| Taeniopygia guttata clone 0058P0045E08 ribosomal protein L13A-like mRNA, complete sequence Length = 801 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttcttgttgt 66 |||||||||||| |||||||||||| Sbjct: 560 ctcatcatcttcctcttcttgttgt 536
>gb|DQ216002.1| Taeniopygia guttata clone 0058P0010A09 ribosomal protein L13A-like mRNA, complete sequence Length = 739 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttcttgttgt 66 |||||||||||| |||||||||||| Sbjct: 505 ctcatcatcttcctcttcttgttgt 481
>gb|DQ216001.1| Taeniopygia guttata clone 0058P0049C02 ribosomal protein L13A-like mRNA, complete sequence Length = 801 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttcttgttgt 66 |||||||||||| |||||||||||| Sbjct: 560 ctcatcatcttcctcttcttgttgt 536
>gb|DQ216000.1| Taeniopygia guttata clone 0058P0016A02 ribosomal protein L13A-like mRNA, complete sequence Length = 799 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttcttgttgt 66 |||||||||||| |||||||||||| Sbjct: 565 ctcatcatcttcctcttcttgttgt 541
>ref|XM_472350.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 876 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 272 ttccccaagggcgggtgggag 292 ||||||||||||||||||||| Sbjct: 208 ttccccaagggcgggtgggag 228
>gb|AY569331.1| Lycopersicon pimpinellifolium 9DC resistance gene cluster Length = 44539 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 atcttcttcttcttgttgttg 68 ||||||||||||||||||||| Sbjct: 43360 atcttcttcttcttgttgttg 43340
>gb|AC146913.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0013C12 map near S6115, complete sequence Length = 123718 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 atcttcttcttcttgttgttg 68 ||||||||||||||||||||| Sbjct: 111222 atcttcttcttcttgttgttg 111202
>gb|AC145327.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0095J10 map near S6115, complete sequence Length = 123717 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 atcttcttcttcttgttgttg 68 ||||||||||||||||||||| Sbjct: 15811 atcttcttcttcttgttgttg 15791
>gb|AC079356.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0016H04, complete sequence Length = 176678 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 41 tctcatcatcttcttcttctt 61 ||||||||||||||||||||| Sbjct: 8208 tctcatcatcttcttcttctt 8188
>ref|XM_813531.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510627.60) partial mRNA Length = 1443 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 1389 tcttcttcttcttgttgttgc 1409
>ref|XM_801537.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053511609.30) partial mRNA Length = 978 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 924 tcttcttcttcttgttgttgc 944
>ref|XM_808641.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053509657.30) partial mRNA Length = 1059 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 1008 tcttcttcttcttgttgttgc 1028
>ref|XM_809057.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506965.100) partial mRNA Length = 978 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 924 tcttcttcttcttgttgttgc 944
>ref|XM_810090.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506131.30) partial mRNA Length = 1491 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 1440 tcttcttcttcttgttgttgc 1460
>ref|XM_810319.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053511613.80) partial mRNA Length = 1119 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 1065 tcttcttcttcttgttgttgc 1085
>ref|XM_816218.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510377.430) partial mRNA Length = 1335 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 1287 tcttcttcttcttgttgttgc 1307
>ref|XM_816343.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508163.230) partial mRNA Length = 1080 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 1026 tcttcttcttcttgttgttgc 1046
>ref|XM_814497.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053507237.340) partial mRNA Length = 1113 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 1062 tcttcttcttcttgttgttgc 1082
>gb|BT000945.1| Arabidopsis thaliana clone C105054 unknown protein (At1g22930) mRNA, complete cds Length = 3427 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 40 ctctcatcatcttcttcttct 60 ||||||||||||||||||||| Sbjct: 3133 ctctcatcatcttcttcttct 3113
>ref|XM_812729.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506973.5) partial mRNA Length = 836 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 782 tcttcttcttcttgttgttgc 802
>ref|XM_719328.1| Plasmodium yoelii yoelii str. 17XNL mature-parasite-infected erythrocyte surface antigen (PY04167) partial mRNA Length = 3012 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 41 tctcatcatcttcttcttctt 61 ||||||||||||||||||||| Sbjct: 1006 tctcatcatcttcttcttctt 986 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 978 ctcatcatcttcttcttctt 959 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 948 ctcatcatcttcttcttctt 929 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 918 ctcatcatcttcttcttctt 899 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 891 ctcatcatcttcttcttctt 872 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 864 ctcatcatcttcttcttctt 845
>ref|XM_541501.2| PREDICTED: Canis familiaris similar to Sarcoplasmic reticulum histidine-rich calcium-binding protein precursor (LOC484386), mRNA Length = 2344 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgttgtt 67 ||||||||||||||||||| ||||| Sbjct: 1245 tcatcatcttcttcttcttcttgtt 1221 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 814 ctcatcatcttcttcttctt 795
