ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart09b11
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY541586.1| Hordeum vulgare WRKY transcription factor (wrky38... 178 2e-42
2emb|AJ536667.1|HVU536667 Hordeum vulgare mRNA for putative WRKY1... 165 3e-38
3emb|Z48431.1|AFABF2 A.fatua mRNA for DNA-binding protein (clone ... 92 3e-16
4gb|AC101984.13| Mus musculus chromosome 10, clone RP24-352K10, c... 40 1.0
5emb|AL645907.9| Mouse DNA sequence from clone RP23-9N7 on chromo... 40 1.0
6emb|BX538266.1|HSM806514 Homo sapiens genomic DNA; cDNA DKFZp686... 40 1.0
7gb|AC008888.7| Homo sapiens chromosome 19 clone CTD-2221F12, com... 40 1.0
8gb|AC026671.18| Homo sapiens 3 BAC RP11-91M9 (Roswell Park Cance... 40 1.0
9gb|AC022154.4| Homo sapiens chromosome 19 clone LLNLR-253H3, com... 40 1.0
10dbj|AK087018.1| Mus musculus 0 day neonate lung cDNA, RIKEN full... 40 1.0
11dbj|AB208807.1| Homo sapiens mRNA for D site of albumin promoter... 40 1.0
12gb|U48212.1|HUMDSITE1 Human D-site binding protein gene, promote... 40 1.0
13gb|BC059177.1| Mus musculus zinc finger and BTB domain containin... 38 4.1
14ref|NM_001040116.1| Pan troglodytes nurim (nuclear envelope memb... 38 4.1
15gb|AC183761.3| Pan troglodytes BAC clone CH251-710C5 from chromo... 38 4.1
16ref|XM_913925.2| PREDICTED: Mus musculus similar to zinc finger ... 38 4.1
17gb|AC125044.3| Mus musculus BAC clone RP23-348B10 from chromosom... 38 4.1
18ref|NM_001037596.1| Bos taurus nurim (nuclear envelope membrane ... 38 4.1
19gb|AC074085.7| Homo sapiens BAC clone RP11-3L10 from 7, complete... 38 4.1
20gb|AY358411.1| Homo sapiens clone DNA57702 NRM (UNQ555) mRNA, co... 38 4.1
21gb|AC122165.37| Medicago truncatula clone mth2-32m22, complete s... 38 4.1
22emb|AL845353.7| Human DNA sequence from clone DAQB-47P19 on chro... 38 4.1
23emb|AL732442.7| Human DNA sequence from clone XXbac-48F10 on chr... 38 4.1
24emb|AL662797.7| Human DNA sequence from clone XXbac-252P9 on chr... 38 4.1
25emb|AL591643.4| Human DNA sequence from clone CTD-2076M15 on chr... 38 4.1
26emb|AL445201.14| Human DNA sequence from clone RP11-358L16 on ch... 38 4.1
27emb|AL390115.18| Human DNA sequence from clone RP11-479J7 on chr... 38 4.1
28emb|AL354807.6| Human DNA sequence from clone RP11-522F22 on chr... 38 4.1
29emb|AL121986.12|HSBA101J8 Human DNA sequence from clone RP11-101... 38 4.1
30emb|AL662812.12| Mouse DNA sequence from clone RP23-48A2 on chro... 38 4.1
31emb|CR788240.3| Human DNA sequence from clone DAMC-316D20 on chr... 38 4.1
32emb|CR759873.4| Human DNA sequence from clone DAAP-285E11 on chr... 38 4.1
33dbj|AK220256.1| Mus musculus mRNA for mKIAA0478 protein 38 4.1
34dbj|AB210178.1| Pan troglodytes NRM gene for nuclear envelope me... 38 4.1
35dbj|AB210177.1| Pan troglodytes NRM gene for nuclear envelope me... 38 4.1
36gb|AC095351.5| Homo sapiens X BAC RP11-359C4 (Roswell Park Cance... 38 4.1
37dbj|AB202096.1| Homo sapiens NRM gene for nurim (nuclear envelop... 38 4.1
38emb|CR623441.1| full-length cDNA clone CS0DB002YM05 of Neuroblas... 38 4.1
39emb|CR619257.1| full-length cDNA clone CS0DA010YD12 of Neuroblas... 38 4.1
40emb|CR618359.1| full-length cDNA clone CS0DB009YG03 of Neuroblas... 38 4.1
41emb|CR614897.1| full-length cDNA clone CS0DB006YD15 of Neuroblas... 38 4.1
42emb|CR608026.1| full-length cDNA clone CS0DK011YE09 of HeLa cell... 38 4.1
43emb|CR604619.1| full-length cDNA clone CS0DA006YB16 of Neuroblas... 38 4.1
