ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart09b08 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_470185.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 870 Score = 165 bits (83), Expect = 2e-37 Identities = 216/260 (83%), Gaps = 3/260 (1%) Strand = Plus / Plus Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257 |||||| |||| |||||||||||||| |||| |||| || || | |||||||||||| Sbjct: 93 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 152 Query: 258 gctcaccctcgccgccggctcctgcgggtatggcacggcggccgcctccttcaacggcgg 317 |||||| || | ||||| || ||||||||||||||||||||||| ||||||||||||| Sbjct: 153 gctcacgctgactgccggttcttgcgggtatggcacggcggccgcgaccttcaacggcgg 212 Query: 318 cc---tgctcgccgccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtg 374 | | ||||||||||| ||| | | |||||||| ||||||||| ||||||||||||| Sbjct: 213 cggattcctcgccgccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtg 272 Query: 375 cttctcggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgt 434 || | |||||| ||||||||||||||||| |||||| || |||||||| || ||||| Sbjct: 273 ctaccaggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgt 332 Query: 435 gacggaccgcgcgaggacga 454 ||||||||||| ||||||| Sbjct: 333 cacggaccgcgccaggacga 352
>dbj|AK099870.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013111F04, full insert sequence Length = 1123 Score = 165 bits (83), Expect = 2e-37 Identities = 216/260 (83%), Gaps = 3/260 (1%) Strand = Plus / Plus Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257 |||||| |||| |||||||||||||| |||| |||| || || | |||||||||||| Sbjct: 147 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 206 Query: 258 gctcaccctcgccgccggctcctgcgggtatggcacggcggccgcctccttcaacggcgg 317 |||||| || | ||||| || ||||||||||||||||||||||| ||||||||||||| Sbjct: 207 gctcacgctgactgccggttcttgcgggtatggcacggcggccgcgaccttcaacggcgg 266 Query: 318 cc---tgctcgccgccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtg 374 | | ||||||||||| ||| | | |||||||| ||||||||| ||||||||||||| Sbjct: 267 cggattcctcgccgccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtg 326 Query: 375 cttctcggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgt 434 || | |||||| ||||||||||||||||| |||||| || |||||||| || ||||| Sbjct: 327 ctaccaggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgt 386 Query: 435 gacggaccgcgcgaggacga 454 ||||||||||| ||||||| Sbjct: 387 cacggaccgcgccaggacga 406
>dbj|AK067081.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013094I23, full insert sequence Length = 1121 Score = 165 bits (83), Expect = 2e-37 Identities = 216/260 (83%), Gaps = 3/260 (1%) Strand = Plus / Plus Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257 |||||| |||| |||||||||||||| |||| |||| || || | |||||||||||| Sbjct: 147 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 206 Query: 258 gctcaccctcgccgccggctcctgcgggtatggcacggcggccgcctccttcaacggcgg 317 |||||| || | ||||| || ||||||||||||||||||||||| ||||||||||||| Sbjct: 207 gctcacgctgactgccggttcttgcgggtatggcacggcggccgcgaccttcaacggcgg 266 Query: 318 cc---tgctcgccgccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtg 374 | | ||||||||||| ||| | | |||||||| ||||||||| ||||||||||||| Sbjct: 267 cggattcctcgccgccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtg 326 Query: 375 cttctcggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgt 434 || | |||||| ||||||||||||||||| |||||| || |||||||| || ||||| Sbjct: 327 ctaccaggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgt 386 Query: 435 gacggaccgcgcgaggacga 454 ||||||||||| ||||||| Sbjct: 387 cacggaccgcgccaggacga 406
>dbj|AK061453.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-G06, full insert sequence Length = 1120 Score = 165 bits (83), Expect = 2e-37 Identities = 216/260 (83%), Gaps = 3/260 (1%) Strand = Plus / Plus Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257 |||||| |||| |||||||||||||| |||| |||| || || | |||||||||||| Sbjct: 151 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 210 Query: 258 gctcaccctcgccgccggctcctgcgggtatggcacggcggccgcctccttcaacggcgg 317 |||||| || | ||||| || ||||||||||||||||||||||| ||||||||||||| Sbjct: 211 gctcacgctgactgccggttcttgcgggtatggcacggcggccgcgaccttcaacggcgg 270 Query: 318 cc---tgctcgccgccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtg 374 | | ||||||||||| ||| | | |||||||| ||||||||| ||||||||||||| Sbjct: 271 cggattcctcgccgccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtg 330 Query: 375 cttctcggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgt 434 || | |||||| ||||||||||||||||| |||||| || |||||||| || ||||| Sbjct: 331 ctaccaggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgt 390 Query: 435 gacggaccgcgcgaggacga 454 ||||||||||| ||||||| Sbjct: 391 cacggaccgcgccaggacga 410
>gb|AY100693.1| Oryza sativa (japonica cultivar-group) expansin-like protein A mRNA, partial cds Length = 899 Score = 105 bits (53), Expect = 1e-19 Identities = 113/133 (84%) Strand = Plus / Plus Query: 322 ctcgccgccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgcttctcg 381 ||||||||||| ||| | | |||||||| ||||||||| ||||||||||||||| | | Sbjct: 22 ctcgccgccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgctaccag 81 Query: 382 gtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacggac 441 ||||| ||||||||||||||||| |||||| || |||||||| || ||||| |||||| Sbjct: 82 gtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacggac 141 Query: 442 cgcgcgaggacga 454 ||||| ||||||| Sbjct: 142 cgcgccaggacga 154
>gb|AC140005.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJA1004C08, complete sequence Length = 138054 Score = 85.7 bits (43), Expect = 1e-13 Identities = 93/109 (85%), Gaps = 3/109 (2%) Strand = Plus / Plus Query: 271 gccggctcctgcgggtatggcacggcggccgcctccttcaacggcggcc---tgctcgcc 327 ||||| || ||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 36986 gccggttcttgcgggtatggcacggcggccgcgaccttcaacggcggcggattcctcgcc 37045 Query: 328 gccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgct 376 ||||| ||| | | |||||||| ||||||||| ||||||||||||||| Sbjct: 37046 gccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgct 37094 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Plus Query: 381 ggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacgga 440 |||||| ||||||||||||||||| |||||| || |||||||| || ||||| ||||| Sbjct: 37206 ggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacgga 37265 Query: 441 ccgcgcgaggacga 454 |||||| ||||||| Sbjct: 37266 ccgcgccaggacga 37279 Score = 46.1 bits (23), Expect = 0.11 Identities = 55/66 (83%) Strand = Plus / Plus Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257 |||||| |||| |||||||||||||| |||| |||| || || | |||||||||||| Sbjct: 36804 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 36863 Query: 258 gctcac 263 |||||| Sbjct: 36864 gctcac 36869
>gb|AY039022.1| Oryza sativa expansin-like protein A (EXLA1) gene, complete cds Length = 3998 Score = 85.7 bits (43), Expect = 1e-13 Identities = 93/109 (85%), Gaps = 3/109 (2%) Strand = Plus / Plus Query: 271 gccggctcctgcgggtatggcacggcggccgcctccttcaacggcggcc---tgctcgcc 327 ||||| || ||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 1495 gccggttcttgcgggtatggcacggcggccgcgaccttcaacggcggcggattcctcgcc 1554 Query: 328 gccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgct 376 ||||| ||| | | |||||||| ||||||||| ||||||||||||||| Sbjct: 1555 gccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgct 1603 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Plus Query: 381 ggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacgga 440 |||||| ||||||||||||||||| |||||| || |||||||| || ||||| ||||| Sbjct: 1715 ggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacgga 1774 Query: 441 ccgcgcgaggacga 454 |||||| ||||||| Sbjct: 1775 ccgcgccaggacga 1788 Score = 46.1 bits (23), Expect = 0.11 Identities = 55/66 (83%) Strand = Plus / Plus Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257 |||||| |||| |||||||||||||| |||| |||| || || | |||||||||||| Sbjct: 1313 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 1372 Query: 258 gctcac 263 |||||| Sbjct: 1373 gctcac 1378
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 85.7 bits (43), Expect = 1e-13 Identities = 93/109 (85%), Gaps = 3/109 (2%) Strand = Plus / Plus Query: 271 gccggctcctgcgggtatggcacggcggccgcctccttcaacggcggcc---tgctcgcc 327 ||||| || ||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 1811347 gccggttcttgcgggtatggcacggcggccgcgaccttcaacggcggcggattcctcgcc 1811406 Query: 328 gccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgct 376 ||||| ||| | | |||||||| ||||||||| ||||||||||||||| Sbjct: 1811407 gccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgct 1811455 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Plus Query: 381 ggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacgga 440 |||||| ||||||||||||||||| |||||| || |||||||| || ||||| ||||| Sbjct: 1811567 ggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacgga 1811626 Query: 441 ccgcgcgaggacga 454 |||||| ||||||| Sbjct: 1811627 ccgcgccaggacga 1811640 Score = 46.1 bits (23), Expect = 0.11 Identities = 55/66 (83%) Strand = Plus / Plus Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257 |||||| |||| |||||||||||||| |||| |||| || || | |||||||||||| Sbjct: 1811165 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 1811224 Query: 258 gctcac 263 |||||| Sbjct: 1811225 gctcac 1811230
>gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1004C08, complete sequence Length = 133090 Score = 85.7 bits (43), Expect = 1e-13 Identities = 93/109 (85%), Gaps = 3/109 (2%) Strand = Plus / Minus Query: 271 gccggctcctgcgggtatggcacggcggccgcctccttcaacggcggcc---tgctcgcc 327 ||||| || ||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 23015 gccggttcttgcgggtatggcacggcggccgcgaccttcaacggcggcggattcctcgcc 22956 Query: 328 gccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgct 376 ||||| ||| | | |||||||| ||||||||| ||||||||||||||| Sbjct: 22955 gccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgct 22907 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 381 ggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacgga 440 |||||| ||||||||||||||||| |||||| || |||||||| || ||||| ||||| Sbjct: 22795 ggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacgga 22736 Query: 441 ccgcgcgaggacga 454 |||||| ||||||| Sbjct: 22735 ccgcgccaggacga 22722 Score = 46.1 bits (23), Expect = 0.11 Identities = 55/66 (83%) Strand = Plus / Minus Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257 |||||| |||| |||||||||||||| |||| |||| || || | |||||||||||| Sbjct: 23197 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 23138 Query: 258 gctcac 263 |||||| Sbjct: 23137 gctcac 23132
