ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart09b08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_470185.1| Oryza sativa (japonica cultivar-group), predic... 165 2e-37
2dbj|AK099870.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
3dbj|AK067081.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
4dbj|AK061453.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
5gb|AY100693.1| Oryza sativa (japonica cultivar-group) expansin-l... 105 1e-19
6gb|AC140005.2| Oryza sativa (japonica cultivar-group) chromosome... 86 1e-13
7gb|AY039022.1| Oryza sativa expansin-like protein A (EXLA1) gene... 86 1e-13
8gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 86 1e-13
9gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome... 86 1e-13
10dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
11ref|NM_197592.1| Oryza sativa (japonica cultivar-group) putative... 72 2e-09
12dbj|AK068088.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
13dbj|AK066611.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
14gb|AC101757.12| Mus musculus chromosome 8, clone RP24-545I11, co... 52 0.002
15gb|CP000077.1| Sulfolobus acidocaldarius DSM 639, complete genome 52 0.002
16ref|XM_634939.1| Dictyostelium discoideum hypothetical protein (... 50 0.007
17gb|AC167021.3| Mus musculus BAC clone RP23-152D8 from chromosome... 50 0.007
18gb|AC113005.10| Mus musculus chromosome 3, clone RP23-299B23, co... 50 0.007
19gb|AC119820.20| Mus musculus chromosome 1, clone RP23-148M18, co... 50 0.007
20gb|AC161496.6| Mus musculus chromosome 3, clone RP23-119A9, comp... 50 0.007
21gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 50 0.007
22gb|AC118592.7| Mus musculus chromosome 7, clone RP24-463B5, comp... 50 0.007
23gb|AC100726.7| Mus musculus chromosome 19, clone RP24-245B11, co... 50 0.007
24gb|AC139578.4| Mus musculus BAC clone RP23-188P12 from chromosom... 50 0.007
25gb|AF030001.1|MMMHC29N7 Mus musculus major histocompatibility lo... 50 0.007
26gb|AC096338.17| Rattus norvegicus X BAC CH230-95I19 (Children's ... 50 0.007
27gb|AC139211.13| Mus musculus chromosome 6, clone RP23-302O24, co... 50 0.007
28gb|AC102445.11| Mus musculus chromosome 14, clone RP24-196M4, co... 50 0.007
29gb|AC164402.3| Mus musculus chromosome 15, clone RP23-463G20, co... 50 0.007
30gb|AC113495.15| Mus musculus chromosome 9, clone RP23-361O11, co... 50 0.007
31gb|AC163636.5| Mus musculus BAC clone RP24-499E13 from chromosom... 50 0.007
32gb|AC096226.12| Rattus norvegicus 18 BAC CH230-26M18 (Children's... 50 0.007
33ref|XM_543410.2| PREDICTED: Canis familiaris similar to Probable... 50 0.007
34ref|XM_566508.1| Cryptococcus neoformans var. neoformans JEC21 h... 50 0.007
35gb|AC124458.5| Mus musculus BAC clone RP24-136E11 from chromosom... 50 0.007
36gb|AC127553.3| Mus musculus BAC clone RP24-553F11 from chromosom... 50 0.007
37gb|AC104396.7| Mus musculus BAC clone RP23-413J8 from chromosome... 50 0.007
38ref|XM_811341.1| Trypanosoma cruzi strain CL Brener hypothetical... 50 0.007
39gb|AC122467.3| Mus musculus BAC clone RP24-311K2 from chromosome... 50 0.007
40gb|AC098723.3| Mus musculus BAC clone RP23-3D10 from 7, complete... 50 0.007
41gb|AC004015.1| Homo sapiens BAC clone CTA-333F24 from 7, complet... 50 0.007
42gb|AC101527.12| Mus musculus chromosome 15, clone RP23-191D20, c... 50 0.007
43emb|AL357143.13| Human DNA sequence from clone RP11-71G12 on chr... 50 0.007
44emb|AL162377.10| Human DNA sequence from clone RP11-327P2 on chr... 50 0.007
45gb|AC091153.10| Homo sapiens chromosome 17, clone RP11-314A20, c... 50 0.007
46emb|AL020995.14|HS117O3 Human DNA sequence from clone RP1-117O3 ... 50 0.007
47gb|AC027820.12| Homo sapiens chromosome 17, clone RP11-198F11, c... 50 0.007
48ref|NM_014389.1| Homo sapiens proline, glutamic acid and leucine... 50 0.007
49emb|AL627215.12| Mouse DNA sequence from clone RP23-292E3 on chr... 50 0.007
50emb|AL603708.13| Mouse DNA sequence from clone RP23-381C21 on ch... 50 0.007
51emb|AL691481.15| Mouse DNA sequence from clone RP23-173C3 on chr... 50 0.007
52gb|AC120797.9| Mus musculus chromosome 18, clone RP24-81D18, com... 50 0.007
53gb|AC150683.3| Mus musculus BAC clone RP23-435E16 from chromosom... 50 0.007
54gb|AC104439.2| Homo sapiens chromosome 3 clone RP11-793E15, comp... 50 0.007
55gb|AC161009.5| Pan troglodytes BAC clone CH251-560O18 from chrom... 50 0.007
56gb|U88153.2|HSU88153 Homo sapiens PELP1 mRNA, complete cds 50 0.007
57gb|AC023789.8| Mus musculus chromosome 4 clone RP23-43A16, compl... 50 0.007
58dbj|AB010266.1| Mus musculus Creb-rp, Tnx and Cyp21 genes for cA... 50 0.007
59gb|AC079222.17| Mus musculus chromosome 1, clone RP22-292L24, co... 50 0.007
60gb|AC161113.2| Mus musculus BAC clone RP24-362N9 from chromosome... 50 0.007
61gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 geno... 50 0.007
62gb|AC130527.4| Mus musculus BAC clone RP23-56C10 from chromosome... 50 0.007
63gb|AC155636.3| Mus musculus BAC clone RP23-345F5 from chromosome... 50 0.007
64dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
65gb|AC100735.15| Mus musculus chromosome 7, clone RP24-331F7, com... 50 0.007
66gb|AC018553.6| Homo sapiens chromosome 16 clone RP11-434E6, comp... 50 0.007
67gb|AC140675.5| Mus musculus BAC clone RP23-44J10 from chromosome... 50 0.007
68gb|AC133645.5| Mus musculus BAC clone RP23-73O10 from chromosome... 50 0.007
69gb|AC007343.7| Homo sapiens chromosome 16 clone RP11-463J22, com... 50 0.007
70gb|AC009021.8| Homo sapiens chromosome 16 clone RP11-105C19, com... 50 0.007
71ref|NM_214596.1| Strongylocentrotus purpuratus radial spokehead ... 50 0.007
72gb|AC138069.3| Homo sapiens chromosome 3 clone RP13-546I2, compl... 50 0.007
73emb|CT030725.15| Mouse DNA sequence from clone RP24-281O2 on chr... 50 0.007
74gb|AC102506.9| Mus musculus chromosome 1, clone RP24-139E15, com... 50 0.007
75gb|AC109198.9| Mus musculus chromosome 15, clone RP23-31G10, com... 50 0.007
76gb|AC102858.11| Mus musculus chromosome 5, clone RP24-507F5, com... 50 0.007
77gb|AC006289.1|AC006289 Mus musculus chromosome 17, clone 29_N_7,... 50 0.007
78emb|AL773539.18| Mouse DNA sequence from clone RP23-9F18 on chro... 50 0.007
79gb|AY882602.1| Homo sapiens transcription factor HMX3 mRNA, comp... 50 0.007
80gb|AC113936.16| Mus musculus chromosome 10, clone RP23-9F21, com... 50 0.007
81gb|AC121504.14| Mus musculus chromosome 13, clone RP24-140A15, c... 50 0.007
82emb|BX293544.7| Mouse DNA sequence from clone RP23-109C9 on chro... 50 0.007
83gb|U73123.1|SPU73123 Strongylocentrotus purpuratus radial spokeh... 50 0.007
84gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 50 0.007
85emb|AL845485.16| Mouse DNA sequence from clone RP23-237D23 on ch... 50 0.007
86gb|AC141471.4| Mus musculus BAC clone RP24-326K11 from 18, compl... 50 0.007
87gb|AC135673.5| Mus musculus BAC clone RP24-279A17 from 16, compl... 50 0.007
88emb|CT573030.2| Mouse DNA sequence from clone RP24-100B3 on chro... 50 0.007
89gb|U88154.1|HSU88154 Homo sapiens proline and glutamic acid rich... 50 0.007
90gb|AC015535.11| Mus musculus chromosome 5, clone RP23-39M18, com... 50 0.007
91emb|CT025535.14| Mouse DNA sequence from clone RP23-359O5 on chr... 50 0.007
92gb|BC002875.2| Homo sapiens proline, glutamic acid and leucine r... 50 0.007
93gb|AC147562.5| Mus musculus BAC clone RP23-239A13 from 3, comple... 50 0.007
94gb|BC069058.1| Homo sapiens proline, glutamic acid and leucine r... 50 0.007
95gb|BC039131.1| Homo sapiens proline, glutamic acid and leucine r... 50 0.007
96gb|AC126054.5| Mus musculus BAC clone RP23-298O13 from 8, comple... 50 0.007
97gb|BC010457.2| Homo sapiens proline, glutamic acid and leucine r... 50 0.007
98gb|AF547989.1| Homo sapiens MNAR (MNAR) mRNA, complete cds 50 0.007
99gb|AC118226.7| Mus musculus chromosome 5, clone RP23-372N19, com... 50 0.007
100gb|AC168881.3| Mus musculus BAC clone RP23-170A19 from chromosom... 50 0.007
101emb|AL626782.10| Mouse DNA sequence from clone RP23-335N15 on ch... 50 0.007
102emb|AL607074.13| Mouse DNA sequence from clone RP23-174M9 on chr... 50 0.007
103emb|AL732296.11| Mouse DNA sequence from clone RP23-131P6 on chr... 50 0.007
104emb|AL611970.11| Mouse DNA sequence from clone RP23-413K17 on ch... 50 0.007
105emb|AL645468.11| Mouse DNA sequence from clone RP23-246F18 on ch... 50 0.007
106emb|AJ251154.1|MMU251154 Mus musculus olfactory receptor cluster... 50 0.007
107emb|AL365322.10| Mouse DNA sequence from clone RP23-282D4 on chr... 50 0.007
108gb|AC155715.24| Mus musculus 10 BAC RP24-118H2 (Roswell Park Can... 50 0.007
109gb|AC102610.18| Mus musculus chromosome 19, clone RP23-411P21, c... 50 0.007
110gb|AC158595.25| Mus musculus 10 BAC RP24-216B14 (Roswell Park Ca... 50 0.007
111gb|AC124528.4| Mus musculus BAC clone RP23-411B19 from chromosom... 50 0.007
112emb|AL590992.12| Mouse DNA sequence from clone RP23-212C14 on ch... 50 0.007
113gb|AC130283.8| Mus musculus chromosome 15, clone RP23-136E18, co... 48 0.027
114gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, com... 48 0.027
115gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, c... 48 0.027
116ref|NM_113819.2| Arabidopsis thaliana unknown protein AT3G28980 ... 48 0.027
117gb|AC154808.2| Mus musculus BAC clone RP24-512K19 from chromosom... 48 0.027
118gb|AC155264.2| Mus musculus BAC clone RP23-281B4 from chromosome... 48 0.027
119gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, co... 48 0.027
120gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, co... 48 0.027
121gb|AE010302.1| Methanopyrus kandleri AV19 section 1 of 157 of th... 48 0.027
122ref|XM_637799.1| Dictyostelium discoideum hypothetical protein (... 48 0.027
123gb|AC154483.2| Mus musculus BAC clone RP24-113B3 from chromosome... 48 0.027
124gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosom... 48 0.027
125gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 48 0.027
126gb|AC153558.7| Mus musculus 10 BAC RP23-367D2 (Roswell Park Canc... 48 0.027
127gb|AC109149.15| Mus musculus chromosome 19, clone RP24-178F17, c... 48 0.027
128gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold 48 0.027
129gb|AF106329.1| Escherichia coli plasmid F putative methyltransfe... 48 0.027
130gb|AC109268.10| Mus musculus chromosome 1, clone RP23-305F24, co... 48 0.027
131gb|AC101391.15| Mus musculus chromosome 5, clone RP23-119E13, co... 48 0.027
132gb|AC164700.3| Mus musculus BAC clone RP24-548M16 from chromosom... 48 0.027
133gb|AC102354.14| Mus musculus chromosome 17, clone RP23-80J17, co... 48 0.027
134gb|AC115937.14| Mus musculus chromosome 5, clone RP24-547J21, co... 48 0.027
135gb|AC114613.12| Mus musculus chromosome 5, clone RP24-80F7, comp... 48 0.027
136gb|AC158594.12| Mus musculus 10 BAC RP23-197I5 (Roswell Park Can... 48 0.027
137ref|XM_869058.1| PREDICTED: Bos taurus similar to Protein KIAA05... 48 0.027
138gb|AC120390.12| Mus musculus chromosome 9, clone RP24-308L17, co... 48 0.027
139gb|AC124614.11| Mus musculus chromosome 10, clone RP24-417L12, c... 48 0.027
140gb|BC072219.1| Xenopus laevis hypothetical protein MGC81377, mRN... 48 0.027
141gb|AC134460.4| Mus musculus BAC clone RP23-373D18 from chromosom... 48 0.027
142gb|AC139755.3| Mus musculus BAC clone RP24-96N20 from chromosome... 48 0.027
143gb|AC131586.10| Mus musculus chromosome 14, clone RP24-226L18, c... 48 0.027
144gb|BC072638.1| Mus musculus RIKEN cDNA E130013N09 gene, mRNA (cD... 48 0.027
145gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7... 48 0.027
146gb|AC147375.3| Mus musculus BAC clone RP24-159O13 from chromosom... 48 0.027
147ref|NM_175229.2| Mus musculus serine/arginine repetitive matrix ... 48 0.027
148gb|AC147143.2| Pan troglodytes BAC clone CH251-267L18 from Y, co... 48 0.027
149gb|AC149133.1| Pan troglodytes chromosome X clone RP43-010O16 ma... 48 0.027
150gb|AC132441.3| Mus musculus BAC clone RP23-239J2 from chromosome... 48 0.027
151gb|AC125192.3| Mus musculus BAC clone RP23-266B4 from chromosome... 48 0.027
152ref|XM_657374.1| Aspergillus nidulans FGSC A4 hypothetical prote... 48 0.027
153gb|AC102135.12| Mus musculus chromosome 18, clone RP23-253J5, co... 48 0.027
154gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, comp... 48 0.027
155gb|AC132844.7| Mus musculus chromosome 17, clone RP24-481P13, co... 48 0.027
156gb|AC114539.8| Mus musculus chromosome 19, clone RP23-62I23, com... 48 0.027
157gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome... 48 0.027
158gb|AC122820.4| Mus musculus BAC clone RP23-200M5 from chromosome... 48 0.027
159gb|AC117076.3| Dictyostelium discoideum chromosome 2 map 3323568... 48 0.027
160gb|AC183773.2| Pan troglodytes BAC clone CH251-2N7 from chromoso... 48 0.027
161ref|XM_992312.1| PREDICTED: Mus musculus serine/arginine repetit... 48 0.027
162gb|AC102257.5| Mus musculus chromosome 18, clone RP24-196N23, co... 48 0.027
163ref|XM_992125.1| PREDICTED: Mus musculus similar to olfactory re... 48 0.027
164ref|XM_001001853.1| PREDICTED: Mus musculus hypothetical protein... 48 0.027
165gb|AC118211.10| Mus musculus chromosome 8, clone RP24-223O5, com... 48 0.027
166gb|AC107663.10| Mus musculus chromosome 13, clone RP23-99G9, com... 48 0.027
167gb|AC110262.12| Mus musculus chromosome 17, clone RP23-291L10, c... 48 0.027
168gb|AC117690.10| Mus musculus chromosome 16, clone RP23-446I8, co... 48 0.027
169gb|AC133950.4| Mus musculus BAC clone RP24-243C16 from chromosom... 48 0.027
170gb|AC133077.4| Mus musculus BAC clone RP24-423E10 from chromosom... 48 0.027
171gb|DQ484017.1| Gymnogyps californianus clone 183G microsatellite... 48 0.027
172emb|AL773599.11| Mouse DNA sequence from clone RP23-326I8 on chr... 48 0.027
173ref|XM_823587.1| Trypanosoma brucei TREU927 hypothetical protein... 48 0.027
174emb|CT009492.5| M.truncatula DNA sequence from clone MTH2-93A21 ... 48 0.027
175gb|AC146243.2| Pan troglodytes BAC clone CH251-166E5 from Y, com... 48 0.027
176gb|AC147361.1| Pan troglodytes BAC clone CH251-528H6 from Y, com... 48 0.027
177gb|AC147114.2| Pan troglodytes BAC clone CH251-548O14 from Y, co... 48 0.027
178gb|AC147515.1| Pan troglodytes BAC clone CH251-558O8 from Y, com... 48 0.027
179ref|XM_387700.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 48 0.027
180gb|AC129200.4| Mus musculus BAC clone RP24-221J22 from chromosom... 48 0.027
181gb|AC134581.5| Mus musculus BAC clone RP24-90L20 from chromosome... 48 0.027
182gb|AC117239.4| Mus musculus BAC clone RP24-117K6 from chromosome... 48 0.027
183gb|AC132100.3| Mus musculus BAC clone RP24-294D10 from chromosom... 48 0.027
184gb|AC130543.3| Mus musculus BAC clone RP24-178J22 from chromosom... 48 0.027
185gb|AC132242.2| Mus musculus BAC clone RP24-413O2 from chromosome... 48 0.027
186gb|AC122821.4| Mus musculus BAC clone RP23-201I4 from chromosome... 48 0.027
187gb|AC110212.12| Mus musculus chromosome 19, clone RP23-183H23, c... 48 0.027
188gb|BC060623.1| Mus musculus RIKEN cDNA E130013N09 gene, mRNA (cD... 48 0.027
189gb|AC125352.4| Mus musculus BAC clone RP23-451M13 from chromosom... 48 0.027
190ref|XM_814622.1| Trypanosoma cruzi strain CL Brener mucin-associ... 48 0.027
191gb|AC121889.3| Mus musculus BAC clone RP24-146D9 from chromosome... 48 0.027
192gb|AC131751.2| Mus musculus BAC clone RP23-19P8 from 10, complet... 48 0.027
193gb|AC122864.3| Mus musculus BAC clone RP23-142M19 from 6, comple... 48 0.027
194gb|AC122268.5| Mus musculus BAC clone RP23-216B15 from 14, compl... 48 0.027
195gb|AC110508.8| Mus musculus chromosome 3, clone RP23-382L1, comp... 48 0.027
196gb|AC114817.3| Mus musculus BAC clone RP23-28O15 from 14, comple... 48 0.027
197gb|AC117198.3| Mus musculus BAC clone RP23-127K18 from 9, comple... 48 0.027
198gb|AC098731.3| Mus musculus BAC clone RP23-3L10 from 9, complete... 48 0.027
199gb|AC112680.12| Mus musculus chromosome 9, clone RP23-203D1, com... 48 0.027
200ref|XM_546592.2| PREDICTED: Canis familiaris similar to Zinc fin... 48 0.027
201ref|XM_721979.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 48 0.027
202ref|XM_724266.1| Plasmodium yoelii yoelii str. 17XNL casein kina... 48 0.027
203gb|AC073094.11| Homo sapiens BAC clone RP11-369D24 from 7, compl... 48 0.027
204ref|XM_733967.1| Plasmodium chabaudi chabaudi hypothetical prote... 48 0.027
205ref|XM_735356.1| Plasmodium chabaudi chabaudi hypothetical prote... 48 0.027
206ref|XM_737002.1| Plasmodium chabaudi chabaudi hypothetical prote... 48 0.027
207ref|XM_669806.1| Plasmodium berghei strain ANKA Casein kinase II... 48 0.027
208gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, c... 48 0.027
209ref|XM_662725.1| Cryptosporidium hominis TU502 DNA polymerase ep... 48 0.027
210ref|NM_012993.1| Rattus norvegicus nardilysin, N-arginine dibasi... 48 0.027
211gb|AC138270.12| Mus musculus chromosome 7, clone RP23-323F17, co... 48 0.027
212gb|AC123687.20| Mus musculus chromosome 5, clone RP23-314A12, co... 48 0.027
213gb|AC154864.2| Mus musculus BAC clone RP23-7A5 from chromosome 1... 48 0.027
214gb|AC156564.3| Mus musculus BAC clone RP24-81G20 from chromosome... 48 0.027
215ref|NM_001040149.1| Macaca mulatta proline, glutamic acid and le... 48 0.027
216gb|BC094956.1| Rattus norvegicus cDNA clone IMAGE:7368168, **** ... 48 0.027
217gb|AC163208.2| Mus musculus chromosome 18, clone RP24-340O19, co... 48 0.027
218gb|AC108554.8| Rattus norvegicus 7 BAC CH230-81L13 (Children's H... 48 0.027
219gb|AC126071.5| Rattus norvegicus 10 BAC CH230-209B21 (Children's... 48 0.027
220emb|AL683813.10| Human DNA sequence from clone RP11-1114A5 on ch... 48 0.027
221emb|AL445531.10| Human DNA sequence from clone RP11-546O6 on chr... 48 0.027
222emb|AL365274.17| Human DNA sequence from clone RP11-298A17 on ch... 48 0.027
223emb|AL390835.14| Human DNA sequence from clone RP5-1119O21 on ch... 48 0.027
224emb|AL161932.15| Human DNA sequence from clone RP11-241I20 on ch... 48 0.027
225emb|AL161730.9| Human DNA sequence from clone RP11-441I5 on chro... 48 0.027
226emb|AL139136.17| Human DNA sequence from clone RP11-53I24 on chr... 48 0.027
227emb|AL139216.14| Human DNA sequence from clone RP5-1017J17 on ch... 48 0.027
228emb|AL139241.11| Human DNA sequence from clone RP11-34A14 on chr... 48 0.027
229emb|AL157895.8| Human DNA sequence from clone RP11-354E11 on chr... 48 0.027
230gb|AC124658.5| Homo sapiens chromosome 11, clone RP11-655D12, co... 48 0.027
231gb|AC124914.3| Homo sapiens chromosome 3 clone RP11-146K16, comp... 48 0.027
232gb|AC126567.8| Homo sapiens 3 BAC RP11-656G9 (Roswell Park Cance... 48 0.027
233gb|AC119420.12| Mus musculus strain 129S6/SvEvTac clone rp22-121... 48 0.027
234emb|AL133380.5| Human DNA sequence from clone RP5-862P8 on chrom... 48 0.027
235emb|AL031774.1|HS298J15 Human DNA sequence from clone RP1-298J15... 48 0.027
236gb|AY152827.1| Felis catus clone BAC 186b21 major histocompatibl... 48 0.027
237emb|Y15943.1|DMAAR2B Didelphis marsupialis gene encoding alpha a... 48 0.027
238gb|DQ447200.1| Macaca mulatta modulator of nongenomic activity o... 48 0.027
239ref|XM_781838.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.027
240gb|AC161231.7| Mus musculus chromosome 5, clone RP24-241P24, com... 48 0.027
241gb|AC151985.2| Mus musculus BAC clone RP23-381C14 from chromosom... 48 0.027
242emb|AL645527.20| Mouse DNA sequence from clone RP23-26L6 on chro... 48 0.027
243gb|AC153523.7| Mus musculus 10 BAC RP23-463C2 (Roswell Park Canc... 48 0.027
244gb|AC164614.3| Mus musculus BAC clone RP23-337L12 from chromosom... 48 0.027
245emb|AL929272.10| Mouse DNA sequence from clone RP23-69H10 on chr... 48 0.027
246emb|AL645904.13| Mouse DNA sequence from clone RP23-121P11 on ch... 48 0.027
247emb|AL603842.9| Mouse DNA sequence from clone RP23-100P23 on chr... 48 0.027
248emb|AL611937.6| Mouse DNA sequence from clone RP23-221M24 on chr... 48 0.027
249emb|AL162873.1|ATF8F6 Arabidopsis thaliana DNA chromosome 5, BAC... 48 0.027
250emb|AJ400877.1|HSA400877 Homo sapiens ASCL3 gene, CEGP1 gene, C1... 48 0.027