44emb|CR604044.1| full-length cDNA clone CS0DL008YE02 of B cells (... 38 4.1
45dbj|AK075509.1| Homo sapiens cDNA PSEC0207 fis, clone HEMBA10029... 38 4.1
46emb|CR597197.1| full-length cDNA clone CS0DI016YE23 of Placenta ... 38 4.1
47emb|CR596567.1| full-length cDNA clone CS0DC004YH09 of Neuroblas... 38 4.1
48emb|CR592223.1| full-length cDNA clone CS0DI086YJ20 of Placenta ... 38 4.1
49gb|AF326231.2| Euglena laciniata 18S small subunit ribosomal RNA... 38 4.1
50gb|AF329972.1|AF329972S1 Euglena cantabrica 18S small subunit ri... 38 4.1
51gb|AC087236.11| Homo sapiens 12 BAC RP11-127B1 (Roswell Park Can... 38 4.1
52gb|BC021260.1|BC021260 Homo sapiens, clone IMAGE:4135057, mRNA, ... 38 4.1
53gb|AC025475.5| Homo sapiens chromosome 5 clone RP11-351N6, compl... 38 4.1
54gb|BC059859.1| Mus musculus zinc finger and BTB domain containin... 38 4.1
55gb|BC109506.1| Bos taurus cDNA clone MGC:134557 IMAGE:8050653, c... 38 4.1
56dbj|AK048974.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 38 4.1
57gb|AC148659.1| Macaca mulatta Major Histocompatibility Complex B... 38 4.1
58dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 38 4.1
59gb|AY910576.1| Paracoccidioides brasiliensis Ras2 (ras2) mRNA, c... 38 4.1
60emb|BX908728.7| Human DNA sequence from clone DAMA-178G23 on chr... 38 4.1
61dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 38 4.1
62gb|AC084866.5| Homo sapiens BAC clone RP11-6E9 from 4, complete ... 38 4.1
63gb|AC113431.2| Homo sapiens chromosome 5 clone RP11-90F2, comple... 38 4.1
64dbj|AP002537.2| Oryza sativa (japonica cultivar-group) genomic D... 38 4.1
65dbj|AP003417.2| Oryza sativa (japonica cultivar-group) genomic D... 38 4.1
66ref|NM_001002104.1| Danio rerio zgc:86877 (zgc:86877), mRNA 38 4.1
67ref|NM_007243.1| Homo sapiens nurim (nuclear envelope membrane p... 38 4.1
68gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 38 4.1
69dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 38 4.1
70dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility co... 38 4.1
71dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 38 4.1
72dbj|AB110936.1| Homo sapiens NRM gene for nuclear envelope membr... 38 4.1
73dbj|AB110935.1| Homo sapiens NRM gene for nuclear envelope membr... 38 4.1
74emb|AL929202.6| Zebrafish DNA sequence from clone DKEY-147L19, c... 38 4.1
75gb|BC071508.1| Danio rerio zgc:86877, mRNA (cDNA clone MGC:86877... 38 4.1
76gb|BC039865.1| Homo sapiens nurim (nuclear envelope membrane pro... 38 4.1
77gb|AF143676.1|AF143676 Homo sapiens multispanning nuclear envelo... 38 4.1
78emb|AJ532421.1|EGR532421 Euglena granulata partial 18S rRNA gene... 38 4.1
79emb|AJ532420.1|ELA532420 Euglena laciniata partial 18S rRNA gene... 38 4.1
80gb|AC124707.4| Mus musculus BAC clone RP24-73H16 from 12, comple... 38 4.1
81gb|AC132481.4| Mus musculus BAC clone RP23-14I14 from 17, comple... 38 4.1
82emb|CR936878.10| Human DNA sequence from clone DADB-118P11 on ch... 38 4.1
83ref|NM_198248.1| Mus musculus zinc finger and BTB domain contain... 38 4.1
84emb|AL627214.15| Mouse DNA sequence from clone RP23-357K18 on ch... 38 4.1
85dbj|AP002532.1| Homo sapiens genomic DNA, chromosome 1q22-q23, C... 38 4.1
86dbj|AB045358.1| Homo sapiens genomic DNA, chromosome 1q22-q23, c... 38 4.1
87dbj|AB023049.1| Homo sapiens genomic DNA, chromosome 6p21.3, HLA... 38 4.1 
>gb|AY541586.1| Hordeum vulgare WRKY transcription factor (wrky38) gene, complete
           cds
          Length = 1667