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 85.7 bits (43), Expect = 1e-13 Identities = 93/109 (85%), Gaps = 3/109 (2%) Strand = Plus / Plus Query: 271 gccggctcctgcgggtatggcacggcggccgcctccttcaacggcggcc---tgctcgcc 327 ||||| || ||||||||||||||||||||||| |||||||||||||| | |||||| Sbjct: 1811345 gccggttcttgcgggtatggcacggcggccgcgaccttcaacggcggcggattcctcgcc 1811404 Query: 328 gccgccggcacggtcctgtaccgcggcggcgtccgctgcggcgcgtgct 376 ||||| ||| | | |||||||| ||||||||| ||||||||||||||| Sbjct: 1811405 gccgcgggccccgcgctgtaccggggcggcgtcggctgcggcgcgtgct 1811453 Score = 67.9 bits (34), Expect = 3e-08 Identities = 64/74 (86%) Strand = Plus / Plus Query: 381 ggtgaggtgcaaggacaagaagctctgcagcggtgccggcgcccgggtggtcgtgacgga 440 |||||| ||||||||||||||||| |||||| || |||||||| || ||||| ||||| Sbjct: 1811565 ggtgagatgcaaggacaagaagctgtgcagcaacgcgggcgcccgtgtcgtcgtcacgga 1811624 Query: 441 ccgcgcgaggacga 454 |||||| ||||||| Sbjct: 1811625 ccgcgccaggacga 1811638 Score = 46.1 bits (23), Expect = 0.11 Identities = 55/66 (83%) Strand = Plus / Plus Query: 198 gctcgcctccgcctgcgaccgctgcgcccgccactccnaggccgccttctacacctcctc 257 |||||| |||| |||||||||||||| |||| |||| || || | |||||||||||| Sbjct: 1811163 gctcgcttccggctgcgaccgctgcgtgcgccgctccagagcggcttactacacctcctc 1811222 Query: 258 gctcac 263 |||||| Sbjct: 1811223 gctcac 1811228
>ref|NM_197592.1| Oryza sativa (japonica cultivar-group) putative pollen allergen (OSJNBb0015I11.10), mRNA Length = 898 Score = 71.9 bits (36), Expect = 2e-09 Identities = 117/144 (81%) Strand = Plus / Plus Query: 298 gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357 ||||| |||||||||||||||| ||||||||||| || ||| |||| | | ||||| Sbjct: 248 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 307 Query: 358 gtccgctgcggcgcgtgcttctcggtgaggtgcaaggacaagaagctctgcagcggtgcc 417 ||| |||||||||| |||||| |||| ||||||||||| ||||| |||||| || Sbjct: 308 gtcggctgcggcgcctgcttccaggtgcggtgcaaggacggcaagctgtgcagcacggcg 367 Query: 418 ggcgcccgggtggtcgtgacggac 441 |||||| |||||||||||||||| Sbjct: 368 ggcgccaaggtggtcgtgacggac 391
>dbj|AK068088.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013131C11, full insert sequence Length = 1196 Score = 71.9 bits (36), Expect = 2e-09 Identities = 117/144 (81%) Strand = Plus / Plus Query: 298 gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357 ||||| |||||||||||||||| ||||||||||| || ||| |||| | | ||||| Sbjct: 432 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 491 Query: 358 gtccgctgcggcgcgtgcttctcggtgaggtgcaaggacaagaagctctgcagcggtgcc 417 ||| |||||||||| |||||| |||| ||||||||||| ||||| |||||| || Sbjct: 492 gtcggctgcggcgcctgcttccaggtgcggtgcaaggacggcaagctgtgcagcacggcg 551 Query: 418 ggcgcccgggtggtcgtgacggac 441 |||||| |||||||||||||||| Sbjct: 552 ggcgccaaggtggtcgtgacggac 575
>dbj|AK066611.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013071J19, full insert sequence Length = 1023 Score = 71.9 bits (36), Expect = 2e-09 Identities = 117/144 (81%) Strand = Plus / Plus Query: 298 gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357 ||||| |||||||||||||||| ||||||||||| || ||| |||| | | ||||| Sbjct: 264 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 323 Query: 358 gtccgctgcggcgcgtgcttctcggtgaggtgcaaggacaagaagctctgcagcggtgcc 417 ||| |||||||||| |||||| |||| ||||||||||| ||||| |||||| || Sbjct: 324 gtcggctgcggcgcctgcttccaggtgcggtgcaaggacggcaagctgtgcagcacggcg 383 Query: 418 ggcgcccgggtggtcgtgacggac 441 |||||| |||||||||||||||| Sbjct: 384 ggcgccaaggtggtcgtgacggac 407
>gb|AC101757.12| Mus musculus chromosome 8, clone RP24-545I11, complete sequence Length = 148875 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttctgc 186 |||||||||||||||||||||||||| Sbjct: 69374 tcctcttcctcttcttcctcttctgc 69349 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 163 ctcttcctcttcttcctcttct 184 |||||||||||||||||||||| Sbjct: 146668 ctcttcctcttcttcctcttct 146689 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 146690 tcttcctcttcttcctcttc 146709 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 29764 ctcctcttcctcttcctcctcttc 29787
>gb|CP000077.1| Sulfolobus acidocaldarius DSM 639, complete genome Length = 2225959 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttctg 185 |||||||||||||||||||||||||| Sbjct: 596785 ctcctcttcctcttcttcctcttctg 596810
>ref|XM_634939.1| Dictyostelium discoideum hypothetical protein (DDB0220697), partial mRNA Length = 3627 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttctg 185 ||||||||||||||||||||||||| Sbjct: 1376 tcctcttcctcttcttcctcttctg 1352
>gb|AC167021.3| Mus musculus BAC clone RP23-152D8 from chromosome 6, complete sequence Length = 222021 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 114621 ctcctcttcctcttcttcctcttct 114597 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 114630 ctcctcttcctcctcttcctcttct 114606
>gb|AC113005.10| Mus musculus chromosome 3, clone RP23-299B23, complete sequence Length = 218917 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 112892 ctcctcttcctcttcttcctcttct 112868 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||| ||||||||||||||| Sbjct: 112934 ctcctcttcttcttcttcctcttct 112910 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 112900 tcctcttcctcctcttcctcttct 112877 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 112879 tcttcctcttcttcctcttc 112860
>gb|AC119820.20| Mus musculus chromosome 1, clone RP23-148M18, complete sequence Length = 183287 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 116188 ctcctcttcctcttcttcctcttct 116212 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 116179 ctcctcttcctcctcttcctcttct 116203
>gb|AC161496.6| Mus musculus chromosome 3, clone RP23-119A9, complete sequence Length = 203655 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 609 ctcctcttcctcttcttcctcttct 633 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||| ||||||||||||||| Sbjct: 567 ctcctcttcttcttcttcctcttct 591 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 622 tcttcctcttcttcctcttc 641 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 601 tcctcttcctcctcttcctcttct 624
>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete sequence Length = 2300533 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 439904 ctcctcttcctcttcttcctcttct 439880
>gb|AC118592.7| Mus musculus chromosome 7, clone RP24-463B5, complete sequence Length = 134114 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 50840 ctcctcttcctcttcttcctcttct 50816 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 50849 ctcctcttcctcctcttcctcttct 50825 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 50815 tcttcctcttcttcctcttct 50795
>gb|AC100726.7| Mus musculus chromosome 19, clone RP24-245B11, complete sequence Length = 176074 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 72347 ctcctcttcctcttcttcctcttct 72323 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 72334 tcttcctcttcttcctcttc 72315
>gb|AC139578.4| Mus musculus BAC clone RP23-188P12 from chromosome 18, complete sequence Length = 179415 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 173214 ctcctcttcctcttcttcctcttct 173190
>gb|AF030001.1|MMMHC29N7 Mus musculus major histocompatibility locus class III region:butyrophilin-like protein gene, partial cds; Notch4, PBX2, RAGE, lysophatidic acid acyl transferase-alpha, palmitoyl-protein thioesterase 2 (PPT2), CREB-RP, and tenascin X (TNX) genes, complete cds; and CYP21OHB pseudogene, complete sequence Length = 201964 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 148 ctgctgccgccgctcctcttcctcttcttcctc 180 ||||||| || |||||||||||||||||||||| Sbjct: 154269 ctgctgctgctgctcctcttcctcttcttcctc 154301
>gb|AC096338.17| Rattus norvegicus X BAC CH230-95I19 (Children's Hospital Oakland Research Institute) complete sequence Length = 236662 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 47059 ctcctcttcctcttcttcctcttct 47035 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 47046 tcttcctcttcttcctcttc 47027
>gb|AC139211.13| Mus musculus chromosome 6, clone RP23-302O24, complete sequence Length = 154129 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 65170 ctcctcttcctcttcttcctcttct 65146 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 65157 tcttcctcttcttcctcttct 65137 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 65148 tcttcctcttcttcctcttct 65128 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 65190 tcttcctcttcttcctcttc 65171 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 65178 tcctcttcctcctcttcctcttct 65155 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||| |||||||||||||| Sbjct: 65033 ctcctcttcttcttcttcctcttc 65010
>gb|AC102445.11| Mus musculus chromosome 14, clone RP24-196M4, complete sequence Length = 157416 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 119436 ctcctcttcctcttcttcctcttct 119412
>gb|AC164402.3| Mus musculus chromosome 15, clone RP23-463G20, complete sequence Length = 196916 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 19017 ctcctcttcctcttcttcctcttct 19041
>gb|AC113495.15| Mus musculus chromosome 9, clone RP23-361O11, complete sequence Length = 195356 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 96784 ctcctcttcctcttcttcctcttct 96760
>gb|AC163636.5| Mus musculus BAC clone RP24-499E13 from chromosome 1, complete sequence Length = 173781 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 115877 ctcctcttcctcttcttcctcttct 115901 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||||||| |||| Sbjct: 115907 ctcctcttcctcttcttccccttc 115930
>gb|AC096226.12| Rattus norvegicus 18 BAC CH230-26M18 (Children's Hospital Oakland Research Institute) complete sequence Length = 232962 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttctgctcc 189 |||||||||||||||||||||||| |||| Sbjct: 174735 tcctcttcctcttcttcctcttctcctcc 174707 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctct 181 ||||||||||||||||||||| Sbjct: 174798 tcctcttcctcttcttcctct 174778 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctct 181 ||||||||||||||||||||| Sbjct: 174687 tcctcttcctcttcttcctct 174667
>ref|XM_543410.2| PREDICTED: Canis familiaris similar to Probable RNA-binding protein 19 (RNA binding motif protein 19) (LOC486284), mRNA Length = 3643 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 2281 ctcctcttcctcttcttcctcttct 2257