>gb|AC144478.20| Medicago truncatula clone mth2-20b20, complete sequence Length = 144248 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttgt 63 ||||||||||||||||||||| Sbjct: 49644 tcatcatcttcttcttcttgt 49624
>gb|AY080730.1| Arabidopsis thaliana At1g22930 mRNA sequence Length = 3368 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 40 ctctcatcatcttcttcttct 60 ||||||||||||||||||||| Sbjct: 3257 ctctcatcatcttcttcttct 3237
>emb|AL939106.1|SCO939106 Streptomyces coelicolor A3(2) complete genome; segment 3/29 Length = 314100 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 322 gcgcgaggccctcgaggaggc 342 ||||||||||||||||||||| Sbjct: 178203 gcgcgaggccctcgaggaggc 178183
>emb|AJ002236.1|LPJ002236 Lycopersicon pimpinellifolium Cf-9 resistance gene cluster Length = 48710 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 atcttcttcttcttgttgttg 68 ||||||||||||||||||||| Sbjct: 40324 atcttcttcttcttgttgttg 40304
>emb|AJ002235.1|LHJ002235 Lycopersicon hirsutum Cf-4 resistance gene cluster Length = 37411 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 atcttcttcttcttgttgttg 68 ||||||||||||||||||||| Sbjct: 36424 atcttcttcttcttgttgttg 36404 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 atcttcttcttcttgttgttg 68 ||||||||||||||||||||| Sbjct: 21847 atcttcttcttcttgttgttg 21827
>gb|DQ397854.1| Cenarchaeum symbiosum clone C20E06, complete sequence Length = 45512 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 349 cagcggggacatgggcaaggt 369 ||||||||||||||||||||| Sbjct: 25398 cagcggggacatgggcaaggt 25378
>gb|DQ397842.1| Cenarchaeum symbiosum clone C07C04, complete sequence Length = 41652 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 349 cagcggggacatgggcaaggt 369 ||||||||||||||||||||| Sbjct: 12300 cagcggggacatgggcaaggt 12320
>gb|DQ397602.1| Cenarchaeum symbiosum clone C08B03, complete sequence Length = 40416 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 349 cagcggggacatgggcaaggt 369 ||||||||||||||||||||| Sbjct: 8554 cagcggggacatgggcaaggt 8534
>gb|DQ378290.1| Drosophila virilis strain Tucson 15010-1001.10 fosmid 10J19, complete sequence Length = 34783 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 11739 tcttcttcttcttgttgttgc 11759
>gb|AY065146.1| Arabidopsis thaliana unknown protein (At1g19180; T29M8.5) mRNA, complete cds Length = 1286 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 123 tcttcttcttcttgttgttgc 103
>gb|AY058863.1| Arabidopsis thaliana At1g19180/T29M8_5 mRNA, partial cds Length = 766 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 142 tcttcttcttcttgttgttgc 122
>gb|AC079022.2|AC079022 Oryza sativa chromosome 5 clone P0574H01, complete sequence Length = 151589 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 41 tctcatcatcttcttcttctt 61 ||||||||||||||||||||| Sbjct: 90607 tctcatcatcttcttcttctt 90587
>gb|AY039894.1| Arabidopsis thaliana At1g19180/T29M8_5 mRNA, complete cds Length = 1131 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 118 tcttcttcttcttgttgttgc 98
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 26011431 tcttcttcttcttgttgttgc 26011411 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 38 atctctcatcatcttcttctt 58 ||||||||||||||||||||| Sbjct: 24733023 atctctcatcatcttcttctt 24733043
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 atcttcttcttcttgttgttg 68 ||||||||||||||||||||| Sbjct: 12943886 atcttcttcttcttgttgttg 12943866 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 gaaggcgagggcgagctgga 231 |||||||||||||||||||| Sbjct: 3163453 gaaggcgagggcgagctgga 3163434
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 41 tctcatcatcttcttcttctt 61 ||||||||||||||||||||| Sbjct: 26302132 tctcatcatcttcttcttctt 26302112 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 47 catcttcttcttcttgttgtt 67 ||||||||||||||||||||| Sbjct: 3283254 catcttcttcttcttgttgtt 3283234 Score = 40.1 bits (20), Expect = 6.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgcaacgaaacgag 80 ||||||||||||| || || |||||||||||| Sbjct: 606736 tcttcttcttcttcttcttccaacgaaacgag 606705
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 41 tctcatcatcttcttcttctt 61 ||||||||||||||||||||| Sbjct: 490809 tctcatcatcttcttcttctt 490789 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgt 63 ||||||||||||||||||||| Sbjct: 28972 tcatcatcttcttcttcttgt 28992
>emb|BX815493.1|CNS0AEL1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS66ZD10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 2905 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 40 ctctcatcatcttcttcttct 60 ||||||||||||||||||||| Sbjct: 2402 ctctcatcatcttcttcttct 2382
>emb|BX816550.1|CNS0ABUI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH54ZG10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1384 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 96 tcttcttcttcttgttgttgc 76
>emb|BX815834.1|CNS0ABVN Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH11ZD05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1185 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 96 tcttcttcttcttgttgttgc 76
>emb|BX817360.1|CNS0AB8B Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL18ZC04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1167 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 98 tcttcttcttcttgttgttgc 78