 Score =  178 bits (90), Expect = 2e-42
 Identities = 93/94 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   agcgcgtggtgtttgagggaccaatggatccatggatgggcagccagccatccctgagcc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 116 agcgcgtggtgtttgagggaccaatggatccatggatgggcagccagccatccctgagcc 175

                                             
Query: 61  tcgacctgcacgtccgcctaccgccgatggggca 94
           |||||||||||||| |||||||||||||||||||
Sbjct: 176 tcgacctgcacgtcggcctaccgccgatggggca 209
to top
>emb|AJ536667.1|HVU536667 Hordeum vulgare mRNA for putative WRKY1 protein
          Length = 1454

 Score =  165 bits (83), Expect = 3e-38
 Identities = 86/87 (98%)
 Strand = Plus / Plus

                                                                      
Query: 8  ggtgtttgagggaccaatggatccatggatgggcagccagccatccctgagcctcgacct 67
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1  ggtgtttgagggaccaatggatccatggatgggcagccagccatccctgagcctcgacct 60

                                     
Query: 68 gcacgtccgcctaccgccgatggggca 94
          ||||||| |||||||||||||||||||
Sbjct: 61 gcacgtcggcctaccgccgatggggca 87
to top
>emb|Z48431.1|AFABF2 A.fatua mRNA for DNA-binding protein (clone ABF2)
          Length = 1283

 Score = 91.7 bits (46), Expect = 3e-16
 Identities = 64/70 (91%)
 Strand = Plus / Plus

                                                                       
Query: 22  caatggatccatggatgggcagccagccatccctgagcctcgacctgcacgtccgcctac 81
           |||||||||||||||| ||||||||||| ||||| ||||| |||||||||||| |||| |
Sbjct: 106 caatggatccatggatcggcagccagccttccctcagccttgacctgcacgtcggcctgc 165

                     
Query: 82  cgccgatggg 91
           ||||||||||
Sbjct: 166 cgccgatggg 175
to top
>gb|AC101984.13| Mus musculus chromosome 10, clone RP24-352K10, complete sequence
          Length = 167874

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 43    gccagccatccctgagcctc 62
             ||||||||||||||||||||
Sbjct: 77775 gccagccatccctgagcctc 77794
to top
>emb|AL645907.9| Mouse DNA sequence from clone RP23-9N7 on chromosome 11 Contains the 5'
              end of a novel gene, a novel gene, the Clk4 gene for CDC
              like kinase 4, the 5' end of the Col23a1 gene for
              procollagen (type XXIII, alpha 1) and two CpG islands,
              complete sequence
          Length = 219268

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 32     atggatgggcagccagccat 51
              ||||||||||||||||||||
Sbjct: 142696 atggatgggcagccagccat 142677
to top
>emb|BX538266.1|HSM806514 Homo sapiens genomic DNA; cDNA DKFZp686P0190 (from clone
            DKFZp686P0190)
          Length = 7479

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 9    gtgtttgagggaccaatgga 28
            ||||||||||||||||||||
Sbjct: 3592 gtgtttgagggaccaatgga 3611
to top
>gb|AC008888.7| Homo sapiens chromosome 19 clone CTD-2221F12, complete sequence
          Length = 119631

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    agggaccaatggatccatgg 35
             ||||||||||||||||||||
Sbjct: 14800 agggaccaatggatccatgg 14781
to top
>gb|AC026671.18| Homo sapiens 3 BAC RP11-91M9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 141674

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     gtgtttgagggaccaatgga 28
             ||||||||||||||||||||
Sbjct: 22771 gtgtttgagggaccaatgga 22752
to top
>gb|AC022154.4| Homo sapiens chromosome 19 clone LLNLR-253H3, complete sequence
          Length = 38149

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 16    agggaccaatggatccatgg 35
             ||||||||||||||||||||
Sbjct: 36850 agggaccaatggatccatgg 36831
to top
>dbj|AK087018.1| Mus musculus 0 day neonate lung cDNA, RIKEN full-length enriched
            library, clone:E030020C10 product:unclassifiable, full
            insert sequence
          Length = 1573

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 32   atggatgggcagccagccat 51
            ||||||||||||||||||||
Sbjct: 1379 atggatgggcagccagccat 1360
to top
>dbj|AB208807.1| Homo sapiens mRNA for D site of albumin promoter (albumin D-box)
            binding protein variant protein
          Length = 5756