>ref|XM_566508.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNA01630) partial mRNA Length = 1523 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 1446 ctcctcttcctcttcttcctcttct 1422
>gb|AC124458.5| Mus musculus BAC clone RP24-136E11 from chromosome 12, complete sequence Length = 168181 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 14424 ctcctcttcctcttcttcctcttct 14448 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14536 tcttcctcttcttcctcttct 14556 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14527 tcttcctcttcttcctcttct 14547 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14518 tcttcctcttcttcctcttct 14538 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14509 tcttcctcttcttcctcttct 14529 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14500 tcttcctcttcttcctcttct 14520 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14491 tcttcctcttcttcctcttct 14511 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14482 tcttcctcttcttcctcttct 14502 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14473 tcttcctcttcttcctcttct 14493 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14464 tcttcctcttcttcctcttct 14484 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14455 tcttcctcttcttcctcttct 14475 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14446 tcttcctcttcttcctcttct 14466 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 14437 tcttcctcttcttcctcttct 14457
>gb|AC127553.3| Mus musculus BAC clone RP24-553F11 from chromosome 5, complete sequence Length = 159693 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttctgctcc 189 |||||||||||||||||||||||| |||| Sbjct: 129315 tcctcttcctcttcttcctcttctcctcc 129287 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 129347 tcctcttcctcttcttcctcttct 129324
>gb|AC104396.7| Mus musculus BAC clone RP23-413J8 from chromosome 3, complete sequence Length = 195860 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttctgctcc 189 |||||||||||||||||||||||| |||| Sbjct: 47863 tcctcttcctcttcttcctcttctcctcc 47835
>ref|XM_811341.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053507049.179) partial mRNA Length = 3402 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 681 ctcctcttcctcttcttcctcttct 657
>gb|AC122467.3| Mus musculus BAC clone RP24-311K2 from chromosome 6, complete sequence Length = 110480 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 12797 ctcctcttcctcttcttcctcttct 12773 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 12806 ctcctcttcctcctcttcctcttct 12782
>gb|AC098723.3| Mus musculus BAC clone RP23-3D10 from 7, complete sequence Length = 227968 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 42219 ctcctcttcctcttcttcctcttct 42243 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 42244 tcttcctcttcttcctcttct 42264 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 42210 ctcctcttcctcctcttcctcttct 42234
>gb|AC004015.1| Homo sapiens BAC clone CTA-333F24 from 7, complete sequence Length = 144239 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 113195 ctcctcttcctcttcttcctcttct 113219 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 113217 tcttcctcttcttcctcttct 113237 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 113208 tcttcctcttcttcctcttct 113228
>gb|AC101527.12| Mus musculus chromosome 15, clone RP23-191D20, complete sequence Length = 193390 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 100449 ctcctcttcctcttcttcctcttct 100473 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100480 tcttcctcttcttcctcttct 100500 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100471 tcttcctcttcttcctcttct 100491 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100462 tcttcctcttcttcctcttct 100482 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 100440 ctcctcttcctcctcttcctcttct 100464 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100408 tcttcctcttcttcctcttct 100428 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100399 tcttcctcttcttcctcttct 100419 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100390 tcttcctcttcttcctcttct 100410 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100381 tcttcctcttcttcctcttct 100401 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100372 tcttcctcttcttcctcttct 100392 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100363 tcttcctcttcttcctcttct 100383 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100354 tcttcctcttcttcctcttct 100374 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 100519 tcctcttcctcttcttcttcttct 100542 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 100489 tcttcctcttcttcctcttc 100508 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 cttcctcttcttcctcttct 184 |||||||||||||||||||| Sbjct: 69490 cttcctcttcttcctcttct 69509
>emb|AL357143.13| Human DNA sequence from clone RP11-71G12 on chromosome 1 Contains a novel gene and a CPG island, complete sequence Length = 46936 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 159 gctcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||||| Sbjct: 19351 gctcctcttcctcttcttcctcttc 19327
>emb|AL162377.10| Human DNA sequence from clone RP11-327P2 on chromosome 13 Contains 3 novel genes, a meningioma-expressed antigen 6/11 (MEA6) (MEA11) pseudogene and the 3' end of the ATP7B gene for ATPase, Cu++ transporting, beta polypeptide (Wilson disease), complete sequence Length = 169104 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 80421 ctcctcttcctcttcttcctcttct 80397 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 80408 tcttcctcttcttcctcttct 80388
>gb|AC091153.10| Homo sapiens chromosome 17, clone RP11-314A20, complete sequence Length = 195494 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 109764 ctcctcttcctcttcttcctcttct 109740 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 109748 tcctcttcttcttcttcctcttct 109725 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 109736 tcttcctcttcttcctcttc 109717
>emb|AL020995.14|HS117O3 Human DNA sequence from clone RP1-117O3 on chromosome 1p33-34.3 Contains the 3' end of a novel gene, the AK2 gene for adenylate kinase 2, the gene for ornithine decarboxylase-like (ODC-p) and a CpG island, complete sequence Length = 150997 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 80283 ctcctcttcctcttcttcctcttct 80259 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 80444 tcttcctcttcttcctcttc 80425
>gb|AC027820.12| Homo sapiens chromosome 17, clone RP11-198F11, complete sequence Length = 154353 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 149356 ctcctcttcctcttcttcctcttct 149332 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 149340 tcctcttcttcttcttcctcttct 149317 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 149328 tcttcctcttcttcctcttc 149309
>ref|NM_014389.1| Homo sapiens proline, glutamic acid and leucine rich protein 1 (PELP1), mRNA Length = 3393 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 2721 ctcctcttcctcttcttcctcttct 2697
>emb|AL627215.12| Mouse DNA sequence from clone RP23-292E3 on chromosome 11, complete sequence Length = 216106 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 75969 ctcctcttcctcttcttcctcttct 75945 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 157306 tcctcttcctcttcttcctcttct 157329 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||| |||||||||||||||||| Sbjct: 76214 ctcctcctcctcttcttcctcttct 76190 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 157318 tcttcctcttcttcctcttc 157337 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||| ||||||||||||||||| Sbjct: 157272 ctcctcctcctcttcttcctcttc 157295 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 76142 ctcctcttcctcttcctcctcttc 76119 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 76047 ctcctcttcctcttcctcctcttc 76024 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 76017 ctcctcttcctcttcctcctcttc 75994 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 75984 ctcctcttcctcttcctcctcttc 75961 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 75977 tcctcttcctcctcttcctcttct 75954
>emb|AL603708.13| Mouse DNA sequence from clone RP23-381C21 on chromosome 11, complete sequence Length = 198743 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 191671 ctcctcttcctcttcttcctcttct 191695 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 191684 tcttcctcttcttcctcttct 191704
>emb|AL691481.15| Mouse DNA sequence from clone RP23-173C3 on chromosome 4 Contains a non-neuron enolase 1 alpha (Eno1) pseudogene, a mitochondrial H+ transporting ATP synthase F0 complex subunit d (Atp5h) pseudogene and a CpG island, complete sequence Length = 230127 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 216658 ctcctcttcctcttcttcctcttct 216634 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 216667 ctcctcttcctcctcttcctcttct 216643 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 216645 tcttcctcttcttcctcttct 216625 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 216636 tcttcctcttcttcctcttct 216616 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||| ||||||||||| Sbjct: 216604 ctcctcttcctcctcttcctcttc 216581 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 216576 tcctcttcctcttcttcttcttct 216553
>gb|AC120797.9| Mus musculus chromosome 18, clone RP24-81D18, complete sequence Length = 210631 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 98047 ctcctcttcctcttcttcctcttct 98023 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 125145 tcttcctcttcttcctcttc 125164
>gb|AC150683.3| Mus musculus BAC clone RP23-435E16 from chromosome 7, complete sequence Length = 198646 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttctgctcc 189 ||||||||||| ||||||||||||||||| Sbjct: 88803 tcctcttcctcatcttcctcttctgctcc 88831
>gb|AC104439.2| Homo sapiens chromosome 3 clone RP11-793E15, complete sequence Length = 197279 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 107611 ctcctcttcctcttcttcctcttct 107635
>gb|AC161009.5| Pan troglodytes BAC clone CH251-560O18 from chromosome unknown, complete sequence Length = 168542 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttctgctccctcc 193 |||||||||||||||||||||||| || ||||| Sbjct: 94736 tcctcttcctcttcttcctcttcttcttcctcc 94704
>gb|U88153.2|HSU88153 Homo sapiens PELP1 mRNA, complete cds Length = 3910 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 3183 ctcctcttcctcttcttcctcttct 3159 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 3167 tcctcttcttcttcttcctcttct 3144