251gb|AC123298.4| Rattus norvegicus BAC CH230-352N4 (Children's Ho... 48 0.027
252gb|AC025669.19| Mus musculus chromosome 14, clone RP23-5O16, com... 48 0.027
253gb|AC156982.8| Mus musculus chromosome 19, clone RP23-183N3, com... 48 0.027
254emb|BX649410.18| Mouse DNA sequence from clone RP23-168C6 on chr... 48 0.027
255gb|AC127343.3| Mus musculus BAC clone RP23-194I18 from chromosom... 48 0.027
256gb|AC026894.7| Homo sapiens chromosome , clone RP11-318C2, compl... 48 0.027
257gb|AC008798.10| Homo sapiens chromosome 19 clone CTD-2057D4, com... 48 0.027
258gb|AC108137.8| Homo sapiens chromosome 15, clone RP11-941F15, co... 48 0.027
259gb|AC087890.18| Mus Musculus Strain C57BL6/J Chromosome 10 BAC, ... 48 0.027
260gb|AC098719.3| Mus musculus clone RP23-2M3, complete sequence 48 0.027
261gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 48 0.027
262dbj|AK127011.1| Homo sapiens cDNA FLJ45067 fis, clone BRAWH3024989 48 0.027
263gb|AC092857.17| Rattus norvegicus clone rp32-362k5, complete seq... 48 0.027
264gb|AC091531.9| Mus musculus Strain C57BL6/J Chromosome 9 RP23-28... 48 0.027
265gb|AC068627.16| Mus Musculus Chromosome 5 RP23-389F6, complete s... 48 0.027
266gb|AC105227.6| Homo sapiens chromosome 18, clone RP11-1030E3, co... 48 0.027
267gb|AC060232.6| Homo sapiens chromosome 10 clone RP11-458D17, com... 48 0.027
268gb|AC055710.10| Homo sapiens 3 BAC RP11-307E22 (Roswell Park Can... 48 0.027
269dbj|AP001918.1| Plasmid F genomic DNA, complete sequence 48 0.027
270gb|AC105273.2| Homo sapiens chromosome 1 clone RP4-716B13, compl... 48 0.027
271gb|AC007529.5| Homo sapiens 12p13 BAC RPCI11-69C13 (Roswell Park... 48 0.027
272gb|AC091214.20| Homo sapiens 12q BAC RP11-13F9 (Roswell Park Can... 48 0.027
273dbj|AK147324.1| Mus musculus cDNA, RIKEN full-length enriched li... 48 0.027
274dbj|AK144658.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 48 0.027
275dbj|AK159063.1| Mus musculus visual cortex cDNA, RIKEN full-leng... 48 0.027
276gb|AC018362.8| Homo sapiens chromosome 15 clone RP11-265N6 map 1... 48 0.027
277gb|AC153625.2| Mus musculus 6 BAC RP23-277O13 (Roswell Park Canc... 48 0.027
278dbj|AK170668.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 48 0.027
279gb|AC151895.4| Mus musculus BAC clone RP24-323A22 from chromosom... 48 0.027
280gb|AC153139.5| Mus musculus BAC clone RP23-411M4 from chromosome... 48 0.027
281gb|AC101817.13| Mus musculus chromosome 15, clone RP24-359I22, c... 48 0.027
282gb|AC158970.3| Mus musculus chromosome 15, clone RP24-186A9, com... 48 0.027
283gb|S65840.1| Ca2+/calmodulin-dependent protein kinase IV beta po... 48 0.027
284gb|AC159966.5| Mus musculus chromosome 1, clone RP23-287P12, com... 48 0.027
285gb|AC159099.4| Mus musculus chromosome 15, clone RP24-132A22, co... 48 0.027
286gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 48 0.027
287gb|AC148986.5| Mus musculus BAC clone RP23-89A16 from chromosome... 48 0.027
288gb|AC154338.2| Mus musculus BAC clone RP23-247M16 from chromosom... 48 0.027
289dbj|AK085128.1| Mus musculus 13 days embryo lung cDNA, RIKEN ful... 48 0.027
290gb|AC140489.2| Mus musculus BAC clone RP24-144C10 from chromosom... 48 0.027
291gb|AC155242.2| Mus musculus BAC clone RP24-496G24 from chromosom... 48 0.027
292gb|AC026188.6| Homo sapiens chromosome 3 clone RP11-319I18 map 3... 48 0.027
293gb|AC155827.10| Mus musculus 10 BAC RP24-408N5 (Roswell Park Can... 48 0.027
294gb|AC155939.6| Mus musculus 10 BAC RP24-418P10 (Roswell Park Can... 48 0.027
295gb|AC158544.1| Mus musculus 10 BAC RP24-212P21 (Roswell Park Can... 48 0.027
296dbj|AK090123.1| Mus musculus RCB-0545 OHTA cDNA, RIKEN full-leng... 48 0.027
297dbj|AK030860.1| Mus musculus adult male thymus cDNA, RIKEN full-... 48 0.027
298dbj|AK053395.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 48 0.027
299gb|AC158630.5| Mus musculus 10 BAC RP23-440F7 (Roswell Park Canc... 48 0.027
300gb|AC146920.3| Otolemur garnettii clone CH256-154N14, complete s... 48 0.027
301gb|AC090884.1|AC090884 Homo sapiens chromosome 3 clone RP11-165B... 48 0.027
302gb|L05517.1|PFAGGMPREP Plasmodium chabaudi hsp70-like protein, c... 48 0.027
303gb|AC023812.7|AC023812 Homo sapiens chromosome 3 clone 95e11 map... 48 0.027
304gb|AC073120.5| Homo sapiens BAC clone RP11-612D17 from 2, comple... 48 0.027
305gb|AC146477.3| Pan troglodytes BAC clone CH251-514B8 from chromo... 48 0.027
306gb|AC156024.2| Mus musculus BAC clone RP23-89J1 from chromosome ... 48 0.027
307gb|AC157813.6| Mus musculus chromosome 1, clone RP24-70I14, comp... 48 0.027
308gb|AC123530.4| Mus musculus BAC clone RP24-194D2 from chromosome... 48 0.027
309gb|AC107016.20| Homo sapiens 12 BAC RP11-153F5 (Roswell Park Can... 48 0.027
310gb|AC016142.22| Homo sapiens 3 BAC RP11-166N6 (Roswell Park Canc... 48 0.027
311gb|AC092644.3| Homo sapiens BAC clone RP11-394A2 from 2, complet... 48 0.027
312gb|AC020751.5|AC020751 Homo sapiens chromosome 3 clone RP11-10H6... 48 0.027
313gb|AC013264.4| Homo sapiens BAC clone RP11-184N4 from 2, complet... 48 0.027
314gb|AC011317.23| Homo sapiens 3 BAC RP11-103G8 (Roswell Park Canc... 48 0.027
315ref|NM_019384.1| Rattus norvegicus CTD-binding SR-like rA1 (LOC5... 48 0.027
316gb|AC078819.24| Homo sapiens 12q BAC RP11-490H24 (Roswell Park C... 48 0.027
317ref|XM_220207.3| PREDICTED: Rattus norvegicus serine/arginine re... 48 0.027
318gb|AC008746.10| Homo sapiens chromosome 19 clone CTD-2587H19, co... 48 0.027
319gb|AC078991.21| Homo sapiens Xp BAC RP11-459A10 (Roswell Park Ca... 48 0.027
320gb|AC090646.2| Homo sapiens chromosome 3 clone RP11-690A6 map 3p... 48 0.027
321gb|AC093248.3| Homo sapiens chromosome 5 clone RP11-141O11, comp... 48 0.027
322gb|AC134985.11| Mus musculus chromosome 5, clone RP24-432L3, com... 48 0.027
323dbj|AB190673.1| Burkholderia cepacia gene for DNA-directed RNA p... 48 0.027
324dbj|AB190672.1| Burkholderia cepacia gene for DNA-directed RNA p... 48 0.027
325gb|AC112933.16| Mus musculus chromosome 5, clone RP24-418J2, com... 48 0.027
326emb|AL807744.7| Mouse DNA sequence from clone RP23-174C4 on chro... 48 0.027
327emb|AL845357.6| Zebrafish DNA sequence from clone DKEY-202M22 in... 48 0.027
328gb|AC138317.11| Mus musculus chromosome 8, clone RP23-271F20, co... 48 0.027
329dbj|AB025615.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 48 0.027
330dbj|AB005235.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 48 0.027
331ref|XM_311170.2| Anopheles gambiae str. PEST ENSANGP00000019044 ... 48 0.027
332gb|AF198573.1|AF198573 Orconectes longidigitus strain KC214/4 in... 48 0.027
333gb|AF198572.1|AF198572 Orconectes longidigitus strain KC214/3 in... 48 0.027
334gb|AF198571.1|AF198571 Orconectes longidigitus strain KC214/2 in... 48 0.027
335gb|AF198570.1|AF198570 Orconectes longidigitus strain KC214/1 in... 48 0.027
336gb|AC107650.19| Mus musculus chromosome 6, clone RP23-133I9, com... 48 0.027
337ref|NM_210384.1| Eremothecium gossypii AER172Cp (AER172C), mRNA 48 0.027
338gb|AC006101.3|AC006101 citb_338_f_24, complete sequence 48 0.027
339emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromo... 48 0.027
340emb|AM055942.1| Toxoplasma gondii, strain RH, genomic DNA chromo... 48 0.027
341gb|AC147219.5| Mus musculus BAC clone RP23-37K18 from 18, comple... 48 0.027
342gb|AC151576.2| Mus musculus BAC clone RP24-260K24 from 8, comple... 48 0.027
343gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, co... 48 0.027
344gb|AC084382.2| Mus musculus BAC clone RP23-5K17 from 15, complet... 48 0.027
345emb|X93208.1|RSPNRD2 Rattus sp. mRNA for NRD2 convertase 48 0.027
346emb|CT025155.9| Mouse DNA sequence from clone RP23-228F18 on chr... 48 0.027
347gb|AF095748.1|AF095748 Burkholderia cepacia principal sigma fact... 48 0.027
348gb|AC103351.11| Mus musculus chromosome 18, clone RP23-406A11, c... 48 0.027
349gb|AC165322.12| Mus musculus chromosome 1, clone RP23-127J15, co... 48 0.027
350gb|AC102262.9| Mus musculus chromosome 15, clone RP24-216B4, com... 48 0.027
351dbj|AK122248.1| Mus musculus mRNA for mKIAA0324 protein 48 0.027
352ref|NM_012727.2| Rattus norvegicus calcium/calmodulin-dependent ... 48 0.027
353gb|AC104548.6| Mus musculus chromosome 5, clone RP24-83N12, comp... 48 0.027
354gb|AC117681.20| Mus musculus chromosome 1, clone RP23-436A22, co... 48 0.027
355gb|AC166074.3| Mus musculus BAC clone RP23-152H18 from chromosom... 48 0.027
356gb|U49056.1|RNU49056 Rattus norvegicus CTD-binding SR-like prote... 48 0.027
357gb|AC153533.4| Mus musculus 10 BAC RP23-474K10 (Roswell Park Can... 48 0.027
358gb|AC122763.9| Mus musculus chromosome 19, clone RP24-68F2, comp... 48 0.027
359emb|AL591542.20| Mouse DNA sequence from clone RP23-321M14 on ch... 48 0.027
360emb|AL772204.13| Mouse DNA sequence from clone RP23-375M22 on ch... 48 0.027
361emb|AL929196.5| Mouse DNA sequence from clone RP23-7D13 on chrom... 48 0.027
362gb|AC127569.4| Mus musculus BAC clone RP24-216E20 from 9, comple... 48 0.027
363gb|AC141883.4| Mus musculus BAC clone RP24-128P19 from 7, comple... 48 0.027
364gb|AC135083.4| Mus musculus BAC clone RP24-238A21 from 14, compl... 48 0.027
365gb|AC134893.4| Mus musculus BAC clone RP24-251N8 from 9, complet... 48 0.027
366gb|AC140293.4| Mus musculus BAC clone RP24-328A10 from 13, compl... 48 0.027
367gb|AC127244.3| Mus musculus BAC clone RP24-416M6 from 6, complet... 48 0.027
368gb|AC134828.4| Mus musculus BAC clone RP24-472K15 from 6, comple... 48 0.027
369gb|AC127581.4| Mus musculus BAC clone RP24-88B13 from 9, complet... 48 0.027
370emb|CT010444.10| Mouse DNA sequence from clone RP23-151L20 on ch... 48 0.027
371gb|AC146617.3| Mus musculus BAC clone RP23-14M15 from 14, comple... 48 0.027
372gb|AC139108.3| Mus musculus BAC clone RP23-93M1 from 9, complete... 48 0.027
373gb|AC132618.3| Mus musculus BAC clone RP23-238K12 from 6, comple... 48 0.027
374gb|AC133199.3| Mus musculus BAC clone RP23-263B18 from 6, comple... 48 0.027
375gb|AC149588.4| Mus musculus BAC clone RP23-366I10 from 15, compl... 48 0.027
376gb|AC138617.4| Mus musculus BAC clone RP23-403G9 from 8, complet... 48 0.027
377emb|CT025660.9| Mouse DNA sequence from clone RP24-79I19 on chro... 48 0.027
378emb|CT010501.6| Mouse DNA sequence from clone RP23-333D13 on chr... 48 0.027
379emb|AL928890.6| Mouse DNA sequence from clone RP24-314D20 on chr... 48 0.027
380emb|AL954824.2| Mouse DNA sequence from clone RP23-326I8 on chro... 48 0.027
381emb|AL935127.9| Mouse DNA sequence from clone RP23-431O5 on chro... 48 0.027
382gb|AC084069.28| Mus musculus strain C57BL/6J chromosome 13 clone... 48 0.027
383gb|AC171205.1| Mus musculus BAC clone RP23-441H20 from chromosom... 48 0.027
384emb|AL845367.6| Zebrafish DNA sequence from clone DKEYP-33D4 in ... 48 0.027
385gb|AC132939.23| Mus musculus chromosome 5, clone RP24-91I11, com... 48 0.027
386emb|AL672259.9| Mouse DNA sequence from clone RP23-169M4 on chro... 48 0.027
387emb|AL807816.7| Mouse DNA sequence from clone RP23-13H12 on chro... 48 0.027
388emb|AL691503.6| Mouse DNA sequence from clone RP23-47N17 on chro... 48 0.027
389emb|AL645740.6| Mouse DNA sequence from clone RP23-411H13 on chr... 48 0.027
390emb|AL844513.8| Mouse DNA sequence from clone RP23-132A3 on chro... 48 0.027
391emb|AL663030.12| Mouse DNA sequence from clone RP23-84C12 on chr... 48 0.027
392emb|AL772239.8| Mouse DNA sequence from clone RP23-179O4 on chro... 48 0.027
393emb|AL669911.16| Mouse DNA sequence from clone RP23-65G8 on chro... 48 0.027
394gb|AC168209.7| Mus musculus chromosome 5, clone RP24-392C11, com... 48 0.027
395emb|AL513351.26| Mouse DNA sequence from clone RP23-122P5 on chr... 48 0.027
396emb|AL929066.7| Mouse DNA sequence from clone RP23-68E1 on chrom... 48 0.027
397emb|AL607109.21| Mouse DNA sequence from clone RP23-352D7 on chr... 48 0.027
398gb|AC101660.25| Mus musculus chromosome 15, clone RP23-4I22, com... 48 0.027
399gb|J04600.1|RATPKCAM Rat brain specific calmodulin-dependent pro... 48 0.027
400gb|J04446.1|RATCSM Rat calspermin mRNA, complete cds 48 0.027
401gb|M63334.1|RATCAMGRD R.norvegicus calmodulin-dependent protein ... 48 0.027
402gb|M63333.1|RATCAMGRC R.norvegicus calmodulin-dependent protein ... 48 0.027
403gb|M64757.1|RATCALM Rat Ca++/calmodulin protein kinase and calmo... 48 0.027
404gb|M74488.1|RATCACALDK Rat Ca2+/calmodulin-dependent protein kin... 48 0.027
405gb|AC068314.6| Homo sapiens chromosome 3 clone RP11-194D21 map 3... 48 0.027
406gb|L27124.1|RATNRDC Rattus sp. NRD convertase (NRDC) mRNA, compl... 48 0.027
407emb|AL596263.8| Mouse DNA sequence from clone RP23-392O2 on chro... 48 0.027
408gb|AC141887.5| Mus musculus BAC clone RP23-478L20 from chromosom... 46 0.11
409gb|AC122005.3| Mus musculus chromosome 5 clone RP24-340B11, comp... 46 0.11
410ref|XM_631434.1| Dictyostelium discoideum hypothetical protein (... 46 0.11
411gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosom... 46 0.11
412gb|AC168054.4| Mus musculus BAC clone RP24-571H12 from chromosom... 46 0.11
413gb|AC166832.2| Mus musculus BAC clone RP23-220N17 from chromosom... 46 0.11
414gb|AC166828.3| Mus musculus BAC clone RP23-332O23 from chromosom... 46 0.11
415ref|NM_001013850.1| Canis familiaris angio-associated, migratory... 46 0.11
416ref|NM_197153.1| Oryza sativa (japonica cultivar-group) hypothet... 46 0.11
417ref|XM_517111.1| PREDICTED: Pan troglodytes similar to KIAA1327 ... 46 0.11
418gb|AC109201.12| Mus musculus chromosome 15, clone RP23-18P10, co... 46 0.11
419gb|AC119834.12| Mus musculus chromosome 5, clone RP24-383P24, co... 46 0.11
420gb|AC109272.20| Mus musculus chromosome 7, clone RP23-354L18, co... 46 0.11
421gb|AC113587.16| Mus musculus chromosome 15, clone RP24-424I13, c... 46 0.11
422gb|AC120135.7| Mus musculus chromosome 7, clone RP23-64O4, compl... 46 0.11
423gb|AY186725.1| Cancer magister clone Cma97 microsatellite sequence 46 0.11
424gb|U65590.1|HSU65590 Homo sapiens IL-1 receptor antagonist IL-1R... 46 0.11
425gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hos... 46 0.11
426gb|AF235097.2| Homo sapiens chromosome X multiple clones map p11... 46 0.11
427gb|AC165357.4| Mus musculus BAC clone RP23-114G24 from chromosom... 46 0.11
428gb|AC158554.6| Mus musculus chromosome 15, clone RP23-353O17, co... 46 0.11
429gb|AC126959.6| Rattus norvegicus 8 BAC CH230-10P12 (Children's H... 46 0.11
430gb|AC124227.21| Mus musculus chromosome 1, clone RP23-118M13, co... 46 0.11
431gb|AC102342.10| Mus musculus chromosome 18, clone RP23-250K3, co... 46 0.11
432ref|XM_615480.2| PREDICTED: Bos taurus similar to Histone acetyl... 46 0.11
433ref|XM_880839.1| PREDICTED: Bos taurus similar to Histone acetyl... 46 0.11
434ref|XM_880818.1| PREDICTED: Bos taurus similar to Histone acetyl... 46 0.11
435ref|XM_880799.1| PREDICTED: Bos taurus similar to Histone acetyl... 46 0.11
436ref|XM_880782.1| PREDICTED: Bos taurus similar to Histone acetyl... 46 0.11
437ref|XM_880765.1| PREDICTED: Bos taurus similar to Histone acetyl... 46 0.11
438ref|XM_880749.1| PREDICTED: Bos taurus similar to Histone acetyl... 46 0.11
439ref|XM_880727.1| PREDICTED: Bos taurus similar to Histone acetyl... 46 0.11
440ref|XM_867653.1| PREDICTED: Bos taurus similar to Histone acetyl... 46 0.11
441gb|AC115036.10| Mus musculus chromosome 7, clone RP24-274F20, co... 46 0.11
442gb|AC113508.14| Mus musculus chromosome 13, clone RP23-376D8, co... 46 0.11
443gb|AC136976.5| Mus musculus BAC clone RP23-362K12 from chromosom... 46 0.11
444ref|NM_005183.2| Homo sapiens calcium channel, voltage-dependent... 46 0.11
445gb|BC052422.1| Mus musculus ariadne homolog 2 (Drosophila), mRNA... 46 0.11
446gb|BC051998.1| Mus musculus ariadne homolog 2 (Drosophila), mRNA... 46 0.11
447ref|XM_956691.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.11
448gb|AC099741.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 46 0.11
449ref|XM_328600.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.11
450ref|XM_876268.1| PREDICTED: Bos taurus similar to CG13624-PC, is... 46 0.11
451ref|XM_876203.1| PREDICTED: Bos taurus similar to CG13624-PC, is... 46 0.11
452ref|XM_591287.2| PREDICTED: Bos taurus similar to CG13624-PC, is... 46 0.11
453gb|AC139751.2| Mus musculus BAC clone RP24-403E24 from chromosom... 46 0.11
454gb|AC140451.3| Mus musculus BAC clone RP23-52L6 from chromosome ... 46 0.11
455gb|AC147020.2| Mus musculus BAC clone RP23-267A11 from chromosom... 46 0.11
456gb|AC135240.2| Mus musculus BAC clone RP24-63O24 from chromosome... 46 0.11
457gb|AC136641.3| Mus musculus BAC clone RP23-313G19 from chromosom... 46 0.11
458ref|XM_653771.1| Aspergillus nidulans FGSC A4 hypothetical prote... 46 0.11
459gb|AC163095.6| Mus musculus chromosome 18, clone RP23-208G10, co... 46 0.11
460gb|AC133459.9| Mus musculus chromosome 12, clone RP23-383O15, co... 46 0.11
461gb|AC068661.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 46 0.11
462gb|AC155711.14| Mus musculus 10 BAC RP24-189K8 (Roswell Park Can... 46 0.11
463gb|AC165346.4| Mus musculus BAC clone RP23-354N5 from chromosome... 46 0.11
464gb|AC166058.2| Mus musculus BAC clone RP23-343A20 from chromosom... 46 0.11
465ref|XR_004647.1| PREDICTED: Mus musculus hypothetical protein LO... 46 0.11
466ref|XR_003521.1| PREDICTED: Mus musculus similar to ariadne homo... 46 0.11
467gb|AY330351.1| Oryctolagus cuniculus ubiquitin-conjugating enzym... 46 0.11
468ref|XR_003335.1| PREDICTED: Mus musculus similar to High mobilit... 46 0.11
469ref|XR_002076.1| PREDICTED: Mus musculus similar to High mobilit... 46 0.11
470gb|AC124168.3| Mus musculus BAC clone RP23-143G9 from chromosome... 46 0.11
471ref|NM_001012275.2| Rattus norvegicus ariadne homolog 2 (Drosoph... 46 0.11
472emb|AL929011.11| Mouse DNA sequence from clone RP23-55O12 on chr... 46 0.11
473gb|AC132085.3| Mus musculus BAC clone RP24-550M24 from chromosom... 46 0.11
474gb|AC125486.4| Mus musculus BAC clone RP23-21G7 from chromosome ... 46 0.11
475gb|AC116319.4| Mus musculus BAC clone RP23-265J2 from chromosome... 46 0.11
476gb|AC002565.1|HUAC002565 Human Chromosome 16 BAC clone CIT987SK-... 46 0.11
477ref|XM_806832.1| Trypanosoma cruzi strain CL Brener hypothetical... 46 0.11
478gb|AC122016.4| Mus musculus BAC clone RP24-359J23 from chromosom... 46 0.11
479ref|XM_813002.1| Trypanosoma cruzi strain CL Brener mucin-associ... 46 0.11
480ref|XM_813920.1| Trypanosoma cruzi strain CL Brener mucin-associ... 46 0.11
481gb|AC122914.4| Mus musculus BAC clone RP23-26F9 from 15, complet... 46 0.11
482gb|AC122191.4| Mus musculus BAC clone RP23-42J4 from 6, complete... 46 0.11
483gb|AC122280.4| Mus musculus BAC clone RP23-239I12 from 17, compl... 46 0.11
484gb|AC116179.6| Mus musculus BAC clone RP23-272C6 from 10, comple... 46 0.11
485ref|XM_852793.1| PREDICTED: Canis familiaris similar to Apoptoti... 46 0.11
486ref|XM_852756.1| PREDICTED: Canis familiaris similar to Apoptoti... 46 0.11
487ref|XM_843917.1| PREDICTED: Canis familiaris similar to Apoptoti... 46 0.11
488ref|XM_852555.1| PREDICTED: Canis familiaris similar to Apoptoti... 46 0.11
489ref|XM_537371.2| PREDICTED: Canis familiaris similar to Apoptoti... 46 0.11
490ref|XM_853204.1| PREDICTED: Canis familiaris similar to Apoptoti... 46 0.11
491ref|XM_853043.1| PREDICTED: Canis familiaris similar to Apoptoti... 46 0.11
492ref|XM_853003.1| PREDICTED: Canis familiaris similar to Apoptoti... 46 0.11
493gb|AC104920.10| Mus musculus chromosome 10, clone RP23-360H23, c... 46 0.11
494gb|AC098886.4| Mus musculus BAC clone RP23-122M21 from 4, comple... 46 0.11
495ref|NM_007349.3| Homo sapiens PAX interacting (with transcriptio... 46 0.11
496ref|XM_720735.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 46 0.11
497gb|AC138101.8| Mus musculus chromosome 5, clone RP23-149H20, com... 46 0.11
498gb|AC164633.2| Mus musculus chromosome 15, clone RP24-374C19, co... 46 0.11
499gb|BC088394.1| Rattus norvegicus cDNA clone IMAGE:7112426, **** ... 46 0.11
500gb|AC118590.11| Mus musculus chromosome 15, clone RP24-506N7, co... 46 0.11