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 16   agggaccaatggatccatgg 35
            ||||||||||||||||||||
Sbjct: 1043 agggaccaatggatccatgg 1062
to top
>gb|U48212.1|HUMDSITE1 Human D-site binding protein gene, promoter region and exons 1, 2,
            and 3
          Length = 4772

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 16   agggaccaatggatccatgg 35
            ||||||||||||||||||||
Sbjct: 2673 agggaccaatggatccatgg 2692
to top
>gb|BC059177.1| Mus musculus zinc finger and BTB domain containing 40, mRNA (cDNA
            clone MGC:62412 IMAGE:6410689), complete cds
          Length = 7208

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 28   atccatggatgggcagccagcca 50
            ||||| |||||||||||||||||
Sbjct: 5846 atccaaggatgggcagccagcca 5824
to top
>ref|NM_001040116.1| Pan troglodytes nurim (nuclear envelope membrane protein) (NRM),
           mRNA
          Length = 789

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 160 gggcagccagccatccctg 142
to top
>gb|AC183761.3| Pan troglodytes BAC clone CH251-710C5 from chromosome 7, complete
              sequence
          Length = 205916

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 40     gcagccagccatccctgagcctc 62
              |||||||||||| ||||||||||
Sbjct: 119948 gcagccagccatgcctgagcctc 119970
to top
>ref|XM_913925.2| PREDICTED: Mus musculus similar to zinc finger and BTB domain
            containing 40 (LOC638050), mRNA
          Length = 6309

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 28   atccatggatgggcagccagcca 50
            ||||| |||||||||||||||||
Sbjct: 4971 atccaaggatgggcagccagcca 4949
to top
>gb|AC125044.3| Mus musculus BAC clone RP23-348B10 from chromosome 17, complete sequence
          Length = 222615

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 28     atccatggatgggcagcca 46
              |||||||||||||||||||
Sbjct: 217623 atccatggatgggcagcca 217641
to top
>ref|NM_001037596.1| Bos taurus nurim (nuclear envelope membrane protein) (NRM), mRNA
          Length = 1579

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 359 gggcagccagccatccctg 341
to top
>gb|AC074085.7| Homo sapiens BAC clone RP11-3L10 from 7, complete sequence
          Length = 155260

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 40    gcagccagccatccctgagcctc 62
             |||||||||||| ||||||||||
Sbjct: 24738 gcagccagccatgcctgagcctc 24760
to top
>gb|AY358411.1| Homo sapiens clone DNA57702 NRM (UNQ555) mRNA, complete cds
          Length = 1425

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 179 gggcagccagccatccctg 161
to top
>gb|AC122165.37| Medicago truncatula clone mth2-32m22, complete sequence
          Length = 148586

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    tttgagggaccaatggatc 30
             |||||||||||||||||||
Sbjct: 44590 tttgagggaccaatggatc 44608
to top
>emb|AL845353.7| Human DNA sequence from clone DAQB-47P19 on chromosome 6 Contains the
             3' end of the MRPS18B gene for mitochondrial ribosomal
             protein S18B, the C6orf134 gene for chromosome 6 open
             reading frame 134, the C6orf136 gene for chromosome 6 open
             reading frame 136, the DHX16 gene for DEAD/H
             (Asp-Glu-Ala-Asp/His) box polypeptide 16, the KIAA1949
             gene, the NRM gene for nurim (nuclear envelope membrane
             protein), the RPL7P4 pseudogene for ribosomal protein L7
             pseudogene 4, the MDC1 gene for mediator of DNA damage
             checkpoint 1, the TUBB gene for tubulin, beta polypeptide,
             the FLOT1 gene for flotillin 1, the IER3 gene for
             immediate early response 3 and 8 CpG islands, complete
             sequence
          Length = 130755

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    gggcagccagccatccctg 56
             |||||||||||||||||||
Sbjct: 73451 gggcagccagccatccctg 73469
to top
>emb|AL732442.7| Human DNA sequence from clone XXbac-48F10 on chromosome 6 contains the
             3' end of the MRPS18B gene for mitochondrial ribosomal
             protein S18B, two novel proteins, a prothymosin, alpha
             (PTMA) pseudogene, the DDX16 gene for DEAD/H box
             polypeptide 16 , the gene for KIAA1949 protein, the NRM
             gene for nurim and four CpG islands, complete sequence
          Length = 71418

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    gggcagccagccatccctg 56
             |||||||||||||||||||
Sbjct: 67820 gggcagccagccatccctg 67838
to top
>emb|AL662797.7| Human DNA sequence from clone XXbac-252P9 on chromosome 6 contains the
             3' end of a putative novel transcript, the NRM gene for
             nurim (nuclear envelope membrane protein), a ribosomal
             protein L7 (RPL7) pseudogene, the gene for KIAA0170
             protein, the TUBB gene for tubulin, beta polypeptide, the
             FLOT1 gene for flotillin 1, the IER3 gene for immediate
             early response 3, a putative novel transcript and five CpG
             islands, complete sequence
          Length = 171627