>gb|AC023789.8| Mus musculus chromosome 4 clone RP23-43A16, complete sequence Length = 146120 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 159 gctcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||||| Sbjct: 59521 gctcctcttcctcttcttcctcttc 59497
>dbj|AB010266.1| Mus musculus Creb-rp, Tnx and Cyp21 genes for cAMP response element binding protein-related protein, tenascin-X and steroid 21-hydroxylase, partial cds and complete sequences Length = 67977 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 148 ctgctgccgccgctcctcttcctcttcttcctc 180 ||||||| || |||||||||||||||||||||| Sbjct: 23357 ctgctgctgctgctcctcttcctcttcttcctc 23389 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||| ||||||||||| Sbjct: 67425 ctcctcttcctcctcttcctcttc 67402
>gb|AC079222.17| Mus musculus chromosome 1, clone RP22-292L24, complete sequence Length = 159700 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 103629 ctcctcttcctcttcttcctcttct 103605 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 103638 ctcctcttcctcctcttcctcttct 103614 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||| ||||||||||| Sbjct: 106539 ctcctcttcctcctcttcctcttc 106562 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 103691 tcctcttcctcttcttcctc 103672 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 103520 tcctcttcctcttcttcttcttct 103497
>gb|AC161113.2| Mus musculus BAC clone RP24-362N9 from chromosome 9, complete sequence Length = 171642 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 31574 ctcctcttcctcttcttcctcttct 31550 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||||||||| |||||| Sbjct: 165516 ctcctcttcctcttcttcttcttct 165540
>gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 genomic sequence, complete sequence Length = 138824 Score = 50.1 bits (25), Expect = 0.007 Identities = 67/81 (82%) Strand = Plus / Plus Query: 298 gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357 ||||| |||||||||||||||| ||||||||||| || ||| |||| | | ||||| Sbjct: 62387 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 62446 Query: 358 gtccgctgcggcgcgtgcttc 378 ||| |||||||||| |||||| Sbjct: 62447 gtcggctgcggcgcctgcttc 62467
>gb|AC130527.4| Mus musculus BAC clone RP23-56C10 from chromosome 1, complete sequence Length = 233538 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 34867 ctcctcttcctcttcttcctcttct 34891 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||||||| |||| Sbjct: 34897 ctcctcttcctcttcttccccttc 34920
>gb|AC155636.3| Mus musculus BAC clone RP23-345F5 from chromosome 17, complete sequence Length = 223528 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttctgctccctcc 193 |||||||||||||||||||||||| || ||||| Sbjct: 25785 tcctcttcctcttcttcctcttcttcttcctcc 25817
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 50.1 bits (25), Expect = 0.007 Identities = 67/81 (82%) Strand = Plus / Plus Query: 298 gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357 ||||| |||||||||||||||| ||||||||||| || ||| |||| | | ||||| Sbjct: 20660935 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 20660994 Query: 358 gtccgctgcggcgcgtgcttc 378 ||| |||||||||| |||||| Sbjct: 20660995 gtcggctgcggcgcctgcttc 20661015 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 18295788 tcctcttcctcttcttcctcttc 18295766 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||| ||||||||||||||||| Sbjct: 18295810 ctcctcctcctcttcttcctcttc 18295787 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 317 gcctgctcgccgccgccggc 336 |||||||||||||||||||| Sbjct: 8737501 gcctgctcgccgccgccggc 8737520
>gb|AC100735.15| Mus musculus chromosome 7, clone RP24-331F7, complete sequence Length = 179974 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 23515 ctcctcttcctcttcttcctcttct 23539
>gb|AC018553.6| Homo sapiens chromosome 16 clone RP11-434E6, complete sequence Length = 172315 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 163908 ctcctcttcctcttcttcctcttct 163932 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 163921 tcttcctcttcttcctcttct 163941 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 163899 ctcctcttcctcctcttcctcttct 163923
>gb|AC140675.5| Mus musculus BAC clone RP23-44J10 from chromosome 5, complete sequence Length = 229269 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 209724 ctcctcttcctcttcttcctcttct 209748 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 209556 ctcctcttcctcttcttcctcttc 209579 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 209777 ctcctcttcctcttcttcctc 209797 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 209520 ctcctcttcctcttcttcctc 209540 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 209511 ctcctcttcctcctcttcctcttct 209535
>gb|AC133645.5| Mus musculus BAC clone RP23-73O10 from chromosome 5, complete sequence Length = 207846 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 25718 ctcctcttcctcttcttcctcttct 25742 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 25550 ctcctcttcctcttcttcctcttc 25573 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 25771 ctcctcttcctcttcttcctc 25791 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 25514 ctcctcttcctcttcttcctc 25534 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 25505 ctcctcttcctcctcttcctcttct 25529 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 cttcctcttcttcctcttct 184 |||||||||||||||||||| Sbjct: 145150 cttcctcttcttcctcttct 145169
>gb|AC007343.7| Homo sapiens chromosome 16 clone RP11-463J22, complete sequence Length = 186732 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 101984 ctcctcttcctcttcttcctcttct 102008 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 101997 tcttcctcttcttcctcttct 102017 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 101975 ctcctcttcctcctcttcctcttct 101999
>gb|AC009021.8| Homo sapiens chromosome 16 clone RP11-105C19, complete sequence Length = 176219 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 97892 ctcctcttcctcttcttcctcttct 97868 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 97901 ctcctcttcctcctcttcctcttct 97877
>ref|NM_214596.1| Strongylocentrotus purpuratus radial spokehead (LOC373423), mRNA Length = 2332 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 159 gctcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||||| Sbjct: 887 gctcctcttcctcttcttcctcttc 863
>gb|AC138069.3| Homo sapiens chromosome 3 clone RP13-546I2, complete sequence Length = 177334 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 5811 ctcctcttcctcttcttcctcttct 5835
>emb|CT030725.15| Mouse DNA sequence from clone RP24-281O2 on chromosome 16, complete sequence Length = 115213 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 34348 ctcctcttcctcttcttcctcttct 34372 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 34340 tcctcttcctcctcttcctcttct 34363
>gb|AC102506.9| Mus musculus chromosome 1, clone RP24-139E15, complete sequence Length = 151816 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 33628 ctcctcttcctcttcttcctcttct 33652 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 33619 ctcctcttcctcctcttcctcttct 33643 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 33733 tcctcttcctcttcttcttcttct 33756
>gb|AC109198.9| Mus musculus chromosome 15, clone RP23-31G10, complete sequence Length = 207069 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 205134 ctcctcttcctcttcttcctcttct 205158
>gb|AC102858.11| Mus musculus chromosome 5, clone RP24-507F5, complete sequence Length = 176211 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 113351 ctcctcttcctcttcttcctcttct 113375
>gb|AC006289.1|AC006289 Mus musculus chromosome 17, clone 29_N_7, complete sequence Length = 201986 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 148 ctgctgccgccgctcctcttcctcttcttcctc 180 ||||||| || |||||||||||||||||||||| Sbjct: 154290 ctgctgctgctgctcctcttcctcttcttcctc 154322
>emb|AL773539.18| Mouse DNA sequence from clone RP23-9F18 on chromosome 4, complete sequence Length = 182206 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 159 gctcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||||| Sbjct: 86281 gctcctcttcctcttcttcctcttc 86305
>gb|AY882602.1| Homo sapiens transcription factor HMX3 mRNA, complete cds Length = 3186 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 2514 ctcctcttcctcttcttcctcttct 2490 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 2498 tcctcttcttcttcttcctcttct 2475 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 2486 tcttcctcttcttcctcttc 2467
>gb|AC113936.16| Mus musculus chromosome 10, clone RP23-9F21, complete sequence Length = 205086 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 151404 ctcctcttcctcttcttcctcttct 151380
>gb|AC121504.14| Mus musculus chromosome 13, clone RP24-140A15, complete sequence Length = 156791 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 78360 ctcctcttcctcttcttcctcttct 78336 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 78368 tcctcttcctcctcttcctcttct 78345
>emb|BX293544.7| Mouse DNA sequence from clone RP23-109C9 on chromosome 2, complete sequence Length = 97505 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 6698 ctcctcttcctcttcttcctcttct 6674 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 6721 tcctcttcctcttcttcctc 6702
>gb|U73123.1|SPU73123 Strongylocentrotus purpuratus radial spokehead mRNA, complete cds Length = 2332 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 159 gctcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||||| Sbjct: 887 gctcctcttcctcttcttcctcttc 863
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 50.1 bits (25), Expect = 0.007 Identities = 67/81 (82%) Strand = Plus / Plus Query: 298 gccgcctccttcaacggcggcctgctcgccgccgccggcacggtcctgtaccgcggcggc 357 ||||| |||||||||||||||| ||||||||||| || ||| |||| | | ||||| Sbjct: 20672207 gccgcgtccttcaacggcggccacctcgccgccgcgagcccggcgctgttcaggggcggt 20672266 Query: 358 gtccgctgcggcgcgtgcttc 378 ||| |||||||||| |||||| Sbjct: 20672267 gtcggctgcggcgcctgcttc 20672287 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 18305441 tcctcttcctcttcttcctcttc 18305419 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||| ||||||||||||||||| Sbjct: 18305463 ctcctcctcctcttcttcctcttc 18305440 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 317 gcctgctcgccgccgccggc 336 |||||||||||||||||||| Sbjct: 8742640 gcctgctcgccgccgccggc 8742659