>ref|XM_470185.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 870

 Score =  165 bits (83), Expect = 2e-37
 Identities = 216/260 (83%), Gaps = 3/260 (1%)
 Strand = Plus / Plus

                                                                       
Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257
           |||||| |||| ||||||||||||||  |||| ||||   || || | ||||||||||||
Sbjct: 93  gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 152

                                                                       
Query: 258 gctcaccctcgccgccggctcctgcgggtatggcacggcggccgcctccttcaacggcgg 317
           |||||| ||  | ||||| || |||||||||||||||||||||||  |||||||||||||
Sbjct: 153 gctcacgctgactgccggttcttgcgggtatggcacggcggccgcgaccttcaacggcgg 212

                                                                       
Query: 318 cc---tgctcgccgccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtg 374
           |    | ||||||||||| ||| | |  |||||||| ||||||||| |||||||||||||
Sbjct: 213 cggattcctcgccgccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtg 272

                                                                       
Query: 375 cttctcggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgt 434
           || |  |||||| ||||||||||||||||| ||||||   || |||||||| || |||||
Sbjct: 273 ctaccaggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgt 332

                               
Query: 435 gacggaccgcgcgaggacga 454
            ||||||||||| |||||||
Sbjct: 333 cacggaccgcgccaggacga 352



to top

>dbj|AK099870.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013111F04, full
           insert sequence
          Length = 1123

 Score =  165 bits (83), Expect = 2e-37
 Identities = 216/260 (83%), Gaps = 3/260 (1%)
 Strand = Plus / Plus

                                                                       
Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257
           |||||| |||| ||||||||||||||  |||| ||||   || || | ||||||||||||
Sbjct: 147 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 206

                                                                       
Query: 258 gctcaccctcgccgccggctcctgcgggtatggcacggcggccgcctccttcaacggcgg 317
           |||||| ||  | ||||| || |||||||||||||||||||||||  |||||||||||||
Sbjct: 207 gctcacgctgactgccggttcttgcgggtatggcacggcggccgcgaccttcaacggcgg 266

                                                                       
Query: 318 cc---tgctcgccgccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtg 374
           |    | ||||||||||| ||| | |  |||||||| ||||||||| |||||||||||||
Sbjct: 267 cggattcctcgccgccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtg 326

                                                                       
Query: 375 cttctcggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgt 434
           || |  |||||| ||||||||||||||||| ||||||   || |||||||| || |||||
Sbjct: 327 ctaccaggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgt 386

                               
Query: 435 gacggaccgcgcgaggacga 454
            ||||||||||| |||||||
Sbjct: 387 cacggaccgcgccaggacga 406



to top

>dbj|AK067081.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094I23, full
           insert sequence
          Length = 1121

 Score =  165 bits (83), Expect = 2e-37
 Identities = 216/260 (83%), Gaps = 3/260 (1%)
 Strand = Plus / Plus

                                                                       
Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257
           |||||| |||| ||||||||||||||  |||| ||||   || || | ||||||||||||
Sbjct: 147 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 206

                                                                       
Query: 258 gctcaccctcgccgccggctcctgcgggtatggcacggcggccgcctccttcaacggcgg 317
           |||||| ||  | ||||| || |||||||||||||||||||||||  |||||||||||||
Sbjct: 207 gctcacgctgactgccggttcttgcgggtatggcacggcggccgcgaccttcaacggcgg 266

                                                                       
Query: 318 cc---tgctcgccgccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtg 374
           |    | ||||||||||| ||| | |  |||||||| ||||||||| |||||||||||||
Sbjct: 267 cggattcctcgccgccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtg 326

                                                                       
Query: 375 cttctcggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgt 434
           || |  |||||| ||||||||||||||||| ||||||   || |||||||| || |||||
Sbjct: 327 ctaccaggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgt 386

                               
Query: 435 gacggaccgcgcgaggacga 454
            ||||||||||| |||||||
Sbjct: 387 cacggaccgcgccaggacga 406



to top

>dbj|AK061453.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G06, full
           insert sequence
          Length = 1120

 Score =  165 bits (83), Expect = 2e-37
 Identities = 216/260 (83%), Gaps = 3/260 (1%)
 Strand = Plus / Plus

                                                                       
Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257
           |||||| |||| ||||||||||||||  |||| ||||   || || | ||||||||||||
Sbjct: 151 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 210

                                                                       
Query: 258 gctcaccctcgccgccggctcctgcgggtatggcacggcggccgcctccttcaacggcgg 317
           |||||| ||  | ||||| || |||||||||||||||||||||||  |||||||||||||
Sbjct: 211 gctcacgctgactgccggttcttgcgggtatggcacggcggccgcgaccttcaacggcgg 270

                                                                       
Query: 318 cc---tgctcgccgccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtg 374
           |    | ||||||||||| ||| | |  |||||||| ||||||||| |||||||||||||
Sbjct: 271 cggattcctcgccgccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtg 330

                                                                       
Query: 375 cttctcggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgt 434
           || |  |||||| ||||||||||||||||| ||||||   || |||||||| || |||||
Sbjct: 331 ctaccaggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgt 390

                               
Query: 435 gacggaccgcgcgaggacga 454
            ||||||||||| |||||||
Sbjct: 391 cacggaccgcgccaggacga 410



to top

>gb|AY100693.1| Oryza sativa (japonica cultivar-group) expansin-like protein A
           mRNA, partial cds
          Length = 899

 Score =  105 bits (53), Expect = 1e-19
 Identities = 113/133 (84%)
 Strand = Plus / Plus

                                                                       
Query: 322 ctcgccgccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgcttctcg 381
           ||||||||||| ||| | |  |||||||| ||||||||| ||||||||||||||| |  |
Sbjct: 22  ctcgccgccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgctaccag 81

                                                                       
Query: 382 gtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacggac 441
           ||||| ||||||||||||||||| ||||||   || |||||||| || ||||| ||||||
Sbjct: 82  gtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacggac 141

                        
Query: 442 cgcgcgaggacga 454
           ||||| |||||||
Sbjct: 142 cgcgccaggacga 154



to top

>gb|AC140005.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJA1004C08,
             complete sequence
          Length = 138054

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 93/109 (85%), Gaps = 3/109 (2%)
 Strand = Plus / Plus

                                                                         
Query: 271   gccggctcctgcgggtatggcacggcggccgcctccttcaacggcggcc---tgctcgcc 327
             ||||| || |||||||||||||||||||||||  ||||||||||||||    | ||||||
Sbjct: 36986 gccggttcttgcgggtatggcacggcggccgcgaccttcaacggcggcggattcctcgcc 37045

                                                              
Query: 328   gccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgct 376
             ||||| ||| | |  |||||||| ||||||||| |||||||||||||||
Sbjct: 37046 gccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgct 37094



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                         
Query: 381   ggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacgga 440
             |||||| ||||||||||||||||| ||||||   || |||||||| || ||||| |||||
Sbjct: 37206 ggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacgga 37265

                           
Query: 441   ccgcgcgaggacga 454
             |||||| |||||||
Sbjct: 37266 ccgcgccaggacga 37279



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                         
Query: 198   gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257
             |||||| |||| ||||||||||||||  |||| ||||   || || | ||||||||||||
Sbjct: 36804 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 36863

                   
Query: 258   gctcac 263
             ||||||
Sbjct: 36864 gctcac 36869



to top

>gb|AY039022.1| Oryza sativa expansin-like protein A (EXLA1) gene, complete cds
          Length = 3998

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 93/109 (85%), Gaps = 3/109 (2%)
 Strand = Plus / Plus

                                                                        
Query: 271  gccggctcctgcgggtatggcacggcggccgcctccttcaacggcggcc---tgctcgcc 327
            ||||| || |||||||||||||||||||||||  ||||||||||||||    | ||||||
Sbjct: 1495 gccggttcttgcgggtatggcacggcggccgcgaccttcaacggcggcggattcctcgcc 1554

                                                             
Query: 328  gccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgct 376
            ||||| ||| | |  |||||||| ||||||||| |||||||||||||||
Sbjct: 1555 gccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgct 1603



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                        
Query: 381  ggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacgga 440
            |||||| ||||||||||||||||| ||||||   || |||||||| || ||||| |||||
Sbjct: 1715 ggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacgga 1774

                          
Query: 441  ccgcgcgaggacga 454
            |||||| |||||||
Sbjct: 1775 ccgcgccaggacga 1788



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                        
Query: 198  gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257
            |||||| |||| ||||||||||||||  |||| ||||   || || | ||||||||||||
Sbjct: 1313 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 1372

                  
Query: 258  gctcac 263
            ||||||
Sbjct: 1373 gctcac 1378



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 93/109 (85%), Gaps = 3/109 (2%)
 Strand = Plus / Plus

                                                                           
Query: 271     gccggctcctgcgggtatggcacggcggccgcctccttcaacggcggcc---tgctcgcc 327
               ||||| || |||||||||||||||||||||||  ||||||||||||||    | ||||||
Sbjct: 1811347 gccggttcttgcgggtatggcacggcggccgcgaccttcaacggcggcggattcctcgcc 1811406

                                                                
Query: 328     gccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgct 376
               ||||| ||| | |  |||||||| ||||||||| |||||||||||||||
Sbjct: 1811407 gccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgct 1811455



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                           
Query: 381     ggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacgga 440
               |||||| ||||||||||||||||| ||||||   || |||||||| || ||||| |||||
Sbjct: 1811567 ggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacgga 1811626

                             
Query: 441     ccgcgcgaggacga 454
               |||||| |||||||
Sbjct: 1811627 ccgcgccaggacga 1811640



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                           
Query: 198     gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257
               |||||| |||| ||||||||||||||  |||| ||||   || || | ||||||||||||
Sbjct: 1811165 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 1811224

                     
Query: 258     gctcac 263
               ||||||
Sbjct: 1811225 gctcac 1811230



to top

>gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1004C08,
             complete sequence
          Length = 133090

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 93/109 (85%), Gaps = 3/109 (2%)
 Strand = Plus / Minus

                                                                         
Query: 271   gccggctcctgcgggtatggcacggcggccgcctccttcaacggcggcc---tgctcgcc 327
             ||||| || |||||||||||||||||||||||  ||||||||||||||    | ||||||
Sbjct: 23015 gccggttcttgcgggtatggcacggcggccgcgaccttcaacggcggcggattcctcgcc 22956

                                                              
Query: 328   gccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgct 376
             ||||| ||| | |  |||||||| ||||||||| |||||||||||||||
Sbjct: 22955 gccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgct 22907



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                         
Query: 381   ggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacgga 440
             |||||| ||||||||||||||||| ||||||   || |||||||| || ||||| |||||
Sbjct: 22795 ggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacgga 22736

                           
Query: 441   ccgcgcgaggacga 454
             |||||| |||||||
Sbjct: 22735 ccgcgccaggacga 22722



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                         
Query: 198   gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257
             |||||| |||| ||||||||||||||  |||| ||||   || || | ||||||||||||
Sbjct: 23197 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 23138

                   
Query: 258   gctcac 263
             ||||||
Sbjct: 23137 gctcac 23132



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 93/109 (85%), Gaps = 3/109 (2%)
 Strand = Plus / Plus

                                                                           
Query: 271     gccggctcctgcgggtatggcacggcggccgcctccttcaacggcggcc---tgctcgcc 327
               ||||| || |||||||||||||||||||||||  ||||||||||||||    | ||||||
Sbjct: 1811345 gccggttcttgcgggtatggcacggcggccgcgaccttcaacggcggcggattcctcgcc 1811404