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    gggcagccagccatccctg 56
             |||||||||||||||||||
Sbjct: 13302 gggcagccagccatccctg 13320
to top
>emb|AL591643.4| Human DNA sequence from clone CTD-2076M15 on chromosome Xq23-24,
             complete sequence
          Length = 61143

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 40    gcagccagccatccctgagcctc 62
             |||||||||||| ||||||||||
Sbjct: 18280 gcagccagccatgcctgagcctc 18258
to top
>emb|AL445201.14| Human DNA sequence from clone RP11-358L16 on chromosome 10 Contains a
             AFR GTPase-activating protein (MRIP2) pseudogene, a novel
             gene, gene LOC93550, the 3' end of a KIAA0592 pseudogene
             and three CpG islands, complete sequence
          Length = 179193

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 40    gcagccagccatccctgagcctc 62
             |||||||||||| ||||||||||
Sbjct: 59747 gcagccagccatgcctgagcctc 59769
to top
>emb|AL390115.18| Human DNA sequence from clone RP11-479J7 on chromosome 1 Contains a
             novel gene and the 3' end of a novel gene, complete
             sequence
          Length = 102533

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 40    gcagccagccatccctgagcctc 62
             |||||||||||| ||||||||||
Sbjct: 44479 gcagccagccatgcctgagcctc 44457
to top
>emb|AL354807.6| Human DNA sequence from clone RP11-522F22 on chromosome 13 Contains a
              DnaJ (Hsp40) homolog, subfamily A, member 1 (DNAJA1)
              pseudogene, complete sequence
          Length = 157135

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 40     gcagccagccatccctgagcctc 62
              |||||||||||| ||||||||||
Sbjct: 146456 gcagccagccatgcctgagcctc 146434
to top
>emb|AL121986.12|HSBA101J8 Human DNA sequence from clone RP11-101J8 on chromosome 1q21.2-22 Contains
              the CD1A gene for CD1A antigen, a polypeptide, a
              high-mobility group nucleosome binding domain 1 (HMGN1)
              pseudogene, the CD1C gene for CD1C antigen, c polypeptide,
              the CD1B gene for CD1B antigen, b polypeptide, the CD1E
              gene for CD1E antigen, e polypeptide, the OR10T2 gene for
              olfactory receptor, family 10, subfamily T, member 2 and
              the OR10K2 gene for olfactory receptor, family 10,
              subfamily K, member 2, complete sequence
          Length = 168753

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 40     gcagccagccatccctgagcctc 62
              |||||||||||| ||||||||||
Sbjct: 120696 gcagccagccatgcctgagcctc 120674
to top
>emb|AL662812.12| Mouse DNA sequence from clone RP23-48A2 on chromosome 11 Contains the
              gene for a novel protein similar to smoothelin Smtn, three
              novel genes, the Mybbp1a gene for MYB binding protein
              (P160) 1a, a ribosomal protein 7a (Rpl7a) pseudogene, the
              5' end of the Ube2g1 gene for ubiquitin-conjugating enzyme
              E2G 1 (UBC7 homolog, C. elegans) and four CpG islands,
              complete sequence
          Length = 258521

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     tttgagggaccaatggatc 30
              |||||||||||||||||||
Sbjct: 255896 tttgagggaccaatggatc 255914
to top
>emb|CR788240.3| Human DNA sequence from clone DAMC-316D20 on chromosome 6, complete
             sequence
          Length = 75074

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    gggcagccagccatccctg 56
             |||||||||||||||||||
Sbjct: 23754 gggcagccagccatccctg 23772
to top
>emb|CR759873.4| Human DNA sequence from clone DAAP-285E11 on chromosome 6, complete
             sequence
          Length = 72240

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    gggcagccagccatccctg 56
             |||||||||||||||||||
Sbjct: 31958 gggcagccagccatccctg 31976
to top
>dbj|AK220256.1| Mus musculus mRNA for mKIAA0478 protein
          Length = 7071

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 28   atccatggatgggcagccagcca 50
            ||||| |||||||||||||||||
Sbjct: 5731 atccaaggatgggcagccagcca 5709
to top
>dbj|AB210178.1| Pan troglodytes NRM gene for nuclear envelope membrane protein,
            complete cds, cell_line: Ericka
          Length = 4016