>emb|BX817949.1|CNS0AAZ7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL52ZF08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 880 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 40 ctctcatcatcttcttcttct 60 ||||||||||||||||||||| Sbjct: 345 ctctcatcatcttcttcttct 325
>emb|BX817114.1|CNS0AAHD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH86ZA11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1225 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 103 tcttcttcttcttgttgttgc 83
>gb|AC069143.3|T29M8 Sequence of BAC T29M8 from Arabidopsis thaliana chromosome 1, complete sequence Length = 58738 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 11669 tcttcttcttcttgttgttgc 11649
>gb|AC084445.1|AC084445 Caenorhabditis briggsae cosmid CB018A07, complete sequence Length = 62584 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 39 tctctcatcatcttcttcttc 59 ||||||||||||||||||||| Sbjct: 57961 tctctcatcatcttcttcttc 57941
>gb|AY084283.1| Arabidopsis thaliana clone 102248 mRNA, complete sequence Length = 960 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 41 tctcatcatcttcttcttctt 61 ||||||||||||||||||||| Sbjct: 366 tctcatcatcttcttcttctt 386
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 217 cgagggcgagctggaggtgctggtg 241 ||||||||||||||| ||||||||| Sbjct: 1436818 cgagggcgagctggacgtgctggtg 1436842 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 162 ccggcgggcgcatcgtggtg 181 |||||||||||||||||||| Sbjct: 949058 ccggcgggcgcatcgtggtg 949077
>dbj|AP005390.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0075O18 Length = 125411 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgttgttgcaa 71 ||||||||||||||||||| || |||||| Sbjct: 47601 tcatcatcttcttcttcttctttttgcaa 47629
>dbj|AP004334.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0455H11 Length = 101607 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 41 tctcatcatcttcttcttctt 61 ||||||||||||||||||||| Sbjct: 76760 tctcatcatcttcttcttctt 76740
>dbj|AP003752.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1332_C12 Length = 67349 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 41 tctcatcatcttcttcttctt 61 ||||||||||||||||||||| Sbjct: 21710 tctcatcatcttcttcttctt 21690
>dbj|AP004737.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0072A21 Length = 158287 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttcttg 62 ||||||||||||||||||||| Sbjct: 66557 ctcatcatcttcttcttcttg 66537
>dbj|AB010700.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUD21 Length = 69850 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 41 tctcatcatcttcttcttctt 61 ||||||||||||||||||||| Sbjct: 14266 tctcatcatcttcttcttctt 14286
>emb|AJ427979.1|OSA427979 Oryza sativa HAK10 gene for putative potasium transporter, exons 1-9 Length = 5051 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 42 ctcatcatcttcttcttcttg 62 ||||||||||||||||||||| Sbjct: 3768 ctcatcatcttcttcttcttg 3788
>emb|Y12640.1|LECF4A L.esculentum Cf-4A gene Length = 3005 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 atcttcttcttcttgttgttg 68 ||||||||||||||||||||| Sbjct: 2629 atcttcttcttcttgttgttg 2609
>dbj|AK105282.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-D03, full insert sequence Length = 1578 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 272 ttccccaagggcgggtgggag 292 ||||||||||||||||||||| Sbjct: 596 ttccccaagggcgggtgggag 616
>dbj|AK100999.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023147B04, full insert sequence Length = 1999 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgt 63 ||||||||||||||||||||| Sbjct: 58 tcatcatcttcttcttcttgt 78
>dbj|AK070028.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023034G13, full insert sequence Length = 1954 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 38 atctctcatcatcttcttctt 58 ||||||||||||||||||||| Sbjct: 1380 atctctcatcatcttcttctt 1360
>dbj|AP003847.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1714_H10 Length = 191580 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 47 catcttcttcttcttgttgtt 67 ||||||||||||||||||||| Sbjct: 92947 catcttcttcttcttgttgtt 92927
>gb|L29299.1|FRANIFX Frankia alni nitrogen fixation gene cluster, complete sequence Length = 4566 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 322 gcgcgaggccctcgaggaggccggc 346 ||||||||| ||||||||||||||| Sbjct: 3539 gcgcgaggcgctcgaggaggccggc 3563
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 48 atcttcttcttcttgttgttg 68 ||||||||||||||||||||| Sbjct: 13024093 atcttcttcttcttgttgttg 13024073 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 gaaggcgagggcgagctgga 231 |||||||||||||||||||| Sbjct: 3172158 gaaggcgagggcgagctgga 3172139
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 25939607 tcttcttcttcttgttgttgc 25939587 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 38 atctctcatcatcttcttctt 58 ||||||||||||||||||||| Sbjct: 24661229 atctctcatcatcttcttctt 24661249
>emb|AL954829.6|CNS08CD5 Oryza sativa chromosome 12, . BAC OSJNBa0044E20 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 140383 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 38 atctctcatcatcttcttctt 58 ||||||||||||||||||||| Sbjct: 40180 atctctcatcatcttcttctt 40200
>emb|AL713940.4|CNS07YPM Oryza sativa chromosome 12, . BAC OJ1327_A12 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 161806 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttgc 69 ||||||||||||||||||||| Sbjct: 100240 tcttcttcttcttgttgttgc 100260
>gb|AF000657.1|ATAF000657 Arabidopsis thaliana BAC F19G10, complete sequence Length = 92948 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 40 ctctcatcatcttcttcttct 60 ||||||||||||||||||||| Sbjct: 49450 ctctcatcatcttcttcttct 49470