                                                                
Query: 328     gccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgct 376
               ||||| ||| | |  |||||||| ||||||||| |||||||||||||||
Sbjct: 1811405 gccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgct 1811453



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                           
Query: 381     ggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacgga 440
               |||||| ||||||||||||||||| ||||||   || |||||||| || ||||| |||||
Sbjct: 1811565 ggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacgga 1811624

                             
Query: 441     ccgcgcgaggacga 454
               |||||| |||||||
Sbjct: 1811625 ccgcgccaggacga 1811638



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 55/66 (83%)
 Strand = Plus / Plus

                                                                           
Query: 198     gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257
               |||||| |||| ||||||||||||||  |||| ||||   || || | ||||||||||||
Sbjct: 1811163 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 1811222

                     
Query: 258     gctcac 263
               ||||||
Sbjct: 1811223 gctcac 1811228



to top

>ref|NM_197592.1| Oryza sativa (japonica cultivar-group) putative pollen allergen
           (OSJNBb0015I11.10), mRNA
          Length = 898

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Plus

                                                                       
Query: 298 gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357
           ||||| ||||||||||||||||  |||||||||||  || |||  |||| | | ||||| 
Sbjct: 248 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 307

                                                                       
Query: 358 gtccgctgcggcgcgtgcttctcggtgaggtgcaaggacaagaagctctgcagcggtgcc 417
           ||| |||||||||| ||||||  |||| |||||||||||   ||||| ||||||   || 
Sbjct: 308 gtcggctgcggcgcctgcttccaggtgcggtgcaaggacggcaagctgtgcagcacggcg 367

                                   
Query: 418 ggcgcccgggtggtcgtgacggac 441
           ||||||  ||||||||||||||||
Sbjct: 368 ggcgccaaggtggtcgtgacggac 391



to top

>dbj|AK068088.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013131C11, full
           insert sequence
          Length = 1196

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Plus

                                                                       
Query: 298 gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357
           ||||| ||||||||||||||||  |||||||||||  || |||  |||| | | ||||| 
Sbjct: 432 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 491

                                                                       
Query: 358 gtccgctgcggcgcgtgcttctcggtgaggtgcaaggacaagaagctctgcagcggtgcc 417
           ||| |||||||||| ||||||  |||| |||||||||||   ||||| ||||||   || 
Sbjct: 492 gtcggctgcggcgcctgcttccaggtgcggtgcaaggacggcaagctgtgcagcacggcg 551

                                   
Query: 418 ggcgcccgggtggtcgtgacggac 441
           ||||||  ||||||||||||||||
Sbjct: 552 ggcgccaaggtggtcgtgacggac 575



to top

>dbj|AK066611.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013071J19, full
           insert sequence
          Length = 1023

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Plus

                                                                       
Query: 298 gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357
           ||||| ||||||||||||||||  |||||||||||  || |||  |||| | | ||||| 
Sbjct: 264 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 323

                                                                       
Query: 358 gtccgctgcggcgcgtgcttctcggtgaggtgcaaggacaagaagctctgcagcggtgcc 417
           ||| |||||||||| ||||||  |||| |||||||||||   ||||| ||||||   || 
Sbjct: 324 gtcggctgcggcgcctgcttccaggtgcggtgcaaggacggcaagctgtgcagcacggcg 383

                                   
Query: 418 ggcgcccgggtggtcgtgacggac 441
           ||||||  ||||||||||||||||
Sbjct: 384 ggcgccaaggtggtcgtgacggac 407



to top

>gb|AC101757.12| Mus musculus chromosome 8, clone RP24-545I11, complete sequence
          Length = 148875

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 161   tcctcttcctcttcttcctcttctgc 186
             ||||||||||||||||||||||||||
Sbjct: 69374 tcctcttcctcttcttcctcttctgc 69349



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 163    ctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||
Sbjct: 146668 ctcttcctcttcttcctcttct 146689



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 146690 tcttcctcttcttcctcttc 146709



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||| ||||||||
Sbjct: 29764 ctcctcttcctcttcctcctcttc 29787



to top

>gb|CP000077.1| Sulfolobus acidocaldarius DSM 639, complete genome
          Length = 2225959

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 160    ctcctcttcctcttcttcctcttctg 185
              ||||||||||||||||||||||||||
Sbjct: 596785 ctcctcttcctcttcttcctcttctg 596810



to top

>ref|XM_634939.1| Dictyostelium discoideum hypothetical protein (DDB0220697), partial
            mRNA
          Length = 3627

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 161  tcctcttcctcttcttcctcttctg 185
            |||||||||||||||||||||||||
Sbjct: 1376 tcctcttcctcttcttcctcttctg 1352



to top

>gb|AC167021.3| Mus musculus BAC clone RP23-152D8 from chromosome 6, complete sequence
          Length = 222021

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 114621 ctcctcttcctcttcttcctcttct 114597



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||| ||||||||||||
Sbjct: 114630 ctcctcttcctcctcttcctcttct 114606



to top

>gb|AC113005.10| Mus musculus chromosome 3, clone RP23-299B23, complete sequence
          Length = 218917

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 112892 ctcctcttcctcttcttcctcttct 112868



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              ||||||||| |||||||||||||||
Sbjct: 112934 ctcctcttcttcttcttcctcttct 112910



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||| ||||||||||||
Sbjct: 112900 tcctcttcctcctcttcctcttct 112877



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 112879 tcttcctcttcttcctcttc 112860



to top

>gb|AC119820.20| Mus musculus chromosome 1, clone RP23-148M18, complete sequence
          Length = 183287

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 116188 ctcctcttcctcttcttcctcttct 116212



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||| ||||||||||||
Sbjct: 116179 ctcctcttcctcctcttcctcttct 116203



to top

>gb|AC161496.6| Mus musculus chromosome 3, clone RP23-119A9, complete sequence
          Length = 203655

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 160 ctcctcttcctcttcttcctcttct 184
           |||||||||||||||||||||||||
Sbjct: 609 ctcctcttcctcttcttcctcttct 633



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 160 ctcctcttcctcttcttcctcttct 184
           ||||||||| |||||||||||||||
Sbjct: 567 ctcctcttcttcttcttcctcttct 591



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 164 tcttcctcttcttcctcttc 183
           ||||||||||||||||||||
Sbjct: 622 tcttcctcttcttcctcttc 641



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 161 tcctcttcctcttcttcctcttct 184
           ||||||||||| ||||||||||||
Sbjct: 601 tcctcttcctcctcttcctcttct 624



to top

>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
              sequence
          Length = 2300533

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 439904 ctcctcttcctcttcttcctcttct 439880



to top

>gb|AC118592.7| Mus musculus chromosome 7, clone RP24-463B5, complete sequence
          Length = 134114

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 50840 ctcctcttcctcttcttcctcttct 50816



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 50849 ctcctcttcctcctcttcctcttct 50825



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 50815 tcttcctcttcttcctcttct 50795



to top

>gb|AC100726.7| Mus musculus chromosome 19, clone RP24-245B11, complete sequence
          Length = 176074

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 72347 ctcctcttcctcttcttcctcttct 72323



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 72334 tcttcctcttcttcctcttc 72315



to top

>gb|AC139578.4| Mus musculus BAC clone RP23-188P12 from chromosome 18, complete sequence
          Length = 179415

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 173214 ctcctcttcctcttcttcctcttct 173190



to top

>gb|AF030001.1|MMMHC29N7 Mus musculus major histocompatibility locus class III
              region:butyrophilin-like protein gene, partial cds; Notch4,
              PBX2, RAGE, lysophatidic acid acyl transferase-alpha,
              palmitoyl-protein thioesterase 2 (PPT2), CREB-RP, and
              tenascin X (TNX) genes, complete cds; and CYP21OHB
              pseudogene, complete sequence
          Length = 201964

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 148    ctgctgccgccgctcctcttcctcttcttcctc 180
              ||||||| || ||||||||||||||||||||||
Sbjct: 154269 ctgctgctgctgctcctcttcctcttcttcctc 154301



to top

>gb|AC096338.17| Rattus norvegicus X BAC CH230-95I19 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 236662

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 47059 ctcctcttcctcttcttcctcttct 47035



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 47046 tcttcctcttcttcctcttc 47027



to top

>gb|AC139211.13| Mus musculus chromosome 6, clone RP23-302O24, complete sequence
          Length = 154129

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 65170 ctcctcttcctcttcttcctcttct 65146



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 65157 tcttcctcttcttcctcttct 65137



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 65148 tcttcctcttcttcctcttct 65128



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 65190 tcttcctcttcttcctcttc 65171



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||| ||||||||||||
Sbjct: 65178 tcctcttcctcctcttcctcttct 65155



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||| ||||||||||||||
Sbjct: 65033 ctcctcttcttcttcttcctcttc 65010



to top

>gb|AC102445.11| Mus musculus chromosome 14, clone RP24-196M4, complete sequence
          Length = 157416

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 119436 ctcctcttcctcttcttcctcttct 119412



to top

>gb|AC164402.3| Mus musculus chromosome 15, clone RP23-463G20, complete sequence
          Length = 196916

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 19017 ctcctcttcctcttcttcctcttct 19041



to top

>gb|AC113495.15| Mus musculus chromosome 9, clone RP23-361O11, complete sequence
          Length = 195356

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 96784 ctcctcttcctcttcttcctcttct 96760



to top

>gb|AC163636.5| Mus musculus BAC clone RP24-499E13 from chromosome 1, complete sequence
          Length = 173781

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 115877 ctcctcttcctcttcttcctcttct 115901



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||| ||||
Sbjct: 115907 ctcctcttcctcttcttccccttc 115930



to top

>gb|AC096226.12| Rattus norvegicus 18 BAC CH230-26M18 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 232962

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 161    tcctcttcctcttcttcctcttctgctcc 189
              |||||||||||||||||||||||| ||||
Sbjct: 174735 tcctcttcctcttcttcctcttctcctcc 174707



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 161    tcctcttcctcttcttcctct 181
              |||||||||||||||||||||
Sbjct: 174798 tcctcttcctcttcttcctct 174778



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 161    tcctcttcctcttcttcctct 181
              |||||||||||||||||||||
Sbjct: 174687 tcctcttcctcttcttcctct 174667



to top

>ref|XM_543410.2| PREDICTED: Canis familiaris similar to Probable RNA-binding protein
            19 (RNA binding motif protein 19) (LOC486284), mRNA
          Length = 3643

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 2281 ctcctcttcctcttcttcctcttct 2257



to top

>ref|XM_566508.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNA01630) partial mRNA
          Length = 1523

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 1446 ctcctcttcctcttcttcctcttct 1422



to top

>gb|AC124458.5| Mus musculus BAC clone RP24-136E11 from chromosome 12, complete
             sequence
          Length = 168181

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 14424 ctcctcttcctcttcttcctcttct 14448



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14536 tcttcctcttcttcctcttct 14556



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14527 tcttcctcttcttcctcttct 14547



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14518 tcttcctcttcttcctcttct 14538



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14509 tcttcctcttcttcctcttct 14529



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14500 tcttcctcttcttcctcttct 14520



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14491 tcttcctcttcttcctcttct 14511



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14482 tcttcctcttcttcctcttct 14502



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14473 tcttcctcttcttcctcttct 14493



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14464 tcttcctcttcttcctcttct 14484



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14455 tcttcctcttcttcctcttct 14475



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14446 tcttcctcttcttcctcttct 14466



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 14437 tcttcctcttcttcctcttct 14457



to top

>gb|AC127553.3| Mus musculus BAC clone RP24-553F11 from chromosome 5, complete sequence
          Length = 159693

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 161    tcctcttcctcttcttcctcttctgctcc 189
              |||||||||||||||||||||||| ||||
Sbjct: 129315 tcctcttcctcttcttcctcttctcctcc 129287



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 129347 tcctcttcctcttcttcctcttct 129324



to top

>gb|AC104396.7| Mus musculus BAC clone RP23-413J8 from chromosome 3, complete sequence
          Length = 195860

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 161   tcctcttcctcttcttcctcttctgctcc 189
             |||||||||||||||||||||||| ||||
Sbjct: 47863 tcctcttcctcttcttcctcttctcctcc 47835



to top

>ref|XM_811341.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053507049.179) partial mRNA
          Length = 3402

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 160 ctcctcttcctcttcttcctcttct 184
           |||||||||||||||||||||||||
Sbjct: 681 ctcctcttcctcttcttcctcttct 657



to top

>gb|AC122467.3| Mus musculus BAC clone RP24-311K2 from chromosome 6, complete sequence
          Length = 110480

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 12797 ctcctcttcctcttcttcctcttct 12773



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 12806 ctcctcttcctcctcttcctcttct 12782



to top

>gb|AC098723.3| Mus musculus BAC clone RP23-3D10 from 7, complete sequence
          Length = 227968

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 42219 ctcctcttcctcttcttcctcttct 42243



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 42244 tcttcctcttcttcctcttct 42264



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 42210 ctcctcttcctcctcttcctcttct 42234



to top

>gb|AC004015.1| Homo sapiens BAC clone CTA-333F24 from 7, complete sequence
          Length = 144239

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 113195 ctcctcttcctcttcttcctcttct 113219



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 113217 tcttcctcttcttcctcttct 113237



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 113208 tcttcctcttcttcctcttct 113228



to top

>gb|AC101527.12| Mus musculus chromosome 15, clone RP23-191D20, complete sequence
          Length = 193390

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 100449 ctcctcttcctcttcttcctcttct 100473



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100480 tcttcctcttcttcctcttct 100500



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100471 tcttcctcttcttcctcttct 100491



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100462 tcttcctcttcttcctcttct 100482



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||| ||||||||||||
Sbjct: 100440 ctcctcttcctcctcttcctcttct 100464



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100408 tcttcctcttcttcctcttct 100428



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100399 tcttcctcttcttcctcttct 100419



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100390 tcttcctcttcttcctcttct 100410



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100381 tcttcctcttcttcctcttct 100401



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100372 tcttcctcttcttcctcttct 100392



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100363 tcttcctcttcttcctcttct 100383



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100354 tcttcctcttcttcctcttct 100374



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 100519 tcctcttcctcttcttcttcttct 100542



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 100489 tcttcctcttcttcctcttc 100508



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 165   cttcctcttcttcctcttct 184
             ||||||||||||||||||||
Sbjct: 69490 cttcctcttcttcctcttct 69509



to top

>emb|AL357143.13| Human DNA sequence from clone RP11-71G12 on chromosome 1 Contains a
             novel gene and a CPG island, complete sequence
          Length = 46936

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 159   gctcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||||
Sbjct: 19351 gctcctcttcctcttcttcctcttc 19327



to top

>emb|AL162377.10| Human DNA sequence from clone RP11-327P2 on chromosome 13 Contains 3
             novel genes, a meningioma-expressed antigen 6/11 (MEA6)
             (MEA11) pseudogene and the 3' end of the ATP7B gene for
             ATPase, Cu++ transporting, beta polypeptide (Wilson
             disease), complete sequence
          Length = 169104

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 80421 ctcctcttcctcttcttcctcttct 80397



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 80408 tcttcctcttcttcctcttct 80388



to top

>gb|AC091153.10| Homo sapiens chromosome 17, clone RP11-314A20, complete sequence
          Length = 195494

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 109764 ctcctcttcctcttcttcctcttct 109740



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              |||||||| |||||||||||||||
Sbjct: 109748 tcctcttcttcttcttcctcttct 109725



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 109736 tcttcctcttcttcctcttc 109717



to top

>emb|AL020995.14|HS117O3 Human DNA sequence from clone RP1-117O3 on chromosome 1p33-34.3
             Contains the 3' end of a novel gene, the AK2 gene for
             adenylate kinase 2, the gene for ornithine
             decarboxylase-like (ODC-p) and a CpG island, complete
             sequence
          Length = 150997

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 80283 ctcctcttcctcttcttcctcttct 80259



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 80444 tcttcctcttcttcctcttc 80425



to top

>gb|AC027820.12| Homo sapiens chromosome 17, clone RP11-198F11, complete sequence
          Length = 154353

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 149356 ctcctcttcctcttcttcctcttct 149332



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              |||||||| |||||||||||||||
Sbjct: 149340 tcctcttcttcttcttcctcttct 149317



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 149328 tcttcctcttcttcctcttc 149309



to top

>ref|NM_014389.1| Homo sapiens proline, glutamic acid and leucine rich protein 1
            (PELP1), mRNA
          Length = 3393

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 2721 ctcctcttcctcttcttcctcttct 2697



to top

>emb|AL627215.12| Mouse DNA sequence from clone RP23-292E3 on chromosome 11, complete
             sequence
          Length = 216106

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 75969 ctcctcttcctcttcttcctcttct 75945



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 157306 tcctcttcctcttcttcctcttct 157329



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||| ||||||||||||||||||
Sbjct: 76214 ctcctcctcctcttcttcctcttct 76190



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 157318 tcttcctcttcttcctcttc 157337



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              |||||| |||||||||||||||||
Sbjct: 157272 ctcctcctcctcttcttcctcttc 157295



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||| ||||||||
Sbjct: 76142 ctcctcttcctcttcctcctcttc 76119



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||| ||||||||
Sbjct: 76047 ctcctcttcctcttcctcctcttc 76024



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||| ||||||||
Sbjct: 76017 ctcctcttcctcttcctcctcttc 75994



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||| ||||||||
Sbjct: 75984 ctcctcttcctcttcctcctcttc 75961



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||| ||||||||||||
Sbjct: 75977 tcctcttcctcctcttcctcttct 75954



to top

>emb|AL603708.13| Mouse DNA sequence from clone RP23-381C21 on chromosome 11, complete
              sequence
          Length = 198743

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 191671 ctcctcttcctcttcttcctcttct 191695



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 191684 tcttcctcttcttcctcttct 191704



to top

>emb|AL691481.15| Mouse DNA sequence from clone RP23-173C3 on chromosome 4 Contains a
              non-neuron enolase 1 alpha  (Eno1) pseudogene, a
              mitochondrial H+ transporting ATP synthase F0 complex
              subunit d (Atp5h) pseudogene and a CpG island, complete
              sequence
          Length = 230127

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 216658 ctcctcttcctcttcttcctcttct 216634



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||| ||||||||||||
Sbjct: 216667 ctcctcttcctcctcttcctcttct 216643



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 216645 tcttcctcttcttcctcttct 216625



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 216636 tcttcctcttcttcctcttct 216616



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              |||||||||||| |||||||||||
Sbjct: 216604 ctcctcttcctcctcttcctcttc 216581



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 216576 tcctcttcctcttcttcttcttct 216553



to top

>gb|AC120797.9| Mus musculus chromosome 18, clone RP24-81D18, complete sequence
          Length = 210631

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 98047 ctcctcttcctcttcttcctcttct 98023



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 125145 tcttcctcttcttcctcttc 125164



to top

>gb|AC150683.3| Mus musculus BAC clone RP23-435E16 from chromosome 7, complete sequence
          Length = 198646

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 161   tcctcttcctcttcttcctcttctgctcc 189
             ||||||||||| |||||||||||||||||
Sbjct: 88803 tcctcttcctcatcttcctcttctgctcc 88831



to top

>gb|AC104439.2| Homo sapiens chromosome 3 clone RP11-793E15, complete sequence
          Length = 197279

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 107611 ctcctcttcctcttcttcctcttct 107635



to top

>gb|AC161009.5| Pan troglodytes BAC clone CH251-560O18 from chromosome unknown,
             complete sequence
          Length = 168542

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 161   tcctcttcctcttcttcctcttctgctccctcc 193
             |||||||||||||||||||||||| || |||||
Sbjct: 94736 tcctcttcctcttcttcctcttcttcttcctcc 94704



to top

>gb|U88153.2|HSU88153 Homo sapiens PELP1 mRNA, complete cds
          Length = 3910

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 3183 ctcctcttcctcttcttcctcttct 3159



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            |||||||| |||||||||||||||
Sbjct: 3167 tcctcttcttcttcttcctcttct 3144



to top

>gb|AC023789.8| Mus musculus chromosome 4 clone RP23-43A16, complete sequence
          Length = 146120

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 159   gctcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||||
Sbjct: 59521 gctcctcttcctcttcttcctcttc 59497



to top

>dbj|AB010266.1| Mus musculus Creb-rp, Tnx and Cyp21 genes for cAMP response element
             binding protein-related protein, tenascin-X and steroid
             21-hydroxylase, partial cds and complete sequences
          Length = 67977

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 148   ctgctgccgccgctcctcttcctcttcttcctc 180
             ||||||| || ||||||||||||||||||||||
Sbjct: 23357 ctgctgctgctgctcctcttcctcttcttcctc 23389