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 38   gggcagccagccatccctg 56
            |||||||||||||||||||
Sbjct: 1603 gggcagccagccatccctg 1585
to top
>dbj|AB210177.1| Pan troglodytes NRM gene for nuclear envelope membrane protein,
            complete cds, cell_line: Borie
          Length = 4016

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 38   gggcagccagccatccctg 56
            |||||||||||||||||||
Sbjct: 1603 gggcagccagccatccctg 1585
to top
>gb|AC095351.5| Homo sapiens X BAC RP11-359C4 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 194296

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 40     gcagccagccatccctgagcctc 62
              |||||||||||| ||||||||||
Sbjct: 183682 gcagccagccatgcctgagcctc 183704
to top
>dbj|AB202096.1| Homo sapiens NRM gene for nurim (nuclear envelope membrane protein),
            complete cds
          Length = 4012

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 38   gggcagccagccatccctg 56
            |||||||||||||||||||
Sbjct: 2411 gggcagccagccatccctg 2429
to top
>emb|CR623441.1| full-length cDNA clone CS0DB002YM05 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1352

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 140 gggcagccagccatccctg 122
to top
>emb|CR619257.1| full-length cDNA clone CS0DA010YD12 of Neuroblastoma of Homo
          sapiens (human)
          Length = 1265

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 38 gggcagccagccatccctg 56
          |||||||||||||||||||
Sbjct: 52 gggcagccagccatccctg 34
to top
>emb|CR618359.1| full-length cDNA clone CS0DB009YG03 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1374

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 144 gggcagccagccatccctg 126
to top
>emb|CR614897.1| full-length cDNA clone CS0DB006YD15 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1353

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 150 gggcagccagccatccctg 132
to top
>emb|CR608026.1| full-length cDNA clone CS0DK011YE09 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1406

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 169 gggcagccagccatccctg 151
to top
>emb|CR604619.1| full-length cDNA clone CS0DA006YB16 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1402

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 168 gggcagccagccatccctg 150
to top
>emb|CR604044.1| full-length cDNA clone CS0DL008YE02 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 1378

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 168 gggcagccagccatccctg 150
to top
>dbj|AK075509.1| Homo sapiens cDNA PSEC0207 fis, clone HEMBA1002981, highly similar
           to Homo sapiens multispanning nuclear envelope membrane
           protein nurim (NRM29) mRNA
          Length = 1754

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 514 gggcagccagccatccctg 496
to top
>emb|CR597197.1| full-length cDNA clone CS0DI016YE23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1403

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 173 gggcagccagccatccctg 155
to top
>emb|CR596567.1| full-length cDNA clone CS0DC004YH09 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1390

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 144 gggcagccagccatccctg 126
to top
>emb|CR592223.1| full-length cDNA clone CS0DI086YJ20 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1377

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 152 gggcagccagccatccctg 134
to top
>gb|AF326231.2| Euglena laciniata 18S small subunit ribosomal RNA gene, partial
            sequence
          Length = 1856

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 29   tccatggatgggcagccagccat 51
            |||||||||||||| ||||||||
Sbjct: 1228 tccatggatgggcatccagccat 1206
to top
>gb|AF329972.1|AF329972S1 Euglena cantabrica 18S small subunit ribosomal RNA gene, partial
            sequence
          Length = 1396

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 29   tccatggatgggcagccagccat 51
            |||||||||||||| ||||||||
Sbjct: 1134 tccatggatgggcatccagccat 1112
to top
>gb|AC087236.11| Homo sapiens 12 BAC RP11-127B1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 61010

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 40    gcagccagccatccctgagcctc 62
             |||||||||||| ||||||||||
Sbjct: 46749 gcagccagccatgcctgagcctc 46771
to top
>gb|BC021260.1|BC021260 Homo sapiens, clone IMAGE:4135057, mRNA, partial cds
          Length = 1406

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 150 gggcagccagccatccctg 132
to top
>gb|AC025475.5| Homo sapiens chromosome 5 clone RP11-351N6, complete sequence
          Length = 186462

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 40   gcagccagccatccctgagcctc 62
            |||||||||||| ||||||||||
Sbjct: 7147 gcagccagccatgcctgagcctc 7169
to top
>gb|BC059859.1| Mus musculus zinc finger and BTB domain containing 40, mRNA (cDNA
           clone IMAGE:6414843)
          Length = 2348

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 28  atccatggatgggcagccagcca 50
           ||||| |||||||||||||||||
Sbjct: 989 atccaaggatgggcagccagcca 967
to top
>gb|BC109506.1| Bos taurus cDNA clone MGC:134557 IMAGE:8050653, complete cds
          Length = 1579