>gb|AC073405.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0036D10, complete sequence Length = 156772 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgt 63 ||||||||||||||||||||| Sbjct: 28972 tcatcatcttcttcttcttgt 28992
>gb|AC152969.1| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0098I11, complete sequence Length = 122970 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgt 63 ||||||||||||||||||||| Sbjct: 38201 tcatcatcttcttcttcttgt 38221
>gb|AC115058.17| Mus musculus chromosome 5, clone RP24-381E3, complete sequence Length = 187046 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 105732 tcttcttcttcttgttgttg 105713
>ref|NM_100563.3| Arabidopsis thaliana peptidase/ serine-type peptidase AT1G06870 mRNA, complete cds Length = 1687 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 31 tcttcttcttcttgttgttg 12
>ref|NM_125283.3| Arabidopsis thaliana unknown protein AT5G58930 mRNA, complete cds Length = 2147 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 712 ctcatcatcttcttcttctt 693
>ref|NM_105536.3| Arabidopsis thaliana PAN (PERIANTHIA); DNA binding / transcription factor AT1G68640 (PAN) mRNA, complete cds Length = 1762 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 37 catctctcatcatcttcttcttct 60 ||||| |||||||||||||||||| Sbjct: 203 catctttcatcatcttcttcttct 226
>ref|NM_126697.1| Arabidopsis thaliana unknown protein AT2G07280 mRNA, complete cds Length = 1206 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 46 tcatcttcttcttcttgttg 65 |||||||||||||||||||| Sbjct: 307 tcatcttcttcttcttgttg 288
>ref|XM_631926.1| Dictyostelium discoideum hypothetical protein (DDB0219268), partial mRNA Length = 3693 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 2270 tcttcttcttcttgttgttg 2251
>ref|XM_633446.1| Dictyostelium discoideum hypothetical protein (DDB0186048), partial mRNA Length = 4377 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 1571 tcttcttcttcttgttgttg 1552
>ref|XM_633133.1| Dictyostelium discoideum hypothetical protein (DDB0186668), partial mRNA Length = 3267 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 2257 cttcttcttcttgttgttgc 2238
>ref|XM_632312.1| Dictyostelium discoideum hypothetical protein (DDB0218887), partial mRNA Length = 2301 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 2099 tcttcttcttcttgttgttg 2080
>ref|XM_476285.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2406 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 161 tcttcttcttcttgttgttg 142
>ref|NM_183532.1| Oryza sativa (japonica cultivar-group), mRNA Length = 552 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 gaaggcgagggcgagctgga 231 |||||||||||||||||||| Sbjct: 189 gaaggcgagggcgagctgga 170
>ref|XM_640590.1| Dictyostelium discoideum hypothetical protein (DDB0216801), partial mRNA Length = 3123 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 944 tcttcttcttcttgttgttg 925
>ref|XM_639104.1| Dictyostelium discoideum hypothetical protein (DDB0217562), partial mRNA Length = 4401 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 3926 tcttcttcttcttgttgttg 3907
>ref|XM_638425.1| Dictyostelium discoideum hypothetical protein (DDB0217700), partial mRNA Length = 3873 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 77 tcttcttcttcttgttgttg 58
>ref|XM_638091.1| Dictyostelium discoideum hypothetical protein (DDB0203816), partial mRNA Length = 2724 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 656 tcttcttcttcttgttgttg 637
>ref|XM_637150.1| Dictyostelium discoideum hypothetical protein (DDB0205321), partial mRNA Length = 1710 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 977 tcttcttcttcttgttgttg 958
>ref|XM_633898.1| Dictyostelium discoideum hypothetical protein (DDB0185655), partial mRNA Length = 1137 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 923 tcttcttcttcttgttgttg 904
>ref|XM_629846.1| Dictyostelium discoideum hypothetical protein (DDB0184244), partial mRNA Length = 4710 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 3986 tcttcttcttcttgttgttg 3967
>ref|XM_629293.1| Dictyostelium discoideum hypothetical protein (DDB0191750), partial mRNA Length = 1392 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 683 tcttcttcttcttgttgttg 664
>ref|NM_187687.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1908 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 277 caagggcgggtgggagctggacga 300 ||||| |||||||||||||||||| Sbjct: 1518 caaggccgggtgggagctggacga 1541
>ref|XM_465994.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1324 Score = 40.1 bits (20), Expect = 6.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 323 cgcgaggccctcgaggaggccggcgtca 350 ||||||||| | |||||||||||||||| Sbjct: 473 cgcgaggccatggaggaggccggcgtca 500
>ref|XM_466202.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1722 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 211 tcttcttcttcttgttgttg 230
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 14 gccgcttcttgcaaccatccatcc 37 ||||||||||| |||||||||||| Sbjct: 2054779 gccgcttcttgaaaccatccatcc 2054756
>ref|NM_192666.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 501 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 gaaggcgagggcgagctgga 231 |||||||||||||||||||| Sbjct: 351 gaaggcgagggcgagctgga 332