>emb|AL845485.16| Mouse DNA sequence from clone RP23-237D23 on chromosome 2, complete sequence Length = 230213 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 91369 ctcctcttcctcttcttcctcttct 91393
>gb|AC141471.4| Mus musculus BAC clone RP24-326K11 from 18, complete sequence Length = 216048 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 28753 ctcctcttcctcttcttcctcttct 28729
>gb|AC135673.5| Mus musculus BAC clone RP24-279A17 from 16, complete sequence Length = 173965 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 80828 ctcctcttcctcttcttcctcttct 80852
>emb|CT573030.2| Mouse DNA sequence from clone RP24-100B3 on chromosome 17, complete sequence Length = 111957 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 148 ctgctgccgccgctcctcttcctcttcttcctc 180 ||||||| || |||||||||||||||||||||| Sbjct: 15879 ctgctgctgctgctcctcttcctcttcttcctc 15911
>gb|U88154.1|HSU88154 Homo sapiens proline and glutamic acid rich nuclear protein isoform mRNA, partial cds Length = 3121 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 2394 ctcctcttcctcttcttcctcttct 2370 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 2378 tcctcttcttcttcttcctcttct 2355
>gb|AC015535.11| Mus musculus chromosome 5, clone RP23-39M18, complete sequence Length = 263382 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttctgctcc 189 |||||||||||||||||||||||| |||| Sbjct: 235838 tcctcttcctcttcttcctcttctcctcc 235866 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 235806 tcctcttcctcttcttcctcttct 235829
>emb|CT025535.14| Mouse DNA sequence from clone RP23-359O5 on chromosome 14, complete sequence Length = 193236 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 77386 ctcctcttcctcttcttcctcttct 77410 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||| ||||||||||||||||| Sbjct: 2213 ctcctcctcctcttcttcctcttc 2236
>gb|BC002875.2| Homo sapiens proline, glutamic acid and leucine rich protein 1, mRNA (cDNA clone IMAGE:3940843), partial cds Length = 2311 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 1562 ctcctcttcctcttcttcctcttct 1538 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 1546 tcctcttcttcttcttcctcttct 1523 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 1534 tcttcctcttcttcctcttc 1515
>gb|AC147562.5| Mus musculus BAC clone RP23-239A13 from 3, complete sequence Length = 167633 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttctgctcc 189 |||||||||||||||||||||||| |||| Sbjct: 103869 tcctcttcctcttcttcctcttctcctcc 103841
>gb|BC069058.1| Homo sapiens proline, glutamic acid and leucine rich protein 1, mRNA (cDNA clone MGC:70420 IMAGE:6068755), complete cds Length = 3456 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 2721 ctcctcttcctcttcttcctcttct 2697 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 2705 tcctcttcttcttcttcctcttct 2682 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 2693 tcttcctcttcttcctcttc 2674
>gb|BC039131.1| Homo sapiens proline, glutamic acid and leucine rich protein 1, mRNA (cDNA clone IMAGE:4158475), with apparent retained intron Length = 3453 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 2674 ctcctcttcctcttcttcctcttct 2650 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 2658 tcctcttcttcttcttcctcttct 2635 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 2646 tcttcctcttcttcctcttc 2627
>gb|AC126054.5| Mus musculus BAC clone RP23-298O13 from 8, complete sequence Length = 233117 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 75354 ctcctcttcctcttcttcctcttct 75378 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 75367 tcttcctcttcttcctcttc 75386
>gb|BC010457.2| Homo sapiens proline, glutamic acid and leucine rich protein 1, mRNA (cDNA clone IMAGE:4156419), partial cds Length = 3216 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 2475 ctcctcttcctcttcttcctcttct 2451 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 2459 tcctcttcttcttcttcctcttct 2436 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 2447 tcttcctcttcttcctcttc 2428
>gb|AF547989.1| Homo sapiens MNAR (MNAR) mRNA, complete cds Length = 3393 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 2721 ctcctcttcctcttcttcctcttct 2697
>gb|AC118226.7| Mus musculus chromosome 5, clone RP23-372N19, complete sequence Length = 173599 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 27713 ctcctcttcctcttcttcctcttct 27689 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 18743 ctcctcttcctcttcttcctc 18723 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 146751 tcctcttcctcttcttcctc 146732 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 27682 tcctcttcctcttcttcctc 27663 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||| |||||||||||||||||| Sbjct: 27604 tcctcctcctcttcttcctcttct 27581
>gb|AC168881.3| Mus musculus BAC clone RP23-170A19 from chromosome 13, complete sequence Length = 212206 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 141949 ctcctcttcctcttcttcctcttct 141925 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 141876 tcctcttcctcttcttcctcttct 141853 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 141837 tcctcttcctcttcttcctcttct 141814 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 141813 tcctcttcctcttcttcctcttct 141790 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 141891 tcctcttcctcttcttcctcttc 141869 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 141783 tcctcttcctcttcttcctcttc 141761 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 141936 tcttcctcttcttcctcttct 141916 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 141927 tcttcctcttcttcctcttct 141907 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 141861 tcctcttcttcttcttcctcttct 141838 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 141849 tcttcctcttcttcctcttc 141830 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 141825 tcttcctcttcttcctcttc 141806 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 141801 tcttcctcttcttcctcttc 141782 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 141762 tcctcttcctcttcttcttcttct 141739
>emb|AL626782.10| Mouse DNA sequence from clone RP23-335N15 on chromosome X, complete sequence Length = 177264 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 38260 ctcctcttcctcttcttcctcttct 38236 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 38388 tcttcctcttcttcctcttct 38368 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 38379 tcttcctcttcttcctcttct 38359 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 38269 ctcctcttcctcctcttcctcttct 38245 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 38247 tcttcctcttcttcctcttct 38227 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 38238 tcttcctcttcttcctcttct 38218 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 38229 tcttcctcttcttcctcttct 38209 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 38370 tcttcctcttcttcctcttc 38351 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 38220 tcttcctcttcttcctcttc 38201 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 38178 tcctcttcctcttcttcttcttct 38155
>emb|AL607074.13| Mouse DNA sequence from clone RP23-174M9 on chromosome 4, complete sequence Length = 204428 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 155748 ctcctcttcctcttcttcctcttct 155772
>emb|AL732296.11| Mouse DNA sequence from clone RP23-131P6 on chromosome 2, complete sequence Length = 203503 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 89957 ctcctcttcctcttcttcctcttct 89933 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 89944 tcttcctcttcttcctcttct 89924 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||| ||||||||||| Sbjct: 89996 ctcctcttcctcctcttcctcttc 89973 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 89987 ctcctcttcctcttcctcctcttc 89964 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 89972 ctcctcttcctcttcctcctcttc 89949 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 89965 tcctcttcctcctcttcctcttct 89942 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 89935 tcttcctcttcttcctcttc 89916
>emb|AL611970.11| Mouse DNA sequence from clone RP23-413K17 on chromosome 4, complete sequence Length = 61588 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 51790 ctcctcttcctcttcttcctcttct 51814 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 51875 tcctcttcctcttcttcctcttc 51897 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 51860 tcctcttcctcttcttcctcttc 51882 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 52108 ctcctcttcctcttcttcctc 52128 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 52015 ctcctcttcctcttcttcctc 52035 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 51967 ctcctcttcctcttcttcctc 51987 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 51949 ctcctcttcctcttcttcctc 51969 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 51821 tcttcctcttcttcctcttct 51841 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 51812 tcttcctcttcttcctcttct 51832 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 51803 tcttcctcttcttcctcttct 51823 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 51737 tcttcctcttcttcctcttct 51757 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 51995 tcctcttcctcttcttcctc 52014 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 51746 tcttcctcttcttcctcttc 51765 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 51725 tcctcttcttcttcttcctcttct 51748 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||| ||||| Sbjct: 51718 ctcctcttcctcttcttcttcttc 51741 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 51677 tcttcctcttcttcctcttc 51696
>emb|AL645468.11| Mouse DNA sequence from clone RP23-246F18 on chromosome 4, complete sequence Length = 209764 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 154978 ctcctcttcctcttcttcctcttct 154954 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 155056 ctcctcttcctcttcttcctc 155036 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 154987 ctcctcttcctcctcttcctcttct 154963
>emb|AJ251154.1|MMU251154 Mus musculus olfactory receptor cluster, OR37A, OR37B, OR37C, OR37E genes and OR37D pseudogene Length = 76099 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 159 gctcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||||| Sbjct: 27225 gctcctcttcctcttcttcctcttc 27201
>emb|AL365322.10| Mouse DNA sequence from clone RP23-282D4 on chromosome 1, complete sequence Length = 259487 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 155931 ctcctcttcctcttcttcctcttct 155955