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 359 gggcagccagccatccctg 341
to top
>dbj|AK048974.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:C230087D24 product:inferred:
            dJ61A9.2.1 (KIAA0478 (C2H2 type zinc finger protein)
            (isoform 1)) {Homo sapiens}, full insert sequence
          Length = 3846

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 28   atccatggatgggcagccagcca 50
            ||||| |||||||||||||||||
Sbjct: 2502 atccaaggatgggcagccagcca 2480
to top
>gb|AC148659.1| Macaca mulatta Major Histocompatibility Complex BAC MMU005H07, complete
              sequence
          Length = 174766

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     gggcagccagccatccctg 56
              |||||||||||||||||||
Sbjct: 147712 gggcagccagccatccctg 147730
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 10      tgtttgagggaccaatggatcca 32
               |||||||||||||||| ||||||
Sbjct: 5096326 tgtttgagggaccaattgatcca 5096304
to top
>gb|AY910576.1| Paracoccidioides brasiliensis Ras2 (ras2) mRNA, complete cds
          Length = 975

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 12  tttgagggaccaatggatc 30
           |||||||||||||||||||
Sbjct: 391 tttgagggaccaatggatc 409
to top
>emb|BX908728.7| Human DNA sequence from clone DAMA-178G23 on chromosome 6, complete
             sequence
          Length = 104755

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    gggcagccagccatccctg 56
             |||||||||||||||||||
Sbjct: 97641 gggcagccagccatccctg 97659
to top
>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds
          Length = 3284914

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 38      gggcagccagccatccctg 56
               |||||||||||||||||||
Sbjct: 1737895 gggcagccagccatccctg 1737877
to top
>gb|AC084866.5| Homo sapiens BAC clone RP11-6E9 from 4, complete sequence
          Length = 196852

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 40     gcagccagccatccctgagcctc 62
              |||||||||||| ||||||||||
Sbjct: 168328 gcagccagccatgcctgagcctc 168350
to top
>gb|AC113431.2| Homo sapiens chromosome 5 clone RP11-90F2, complete sequence
          Length = 156789

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 40     gcagccagccatccctgagcctc 62
              |||||||||||| ||||||||||
Sbjct: 146824 gcagccagccatgcctgagcctc 146846
to top
>dbj|AP002537.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0001B06
          Length = 140304

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 10    tgtttgagggaccaatggatcca 32
             |||||||||||||||| ||||||
Sbjct: 89764 tgtttgagggaccaattgatcca 89742
to top
>dbj|AP003417.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0498B01
          Length = 146812

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 10    tgtttgagggaccaatggatcca 32
             |||||||||||||||| ||||||
Sbjct: 28357 tgtttgagggaccaattgatcca 28335
to top
>ref|NM_001002104.1| Danio rerio zgc:86877 (zgc:86877), mRNA
          Length = 1611

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 40  gcagccagccatccctgagcctc 62
           ||||||||||||| |||||||||
Sbjct: 855 gcagccagccatcgctgagcctc 877
to top
>ref|NM_007243.1| Homo sapiens nurim (nuclear envelope membrane protein) (NRM), mRNA
          Length = 1433

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 178 gggcagccagccatccctg 160
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 61      tcgacctgcacgtccgcct 79
               |||||||||||||||||||
Sbjct: 3721903 tcgacctgcacgtccgcct 3721921
to top
>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 38      gggcagccagccatccctg 56
               |||||||||||||||||||
Sbjct: 1251958 gggcagccagccatccctg 1251940
to top
>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 38     gggcagccagccatccctg 56
              |||||||||||||||||||
Sbjct: 825548 gggcagccagccatccctg 825530
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 34      ggatgggcagccagccatc 52
               |||||||||||||||||||
Sbjct: 5854484 ggatgggcagccagccatc 5854502
to top
>dbj|AB110936.1| Homo sapiens NRM gene for nuclear envelope membrane protein, complete
            cds, cell_line: LKT3
          Length = 4012

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 38   gggcagccagccatccctg 56
            |||||||||||||||||||
Sbjct: 1602 gggcagccagccatccctg 1584
to top
>dbj|AB110935.1| Homo sapiens NRM gene for nuclear envelope membrane protein, complete
            cds, cell_line: AKIBA
          Length = 4012

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 38   gggcagccagccatccctg 56
            |||||||||||||||||||
Sbjct: 1602 gggcagccagccatccctg 1584
to top
>emb|AL929202.6| Zebrafish DNA sequence from clone DKEY-147L19, complete sequence
          Length = 105855