>ref|NM_186181.2| Oryza sativa (japonica cultivar-group), mRNA Length = 655 Score = 40.1 bits (20), Expect = 6.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgcaacgaaacgag 80 ||||||||||||| || || |||||||||||| Sbjct: 52 tcttcttcttcttcttcttccaacgaaacgag 21
>ref|NM_001015967.2| Xenopus tropicalis hypothetical protein LOC548721 (LOC548721), mRNA Length = 626 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 389 ctcatcatcttcttcttctt 370
>gb|AE017352.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 12, complete sequence Length = 906719 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 709797 ctcatcatcttcttcttctt 709778
>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete sequence Length = 1438950 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 1227947 ctcatcatcttcttcttctt 1227966
>gb|AY023011.1| Oryza sativa microsatellite MRG5336 containing (GAA)X8, genomic sequence Length = 224 Score = 40.1 bits (20), Expect = 6.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgcaacgaaacgag 80 ||||||||||||| || || |||||||||||| Sbjct: 120 tcttcttcttcttcttcttccaacgaaacgag 89
>gb|AY023007.1| Oryza sativa microsatellite MRG5332 containing (GAA)X8, genomic sequence Length = 224 Score = 40.1 bits (20), Expect = 6.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttgcaacgaaacgag 80 ||||||||||||| || || |||||||||||| Sbjct: 120 tcttcttcttcttcttcttccaacgaaacgag 89
>gb|AC120527.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0011J22 map R10571S, complete sequence Length = 154441 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 212 gaaggcgagggcgagctgga 231 |||||||||||||||||||| Sbjct: 151532 gaaggcgagggcgagctgga 151551
>gb|AC120506.5| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0006O08 map S15179S, complete sequence Length = 166005 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 42375 tcttcttcttcttgttgttg 42394
>gb|AC154240.2| Mus musculus BAC clone RP24-170E23 from chromosome 12, complete sequence Length = 160191 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 87109 ctcatcatcttcttcttctt 87128
>gb|AC147818.2| Xenopus tropicalis clone CH216-10M9, complete sequence Length = 58071 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 48987 cttcttcttcttgttgttgc 48968
>ref|XM_322365.1| Neurospora crassa OR74A predicted protein (NCU00280.1) partial mRNA Length = 2820 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 2591 tcttcttcttcttgttgttg 2572
>ref|XM_324405.1| Neurospora crassa OR74A predicted protein (NCU05049.1) partial mRNA Length = 1248 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 1135 tcttcttcttcttgttgttg 1116
>ref|XM_951330.1| Neurospora crassa OR74A hypothetical protein (NCU05049.1) partial mRNA Length = 1248 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 1135 tcttcttcttcttgttgttg 1116
>ref|XM_952658.1| Neurospora crassa OR74A hypothetical protein (NCU00280.1) partial mRNA Length = 2820 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 2591 tcttcttcttcttgttgttg 2572
>gb|AY641547.1| Halomonas maura nitrate-reductase operon, complete sequence Length = 8823 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 ggcgcgaggccctcgaggag 340 |||||||||||||||||||| Sbjct: 2348 ggcgcgaggccctcgaggag 2367
>ref|XM_717410.1| Candida albicans SC5314 putative RNA polymerase II transcription elongation factor (CaO19_1453), mRNA Length = 2871 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 261 ctcatcatcttcttcttctt 242
>ref|XM_717271.1| Candida albicans SC5314 putative RNA polymerase II transcription elongation factor (CaO19_9028), mRNA Length = 2871 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 261 ctcatcatcttcttcttctt 242
>ref|XM_716800.1| Candida albicans SC5314 hypothetical protein (CaO19_3984), mRNA Length = 2529 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 689 tcttcttcttcttgttgttg 670
>ref|XM_715461.1| Candida albicans SC5314 hypothetical protein (CaO19_4245), mRNA Length = 1347 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 539 tcttcttcttcttgttgttg 520
>ref|XM_713771.1| Candida albicans SC5314 hypothetical protein (CaO19_6277), mRNA Length = 1845 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 1273 tcttcttcttcttgttgttg 1292
>ref|XM_711153.1| Candida albicans SC5314 hypothetical protein (CaO19_6407), mRNA Length = 1353 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 531 ctcatcatcttcttcttctt 512
>ref|XM_711070.1| Candida albicans SC5314 hypothetical protein (CaO19_13765), mRNA Length = 1353 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 531 ctcatcatcttcttcttctt 512
>ref|XM_708015.1| Candida albicans SC5314 hypothetical protein (CaO19.8345), mRNA Length = 1449 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 170 tcttcttcttcttgttgttg 151
>ref|XM_707992.1| Candida albicans SC5314 hypothetical protein (CaO19.726), mRNA Length = 1449 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 170 tcttcttcttcttgttgttg 151
>ref|XM_706215.1| Candida albicans SC5314 hypothetical protein (CaO19.6608), mRNA Length = 2169 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 1952 tcttcttcttcttgttgttg 1933
>ref|XM_452285.1| Kluyveromyces lactis NRRL Y-1140, KLLA0C01991g predicted mRNA Length = 2121 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 2072 tcttcttcttcttgttgttg 2053
>gb|AY914981.1| Schistosoma japonicum SJCHGC01991 protein mRNA, partial cds Length = 875 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttgttgt 66 ||||||||||||||||||| |||| Sbjct: 53 tcatcatcttcttcttcttcttgt 76