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             |||||||||||| |||||||||||
Sbjct: 67425 ctcctcttcctcctcttcctcttc 67402



to top

>gb|AC079222.17| Mus musculus chromosome 1, clone RP22-292L24, complete sequence
          Length = 159700

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 103629 ctcctcttcctcttcttcctcttct 103605



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||| ||||||||||||
Sbjct: 103638 ctcctcttcctcctcttcctcttct 103614



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              |||||||||||| |||||||||||
Sbjct: 106539 ctcctcttcctcctcttcctcttc 106562



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 161    tcctcttcctcttcttcctc 180
              ||||||||||||||||||||
Sbjct: 103691 tcctcttcctcttcttcctc 103672



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 103520 tcctcttcctcttcttcttcttct 103497



to top

>gb|AC161113.2| Mus musculus BAC clone RP24-362N9 from chromosome 9, complete sequence
          Length = 171642

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 31574 ctcctcttcctcttcttcctcttct 31550



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||| ||||||
Sbjct: 165516 ctcctcttcctcttcttcttcttct 165540



to top

>gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 genomic sequence, complete
             sequence
          Length = 138824

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                         
Query: 298   gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357
             ||||| ||||||||||||||||  |||||||||||  || |||  |||| | | ||||| 
Sbjct: 62387 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 62446

                                  
Query: 358   gtccgctgcggcgcgtgcttc 378
             ||| |||||||||| ||||||
Sbjct: 62447 gtcggctgcggcgcctgcttc 62467



to top

>gb|AC130527.4| Mus musculus BAC clone RP23-56C10 from chromosome 1, complete sequence
          Length = 233538

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 34867 ctcctcttcctcttcttcctcttct 34891



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||| ||||
Sbjct: 34897 ctcctcttcctcttcttccccttc 34920



to top

>gb|AC155636.3| Mus musculus BAC clone RP23-345F5 from chromosome 17, complete sequence
          Length = 223528

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 161   tcctcttcctcttcttcctcttctgctccctcc 193
             |||||||||||||||||||||||| || |||||
Sbjct: 25785 tcctcttcctcttcttcctcttcttcttcctcc 25817



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                            
Query: 298      gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357
                ||||| ||||||||||||||||  |||||||||||  || |||  |||| | | ||||| 
Sbjct: 20660935 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 20660994

                                     
Query: 358      gtccgctgcggcgcgtgcttc 378
                ||| |||||||||| ||||||
Sbjct: 20660995 gtcggctgcggcgcctgcttc 20661015



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 161      tcctcttcctcttcttcctcttc 183
                |||||||||||||||||||||||
Sbjct: 18295788 tcctcttcctcttcttcctcttc 18295766



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 160      ctcctcttcctcttcttcctcttc 183
                |||||| |||||||||||||||||
Sbjct: 18295810 ctcctcctcctcttcttcctcttc 18295787



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 317     gcctgctcgccgccgccggc 336
               ||||||||||||||||||||
Sbjct: 8737501 gcctgctcgccgccgccggc 8737520



to top

>gb|AC100735.15| Mus musculus chromosome 7, clone RP24-331F7, complete sequence
          Length = 179974

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 23515 ctcctcttcctcttcttcctcttct 23539



to top

>gb|AC018553.6| Homo sapiens chromosome 16 clone RP11-434E6, complete sequence
          Length = 172315

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 163908 ctcctcttcctcttcttcctcttct 163932



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 163921 tcttcctcttcttcctcttct 163941



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||| ||||||||||||
Sbjct: 163899 ctcctcttcctcctcttcctcttct 163923



to top

>gb|AC140675.5| Mus musculus BAC clone RP23-44J10 from chromosome 5, complete sequence
          Length = 229269

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 209724 ctcctcttcctcttcttcctcttct 209748



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 209556 ctcctcttcctcttcttcctcttc 209579



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 160    ctcctcttcctcttcttcctc 180
              |||||||||||||||||||||
Sbjct: 209777 ctcctcttcctcttcttcctc 209797



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 160    ctcctcttcctcttcttcctc 180
              |||||||||||||||||||||
Sbjct: 209520 ctcctcttcctcttcttcctc 209540



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||| ||||||||||||
Sbjct: 209511 ctcctcttcctcctcttcctcttct 209535



to top

>gb|AC133645.5| Mus musculus BAC clone RP23-73O10 from chromosome 5, complete sequence
          Length = 207846

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 25718 ctcctcttcctcttcttcctcttct 25742



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 25550 ctcctcttcctcttcttcctcttc 25573



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 25771 ctcctcttcctcttcttcctc 25791



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 25514 ctcctcttcctcttcttcctc 25534



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 25505 ctcctcttcctcctcttcctcttct 25529



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 165    cttcctcttcttcctcttct 184
              ||||||||||||||||||||
Sbjct: 145150 cttcctcttcttcctcttct 145169



to top

>gb|AC007343.7| Homo sapiens chromosome 16 clone RP11-463J22, complete sequence
          Length = 186732

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 101984 ctcctcttcctcttcttcctcttct 102008



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 101997 tcttcctcttcttcctcttct 102017



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||| ||||||||||||
Sbjct: 101975 ctcctcttcctcctcttcctcttct 101999



to top

>gb|AC009021.8| Homo sapiens chromosome 16 clone RP11-105C19, complete sequence
          Length = 176219

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 97892 ctcctcttcctcttcttcctcttct 97868



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 97901 ctcctcttcctcctcttcctcttct 97877



to top

>ref|NM_214596.1| Strongylocentrotus purpuratus radial spokehead (LOC373423), mRNA
          Length = 2332

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 159 gctcctcttcctcttcttcctcttc 183
           |||||||||||||||||||||||||
Sbjct: 887 gctcctcttcctcttcttcctcttc 863



to top

>gb|AC138069.3| Homo sapiens chromosome 3 clone RP13-546I2, complete sequence
          Length = 177334

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 5811 ctcctcttcctcttcttcctcttct 5835



to top

>emb|CT030725.15| Mouse DNA sequence from clone RP24-281O2 on chromosome 16, complete
             sequence
          Length = 115213

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 34348 ctcctcttcctcttcttcctcttct 34372



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||| ||||||||||||
Sbjct: 34340 tcctcttcctcctcttcctcttct 34363



to top

>gb|AC102506.9| Mus musculus chromosome 1, clone RP24-139E15, complete sequence
          Length = 151816

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 33628 ctcctcttcctcttcttcctcttct 33652



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 33619 ctcctcttcctcctcttcctcttct 33643



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||| ||||||
Sbjct: 33733 tcctcttcctcttcttcttcttct 33756



to top

>gb|AC109198.9| Mus musculus chromosome 15, clone RP23-31G10, complete sequence
          Length = 207069

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 205134 ctcctcttcctcttcttcctcttct 205158



to top

>gb|AC102858.11| Mus musculus chromosome 5, clone RP24-507F5, complete sequence
          Length = 176211

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 113351 ctcctcttcctcttcttcctcttct 113375



to top

>gb|AC006289.1|AC006289 Mus musculus chromosome 17, clone 29_N_7, complete sequence
          Length = 201986

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 148    ctgctgccgccgctcctcttcctcttcttcctc 180
              ||||||| || ||||||||||||||||||||||
Sbjct: 154290 ctgctgctgctgctcctcttcctcttcttcctc 154322



to top

>emb|AL773539.18| Mouse DNA sequence from clone RP23-9F18 on chromosome 4, complete
             sequence
          Length = 182206

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 159   gctcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||||
Sbjct: 86281 gctcctcttcctcttcttcctcttc 86305



to top

>gb|AY882602.1| Homo sapiens transcription factor HMX3 mRNA, complete cds
          Length = 3186

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 2514 ctcctcttcctcttcttcctcttct 2490



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            |||||||| |||||||||||||||
Sbjct: 2498 tcctcttcttcttcttcctcttct 2475



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 164  tcttcctcttcttcctcttc 183
            ||||||||||||||||||||
Sbjct: 2486 tcttcctcttcttcctcttc 2467



to top

>gb|AC113936.16| Mus musculus chromosome 10, clone RP23-9F21, complete sequence
          Length = 205086

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 151404 ctcctcttcctcttcttcctcttct 151380



to top

>gb|AC121504.14| Mus musculus chromosome 13, clone RP24-140A15, complete sequence
          Length = 156791

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 78360 ctcctcttcctcttcttcctcttct 78336



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||| ||||||||||||
Sbjct: 78368 tcctcttcctcctcttcctcttct 78345



to top

>emb|BX293544.7| Mouse DNA sequence from clone RP23-109C9 on chromosome 2, complete
            sequence
          Length = 97505

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 6698 ctcctcttcctcttcttcctcttct 6674



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 161  tcctcttcctcttcttcctc 180
            ||||||||||||||||||||
Sbjct: 6721 tcctcttcctcttcttcctc 6702



to top

>gb|U73123.1|SPU73123 Strongylocentrotus purpuratus radial spokehead mRNA, complete cds
          Length = 2332

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 159 gctcctcttcctcttcttcctcttc 183
           |||||||||||||||||||||||||
Sbjct: 887 gctcctcttcctcttcttcctcttc 863



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                            
Query: 298      gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357
                ||||| ||||||||||||||||  |||||||||||  || |||  |||| | | ||||| 
Sbjct: 20672207 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 20672266

                                     
Query: 358      gtccgctgcggcgcgtgcttc 378
                ||| |||||||||| ||||||
Sbjct: 20672267 gtcggctgcggcgcctgcttc 20672287



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 161      tcctcttcctcttcttcctcttc 183
                |||||||||||||||||||||||
Sbjct: 18305441 tcctcttcctcttcttcctcttc 18305419



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 160      ctcctcttcctcttcttcctcttc 183
                |||||| |||||||||||||||||
Sbjct: 18305463 ctcctcctcctcttcttcctcttc 18305440



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 317     gcctgctcgccgccgccggc 336
               ||||||||||||||||||||
Sbjct: 8742640 gcctgctcgccgccgccggc 8742659



to top

>emb|AL845485.16| Mouse DNA sequence from clone RP23-237D23 on chromosome 2, complete
             sequence
          Length = 230213

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 91369 ctcctcttcctcttcttcctcttct 91393



to top

>gb|AC141471.4| Mus musculus BAC clone RP24-326K11 from 18, complete sequence
          Length = 216048

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 28753 ctcctcttcctcttcttcctcttct 28729



to top

>gb|AC135673.5| Mus musculus BAC clone RP24-279A17 from 16, complete sequence
          Length = 173965

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 80828 ctcctcttcctcttcttcctcttct 80852



to top

>emb|CT573030.2| Mouse DNA sequence from clone RP24-100B3 on chromosome 17, complete
             sequence
          Length = 111957

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 148   ctgctgccgccgctcctcttcctcttcttcctc 180
             ||||||| || ||||||||||||||||||||||
Sbjct: 15879 ctgctgctgctgctcctcttcctcttcttcctc 15911



to top

>gb|U88154.1|HSU88154 Homo sapiens proline and glutamic acid rich nuclear protein isoform
            mRNA, partial cds
          Length = 3121

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 2394 ctcctcttcctcttcttcctcttct 2370



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            |||||||| |||||||||||||||
Sbjct: 2378 tcctcttcttcttcttcctcttct 2355



to top

>gb|AC015535.11| Mus musculus chromosome 5, clone RP23-39M18, complete sequence
          Length = 263382

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 161    tcctcttcctcttcttcctcttctgctcc 189
              |||||||||||||||||||||||| ||||
Sbjct: 235838 tcctcttcctcttcttcctcttctcctcc 235866



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 235806 tcctcttcctcttcttcctcttct 235829



to top

>emb|CT025535.14| Mouse DNA sequence from clone RP23-359O5 on chromosome 14, complete
             sequence
          Length = 193236

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 77386 ctcctcttcctcttcttcctcttct 77410



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 160  ctcctcttcctcttcttcctcttc 183
            |||||| |||||||||||||||||
Sbjct: 2213 ctcctcctcctcttcttcctcttc 2236



to top

>gb|BC002875.2| Homo sapiens proline, glutamic acid and leucine rich protein 1, mRNA
            (cDNA clone IMAGE:3940843), partial cds
          Length = 2311

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 1562 ctcctcttcctcttcttcctcttct 1538



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            |||||||| |||||||||||||||
Sbjct: 1546 tcctcttcttcttcttcctcttct 1523



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 164  tcttcctcttcttcctcttc 183
            ||||||||||||||||||||
Sbjct: 1534 tcttcctcttcttcctcttc 1515



to top

>gb|AC147562.5| Mus musculus BAC clone RP23-239A13 from 3, complete sequence
          Length = 167633

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 161    tcctcttcctcttcttcctcttctgctcc 189
              |||||||||||||||||||||||| ||||
Sbjct: 103869 tcctcttcctcttcttcctcttctcctcc 103841



to top

>gb|BC069058.1| Homo sapiens proline, glutamic acid and leucine rich protein 1, mRNA
            (cDNA clone MGC:70420 IMAGE:6068755), complete cds
          Length = 3456

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 2721 ctcctcttcctcttcttcctcttct 2697



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            |||||||| |||||||||||||||
Sbjct: 2705 tcctcttcttcttcttcctcttct 2682



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 164  tcttcctcttcttcctcttc 183
            ||||||||||||||||||||
Sbjct: 2693 tcttcctcttcttcctcttc 2674



to top

>gb|BC039131.1| Homo sapiens proline, glutamic acid and leucine rich protein 1, mRNA
            (cDNA clone IMAGE:4158475), with apparent retained intron
          Length = 3453

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 2674 ctcctcttcctcttcttcctcttct 2650



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            |||||||| |||||||||||||||
Sbjct: 2658 tcctcttcttcttcttcctcttct 2635



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 164  tcttcctcttcttcctcttc 183
            ||||||||||||||||||||
Sbjct: 2646 tcttcctcttcttcctcttc 2627



to top

>gb|AC126054.5| Mus musculus BAC clone RP23-298O13 from 8, complete sequence
          Length = 233117

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 75354 ctcctcttcctcttcttcctcttct 75378



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 75367 tcttcctcttcttcctcttc 75386



to top

>gb|BC010457.2| Homo sapiens proline, glutamic acid and leucine rich protein 1, mRNA
            (cDNA clone IMAGE:4156419), partial cds
          Length = 3216

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 2475 ctcctcttcctcttcttcctcttct 2451



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            |||||||| |||||||||||||||
Sbjct: 2459 tcctcttcttcttcttcctcttct 2436



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 164  tcttcctcttcttcctcttc 183
            ||||||||||||||||||||
Sbjct: 2447 tcttcctcttcttcctcttc 2428



to top

>gb|AF547989.1| Homo sapiens MNAR (MNAR) mRNA, complete cds
          Length = 3393

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||||||||||||||||
Sbjct: 2721 ctcctcttcctcttcttcctcttct 2697



to top

>gb|AC118226.7| Mus musculus chromosome 5, clone RP23-372N19, complete sequence
          Length = 173599

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 27713 ctcctcttcctcttcttcctcttct 27689



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 18743 ctcctcttcctcttcttcctc 18723



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 161    tcctcttcctcttcttcctc 180
              ||||||||||||||||||||
Sbjct: 146751 tcctcttcctcttcttcctc 146732



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 161   tcctcttcctcttcttcctc 180
             ||||||||||||||||||||
Sbjct: 27682 tcctcttcctcttcttcctc 27663



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||| ||||||||||||||||||
Sbjct: 27604 tcctcctcctcttcttcctcttct 27581



to top

>gb|AC168881.3| Mus musculus BAC clone RP23-170A19 from chromosome 13, complete sequence
          Length = 212206

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 141949 ctcctcttcctcttcttcctcttct 141925



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 141876 tcctcttcctcttcttcctcttct 141853



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 141837 tcctcttcctcttcttcctcttct 141814



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 141813 tcctcttcctcttcttcctcttct 141790



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 161    tcctcttcctcttcttcctcttc 183
              |||||||||||||||||||||||
Sbjct: 141891 tcctcttcctcttcttcctcttc 141869



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 161    tcctcttcctcttcttcctcttc 183
              |||||||||||||||||||||||
Sbjct: 141783 tcctcttcctcttcttcctcttc 141761



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 141936 tcttcctcttcttcctcttct 141916



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 141927 tcttcctcttcttcctcttct 141907



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              |||||||| |||||||||||||||
Sbjct: 141861 tcctcttcttcttcttcctcttct 141838



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 141849 tcttcctcttcttcctcttc 141830



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 141825 tcttcctcttcttcctcttc 141806



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 141801 tcttcctcttcttcctcttc 141782



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 141762 tcctcttcctcttcttcttcttct 141739



to top

>emb|AL626782.10| Mouse DNA sequence from clone RP23-335N15 on chromosome X, complete
             sequence
          Length = 177264

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 38260 ctcctcttcctcttcttcctcttct 38236



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 38388 tcttcctcttcttcctcttct 38368



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 38379 tcttcctcttcttcctcttct 38359



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 38269 ctcctcttcctcctcttcctcttct 38245



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 38247 tcttcctcttcttcctcttct 38227



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 38238 tcttcctcttcttcctcttct 38218



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 38229 tcttcctcttcttcctcttct 38209



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 38370 tcttcctcttcttcctcttc 38351



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 38220 tcttcctcttcttcctcttc 38201



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||| ||||||
Sbjct: 38178 tcctcttcctcttcttcttcttct 38155



to top

>emb|AL607074.13| Mouse DNA sequence from clone RP23-174M9 on chromosome 4, complete
              sequence
          Length = 204428

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 155748 ctcctcttcctcttcttcctcttct 155772



to top

>emb|AL732296.11| Mouse DNA sequence from clone RP23-131P6 on chromosome 2, complete
             sequence
          Length = 203503

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 89957 ctcctcttcctcttcttcctcttct 89933



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 89944 tcttcctcttcttcctcttct 89924



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             |||||||||||| |||||||||||
Sbjct: 89996 ctcctcttcctcctcttcctcttc 89973



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||| ||||||||
Sbjct: 89987 ctcctcttcctcttcctcctcttc 89964



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||| ||||||||
Sbjct: 89972 ctcctcttcctcttcctcctcttc 89949



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||| ||||||||||||
Sbjct: 89965 tcctcttcctcctcttcctcttct 89942



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 89935 tcttcctcttcttcctcttc 89916



to top

>emb|AL611970.11| Mouse DNA sequence from clone RP23-413K17 on chromosome 4, complete
             sequence
          Length = 61588

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 51790 ctcctcttcctcttcttcctcttct 51814



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 161   tcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||
Sbjct: 51875 tcctcttcctcttcttcctcttc 51897



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 161   tcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||
Sbjct: 51860 tcctcttcctcttcttcctcttc 51882



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 52108 ctcctcttcctcttcttcctc 52128



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 52015 ctcctcttcctcttcttcctc 52035



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 51967 ctcctcttcctcttcttcctc 51987



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 51949 ctcctcttcctcttcttcctc 51969



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 51821 tcttcctcttcttcctcttct 51841



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 51812 tcttcctcttcttcctcttct 51832



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 51803 tcttcctcttcttcctcttct 51823



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 51737 tcttcctcttcttcctcttct 51757



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 161   tcctcttcctcttcttcctc 180
             ||||||||||||||||||||
Sbjct: 51995 tcctcttcctcttcttcctc 52014



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 51746 tcttcctcttcttcctcttc 51765



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             |||||||| |||||||||||||||
Sbjct: 51725 tcctcttcttcttcttcctcttct 51748



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             |||||||||||||||||| |||||
Sbjct: 51718 ctcctcttcctcttcttcttcttc 51741



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 51677 tcttcctcttcttcctcttc 51696



to top

>emb|AL645468.11| Mouse DNA sequence from clone RP23-246F18 on chromosome 4, complete
              sequence
          Length = 209764

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 154978 ctcctcttcctcttcttcctcttct 154954



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 160    ctcctcttcctcttcttcctc 180
              |||||||||||||||||||||
Sbjct: 155056 ctcctcttcctcttcttcctc 155036



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||| ||||||||||||
Sbjct: 154987 ctcctcttcctcctcttcctcttct 154963



to top

>emb|AJ251154.1|MMU251154 Mus musculus olfactory receptor cluster, OR37A, OR37B, OR37C, OR37E
             genes and OR37D pseudogene
          Length = 76099

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 159   gctcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||||
Sbjct: 27225 gctcctcttcctcttcttcctcttc 27201



to top

>emb|AL365322.10| Mouse DNA sequence from clone RP23-282D4 on chromosome 1, complete
              sequence
          Length = 259487