>gb|AC155715.24| Mus musculus 10 BAC RP24-118H2 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 174860 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 62445 ctcctcttcctcttcttcctcttct 62469
>gb|AC102610.18| Mus musculus chromosome 19, clone RP23-411P21, complete sequence Length = 226019 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 139369 ctcctcttcctcttcttcctcttct 139393
>gb|AC158595.25| Mus musculus 10 BAC RP24-216B14 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 231740 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 176989 ctcctcttcctcttcttcctcttct 177013
>gb|AC124528.4| Mus musculus BAC clone RP23-411B19 from chromosome 1, complete sequence Length = 195050 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 75168 ctcctcttcctcttcttcctcttct 75144
>emb|AL590992.12| Mouse DNA sequence from clone RP23-212C14 on chromosome 11, complete sequence Length = 118444 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 ||||||||||||||||||||||||| Sbjct: 39839 ctcctcttcctcttcttcctcttct 39863
>gb|AC130283.8| Mus musculus chromosome 15, clone RP23-136E18, complete sequence Length = 180660 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 103657 tcctcttcctcttcttcctcttct 103634 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 103672 tcctcttcctcttcttcctcttc 103650 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103792 tcttcctcttcttcctcttct 103772 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103783 tcttcctcttcttcctcttct 103763 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103774 tcttcctcttcttcctcttct 103754 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103765 tcttcctcttcttcctcttct 103745 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103756 tcttcctcttcttcctcttct 103736 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103747 tcttcctcttcttcctcttct 103727 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103738 tcttcctcttcttcctcttct 103718 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103729 tcttcctcttcttcctcttct 103709 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103720 tcttcctcttcttcctcttct 103700 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103711 tcttcctcttcttcctcttct 103691 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103645 tcttcctcttcttcctcttct 103625 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103636 tcttcctcttcttcctcttct 103616 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103627 tcttcctcttcttcctcttct 103607 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103618 tcttcctcttcttcctcttct 103598 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103609 tcttcctcttcttcctcttct 103589 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 103600 tcttcctcttcttcctcttct 103580 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 165 cttcctcttcttcctcttct 184 |||||||||||||||||||| Sbjct: 103800 cttcctcttcttcctcttct 103781 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 103702 tcttcctcttcttcctcttc 103683
>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence Length = 186903 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 13046 ctcctcttcctcttcttcctcttc 13023
>gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, complete sequence Length = 152183 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 57391 tcctcttcctcttcttcctcttct 57368 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 57156 tcctcttcctcttcttcctcttct 57133 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 57406 tcctcttcctcttcttcctcttc 57384 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 57186 tcctcttcctcttcttcctcttc 57164 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 57171 tcctcttcctcttcttcctcttc 57149 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||||||||| |||||| Sbjct: 57664 ctcctcttcctcttcttcttcttct 57640 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 57540 tcttcctcttcttcctcttct 57520 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 57225 tcttcctcttcttcctcttct 57205 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 57216 tcttcctcttcttcctcttc 57197
>ref|NM_113819.2| Arabidopsis thaliana unknown protein AT3G28980 mRNA, complete cds Length = 1628 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 1368 tcctcttcctcttcttcctcttct 1391
>gb|AC154808.2| Mus musculus BAC clone RP24-512K19 from chromosome 13, complete sequence Length = 187080 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 64635 ctcctcttcctcttcttcctcttc 64658 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 64608 ctcctcttcctcttcctcctcttc 64631 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 64593 ctcctcttcctcttcctcctcttc 64616 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 64578 ctcctcttcctcttcctcctcttc 64601 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||| ||||||||||| Sbjct: 64569 ctcctcttcctcctcttcctcttc 64592 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 7287 tcctcttcctcttcttcctc 7268
>gb|AC155264.2| Mus musculus BAC clone RP23-281B4 from chromosome 16, complete sequence Length = 199531 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 103164 tcctcttcctcttcttcctcttct 103141
>gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, complete sequence Length = 175318 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 47243 tcctcttcctcttcttcctcttct 47266 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 47153 tcctcttcctcttcttcctcttct 47176 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 46967 tcctcttcctcttcttcctcttct 46990 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 47186 tcctcttcctcttcttcctcttc 47208 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 47273 tcttcctcttcttcctcttct 47293 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 47264 tcttcctcttcttcctcttct 47284 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 47255 tcttcctcttcttcctcttct 47275 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 47165 tcttcctcttcttcctcttct 47185 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||||||||| |||||| Sbjct: 47047 ctcctcttcctcttcttcttcttct 47071 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 47029 ctcctcttcctcttcttcctc 47049 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 47000 tcttcctcttcttcctcttct 47020 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 46979 tcttcctcttcttcctcttct 46999 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||| |||||||||||||||||| Sbjct: 46930 ctcctcctcctcttcttcctcttct 46954 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 47174 tcttcctcttcttcctcttc 47193 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 47141 tcttcctcttcttcctcttc 47160 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 47117 tcctcttcctcttcttcctc 47136 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 47021 tcctcttcctcctcttcctcttct 47044 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 47009 tcttcctcttcttcctcttc 47028
>gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, complete sequence Length = 174746 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 151481 tcctcttcctcttcttcctcttct 151504 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 151567 tcttcctcttcttcctcttct 151587 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 151576 tcttcctcttcttcctcttc 151595 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 151493 tcttcctcttcttcctcttc 151512
>gb|AE010302.1| Methanopyrus kandleri AV19 section 1 of 157 of the complete genome Length = 11150 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 3753 ctcctcttcctcttcttcctcttc 3730
>ref|XM_637799.1| Dictyostelium discoideum hypothetical protein (DDB0217883), partial mRNA Length = 2250 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 746 tcctcttcctcttcttcctcttct 723
>gb|AC154483.2| Mus musculus BAC clone RP24-113B3 from chromosome 17, complete sequence Length = 182923 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 82304 ctcctcttcctcttcttcctcttc 82281
>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence Length = 196951 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 164339 tcctcttcctcttcttcctcttct 164362 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 164315 tcctcttcctcttcttcctcttct 164338 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 164291 tcctcttcctcttcttcctcttct 164314 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 164249 tcctcttcctcttcttcctcttct 164272 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 164351 tcttcctcttcttcctcttct 164371 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 164261 tcttcctcttcttcctcttct 164281 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 164420 tcctcttcctcttcttcctc 164439 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 164327 tcttcctcttcttcctcttc 164346 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 164303 tcttcctcttcttcctcttc 164322
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 2526051 ctcctcttcctcttcttcctcttc 2526074
>gb|AC153558.7| Mus musculus 10 BAC RP23-367D2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 207823 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 186130 tcctcttcctcttcttcctcttct 186153 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 186118 tcttcctcttcttcctcttc 186137
>gb|AC109149.15| Mus musculus chromosome 19, clone RP24-178F17, complete sequence Length = 176668 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 26791 tcctcttcctcttcttcctcttct 26814 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 26821 tcttcctcttcttcctcttct 26841 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 26812 tcttcctcttcttcctcttct 26832 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 26803 tcttcctcttcttcctcttct 26823 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 26770 tcttcctcttcttcctcttct 26790 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 26761 tcttcctcttcttcctcttct 26781 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 26752 tcttcctcttcttcctcttct 26772 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 26743 tcttcctcttcttcctcttct 26763 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 26734 tcttcctcttcttcctcttct 26754 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 26707 tcttcctcttcttcctcttct 26727 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 27138 tcctcttcctcttcttcctc 27157 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 26779 tcttcctcttcttcctcttc 26798
>gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold Length = 1743090 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 826981 tcctcttcctcttcttcctcttct 826958 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 826969 tcttcctcttcttcctcttct 826949 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 826948 tcttcctcttcttcctcttct 826928 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 826939 tcttcctcttcttcctcttct 826919 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||| ||||||||||| Sbjct: 826895 ctcctcttcctcctcttcctcttc 826872 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 826852 tcctcttcctcttcttcttcttct 826829
>gb|AF106329.1| Escherichia coli plasmid F putative methyltransferase, putative antirestriction protein, single stranded DNA binding protein (ssb), PsiB (psiB), and PsiA (psiA) genes, complete cds; flmB gene, complete sequence; FlmC (flmC), FlmA (flmA), and X genes, complete cds; and unknown genes Length = 13310 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 5182 tcctcttcctcttcttcctcttct 5205 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 5194 tcttcctcttcttcctcttct 5214
>gb|AC109268.10| Mus musculus chromosome 1, clone RP23-305F24, complete sequence Length = 160975 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 128768 tcctcttcctcttcttcctcttct 128791 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 128801 tcctcttcctcttcttcctcttc 128823 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||| |||||||||| Sbjct: 128816 tcctcttcctctttttcctcttct 128839 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 128756 tcttcctcttcttcctcttc 128775
>gb|AC101391.15| Mus musculus chromosome 5, clone RP23-119E13, complete sequence Length = 209590 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 171474 tcctcttcctcttcttcctcttct 171451 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171600 tcttcctcttcttcctcttct 171580 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171591 tcttcctcttcttcctcttct 171571 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171582 tcttcctcttcttcctcttct 171562 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171573 tcttcctcttcttcctcttct 171553 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171564 tcttcctcttcttcctcttct 171544 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171555 tcttcctcttcttcctcttct 171535 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171546 tcttcctcttcttcctcttct 171526 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171537 tcttcctcttcttcctcttct 171517 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171462 tcttcctcttcttcctcttct 171442 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171453 tcttcctcttcttcctcttct 171433 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171444 tcttcctcttcttcctcttct 171424 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171435 tcttcctcttcttcctcttct 171415 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171426 tcttcctcttcttcctcttct 171406 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171417 tcttcctcttcttcctcttct 171397 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||||||||| |||||| Sbjct: 171352 ctcctcttcctcttcttcttcttct 171328 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171285 tcttcctcttcttcctcttct 171265 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171276 tcttcctcttcttcctcttct 171256 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171267 tcttcctcttcttcctcttct 171247 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171258 tcttcctcttcttcctcttct 171238 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171249 tcttcctcttcttcctcttct 171229 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171240 tcttcctcttcttcctcttct 171220 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171231 tcttcctcttcttcctcttct 171211 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171108 tcttcctcttcttcctcttct 171088 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171099 tcttcctcttcttcctcttct 171079 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171090 tcttcctcttcttcctcttct 171070 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 171081 tcttcctcttcttcctcttct 171061 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 171528 tcttcctcttcttcctcttc 171509 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 171408 tcttcctcttcttcctcttc 171389 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 171360 tcctcttcctcctcttcctcttct 171337 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 171222 tcttcctcttcttcctcttc 171203 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 171168 tcctcttcctcttcttcttcttct 171145 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 171072 tcttcctcttcttcctcttc 171053 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 171000 tcctcttcctcttcttcttcttct 170977
>gb|AC164700.3| Mus musculus BAC clone RP24-548M16 from chromosome 5, complete sequence Length = 212172 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 68494 tcctcttcctcttcttcctcttct 68471 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttctgctcc 189 |||||||| ||||||||||||||| |||| Sbjct: 151669 tcctcttcttcttcttcctcttcttctcc 151641
>gb|AC102354.14| Mus musculus chromosome 17, clone RP23-80J17, complete sequence Length = 117703 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 101091 ctcctcttcctcttcttcctcttc 101068 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 101276 ctcctcttcctcttcctcctcttc 101253
>gb|AC115937.14| Mus musculus chromosome 5, clone RP24-547J21, complete sequence Length = 215400 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 131148 tcctcttcctcttcttcctcttct 131125
>gb|AC114613.12| Mus musculus chromosome 5, clone RP24-80F7, complete sequence Length = 190200 Score = 48.1 bits (24), Expect = 0.027 Identities = 33/36 (91%) Strand = Plus / Minus Query: 148 ctgctgccgccgctcctcttcctcttcttcctcttc 183 ||||||| || ||||||| ||||||||||||||||| Sbjct: 165914 ctgctgctgctgctcctcctcctcttcttcctcttc 165879
>gb|AC158594.12| Mus musculus 10 BAC RP23-197I5 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 218257 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 155128 ctcctcttcctcttcttcctcttc 155151
>ref|XM_869058.1| PREDICTED: Bos taurus similar to Protein KIAA0586 (LOC616919), partial mRNA Length = 2820 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 1586 tcctcttcctcttcttcctcttct 1563
>gb|AC120390.12| Mus musculus chromosome 9, clone RP24-308L17, complete sequence Length = 138507 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 47669 ctcctcttcctcttcttcctcttc 47692 Score = 44.1 bits (22), Expect = 0.42 Identities = 31/34 (91%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttctgctccctcc 193 ||||||||||||||||||||| ||| || ||||| Sbjct: 47792 ctcctcttcctcttcttcctcctcttcttcctcc 47825
>gb|AC124614.11| Mus musculus chromosome 10, clone RP24-417L12, complete sequence Length = 173306 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 82367 tcctcttcctcttcttcctcttct 82344 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 82355 tcttcctcttcttcctcttct 82335 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 82346 tcttcctcttcttcctcttct 82326 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 82337 tcttcctcttcttcctcttct 82317
>gb|BC072219.1| Xenopus laevis hypothetical protein MGC81377, mRNA (cDNA clone MGC:81377 IMAGE:6634406), complete cds Length = 2486 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 694 ctcctcttcctcttcttcctcttc 671
>gb|AC134460.4| Mus musculus BAC clone RP23-373D18 from chromosome 10, complete sequence Length = 174545 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 87935 ctcctcttcctcttcttcctcttc 87912 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||| ||||||||||| Sbjct: 87968 ctcctcttcctcctcttcctcttc 87945
>gb|AC139755.3| Mus musculus BAC clone RP24-96N20 from chromosome 6, complete sequence Length = 192869 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 80839 tcctcttcctcttcttcctcttct 80816
>gb|AC131586.10| Mus musculus chromosome 14, clone RP24-226L18, complete sequence Length = 171023 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 30932 tcctcttcctcttcttcctcttct 30955 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 30917 tcctcttcctcttcttcctcttc 30939 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 30902 tcctcttcctcttcttcctcttc 30924
>gb|BC072638.1| Mus musculus RIKEN cDNA E130013N09 gene, mRNA (cDNA clone IMAGE:30354620), partial cds Length = 4288 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 1453 tcctcttcctcttcttcctcttct 1476 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 1465 tcttcctcttcttcctcttct 1485 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 1474 tcttcctcttcttcctcttc 1493
>gb|AF131866.2| Mus musculus chromosome X clone CT7-271B7 map qA7.1, complete sequence Length = 110310 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 40209 tcctcttcctcttcttcctcttct 40186 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 40110 tcctcttcctcttcttcctcttct 40087
>gb|AC147375.3| Mus musculus BAC clone RP24-159O13 from chromosome 12, complete sequence Length = 176510 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 30078 ctcctcttcctcttcttcctcttc 30055
>ref|NM_175229.2| Mus musculus serine/arginine repetitive matrix 2 (Srrm2), mRNA Length = 8548 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 7644 ctcctcttcctcttcttcctcttc 7667
>gb|AC147143.2| Pan troglodytes BAC clone CH251-267L18 from Y, complete sequence Length = 187629 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 36851 tcctcttcctcttcttcctcttct 36874 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttctgct 187 |||||||||||||| ||||||||| Sbjct: 36815 tcttcctcttcttcttcttctgct 36838
>gb|AC149133.1| Pan troglodytes chromosome X clone RP43-010O16 map human ortholog p11.23 complete sequence Length = 179327 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Plus Query: 162 cctcttcctcttcttcctcttctgctccctcc 193 ||||||||||||||||||||||| || ||||| Sbjct: 154622 cctcttcctcttcttcctcttcttcttcctcc 154653
>gb|AC132441.3| Mus musculus BAC clone RP23-239J2 from chromosome 18, complete sequence Length = 189507 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 14423 ctcctcttcctcttcttcctcttc 14446
>gb|AC125192.3| Mus musculus BAC clone RP23-266B4 from chromosome 8, complete sequence Length = 199459 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 13628 ctcctcttcctcttcttcctcttc 13651