>ref|XM_813532.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510627.80) partial mRNA Length = 993 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 940 cttcttcttcttgttgttgc 959
>ref|XM_813534.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510627.110) partial mRNA Length = 939 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 886 cttcttcttcttgttgttgc 905
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 35644597 tcttcttcttcttgttgttg 35644616 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 277 caagggcgggtgggagctggacga 300 ||||| |||||||||||||||||| Sbjct: 6361859 caaggccgggtgggagctggacga 6361836 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 tcatcatcttcttcttcttg 62 |||||||||||||||||||| Sbjct: 4147297 tcatcatcttcttcttcttg 4147316
>gb|AY190952.1| Drosophila virilis clone DVIF01_45_G15 (D1418) genomic sequence Length = 39016 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 32741 tcttcttcttcttgttgttg 32722
>gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosome 12, complete sequence Length = 171538 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 cttgcaaccatccatccatc 40 |||||||||||||||||||| Sbjct: 49836 cttgcaaccatccatccatc 49855
>emb|CR848420.2| Xenopus tropicalis finished cDNA, clone TNeu114n09 Length = 626 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 389 ctcatcatcttcttcttctt 370
>ref|XM_813599.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508433.90) partial mRNA Length = 837 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 787 cttcttcttcttgttgttgc 806
>ref|XM_384311.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG04135.1) partial mRNA Length = 1548 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 43 tcatcatcttcttcttcttg 62 |||||||||||||||||||| Sbjct: 179 tcatcatcttcttcttcttg 160
>ref|XM_568144.1| Cryptococcus neoformans var. neoformans JEC21 cytoplasm protein (CNL06170) partial mRNA Length = 1699 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 686 ctcatcatcttcttcttctt 667
>ref|XM_571707.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNF04210) partial mRNA Length = 2274 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 ctcatcatcttcttcttctt 61 |||||||||||||||||||| Sbjct: 77 ctcatcatcttcttcttctt 58
>gb|AC138299.14| Mus musculus chromosome 18, clone RP23-296E4, complete sequence Length = 257153 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 256932 tcttcttcttcttgttgttg 256913
>gb|AY459336.1| Oryza sativa (japonica cultivar-group) clone CL034244.2 R2R3-MYB gene region Length = 65993 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 59069 tcttcttcttcttgttgttg 59088
>ref|XM_449407.1| Candida glabrata CBS138 hypothetical protein (CAGL0M01430g) partial mRNA Length = 2256 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 tctcatcatcttcttcttct 60 |||||||||||||||||||| Sbjct: 1417 tctcatcatcttcttcttct 1398
>ref|XM_797823.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510011.9) partial mRNA Length = 921 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 874 cttcttcttcttgttgttgc 893
>ref|XM_799482.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508327.10) partial mRNA Length = 1227 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1174 cttcttcttcttgttgttgc 1193
>ref|XM_799704.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053505075.20) partial mRNA Length = 1296 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 176 tcttcttcttcttgttgttg 157
>ref|XM_800091.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510833.20) partial mRNA Length = 753 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 700 cttcttcttcttgttgttgc 719
>ref|XM_800400.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506601.40) partial mRNA Length = 1290 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1237 cttcttcttcttgttgttgc 1256
>ref|XM_800629.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053507833.10) partial mRNA Length = 849 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 802 cttcttcttcttgttgttgc 821
>ref|XM_801099.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510015.30) partial mRNA Length = 1935 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1882 cttcttcttcttgttgttgc 1901
>ref|XM_801309.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053511611.20) partial mRNA Length = 978 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 925 cttcttcttcttgttgttgc 944
>ref|XM_802095.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506611.10) partial mRNA Length = 1176 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1123 cttcttcttcttgttgttgc 1142
>ref|XM_801994.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053510001.20) partial mRNA Length = 2466 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 2450 tcttcttcttcttgttgttg 2431
>ref|XM_802646.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508305.50) partial mRNA Length = 729 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 682 cttcttcttcttgttgttgc 701
>ref|XM_803090.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053503533.40) partial mRNA Length = 1179 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1126 cttcttcttcttgttgttgc 1145
>ref|XM_803281.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508939.30) partial mRNA Length = 1125 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1072 cttcttcttcttgttgttgc 1091
>ref|XM_803372.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510191.10) partial mRNA Length = 1164 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1111 cttcttcttcttgttgttgc 1130