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 155931 ctcctcttcctcttcttcctcttct 155955



to top

>gb|AC155715.24| Mus musculus 10 BAC RP24-118H2 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 174860

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 62445 ctcctcttcctcttcttcctcttct 62469



to top

>gb|AC102610.18| Mus musculus chromosome 19, clone RP23-411P21, complete sequence
          Length = 226019

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 139369 ctcctcttcctcttcttcctcttct 139393



to top

>gb|AC158595.25| Mus musculus 10 BAC RP24-216B14 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 231740

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||||||||||
Sbjct: 176989 ctcctcttcctcttcttcctcttct 177013



to top

>gb|AC124528.4| Mus musculus BAC clone RP23-411B19 from chromosome 1, complete sequence
          Length = 195050

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 75168 ctcctcttcctcttcttcctcttct 75144



to top

>emb|AL590992.12| Mouse DNA sequence from clone RP23-212C14 on chromosome 11, complete
             sequence
          Length = 118444

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||||||||||
Sbjct: 39839 ctcctcttcctcttcttcctcttct 39863



to top

>gb|AC130283.8| Mus musculus chromosome 15, clone RP23-136E18, complete sequence
          Length = 180660

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 103657 tcctcttcctcttcttcctcttct 103634



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 161    tcctcttcctcttcttcctcttc 183
              |||||||||||||||||||||||
Sbjct: 103672 tcctcttcctcttcttcctcttc 103650



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103792 tcttcctcttcttcctcttct 103772



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103783 tcttcctcttcttcctcttct 103763



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103774 tcttcctcttcttcctcttct 103754



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103765 tcttcctcttcttcctcttct 103745



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103756 tcttcctcttcttcctcttct 103736



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103747 tcttcctcttcttcctcttct 103727



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103738 tcttcctcttcttcctcttct 103718



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103729 tcttcctcttcttcctcttct 103709



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103720 tcttcctcttcttcctcttct 103700



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103711 tcttcctcttcttcctcttct 103691



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103645 tcttcctcttcttcctcttct 103625



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103636 tcttcctcttcttcctcttct 103616



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103627 tcttcctcttcttcctcttct 103607



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103618 tcttcctcttcttcctcttct 103598



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103609 tcttcctcttcttcctcttct 103589



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 103600 tcttcctcttcttcctcttct 103580



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 165    cttcctcttcttcctcttct 184
              ||||||||||||||||||||
Sbjct: 103800 cttcctcttcttcctcttct 103781



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 103702 tcttcctcttcttcctcttc 103683



to top

>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence
          Length = 186903

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 13046 ctcctcttcctcttcttcctcttc 13023



to top

>gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, complete sequence
          Length = 152183

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 57391 tcctcttcctcttcttcctcttct 57368



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 57156 tcctcttcctcttcttcctcttct 57133



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 161   tcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||
Sbjct: 57406 tcctcttcctcttcttcctcttc 57384



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 161   tcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||
Sbjct: 57186 tcctcttcctcttcttcctcttc 57164



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 161   tcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||
Sbjct: 57171 tcctcttcctcttcttcctcttc 57149



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||| ||||||
Sbjct: 57664 ctcctcttcctcttcttcttcttct 57640



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 57540 tcttcctcttcttcctcttct 57520



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 57225 tcttcctcttcttcctcttct 57205



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 57216 tcttcctcttcttcctcttc 57197



to top

>ref|NM_113819.2| Arabidopsis thaliana unknown protein AT3G28980 mRNA, complete cds
          Length = 1628

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 1368 tcctcttcctcttcttcctcttct 1391



to top

>gb|AC154808.2| Mus musculus BAC clone RP24-512K19 from chromosome 13, complete
             sequence
          Length = 187080

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 64635 ctcctcttcctcttcttcctcttc 64658



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||| ||||||||
Sbjct: 64608 ctcctcttcctcttcctcctcttc 64631



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||| ||||||||
Sbjct: 64593 ctcctcttcctcttcctcctcttc 64616



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||| ||||||||
Sbjct: 64578 ctcctcttcctcttcctcctcttc 64601



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             |||||||||||| |||||||||||
Sbjct: 64569 ctcctcttcctcctcttcctcttc 64592



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 161  tcctcttcctcttcttcctc 180
            ||||||||||||||||||||
Sbjct: 7287 tcctcttcctcttcttcctc 7268



to top

>gb|AC155264.2| Mus musculus BAC clone RP23-281B4 from chromosome 16, complete sequence
          Length = 199531

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 103164 tcctcttcctcttcttcctcttct 103141



to top

>gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, complete sequence
          Length = 175318

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 47243 tcctcttcctcttcttcctcttct 47266



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 47153 tcctcttcctcttcttcctcttct 47176



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 46967 tcctcttcctcttcttcctcttct 46990



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 161   tcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||
Sbjct: 47186 tcctcttcctcttcttcctcttc 47208



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 47273 tcttcctcttcttcctcttct 47293



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 47264 tcttcctcttcttcctcttct 47284



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 47255 tcttcctcttcttcctcttct 47275



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 47165 tcttcctcttcttcctcttct 47185



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||| ||||||
Sbjct: 47047 ctcctcttcctcttcttcttcttct 47071



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 47029 ctcctcttcctcttcttcctc 47049



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 47000 tcttcctcttcttcctcttct 47020



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 46979 tcttcctcttcttcctcttct 46999



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||| ||||||||||||||||||
Sbjct: 46930 ctcctcctcctcttcttcctcttct 46954



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 47174 tcttcctcttcttcctcttc 47193



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 47141 tcttcctcttcttcctcttc 47160



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 161   tcctcttcctcttcttcctc 180
             ||||||||||||||||||||
Sbjct: 47117 tcctcttcctcttcttcctc 47136



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||| ||||||||||||
Sbjct: 47021 tcctcttcctcctcttcctcttct 47044



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 47009 tcttcctcttcttcctcttc 47028



to top

>gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, complete sequence
          Length = 174746

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 151481 tcctcttcctcttcttcctcttct 151504



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 151567 tcttcctcttcttcctcttct 151587



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 151576 tcttcctcttcttcctcttc 151595



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 151493 tcttcctcttcttcctcttc 151512



to top

>gb|AE010302.1| Methanopyrus kandleri AV19 section 1 of 157 of the complete genome
          Length = 11150

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 160  ctcctcttcctcttcttcctcttc 183
            ||||||||||||||||||||||||
Sbjct: 3753 ctcctcttcctcttcttcctcttc 3730



to top

>ref|XM_637799.1| Dictyostelium discoideum hypothetical protein (DDB0217883), partial
           mRNA
          Length = 2250

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 161 tcctcttcctcttcttcctcttct 184
           ||||||||||||||||||||||||
Sbjct: 746 tcctcttcctcttcttcctcttct 723



to top

>gb|AC154483.2| Mus musculus BAC clone RP24-113B3 from chromosome 17, complete sequence
          Length = 182923

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 82304 ctcctcttcctcttcttcctcttc 82281



to top

>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence
          Length = 196951

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 164339 tcctcttcctcttcttcctcttct 164362



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 164315 tcctcttcctcttcttcctcttct 164338



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 164291 tcctcttcctcttcttcctcttct 164314



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 164249 tcctcttcctcttcttcctcttct 164272



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 164351 tcttcctcttcttcctcttct 164371



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 164261 tcttcctcttcttcctcttct 164281



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 161    tcctcttcctcttcttcctc 180
              ||||||||||||||||||||
Sbjct: 164420 tcctcttcctcttcttcctc 164439



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 164327 tcttcctcttcttcctcttc 164346



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 164303 tcttcctcttcttcctcttc 164322



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 160     ctcctcttcctcttcttcctcttc 183
               ||||||||||||||||||||||||
Sbjct: 2526051 ctcctcttcctcttcttcctcttc 2526074



to top

>gb|AC153558.7| Mus musculus 10 BAC RP23-367D2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207823

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 186130 tcctcttcctcttcttcctcttct 186153



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 186118 tcttcctcttcttcctcttc 186137



to top

>gb|AC109149.15| Mus musculus chromosome 19, clone RP24-178F17, complete sequence
          Length = 176668

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 26791 tcctcttcctcttcttcctcttct 26814



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 26821 tcttcctcttcttcctcttct 26841



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 26812 tcttcctcttcttcctcttct 26832



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 26803 tcttcctcttcttcctcttct 26823



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 26770 tcttcctcttcttcctcttct 26790



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 26761 tcttcctcttcttcctcttct 26781



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 26752 tcttcctcttcttcctcttct 26772



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 26743 tcttcctcttcttcctcttct 26763



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 26734 tcttcctcttcttcctcttct 26754



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 26707 tcttcctcttcttcctcttct 26727



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 161   tcctcttcctcttcttcctc 180
             ||||||||||||||||||||
Sbjct: 27138 tcctcttcctcttcttcctc 27157



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 26779 tcttcctcttcttcctcttc 26798



to top

>gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold
          Length = 1743090

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 826981 tcctcttcctcttcttcctcttct 826958



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 826969 tcttcctcttcttcctcttct 826949



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 826948 tcttcctcttcttcctcttct 826928



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 826939 tcttcctcttcttcctcttct 826919



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              |||||||||||| |||||||||||
Sbjct: 826895 ctcctcttcctcctcttcctcttc 826872



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 826852 tcctcttcctcttcttcttcttct 826829



to top

>gb|AF106329.1| Escherichia coli plasmid F putative methyltransferase, putative
            antirestriction protein, single stranded DNA binding
            protein (ssb), PsiB (psiB), and PsiA (psiA) genes,
            complete cds; flmB gene, complete sequence; FlmC (flmC),
            FlmA (flmA), and X genes, complete cds; and unknown genes
          Length = 13310

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 5182 tcctcttcctcttcttcctcttct 5205



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 5194 tcttcctcttcttcctcttct 5214



to top

>gb|AC109268.10| Mus musculus chromosome 1, clone RP23-305F24, complete sequence
          Length = 160975

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 128768 tcctcttcctcttcttcctcttct 128791



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 161    tcctcttcctcttcttcctcttc 183
              |||||||||||||||||||||||
Sbjct: 128801 tcctcttcctcttcttcctcttc 128823



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||| ||||||||||
Sbjct: 128816 tcctcttcctctttttcctcttct 128839



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 128756 tcttcctcttcttcctcttc 128775



to top

>gb|AC101391.15| Mus musculus chromosome 5, clone RP23-119E13, complete sequence
          Length = 209590

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 171474 tcctcttcctcttcttcctcttct 171451



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171600 tcttcctcttcttcctcttct 171580



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171591 tcttcctcttcttcctcttct 171571



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171582 tcttcctcttcttcctcttct 171562



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171573 tcttcctcttcttcctcttct 171553



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171564 tcttcctcttcttcctcttct 171544



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171555 tcttcctcttcttcctcttct 171535



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171546 tcttcctcttcttcctcttct 171526



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171537 tcttcctcttcttcctcttct 171517



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171462 tcttcctcttcttcctcttct 171442



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171453 tcttcctcttcttcctcttct 171433



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171444 tcttcctcttcttcctcttct 171424



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171435 tcttcctcttcttcctcttct 171415



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171426 tcttcctcttcttcctcttct 171406



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171417 tcttcctcttcttcctcttct 171397



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||| ||||||
Sbjct: 171352 ctcctcttcctcttcttcttcttct 171328



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171285 tcttcctcttcttcctcttct 171265



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171276 tcttcctcttcttcctcttct 171256



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171267 tcttcctcttcttcctcttct 171247



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171258 tcttcctcttcttcctcttct 171238



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171249 tcttcctcttcttcctcttct 171229



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171240 tcttcctcttcttcctcttct 171220



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171231 tcttcctcttcttcctcttct 171211



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171108 tcttcctcttcttcctcttct 171088



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171099 tcttcctcttcttcctcttct 171079



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171090 tcttcctcttcttcctcttct 171070



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 171081 tcttcctcttcttcctcttct 171061



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 171528 tcttcctcttcttcctcttc 171509



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 171408 tcttcctcttcttcctcttc 171389



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||| ||||||||||||
Sbjct: 171360 tcctcttcctcctcttcctcttct 171337



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 171222 tcttcctcttcttcctcttc 171203



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 171168 tcctcttcctcttcttcttcttct 171145



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 171072 tcttcctcttcttcctcttc 171053



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 171000 tcctcttcctcttcttcttcttct 170977



to top

>gb|AC164700.3| Mus musculus BAC clone RP24-548M16 from chromosome 5, complete sequence
          Length = 212172

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 68494 tcctcttcctcttcttcctcttct 68471



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 161    tcctcttcctcttcttcctcttctgctcc 189
              |||||||| ||||||||||||||| ||||
Sbjct: 151669 tcctcttcttcttcttcctcttcttctcc 151641



to top

>gb|AC102354.14| Mus musculus chromosome 17, clone RP23-80J17, complete sequence
          Length = 117703

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 101091 ctcctcttcctcttcttcctcttc 101068



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||| ||||||||
Sbjct: 101276 ctcctcttcctcttcctcctcttc 101253



to top

>gb|AC115937.14| Mus musculus chromosome 5, clone RP24-547J21, complete sequence
          Length = 215400

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 131148 tcctcttcctcttcttcctcttct 131125



to top

>gb|AC114613.12| Mus musculus chromosome 5, clone RP24-80F7, complete sequence
          Length = 190200

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                  
Query: 148    ctgctgccgccgctcctcttcctcttcttcctcttc 183
              ||||||| || ||||||| |||||||||||||||||
Sbjct: 165914 ctgctgctgctgctcctcctcctcttcttcctcttc 165879



to top

>gb|AC158594.12| Mus musculus 10 BAC RP23-197I5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 218257

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 155128 ctcctcttcctcttcttcctcttc 155151



to top

>ref|XM_869058.1| PREDICTED: Bos taurus similar to Protein KIAA0586 (LOC616919),
            partial mRNA
          Length = 2820

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 1586 tcctcttcctcttcttcctcttct 1563



to top

>gb|AC120390.12| Mus musculus chromosome 9, clone RP24-308L17, complete sequence
          Length = 138507

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 47669 ctcctcttcctcttcttcctcttc 47692



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 160   ctcctcttcctcttcttcctcttctgctccctcc 193
             ||||||||||||||||||||| ||| || |||||
Sbjct: 47792 ctcctcttcctcttcttcctcctcttcttcctcc 47825



to top

>gb|AC124614.11| Mus musculus chromosome 10, clone RP24-417L12, complete sequence
          Length = 173306

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 82367 tcctcttcctcttcttcctcttct 82344



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 82355 tcttcctcttcttcctcttct 82335



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 82346 tcttcctcttcttcctcttct 82326



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 82337 tcttcctcttcttcctcttct 82317



to top

>gb|BC072219.1| Xenopus laevis hypothetical protein MGC81377, mRNA (cDNA clone
           MGC:81377 IMAGE:6634406), complete cds
          Length = 2486

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 160 ctcctcttcctcttcttcctcttc 183
           ||||||||||||||||||||||||
Sbjct: 694 ctcctcttcctcttcttcctcttc 671



to top

>gb|AC134460.4| Mus musculus BAC clone RP23-373D18 from chromosome 10, complete
             sequence
          Length = 174545

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 87935 ctcctcttcctcttcttcctcttc 87912



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             |||||||||||| |||||||||||
Sbjct: 87968 ctcctcttcctcctcttcctcttc 87945



to top

>gb|AC139755.3| Mus musculus BAC clone RP24-96N20 from chromosome 6, complete sequence
          Length = 192869

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 80839 tcctcttcctcttcttcctcttct 80816



to top

>gb|AC131586.10| Mus musculus chromosome 14, clone RP24-226L18, complete sequence
          Length = 171023

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 30932 tcctcttcctcttcttcctcttct 30955



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 161   tcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||
Sbjct: 30917 tcctcttcctcttcttcctcttc 30939



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 161   tcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||
Sbjct: 30902 tcctcttcctcttcttcctcttc 30924



to top

>gb|BC072638.1| Mus musculus RIKEN cDNA E130013N09 gene, mRNA (cDNA clone
            IMAGE:30354620), partial cds
          Length = 4288

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 1453 tcctcttcctcttcttcctcttct 1476



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 1465 tcttcctcttcttcctcttct 1485



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 164  tcttcctcttcttcctcttc 183
            ||||||||||||||||||||
Sbjct: 1474 tcttcctcttcttcctcttc 1493



to top

>gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7.1, complete sequence
          Length = 110310

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 40209 tcctcttcctcttcttcctcttct 40186



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 40110 tcctcttcctcttcttcctcttct 40087



to top

>gb|AC147375.3| Mus musculus BAC clone RP24-159O13 from chromosome 12, complete
             sequence
          Length = 176510

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 30078 ctcctcttcctcttcttcctcttc 30055



to top

>ref|NM_175229.2| Mus musculus serine/arginine repetitive matrix 2 (Srrm2), mRNA
          Length = 8548

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 160  ctcctcttcctcttcttcctcttc 183
            ||||||||||||||||||||||||
Sbjct: 7644 ctcctcttcctcttcttcctcttc 7667



to top

>gb|AC147143.2| Pan troglodytes BAC clone CH251-267L18 from Y, complete sequence
          Length = 187629

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 36851 tcctcttcctcttcttcctcttct 36874



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 164   tcttcctcttcttcctcttctgct 187
             |||||||||||||| |||||||||
Sbjct: 36815 tcttcctcttcttcttcttctgct 36838



to top

>gb|AC149133.1| Pan troglodytes chromosome X clone RP43-010O16 map human ortholog p11.23
              complete sequence
          Length = 179327

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 162    cctcttcctcttcttcctcttctgctccctcc 193
              ||||||||||||||||||||||| || |||||
Sbjct: 154622 cctcttcctcttcttcctcttcttcttcctcc 154653



to top

>gb|AC132441.3| Mus musculus BAC clone RP23-239J2 from chromosome 18, complete sequence
          Length = 189507

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 14423 ctcctcttcctcttcttcctcttc 14446



to top

>gb|AC125192.3| Mus musculus BAC clone RP23-266B4 from chromosome 8, complete sequence
          Length = 199459

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 13628 ctcctcttcctcttcttcctcttc 13651



to top

>ref|XM_657374.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4862.2), mRNA
          Length = 1254

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 160  ctcctcttcctcttcttcctcttc 183
            ||||||||||||||||||||||||
Sbjct: 1119 ctcctcttcctcttcttcctcttc 1096



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||| ||||||||||||
Sbjct: 1128 ctcctcttcctcctcttcctcttct 1104



to top

>gb|AC102135.12| Mus musculus chromosome 18, clone RP23-253J5, complete sequence
          Length = 204286

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 18998 ctcctcttcctcttcttcctcttc 19021



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||| ||||||
Sbjct: 19068 tcctcttcctcttcttcttcttct 19091



to top

>gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, complete sequence
          Length = 189304

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 41933 tcctcttcctcttcttcctcttct 41910



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 41825 tcctcttcctcttcttcctcttct 41802



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 42038 tcttcctcttcttcctcttct 42018



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||| ||||||
Sbjct: 42006 ctcctcttcctcttcttcatcttct 41982



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||| ||||||
Sbjct: 41898 ctcctcttcctcttcttcatcttct 41874



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||||||||| ||||||
Sbjct: 41790 ctcctcttcctcttcttcatcttct 41766



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             |||||||||||||||| |||||||
Sbjct: 41726 tcctcttcctcttctttctcttct 41703



to top

>gb|AC132844.7| Mus musculus chromosome 17, clone RP24-481P13, complete sequence
          Length = 225183

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 145658 tcctcttcctcttcttcctcttct 145635



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 161    tcctcttcctcttcttcctcttc 183
              |||||||||||||||||||||||
Sbjct: 145673 tcctcttcctcttcttcctcttc 145651



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145793 tcttcctcttcttcctcttct 145773



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145784 tcttcctcttcttcctcttct 145764



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145775 tcttcctcttcttcctcttct 145755



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145766 tcttcctcttcttcctcttct 145746



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145757 tcttcctcttcttcctcttct 145737



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145748 tcttcctcttcttcctcttct 145728



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145739 tcttcctcttcttcctcttct 145719



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145730 tcttcctcttcttcctcttct 145710



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145721 tcttcctcttcttcctcttct 145701



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145712 tcttcctcttcttcctcttct 145692



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145646 tcttcctcttcttcctcttct 145626



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145637 tcttcctcttcttcctcttct 145617



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145628 tcttcctcttcttcctcttct 145608