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 40    gcagccagccatccctgagcctc 62
             ||||||||||||| |||||||||
Sbjct: 69869 gcagccagccatcgctgagcctc 69891
to top
>gb|BC071508.1| Danio rerio zgc:86877, mRNA (cDNA clone MGC:86877 IMAGE:6904156),
           complete cds
          Length = 1611

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 40  gcagccagccatccctgagcctc 62
           ||||||||||||| |||||||||
Sbjct: 855 gcagccagccatcgctgagcctc 877
to top
>gb|BC039865.1| Homo sapiens nurim (nuclear envelope membrane protein), mRNA (cDNA
           clone MGC:49014 IMAGE:6043663), complete cds
          Length = 1433

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 178 gggcagccagccatccctg 160
to top
>gb|AF143676.1|AF143676 Homo sapiens multispanning nuclear envelope membrane protein nurim
           (NRM29) mRNA, partial cds
          Length = 1403

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 38  gggcagccagccatccctg 56
           |||||||||||||||||||
Sbjct: 158 gggcagccagccatccctg 140
to top
>emb|AJ532421.1|EGR532421 Euglena granulata partial 18S rRNA gene, strain SAG 1224-8c
          Length = 2410

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 29   tccatggatgggcagccagccat 51
            |||||||||||||| ||||||||
Sbjct: 1175 tccatggatgggcatccagccat 1153
to top
>emb|AJ532420.1|ELA532420 Euglena laciniata partial 18S rRNA gene, strain SAG 1224-31
          Length = 2414

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 29   tccatggatgggcagccagccat 51
            |||||||||||||| ||||||||
Sbjct: 1176 tccatggatgggcatccagccat 1154
to top
>gb|AC124707.4| Mus musculus BAC clone RP24-73H16 from 12, complete sequence
          Length = 196237

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 15    gagggaccaatggatccat 33
             |||||||||||||||||||
Sbjct: 90922 gagggaccaatggatccat 90904
to top
>gb|AC132481.4| Mus musculus BAC clone RP23-14I14 from 17, complete sequence
          Length = 225031

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 28    atccatggatgggcagcca 46
             |||||||||||||||||||
Sbjct: 71262 atccatggatgggcagcca 71280
to top
>emb|CR936878.10| Human DNA sequence from clone DADB-118P11 on chromosome 6, complete
             sequence
          Length = 66216

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    gggcagccagccatccctg 56
             |||||||||||||||||||
Sbjct: 11321 gggcagccagccatccctg 11339
to top
>ref|NM_198248.1| Mus musculus zinc finger and BTB domain containing 40 (Zbtb40), mRNA
          Length = 7208

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 28   atccatggatgggcagccagcca 50
            ||||| |||||||||||||||||
Sbjct: 5846 atccaaggatgggcagccagcca 5824
to top
>emb|AL627214.15| Mouse DNA sequence from clone RP23-357K18 on chromosome 4, complete
              sequence
          Length = 182829

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 28     atccatggatgggcagccagcca 50
              ||||| |||||||||||||||||
Sbjct: 172521 atccaaggatgggcagccagcca 172543
to top
>dbj|AP002532.1| Homo sapiens genomic DNA, chromosome 1q22-q23, CD1 region, section 1/4
          Length = 300000

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 40     gcagccagccatccctgagcctc 62
              |||||||||||| ||||||||||
Sbjct: 199425 gcagccagccatgcctgagcctc 199403
to top
>dbj|AB045358.1| Homo sapiens genomic DNA, chromosome 1q22-q23, clone:893n23, complete
             sequence
          Length = 118264

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 40    gcagccagccatccctgagcctc 62
             |||||||||||| ||||||||||
Sbjct: 67298 gcagccagccatgcctgagcctc 67276
to top
>dbj|AB023049.1| Homo sapiens genomic DNA, chromosome 6p21.3, HLA class I region,
             clone:321E19, complete sequence
          Length = 123554

 Score = 38.2 bits (19), Expect = 4.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 38    gggcagccagccatccctg 56
             |||||||||||||||||||
Sbjct: 24736 gggcagccagccatccctg 24718


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 596,009
Number of Sequences: 3902068
Number of extensions: 596009
Number of successful extensions: 38986
Number of sequences better than 10.0: 87
Number of HSP's better than 10.0 without gapping: 87
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38799
Number of HSP's gapped (non-prelim): 187
length of query: 94
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 73
effective length of database: 17,151,101,840
effective search space: 1252030434320
effective search space used: 1252030434320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top