>ref|XM_803763.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506361.50) partial mRNA Length = 1143 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1096 cttcttcttcttgttgttgc 1115
>ref|XM_804522.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508071.60) partial mRNA Length = 756 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 703 cttcttcttcttgttgttgc 722
>ref|XM_804808.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053509867.60) partial mRNA Length = 1188 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1135 cttcttcttcttgttgttgc 1154
>ref|XM_805270.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053507067.60) partial mRNA Length = 1086 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1036 cttcttcttcttgttgttgc 1055
>ref|XM_805287.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508109.10) partial mRNA Length = 936 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 883 cttcttcttcttgttgttgc 902
>ref|XM_806543.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506879.10) partial mRNA Length = 966 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 915 tcttcttcttcttgttgttg 934
>ref|XM_807217.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508977.20) partial mRNA Length = 1419 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1366 cttcttcttcttgttgttgc 1385
>ref|XM_807222.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508977.130) partial mRNA Length = 1407 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1354 cttcttcttcttgttgttgc 1373
>ref|XM_808331.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510371.10) partial mRNA Length = 1569 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1516 cttcttcttcttgttgttgc 1535
>ref|XM_809113.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053504213.20) partial mRNA Length = 2586 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 41 tctcatcatcttcttcttcttgtt 64 ||||||| |||||||||||||||| Sbjct: 475 tctcatcctcttcttcttcttgtt 452
>ref|XM_809127.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510201.20) partial mRNA Length = 1176 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1123 cttcttcttcttgttgttgc 1142
>ref|XM_809528.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510715.30) partial mRNA Length = 1053 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1000 cttcttcttcttgttgttgc 1019
>ref|XM_809529.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510715.40) partial mRNA Length = 804 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 757 cttcttcttcttgttgttgc 776
>ref|XM_810181.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053508857.100) partial mRNA Length = 2580 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 41 tctcatcatcttcttcttcttgtt 64 ||||||| |||||||||||||||| Sbjct: 475 tctcatcctcttcttcttcttgtt 452
>ref|XM_810415.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506667.40) partial mRNA Length = 867 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 814 cttcttcttcttgttgttgc 833
>ref|XM_811456.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053508387.150) partial mRNA Length = 2817 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 1109 tcttcttcttcttgttgttg 1090
>ref|XM_816223.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510629.10) partial mRNA Length = 1194 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1141 cttcttcttcttgttgttgc 1160
>ref|XM_816232.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510629.350) partial mRNA Length = 1128 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1075 cttcttcttcttgttgttgc 1094
>ref|XM_816294.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053511173.270) partial mRNA Length = 834 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 781 cttcttcttcttgttgttgc 800
>ref|XM_816296.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053511173.360) partial mRNA Length = 831 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 778 cttcttcttcttgttgttgc 797
>ref|XM_816325.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053504081.460) partial mRNA Length = 1401 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1348 cttcttcttcttgttgttgc 1367
>ref|XM_816346.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508163.270) partial mRNA Length = 1467 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1414 cttcttcttcttgttgttgc 1433
>ref|XM_816821.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053511183.560) partial mRNA Length = 954 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 901 cttcttcttcttgttgttgc 920
>ref|XM_816667.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510359.380) partial mRNA Length = 648 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 595 cttcttcttcttgttgttgc 614
>ref|XM_816671.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510359.550) partial mRNA Length = 651 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 598 cttcttcttcttgttgttgc 617
>ref|XM_812755.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053504155.160) partial mRNA Length = 1101 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1048 cttcttcttcttgttgttgc 1067
>ref|XM_813218.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508761.90) partial mRNA Length = 1278 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1225 cttcttcttcttgttgttgc 1244