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145619 tcttcctcttcttcctcttct 145599



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145610 tcttcctcttcttcctcttct 145590



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 145601 tcttcctcttcttcctcttct 145581



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 165    cttcctcttcttcctcttct 184
              ||||||||||||||||||||
Sbjct: 145801 cttcctcttcttcctcttct 145782



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 145703 tcttcctcttcttcctcttc 145684



to top

>gb|AC114539.8| Mus musculus chromosome 19, clone RP23-62I23, complete sequence
          Length = 249767

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 242247 ctcctcttcctcttcttcctcttc 242270



to top

>gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome 8, complete sequence
          Length = 236510

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 100087 ctcctcttcctcttcttcctcttc 100064



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 160    ctcctcttcctcttcttcctc 180
              |||||||||||||||||||||
Sbjct: 100111 ctcctcttcctcttcttcctc 100091



to top

>gb|AC122820.4| Mus musculus BAC clone RP23-200M5 from chromosome 6, complete sequence
          Length = 215238

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 207447 tcctcttcctcttcttcctcttct 207424



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 207412 tcctcttcctcttcttcctcttct 207389



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 207374 tcctcttcctcttcttcttcttct 207351



to top

>gb|AC117076.3| Dictyostelium discoideum chromosome 2 map 3323568-3470138 strain AX4,
              complete sequence
          Length = 146570

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 113602 tcctcttcctcttcttcctcttct 113625



to top

>gb|AC183773.2| Pan troglodytes BAC clone CH251-2N7 from chromosome 7, complete
             sequence
          Length = 168126

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 56986 ctcctcttcctcttcttcctcttc 56963



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 56964 tcctcttcctcttcttcctcttct 56941



to top

>ref|XM_992312.1| PREDICTED: Mus musculus serine/arginine repetitive matrix 2 (Srrm2),
            mRNA
          Length = 8486

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 160  ctcctcttcctcttcttcctcttc 183
            ||||||||||||||||||||||||
Sbjct: 7578 ctcctcttcctcttcttcctcttc 7601



to top

>gb|AC102257.5| Mus musculus chromosome 18, clone RP24-196N23, complete sequence
          Length = 194837

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 14952 ctcctcttcctcttcttcctcttc 14975



to top

>ref|XM_992125.1| PREDICTED: Mus musculus similar to olfactory receptor 775
           (LOC672253), mRNA
          Length = 612

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 161 tcctcttcctcttcttcctcttct 184
           ||||||||||||||||||||||||
Sbjct: 397 tcctcttcctcttcttcctcttct 374



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 164 tcttcctcttcttcctcttct 184
           |||||||||||||||||||||
Sbjct: 487 tcttcctcttcttcctcttct 467



to top

>ref|XM_001001853.1| PREDICTED: Mus musculus hypothetical protein LOC668505 (LOC668505),
           mRNA
          Length = 486

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 161 tcctcttcctcttcttcctcttct 184
           ||||||||||||||||||||||||
Sbjct: 271 tcctcttcctcttcttcctcttct 248



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 164 tcttcctcttcttcctcttct 184
           |||||||||||||||||||||
Sbjct: 361 tcttcctcttcttcctcttct 341



to top

>gb|AC118211.10| Mus musculus chromosome 8, clone RP24-223O5, complete sequence
          Length = 192713

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 40454 ctcctcttcctcttcttcctcttc 40477



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 40517 ctcctcttcctcttcttcctc 40537



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 40508 ctcctcttcctcctcttcctcttct 40532



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 40490 ctcctcttcctcttcttcctc 40510



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 40481 ctcctcttcctcctcttcctcttct 40505



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 40445 ctcctcttcctcctcttcctcttct 40469



to top

>gb|AC107663.10| Mus musculus chromosome 13, clone RP23-99G9, complete sequence
          Length = 213163

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 110692 tcctcttcctcttcttcctcttct 110715



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 161    tcctcttcctcttcttcctcttc 183
              |||||||||||||||||||||||
Sbjct: 110677 tcctcttcctcttcttcctcttc 110699



to top

>gb|AC110262.12| Mus musculus chromosome 17, clone RP23-291L10, complete sequence
          Length = 210850

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 37639 ctcctcttcctcttcttcctcttc 37662



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||| ||||||||||||||||||
Sbjct: 37679 tcctcctcctcttcttcctcttct 37702



to top

>gb|AC117690.10| Mus musculus chromosome 16, clone RP23-446I8, complete sequence
          Length = 189033

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 37555 ctcctcttcctcttcttcctcttc 37578



to top

>gb|AC133950.4| Mus musculus BAC clone RP24-243C16 from chromosome 7, complete sequence
          Length = 176244

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 129655 ctcctcttcctcttcttcctcttc 129632



to top

>gb|AC133077.4| Mus musculus BAC clone RP24-423E10 from chromosome 12, complete
             sequence
          Length = 183317

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 78700 ctcctcttcctcttcttcctcttc 78677



to top

>gb|DQ484017.1| Gymnogyps californianus clone 183G microsatellite sequence
          Length = 1142

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 160 ctcctcttcctcttcttcctcttc 183
           ||||||||||||||||||||||||
Sbjct: 995 ctcctcttcctcttcttcctcttc 972



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||| ||||||||||||
Sbjct: 1004 ctcctcttcctcctcttcctcttct 980



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 164 tcttcctcttcttcctcttc 183
           ||||||||||||||||||||
Sbjct: 883 tcttcctcttcttcctcttc 864



to top

>emb|AL773599.11| Mouse DNA sequence from clone RP23-326I8 on chromosome 4, complete
             sequence
          Length = 46151

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 37471 ctcctcttcctcttcttcctcttc 37448



to top

>ref|XM_823587.1| Trypanosoma brucei TREU927 hypothetical protein (Tb11.02.3880)
            partial mRNA
          Length = 5124

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 160  ctcctcttcctcttcttcctcttc 183
            ||||||||||||||||||||||||
Sbjct: 2058 ctcctcttcctcttcttcctcttc 2035



to top

>emb|CT009492.5| M.truncatula DNA sequence from clone MTH2-93A21 on chromosome 3,
             complete sequence
          Length = 122557

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 74306 tcctcttcctcttcttcctcttct 74283



to top

>gb|AC146243.2| Pan troglodytes BAC clone CH251-166E5 from Y, complete sequence
          Length = 161714

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 2448 tcctcttcctcttcttcctcttct 2425



to top

>gb|AC147361.1| Pan troglodytes BAC clone CH251-528H6 from Y, complete sequence
          Length = 169760

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 161590 tcctcttcctcttcttcctcttct 161613



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 164    tcttcctcttcttcctcttctgct 187
              |||||||||||||| |||||||||
Sbjct: 161554 tcttcctcttcttcttcttctgct 161577



to top

>gb|AC147114.2| Pan troglodytes BAC clone CH251-548O14 from Y, complete sequence
          Length = 229006

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 186633 tcctcttcctcttcttcctcttct 186656



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 160    ctcctcttcctcttcttcctcttctgct 187
              ||||| ||| ||||||||||||||||||
Sbjct: 186655 ctccttttcttcttcttcctcttctgct 186682



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 164    tcttcctcttcttcctcttctgct 187
              |||||||||||||| |||||||||
Sbjct: 186594 tcttcctcttcttcttcttctgct 186617



to top

>gb|AC147515.1| Pan troglodytes BAC clone CH251-558O8 from Y, complete sequence
          Length = 209207

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 167526 tcctcttcctcttcttcctcttct 167503



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 164    tcttcctcttcttcctcttctgct 187
              |||||||||||||| |||||||||
Sbjct: 167565 tcttcctcttcttcttcttctgct 167542



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 160    ctcctcttcctcttcttcctcttctgct 187
              ||||| ||| ||||||||||||||||||
Sbjct: 167504 ctccttttcttcttcttcctcttctgct 167477



to top

>ref|XM_387700.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07524.1)
           partial mRNA
          Length = 3129

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 161 tcctcttcctcttcttcctcttct 184
           ||||||||||||||||||||||||
Sbjct: 227 tcctcttcctcttcttcctcttct 204



to top

>gb|AC129200.4| Mus musculus BAC clone RP24-221J22 from chromosome 2, complete sequence
          Length = 168365

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 13702 ctcctcttcctcttcttcctcttc 13725



to top

>gb|AC134581.5| Mus musculus BAC clone RP24-90L20 from chromosome 8, complete sequence
          Length = 201483

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 33584 ctcctcttcctcttcttcctcttc 33607



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||| ||||||
Sbjct: 33612 tcctcttcctcttcttcttcttct 33635



to top

>gb|AC117239.4| Mus musculus BAC clone RP24-117K6 from chromosome 18, complete sequence
          Length = 150804

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 134424 tcctcttcctcttcttcctcttct 134447



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 161    tcctcttcctcttcttcctc 180
              ||||||||||||||||||||
Sbjct: 134448 tcctcttcctcttcttcctc 134467



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 134436 tcttcctcttcttcctcttc 134455



to top

>gb|AC132100.3| Mus musculus BAC clone RP24-294D10 from chromosome 18, complete
             sequence
          Length = 173949

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 43278 tcctcttcctcttcttcctcttct 43301



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 161   tcctcttcctcttcttcctc 180
             ||||||||||||||||||||
Sbjct: 43302 tcctcttcctcttcttcctc 43321



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 43290 tcttcctcttcttcctcttc 43309



to top

>gb|AC130543.3| Mus musculus BAC clone RP24-178J22 from chromosome 8, complete sequence
          Length = 147985

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 74571 ctcctcttcctcttcttcctcttc 74594



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 74634 ctcctcttcctcttcttcctc 74654



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 74625 ctcctcttcctcctcttcctcttct 74649



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 74607 ctcctcttcctcttcttcctc 74627



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 74598 ctcctcttcctcctcttcctcttct 74622



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 74562 ctcctcttcctcctcttcctcttct 74586



to top

>gb|AC132242.2| Mus musculus BAC clone RP24-413O2 from chromosome 18, complete sequence
          Length = 177442

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 142091 ctcctcttcctcttcttcctcttc 142114



to top

>gb|AC122821.4| Mus musculus BAC clone RP23-201I4 from chromosome 17, complete sequence
          Length = 220013

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 40982 ctcctcttcctcttcttcctcttc 40959



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 165    cttcctcttcttcctcttct 184
              ||||||||||||||||||||
Sbjct: 133303 cttcctcttcttcctcttct 133284



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||| ||||||||||||||||||
Sbjct: 40942 tcctcctcctcttcttcctcttct 40919



to top

>gb|AC110212.12| Mus musculus chromosome 19, clone RP23-183H23, complete sequence
          Length = 212687

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 63678 tcctcttcctcttcttcctcttct 63655



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 63762 tcttcctcttcttcctcttct 63742



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 63735 tcttcctcttcttcctcttct 63715



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 63726 tcttcctcttcttcctcttct 63706



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 63717 tcttcctcttcttcctcttct 63697



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 63708 tcttcctcttcttcctcttct 63688



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 63699 tcttcctcttcttcctcttct 63679



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 63666 tcttcctcttcttcctcttct 63646



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 63657 tcttcctcttcttcctcttct 63637



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 63648 tcttcctcttcttcctcttct 63628



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 63690 tcttcctcttcttcctcttc 63671



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 161   tcctcttcctcttcttcctc 180
             ||||||||||||||||||||
Sbjct: 63331 tcctcttcctcttcttcctc 63312



to top

>gb|BC060623.1| Mus musculus RIKEN cDNA E130013N09 gene, mRNA (cDNA clone
            IMAGE:6826655), partial cds
          Length = 5235

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 2380 tcctcttcctcttcttcctcttct 2403



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 2392 tcttcctcttcttcctcttct 2412



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 164  tcttcctcttcttcctcttc 183
            ||||||||||||||||||||
Sbjct: 2401 tcttcctcttcttcctcttc 2420



to top

>gb|AC125352.4| Mus musculus BAC clone RP23-451M13 from chromosome 8, complete sequence
          Length = 203416

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 75126 tcctcttcctcttcttcctcttct 75149



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 75138 tcttcctcttcttcctcttct 75158



to top

>ref|XM_814622.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053506763.30) partial mRNA
          Length = 774

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 161 tcctcttcctcttcttcctcttct 184
           ||||||||||||||||||||||||
Sbjct: 362 tcctcttcctcttcttcctcttct 339



to top

>gb|AC121889.3| Mus musculus BAC clone RP24-146D9 from chromosome 1, complete sequence
          Length = 160207

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 32724 tcctcttcctcttcttcctcttct 32747



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 161   tcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||
Sbjct: 32757 tcctcttcctcttcttcctcttc 32779



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||| ||||||||||
Sbjct: 32772 tcctcttcctctttttcctcttct 32795



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 32712 tcttcctcttcttcctcttc 32731



to top

>gb|AC131751.2| Mus musculus BAC clone RP23-19P8 from 10, complete sequence
          Length = 185680

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 94611 tcctcttcctcttcttcctcttct 94634



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 94521 tcttcctcttcttcctcttct 94541



to top

>gb|AC122864.3| Mus musculus BAC clone RP23-142M19 from 6, complete sequence
          Length = 210148

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 4332 tcctcttcctcttcttcctcttct 4309



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 4002 tcctcttcctcttcttcctcttct 3979



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 160    ctcctcttcctcttcttcctcttctgctcc 189
              |||||| |||||||||||||||||| ||||
Sbjct: 163237 ctcctcctcctcttcttcctcttcttctcc 163208



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4320 tcttcctcttcttcctcttct 4300



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4311 tcttcctcttcttcctcttct 4291



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4302 tcttcctcttcttcctcttct 4282



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4293 tcttcctcttcttcctcttct 4273



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4284 tcttcctcttcttcctcttct 4264



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4275 tcttcctcttcttcctcttct 4255



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4266 tcttcctcttcttcctcttct 4246



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4257 tcttcctcttcttcctcttct 4237



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4248 tcttcctcttcttcctcttct 4228



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4239 tcttcctcttcttcctcttct 4219



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4230 tcttcctcttcttcctcttct 4210



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4221 tcttcctcttcttcctcttct 4201



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4212 tcttcctcttcttcctcttct 4192



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 164  tcttcctcttcttcctcttct 184
            |||||||||||||||||||||
Sbjct: 4203 tcttcctcttcttcctcttct 4183



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 160  ctcctcttcctcttcttcctcttc 183
            |||||||||||| |||||||||||
Sbjct: 4099 ctcctcttcctcctcttcctcttc 4076



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 160  ctcctcttcctcttcttcctcttc 183
            ||||||||||||||| ||||||||
Sbjct: 4090 ctcctcttcctcttcctcctcttc 4067



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 164  tcttcctcttcttcctcttc 183
            ||||||||||||||||||||
Sbjct: 4014 tcttcctcttcttcctcttc 3995



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 164  tcttcctcttcttcctcttc 183
            ||||||||||||||||||||
Sbjct: 3990 tcttcctcttcttcctcttc 3971



to top

>gb|AC122268.5| Mus musculus BAC clone RP23-216B15 from 14, complete sequence
          Length = 207136

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 57133 tcctcttcctcttcttcctcttct 57110



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 57163 tcttcctcttcttcctcttct 57143



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 57154 tcttcctcttcttcctcttct 57134



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 57145 tcttcctcttcttcctcttc 57126



to top

>gb|AC110508.8| Mus musculus chromosome 3, clone RP23-382L1, complete sequence
          Length = 224790

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 150033 tcctcttcctcttcttcctcttct 150010



to top

>gb|AC114817.3| Mus musculus BAC clone RP23-28O15 from 14, complete sequence
          Length = 211624

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 151236 tcctcttcctcttcttcctcttct 151259



to top

>gb|AC117198.3| Mus musculus BAC clone RP23-127K18 from 9, complete sequence
          Length = 193044

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 133442 ctcctcttcctcttcttcctcttc 133419



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              |||||||||||| |||||||||||
Sbjct: 133466 ctcctcttcctcctcttcctcttc 133443



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||| ||||||||
Sbjct: 133457 ctcctcttcctcttcctcctcttc 133434



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||| ||||||||||||
Sbjct: 133450 tcctcttcctcctcttcctcttct 133427



to top

>gb|AC098731.3| Mus musculus BAC clone RP23-3L10 from 9, complete sequence
          Length = 220184

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 185334 ctcctcttcctcttcttcctcttc 185357



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 185299 tcttcctcttcttcctcttct 185319



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||| ||||||||||||
Sbjct: 185326 tcctcttcctcctcttcctcttct 185349



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 185308 tcttcctcttcttcctcttc 185327



to top

>gb|AC112680.12| Mus musculus chromosome 9, clone RP23-203D1, complete sequence
          Length = 226883

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 130022 ctcctcttcctcttcttcctcttc 129999



to top

>ref|XM_546592.2| PREDICTED: Canis familiaris similar to Zinc finger and BTB domain
            containing protein 4 (KAISO-like zinc finger protein 1)
            (KAISO-L1) (LOC489474), mRNA
          Length = 4845

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 160  ctcctcttcctcttcttcctcttc 183
            ||||||||||||||||||||||||
Sbjct: 2058 ctcctcttcctcttcttcctcttc 2081



to top

>ref|XM_721979.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY06422)
            partial mRNA
          Length = 7950

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 1247 tcctcttcctcttcttcctcttct 1224



to top

>ref|XM_724266.1| Plasmodium yoelii yoelii str. 17XNL casein kinase II subunit beta
           (PY01577) partial mRNA
          Length = 1059

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 161 tcctcttcctcttcttcctcttct 184
           ||||||||||||||||||||||||
Sbjct: 224 tcctcttcctcttcttcctcttct 201



to top

>gb|AC073094.11| Homo sapiens BAC clone RP11-369D24 from 7, complete sequence
          Length = 189126

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 29534 ctcctcttcctcttcttcctcttc 29511



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 29402 ctcctcttcctcttcttcctcttc 29379



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 161   tcctcttcctcttcttcctctt 182
             ||||||||||||||||||||||
Sbjct: 29467 tcctcttcctcttcttcctctt 29446



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 29498 ctcctcttcctcttcttcctc 29478



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 160   ctcctcttcctcttcttcct 179
             ||||||||||||||||||||
Sbjct: 29624 ctcctcttcctcttcttcct 29605



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||| ||||||||||||
Sbjct: 29440 tcctcttcctcctcttcctcttct 29417



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             |||||||||||||||||| |||||
Sbjct: 29432 ctcctcttcctcttcttcgtcttc 29409



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||| ||||||||||||
Sbjct: 29410 tcctcttcctcctcttcctcttct 29387



to top

>ref|XM_733967.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000739.03.0)
           partial mRNA
          Length = 750

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 161 tcctcttcctcttcttcctcttct 184
           ||||||||||||||||||||||||
Sbjct: 257 tcctcttcctcttcttcctcttct 234



to top

>ref|XM_735356.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000845.00.0)
           partial mRNA
          Length = 360

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 161 tcctcttcctcttcttcctcttct 184
           ||||||||||||||||||||||||
Sbjct: 56  tcctcttcctcttcttcctcttct 33



to top

>ref|XM_737002.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000351.03.0)
           partial mRNA
          Length = 855

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 161 tcctcttcctcttcttcctcttct 184
           ||||||||||||||||||||||||
Sbjct: 257 tcctcttcctcttcttcctcttct 234



to top

>ref|XM_669806.1| Plasmodium berghei strain ANKA Casein kinase II regulatory subunit
           (PB000663.03.0) partial mRNA
          Length = 1035

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 161 tcctcttcctcttcttcctcttct 184
           ||||||||||||||||||||||||
Sbjct: 221 tcctcttcctcttcttcctcttct 198



to top

>gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, complete sequence
          Length = 137137

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 56419 ctcctcttcctcttcttcctcttc 56396



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 161   tcctcttcctcttcttcctcttc 183
             |||||||||||||||||||||||
Sbjct: 14733 tcctcttcctcttcttcctcttc 14755



to top

>ref|XM_662725.1| Cryptosporidium hominis TU502 DNA polymerase epsilon catalytic
            subunit -related (Chro.80147) partial mRNA
          Length = 4983

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 160  ctcctcttcctcttcttcctcttc 183
            ||||||||||||||||||||||||
Sbjct: 3171 ctcctcttcctcttcttcctcttc 3148



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 161  tcctcttcctcttcttcctcttc 183
            |||||||||||||||||||||||
Sbjct: 3155 tcctcttcctcttcttcctcttc 3133