>ref|XM_813263.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510465.74) partial mRNA Length = 975 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 922 cttcttcttcttgttgttgc 941
>ref|XM_814047.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510363.70) partial mRNA Length = 975 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 922 cttcttcttcttgttgttgc 941
>ref|XM_814048.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510363.80) partial mRNA Length = 867 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 814 cttcttcttcttgttgttgc 833
>ref|XM_813908.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506067.70) partial mRNA Length = 1134 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1081 cttcttcttcttgttgttgc 1100
>ref|XM_814158.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053507959.210) partial mRNA Length = 1149 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1096 cttcttcttcttgttgttgc 1115
>ref|XM_814381.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053504427.40) partial mRNA Length = 711 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 212 tcttcttcttcttgttgttg 193
>ref|XM_814446.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510625.19) partial mRNA Length = 960 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 907 cttcttcttcttgttgttgc 926
>ref|XM_814450.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053507957.10) partial mRNA Length = 1401 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1348 cttcttcttcttgttgttgc 1367
>ref|XM_814487.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053507237.170) partial mRNA Length = 969 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 919 cttcttcttcttgttgttgc 938
>ref|XM_814629.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506763.150) partial mRNA Length = 1404 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1351 cttcttcttcttgttgttgc 1370
>ref|XM_814822.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053506789.150) partial mRNA Length = 2526 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 tcttcttcttcttgttgttg 68 |||||||||||||||||||| Sbjct: 821 tcttcttcttcttgttgttg 802
>ref|XM_814892.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506501.10) partial mRNA Length = 1404 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1351 cttcttcttcttgttgttgc 1370
>ref|XM_815211.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506245.200) partial mRNA Length = 1482 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1429 cttcttcttcttgttgttgc 1448
>ref|XM_815364.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510483.20) partial mRNA Length = 1146 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1093 cttcttcttcttgttgttgc 1112
>ref|XM_815392.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508165.170) partial mRNA Length = 1233 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1180 cttcttcttcttgttgttgc 1199
>ref|XM_815400.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508165.350) partial mRNA Length = 1044 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 994 cttcttcttcttgttgttgc 1013
>ref|XM_815404.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508165.420) partial mRNA Length = 1053 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1000 cttcttcttcttgttgttgc 1019
>ref|XM_815556.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506599.390) partial mRNA Length = 1296 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1243 cttcttcttcttgttgttgc 1262
>ref|XM_815645.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510275.190) partial mRNA Length = 1020 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 967 cttcttcttcttgttgttgc 986
>ref|XM_815989.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510279.190) partial mRNA Length = 1473 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1420 cttcttcttcttgttgttgc 1439
>ref|XM_815990.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510279.210) partial mRNA Length = 1320 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1267 cttcttcttcttgttgttgc 1286
>ref|XM_816052.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053507071.180) partial mRNA Length = 1410 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 1366 cttcttcttcttgttgttgc 1385
>ref|XM_797174.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053510539.10) partial mRNA Length = 504 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 451 cttcttcttcttgttgttgc 470
>ref|XM_797430.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053432443.10) partial mRNA Length = 738 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 685 cttcttcttcttgttgttgc 704
>ref|XM_797811.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053509093.10) partial mRNA Length = 620 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 50 cttcttcttcttgttgttgc 69 |||||||||||||||||||| Sbjct: 573 cttcttcttcttgttgttgc 592 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,627,095 Number of Sequences: 3902068 Number of extensions: 4627095 Number of successful extensions: 136105 Number of sequences better than 10.0: 357 Number of HSP's better than 10.0 without gapping: 376 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 132445 Number of HSP's gapped (non-prelim): 3640 length of query: 449 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 427 effective length of database: 17,147,199,772 effective search space: 7321854302644 effective search space used: 7321854302644 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)