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||| ||||||||||||
Sbjct: 3180 ctcctcttcctcctcttcctcttct 3156



to top

>ref|NM_012993.1| Rattus norvegicus nardilysin, N-arginine dibasic convertase 1
           (Nrd1), mRNA
          Length = 3581

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 160 ctcctcttcctcttcttcctcttc 183
           ||||||||||||||||||||||||
Sbjct: 511 ctcctcttcctcttcttcctcttc 488



to top

>gb|AC138270.12| Mus musculus chromosome 7, clone RP23-323F17, complete sequence
          Length = 213855

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 42008 tcctcttcctcttcttcctcttct 42031



 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 161   tcctcttcctcttcttcctctt 182
             ||||||||||||||||||||||
Sbjct: 42032 tcctcttcctcttcttcctctt 42053



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 42020 tcttcctcttcttcctcttc 42039



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 41996 tcttcctcttcttcctcttc 42015



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             |||||||| |||||||||||||||
Sbjct: 41929 tcctcttcttcttcttcctcttct 41952



to top

>gb|AC123687.20| Mus musculus chromosome 5, clone RP23-314A12, complete sequence
          Length = 189230

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 37092 tcctcttcctcttcttcctcttct 37069



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||| ||||||
Sbjct: 37017 tcctcttcctcttcttcttcttct 36994



to top

>gb|AC154864.2| Mus musculus BAC clone RP23-7A5 from chromosome 12, complete sequence
          Length = 208597

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 173655 tcctcttcctcttcttcctcttct 173632



to top

>gb|AC156564.3| Mus musculus BAC clone RP24-81G20 from chromosome 8, complete sequence
          Length = 196445

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 63123 ctcctcttcctcttcttcctcttc 63146



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 63114 ctcctcttcctcctcttcctcttct 63138



to top

>ref|NM_001040149.1| Macaca mulatta proline, glutamic acid and leucine rich protein 1
            (PELP1), mRNA
          Length = 3393

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 2720 tcctcttcctcttcttcctcttct 2697



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 164  tcttcctcttcttcctcttc 183
            ||||||||||||||||||||
Sbjct: 2783 tcttcctcttcttcctcttc 2764



to top

>gb|BC094956.1| Rattus norvegicus cDNA clone IMAGE:7368168, **** WARNING: chimeric
            clone ****
          Length = 3392

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 160  ctcctcttcctcttcttcctcttc 183
            ||||||||||||||||||||||||
Sbjct: 2509 ctcctcttcctcttcttcctcttc 2532



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 160  ctcctcttcctcttcttcctcttct 184
            |||||||||||| ||||||||||||
Sbjct: 2500 ctcctcttcctcctcttcctcttct 2524



to top

>gb|AC163208.2| Mus musculus chromosome 18, clone RP24-340O19, complete sequence
          Length = 203011

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 78896 ctcctcttcctcttcttcctcttc 78873



to top

>gb|AC108554.8| Rattus norvegicus 7 BAC CH230-81L13 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 157107

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 98097 tcctcttcctcttcttcctcttct 98074



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 98085 tcttcctcttcttcctcttct 98065



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 98076 tcttcctcttcttcctcttct 98056



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||| ||||||
Sbjct: 98226 tcctcttcctcttcttcttcttct 98203



to top

>gb|AC126071.5| Rattus norvegicus 10 BAC CH230-209B21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 227741

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 37767 tcctcttcctcttcttcctcttct 37790



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 54968 ctcctcttcctcttcttcctc 54988



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 54959 ctcctcttcctcctcttcctcttct 54983



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 37755 tcttcctcttcttcctcttc 37774



to top

>emb|AL683813.10| Human DNA sequence from clone RP11-1114A5 on chromosome X Contains the 5'
              end of the ARHGEF6 gene for Rac/Cdc42 guanine nucleotide
              exchange factor (GEF) 6, a ribosomal protein L7 (RPL7)
              pseudogene, a RAN member RAS oncogene family pseudogene, a
              novel gene, the RNMX gene for RNA binding motif protein (X
              chromosome), the 5' end of a novel gene and two CpG
              islands, complete sequence
          Length = 148654

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 143525 ctcctcttcctcttcttcctcttc 143548



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 143501 ctcctcttcctcttcttcctcttc 143524



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 161    tcctcttcctcttcttcctcttc 183
              |||||||||||||||||||||||
Sbjct: 143604 tcctcttcctcttcttcctcttc 143626



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||| ||||||||||||||||
Sbjct: 143645 ctcctctacctcttcttcctcttc 143668



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||| ||||||||||||
Sbjct: 143517 tcctcttcctcctcttcctcttct 143540



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||| ||||||||||||
Sbjct: 143493 tcctcttcctcctcttcctcttct 143516



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||| ||||||||
Sbjct: 143486 ctcctcttcctcttcctcctcttc 143509



to top

>emb|AL445531.10| Human DNA sequence from clone RP11-546O6 on chromosome 9 Contains the
             3' end of the NCBP1 gene for nuclear cap binding protein
             subunit 1, 80kDa (NCBP, CBP80), the XPA gene for xeroderma
             pigmentosum, complementation group A (XP1, XPAC), a
             keratin 18 (KRT18) pseudogene and two CpG islands,
             complete sequence
          Length = 111345

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 71746 tcctcttcctcttcttcctcttct 71723



to top

>emb|AL365274.17| Human DNA sequence from clone RP11-298A17 on chromosome 9 Contains the
             DAB2IP gene for DAB2 interacting protein (AF9Q34, DIP1/2,
             KIAA1743) and four CpG islands, complete sequence
          Length = 171941

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 16346 tcctcttcctcttcttcctcttct 16323



to top

>emb|AL390835.14| Human DNA sequence from clone RP5-1119O21 on chromosome 10 Contains the
             5' end of a novel gene and a novel gene, complete sequence
          Length = 65508

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 41319 tcctcttcctcttcttcctcttct 41342



to top

>emb|AL161932.15| Human DNA sequence from clone RP11-241I20 on chromosome 10 Contains a
              ribosomal protein L34 (RPL34) pseudogene, the KIF5B gene
              for kinesin family member 5B (kinesin 1 (110-120kD)), a
              ribosomal protein S4 pseudogene, part of a novel
              pseudogene, a pseudogene similar to part of RAB18 (RAB18,
              member RAS oncogene family) and a CpG island, complete
              sequence
          Length = 143423

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 140830 ctcctcttcctcttcttcctcttc 140853



to top

>emb|AL161730.9| Human DNA sequence from clone RP11-441I5 on chromosome 9 Contains the
             DMRTA1 gene for DMRT-like family A1 (DMO) and a CpG
             island, complete sequence
          Length = 170066

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 94379 tcctcttcctcttcttcctcttct 94356



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 94409 tcttcctcttcttcctcttct 94389



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 94400 tcttcctcttcttcctcttct 94380



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 94367 tcttcctcttcttcctcttct 94347



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 94358 tcttcctcttcttcctcttct 94338



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 94349 tcttcctcttcttcctcttct 94329



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tcttcctcttcttcctcttc 183
             ||||||||||||||||||||
Sbjct: 94391 tcttcctcttcttcctcttc 94372



to top

>emb|AL139136.17| Human DNA sequence from clone RP11-53I24 on chromosome 1 Contains the
             3' end of the CRB1 gene for crumbs homolog 1 (Drosophila)
             and the 3' end of  a novel gene, complete sequence
          Length = 181596

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 72475 ctcctcttcctcttcttcctcttc 72452



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 160   ctcctcttcctcttcttcctc 180
             |||||||||||||||||||||
Sbjct: 72580 ctcctcttcctcttcttcctc 72560



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 165   cttcctcttcttcctcttct 184
             ||||||||||||||||||||
Sbjct: 72602 cttcctcttcttcctcttct 72583



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             |||||||||||||||||| |||||
Sbjct: 72562 ctcctcttcctcttcttcttcttc 72539



to top

>emb|AL139216.14| Human DNA sequence from clone RP5-1017J17 on chromosome 1p31.2-32.2
             Contains the 5' end of the gene for a novel protein
             (FLJ23129) and the 5' end of the gene for mesoderm
             induction early response 1 (MI-ER1), complete sequence
          Length = 112515

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 35375 ctcctcttcctcttcttcctcttc 35352



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 102746 tcttcctcttcttcctcttc 102727



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             |||||||||||||||||| |||||
Sbjct: 35249 ctcctcttcctcttcttcttcttc 35226



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             |||||||| |||||||||||||||
Sbjct: 35242 tcctcttcttcttcttcctcttct 35219



to top

>emb|AL139241.11| Human DNA sequence from clone RP11-34A14 on chromosome 10 Contains the 3'
              end of gene FLJ37160, the LOXL4 gene for lysyl oxidase-like
              4, a novel gene and a CpG island, complete sequence
          Length = 188192

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 108982 ctcctcttcctcttcttcctcttc 108959



to top

>emb|AL157895.8| Human DNA sequence from clone RP11-354E11 on chromosome 10 Contains the
              5' end of a novel gene and a novel gene, complete sequence
          Length = 166317

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 148397 tcctcttcctcttcttcctcttct 148374



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 161    tcctcttcctcttcttcctcttc 183
              |||||||||||||||||||||||
Sbjct: 148412 tcctcttcctcttcttcctcttc 148390



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 148361 tcctcttcctcttcttcttcttct 148338



to top

>gb|AC124658.5| Homo sapiens chromosome 11, clone RP11-655D12, complete sequence
          Length = 163126

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 70590 tcctcttcctcttcttcctcttct 70567



to top

>gb|AC124914.3| Homo sapiens chromosome 3 clone RP11-146K16, complete sequence
          Length = 187803

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 71668 tcctcttcctcttcttcctcttct 71691



to top

>gb|AC126567.8| Homo sapiens 3 BAC RP11-656G9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 150746

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 53273 ctcctcttcctcttcttcctcttc 53296



to top

>gb|AC119420.12| Mus musculus strain 129S6/SvEvTac clone rp22-121i21 map 11, complete
             sequence
          Length = 168186

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 73649 ctcctcttcctcttcttcctcttc 73626



to top

>emb|AL133380.5| Human DNA sequence from clone RP5-862P8 on chromosome 1q42.2-43
             Contains a ribosomal protein S7 (RPS7) pseudogene, pecanex
             homolog (Drosophila) (PCNX) pseudogene and the gene for
             mixed lineage kinase 4 (KIAA1804), complete sequence
          Length = 118632

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 161   tcctcttcctcttcttcctcttctgctccctc 192
             |||||||| ||||||||||||||| |||||||
Sbjct: 52300 tcctcttcttcttcttcctcttcttctccctc 52331



to top

>emb|AL031774.1|HS298J15 Human DNA sequence from clone RP1-298J15 on chromosome 6p22.3-23
             Contains the DEK gene for an oncogene (DNA binding), part
             of a novel gene and CpG islands, complete sequence
          Length = 109488

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 12984 ctcctcttcctcttcttcctcttc 12961



to top

>gb|AY152827.1| Felis catus clone BAC 186b21 major histocompatiblity complex extended
             class II region, partial sequence
          Length = 146453

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 76014 ctcctcttcctcttcttcctcttc 75991



to top

>emb|Y15943.1|DMAAR2B Didelphis marsupialis gene encoding alpha adrenergic receptor
           subtype 2B, partial
          Length = 1147

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 160 ctcctcttcctcttcttcctcttc 183
           ||||||||||||||||||||||||
Sbjct: 841 ctcctcttcctcttcttcctcttc 818



to top

>gb|DQ447200.1| Macaca mulatta modulator of nongenomic activity of estrogen receptor
            mRNA, complete cds
          Length = 3393

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 2720 tcctcttcctcttcttcctcttct 2697



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 164  tcttcctcttcttcctcttc 183
            ||||||||||||||||||||
Sbjct: 2783 tcttcctcttcttcctcttc 2764



to top

>ref|XM_781838.1| PREDICTED: Strongylocentrotus purpuratus similar to tuberous
            sclerosis 2 isoform 2 (LOC581860), mRNA
          Length = 4629

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 161  tcctcttcctcttcttcctcttct 184
            ||||||||||||||||||||||||
Sbjct: 2558 tcctcttcctcttcttcctcttct 2535



to top

>gb|AC161231.7| Mus musculus chromosome 5, clone RP24-241P24, complete sequence
          Length = 193682

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 68017 ctcctcttcctcttcttcctcttc 68040



to top

>gb|AC151985.2| Mus musculus BAC clone RP23-381C14 from chromosome 5, complete sequence
          Length = 204862

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 100824 tcctcttcctcttcttcctcttct 100801



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100950 tcttcctcttcttcctcttct 100930



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100941 tcttcctcttcttcctcttct 100921



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100932 tcttcctcttcttcctcttct 100912



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100923 tcttcctcttcttcctcttct 100903



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100914 tcttcctcttcttcctcttct 100894



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100905 tcttcctcttcttcctcttct 100885



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100896 tcttcctcttcttcctcttct 100876



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100887 tcttcctcttcttcctcttct 100867



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100812 tcttcctcttcttcctcttct 100792



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100803 tcttcctcttcttcctcttct 100783



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100794 tcttcctcttcttcctcttct 100774



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100785 tcttcctcttcttcctcttct 100765



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100776 tcttcctcttcttcctcttct 100756



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100767 tcttcctcttcttcctcttct 100747



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 160    ctcctcttcctcttcttcctcttct 184
              |||||||||||||||||| ||||||
Sbjct: 100702 ctcctcttcctcttcttcttcttct 100678



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100635 tcttcctcttcttcctcttct 100615



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100626 tcttcctcttcttcctcttct 100606



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100617 tcttcctcttcttcctcttct 100597



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100608 tcttcctcttcttcctcttct 100588



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100599 tcttcctcttcttcctcttct 100579



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100590 tcttcctcttcttcctcttct 100570



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100581 tcttcctcttcttcctcttct 100561



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100467 tcttcctcttcttcctcttct 100447



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100458 tcttcctcttcttcctcttct 100438



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100449 tcttcctcttcttcctcttct 100429



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100440 tcttcctcttcttcctcttct 100420



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 100431 tcttcctcttcttcctcttct 100411



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 100878 tcttcctcttcttcctcttc 100859



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 100758 tcttcctcttcttcctcttc 100739



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||| ||||||||||||
Sbjct: 100710 tcctcttcctcctcttcctcttct 100687



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 100572 tcttcctcttcttcctcttc 100553



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 100518 tcctcttcctcttcttcttcttct 100495



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 100422 tcttcctcttcttcctcttc 100403



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 100350 tcctcttcctcttcttcttcttct 100327



to top

>emb|AL645527.20| Mouse DNA sequence from clone RP23-26L6 on chromosome 11 Contains the
             Vamp2 gene for vesicle-associated membrane 2, the Per1
             gene for period homolog 1 (Drosophila), the Hes7 gene for
             hairy and enhancer of split 7 (Drosophila), the Aloxe3
             gene for arachidonate lipoxygenase 3, the Alox12b gene for
             arachidonate 12-lipoxygenase 12R type, the Alox15b gene
             for arachidonate 15-lipoxygenase second type, the Gucy2e
             gene for guanylate cyclase 2e, a novel gene, the gene for
             LYST-interacting protein LIP8 (Lip8-pending), the gene for
             the likely ortholog of H. sapiens trafficking protein
             particle complex 1 (TRAPPC1)), the Kcnab3 gene for
             potassium voltage-gated channel shaker-related subfamily
             beta member 3, a novel gene, the 3' end of the Chd3 gene
             for chromodomain helicase DNA binding protein 3 and six
             CpG islands, complete sequence
          Length = 261224

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 92706 ctcctcttcctcttcttcctcttc 92729



to top

>gb|AC153523.7| Mus musculus 10 BAC RP23-463C2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 200141

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 164940 ctcctcttcctcttcttcctcttc 164917



to top

>gb|AC164614.3| Mus musculus BAC clone RP23-337L12 from chromosome 9, complete sequence
          Length = 215002

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 176048 tcctcttcctcttcttcctcttct 176025



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 176006 tcctcttcctcttcttcctcttct 175983



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 175982 tcctcttcctcttcttcctcttct 175959



 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 175958 tcctcttcctcttcttcctcttct 175935



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 176036 tcttcctcttcttcctcttct 176016



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 164    tcttcctcttcttcctcttct 184
              |||||||||||||||||||||
Sbjct: 175946 tcttcctcttcttcctcttct 175926



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 175994 tcttcctcttcttcctcttc 175975



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 175970 tcttcctcttcttcctcttc 175951



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 161    tcctcttcctcttcttcctc 180
              ||||||||||||||||||||
Sbjct: 175877 tcctcttcctcttcttcctc 175858



to top

>emb|AL929272.10| Mouse DNA sequence from clone RP23-69H10 on chromosome 11 Contains the
             5' end of the Vrk2 gene for vaccinia related kinase 2 and
             a CpG island, complete sequence
          Length = 196753

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 67059 ctcctcttcctcttcttcctcttc 67036



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 160   ctcctcttcctcttcttcctcttct 184
             |||||||||||| ||||||||||||
Sbjct: 67014 ctcctcttcctcctcttcctcttct 66990



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 160   ctcctcttcctcttcttcct 179
             ||||||||||||||||||||
Sbjct: 67005 ctcctcttcctcttcttcct 66986



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||| ||||||
Sbjct: 44346 tcctcttcctcttcttcttcttct 44323



to top

>emb|AL645904.13| Mouse DNA sequence from clone RP23-121P11 on chromosome 11 Contains the
              gene for a novel protein (1700121K02Rik), the Hnrph1 gene
              for heterogeneous nuclear ribonucleoprotein H1, the Rufy1
              gene for RUN and FYVE domain containing 1, a novel
              pseudogene and three CpG islands, complete sequence
          Length = 193696

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 160    ctcctcttcctcttcttcctcttc 183
              ||||||||||||||||||||||||
Sbjct: 154113 ctcctcttcctcttcttcctcttc 154136



to top

>emb|AL603842.9| Mouse DNA sequence from clone RP23-100P23 on chromosome 11 Contains the
              5' end of a novel gene, three novel genes, the Slc6a4 gene
              for solute carrier family 6 (neurotransmitter transporter,
              serotonin) member 4, the Blmh gene for bleomycin hydrolase
              and three CpG islands, complete sequence
          Length = 229289

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 107065 tcctcttcctcttcttcctcttct 107088



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 161    tcctcttcctcttcttcctcttc 183
              |||||||||||||||||||||||
Sbjct: 107008 tcctcttcctcttcttcctcttc 107030



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tcttcctcttcttcctcttc 183
              ||||||||||||||||||||
Sbjct: 107053 tcttcctcttcttcctcttc 107072



 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||| ||||||
Sbjct: 107023 tcctcttcctcttcttcttcttct 107046



to top

>emb|AL611937.6| Mouse DNA sequence from clone RP23-221M24 on chromosome 11 Contains the
             genes for olfactory receptors MOR255-2, -1 and -6, a novel
             KRAB box containing protein, a high mobility group box 1
             (Hmgb1) pseudogene and a olfactory receptor MOR255
             pseudogene, complete sequence
          Length = 109397

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 160   ctcctcttcctcttcttcctcttc 183
             ||||||||||||||||||||||||
Sbjct: 32213 ctcctcttcctcttcttcctcttc 32236



to top

>emb|AL162873.1|ATF8F6 Arabidopsis thaliana DNA chromosome 5, BAC clone F8F6 (ESSA project)
          Length = 96936

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 161   tcctcttcctcttcttcctcttct 184
             ||||||||||||||||||||||||
Sbjct: 36074 tcctcttcctcttcttcctcttct 36051



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 36062 tcttcctcttcttcctcttct 36042



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 164   tcttcctcttcttcctcttct 184
             |||||||||||||||||||||
Sbjct: 36053 tcttcctcttcttcctcttct 36033



to top

>emb|AJ400877.1|HSA400877 Homo sapiens ASCL3 gene, CEGP1 gene, C11orf14 gene, C11orf15 gene,
              C11orf16 gene and C11orf17 gene
          Length = 256164

 Score = 48.1 bits (24), Expect = 0.027
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 161    tcctcttcctcttcttcctcttct 184
              ||||||||||||||||||||||||
Sbjct: 200468 tcctcttcctcttcttcctcttct 200491


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,740,837
Number of Sequences: 3902068
Number of extensions: 4740837
Number of successful extensions: 247677
Number of sequences better than 10.0: 5660
Number of HSP's better than 10.0 without gapping: 5680
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 196105
Number of HSP's gapped (non-prelim): 50791
length of query: 481
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 459
effective length of database: 17,147,199,772
effective search space: 7870564695348
effective search space used: 7870564695348
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top