>ref|XM_657374.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4862.2), mRNA Length = 1254 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 1119 ctcctcttcctcttcttcctcttc 1096 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 1128 ctcctcttcctcctcttcctcttct 1104
>gb|AC102135.12| Mus musculus chromosome 18, clone RP23-253J5, complete sequence Length = 204286 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 18998 ctcctcttcctcttcttcctcttc 19021 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 19068 tcctcttcctcttcttcttcttct 19091
>gb|AC158220.4| Mus musculus chromosome 7, clone RP23-278M8, complete sequence Length = 189304 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 41933 tcctcttcctcttcttcctcttct 41910 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 41825 tcctcttcctcttcttcctcttct 41802 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 42038 tcttcctcttcttcctcttct 42018 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||||||||| |||||| Sbjct: 42006 ctcctcttcctcttcttcatcttct 41982 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||||||||| |||||| Sbjct: 41898 ctcctcttcctcttcttcatcttct 41874 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||||||||| |||||| Sbjct: 41790 ctcctcttcctcttcttcatcttct 41766 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||| ||||||| Sbjct: 41726 tcctcttcctcttctttctcttct 41703
>gb|AC132844.7| Mus musculus chromosome 17, clone RP24-481P13, complete sequence Length = 225183 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 145658 tcctcttcctcttcttcctcttct 145635 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 145673 tcctcttcctcttcttcctcttc 145651 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145793 tcttcctcttcttcctcttct 145773 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145784 tcttcctcttcttcctcttct 145764 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145775 tcttcctcttcttcctcttct 145755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145766 tcttcctcttcttcctcttct 145746 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145757 tcttcctcttcttcctcttct 145737 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145748 tcttcctcttcttcctcttct 145728 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145739 tcttcctcttcttcctcttct 145719 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145730 tcttcctcttcttcctcttct 145710 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145721 tcttcctcttcttcctcttct 145701 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145712 tcttcctcttcttcctcttct 145692 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145646 tcttcctcttcttcctcttct 145626 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145637 tcttcctcttcttcctcttct 145617 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145628 tcttcctcttcttcctcttct 145608 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145619 tcttcctcttcttcctcttct 145599 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145610 tcttcctcttcttcctcttct 145590 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 145601 tcttcctcttcttcctcttct 145581 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 165 cttcctcttcttcctcttct 184 |||||||||||||||||||| Sbjct: 145801 cttcctcttcttcctcttct 145782 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 145703 tcttcctcttcttcctcttc 145684
>gb|AC114539.8| Mus musculus chromosome 19, clone RP23-62I23, complete sequence Length = 249767 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 242247 ctcctcttcctcttcttcctcttc 242270
>gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome 8, complete sequence Length = 236510 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 100087 ctcctcttcctcttcttcctcttc 100064 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 100111 ctcctcttcctcttcttcctc 100091
>gb|AC122820.4| Mus musculus BAC clone RP23-200M5 from chromosome 6, complete sequence Length = 215238 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 207447 tcctcttcctcttcttcctcttct 207424 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 207412 tcctcttcctcttcttcctcttct 207389 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 207374 tcctcttcctcttcttcttcttct 207351
>gb|AC117076.3| Dictyostelium discoideum chromosome 2 map 3323568-3470138 strain AX4, complete sequence Length = 146570 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 113602 tcctcttcctcttcttcctcttct 113625
>gb|AC183773.2| Pan troglodytes BAC clone CH251-2N7 from chromosome 7, complete sequence Length = 168126 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 56986 ctcctcttcctcttcttcctcttc 56963 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 56964 tcctcttcctcttcttcctcttct 56941
>ref|XM_992312.1| PREDICTED: Mus musculus serine/arginine repetitive matrix 2 (Srrm2), mRNA Length = 8486 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 7578 ctcctcttcctcttcttcctcttc 7601
>gb|AC102257.5| Mus musculus chromosome 18, clone RP24-196N23, complete sequence Length = 194837 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 14952 ctcctcttcctcttcttcctcttc 14975
>ref|XM_992125.1| PREDICTED: Mus musculus similar to olfactory receptor 775 (LOC672253), mRNA Length = 612 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 397 tcctcttcctcttcttcctcttct 374 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 487 tcttcctcttcttcctcttct 467
>ref|XM_001001853.1| PREDICTED: Mus musculus hypothetical protein LOC668505 (LOC668505), mRNA Length = 486 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 271 tcctcttcctcttcttcctcttct 248 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 361 tcttcctcttcttcctcttct 341
>gb|AC118211.10| Mus musculus chromosome 8, clone RP24-223O5, complete sequence Length = 192713 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 40454 ctcctcttcctcttcttcctcttc 40477 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 40517 ctcctcttcctcttcttcctc 40537 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 40508 ctcctcttcctcctcttcctcttct 40532 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 40490 ctcctcttcctcttcttcctc 40510 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 40481 ctcctcttcctcctcttcctcttct 40505 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 40445 ctcctcttcctcctcttcctcttct 40469
>gb|AC107663.10| Mus musculus chromosome 13, clone RP23-99G9, complete sequence Length = 213163 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 110692 tcctcttcctcttcttcctcttct 110715 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 110677 tcctcttcctcttcttcctcttc 110699
>gb|AC110262.12| Mus musculus chromosome 17, clone RP23-291L10, complete sequence Length = 210850 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 37639 ctcctcttcctcttcttcctcttc 37662 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||| |||||||||||||||||| Sbjct: 37679 tcctcctcctcttcttcctcttct 37702
>gb|AC117690.10| Mus musculus chromosome 16, clone RP23-446I8, complete sequence Length = 189033 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 37555 ctcctcttcctcttcttcctcttc 37578
>gb|AC133950.4| Mus musculus BAC clone RP24-243C16 from chromosome 7, complete sequence Length = 176244 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 129655 ctcctcttcctcttcttcctcttc 129632
>gb|AC133077.4| Mus musculus BAC clone RP24-423E10 from chromosome 12, complete sequence Length = 183317 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 78700 ctcctcttcctcttcttcctcttc 78677
>gb|DQ484017.1| Gymnogyps californianus clone 183G microsatellite sequence Length = 1142 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 995 ctcctcttcctcttcttcctcttc 972 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 1004 ctcctcttcctcctcttcctcttct 980 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 883 tcttcctcttcttcctcttc 864
>emb|AL773599.11| Mouse DNA sequence from clone RP23-326I8 on chromosome 4, complete sequence Length = 46151 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 37471 ctcctcttcctcttcttcctcttc 37448
>ref|XM_823587.1| Trypanosoma brucei TREU927 hypothetical protein (Tb11.02.3880) partial mRNA Length = 5124 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 2058 ctcctcttcctcttcttcctcttc 2035
>emb|CT009492.5| M.truncatula DNA sequence from clone MTH2-93A21 on chromosome 3, complete sequence Length = 122557 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 74306 tcctcttcctcttcttcctcttct 74283
>gb|AC146243.2| Pan troglodytes BAC clone CH251-166E5 from Y, complete sequence Length = 161714 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 2448 tcctcttcctcttcttcctcttct 2425
>gb|AC147361.1| Pan troglodytes BAC clone CH251-528H6 from Y, complete sequence Length = 169760 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 161590 tcctcttcctcttcttcctcttct 161613 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttctgct 187 |||||||||||||| ||||||||| Sbjct: 161554 tcttcctcttcttcttcttctgct 161577
>gb|AC147114.2| Pan troglodytes BAC clone CH251-548O14 from Y, complete sequence Length = 229006 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 186633 tcctcttcctcttcttcctcttct 186656 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttctgct 187 ||||| ||| |||||||||||||||||| Sbjct: 186655 ctccttttcttcttcttcctcttctgct 186682 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttctgct 187 |||||||||||||| ||||||||| Sbjct: 186594 tcttcctcttcttcttcttctgct 186617
>gb|AC147515.1| Pan troglodytes BAC clone CH251-558O8 from Y, complete sequence Length = 209207 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 167526 tcctcttcctcttcttcctcttct 167503 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttctgct 187 |||||||||||||| ||||||||| Sbjct: 167565 tcttcctcttcttcttcttctgct 167542 Score = 40.1 bits (20), Expect = 6.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttctgct 187 ||||| ||| |||||||||||||||||| Sbjct: 167504 ctccttttcttcttcttcctcttctgct 167477
>ref|XM_387700.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07524.1) partial mRNA Length = 3129 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 227 tcctcttcctcttcttcctcttct 204
>gb|AC129200.4| Mus musculus BAC clone RP24-221J22 from chromosome 2, complete sequence Length = 168365 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 13702 ctcctcttcctcttcttcctcttc 13725
>gb|AC134581.5| Mus musculus BAC clone RP24-90L20 from chromosome 8, complete sequence Length = 201483 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 33584 ctcctcttcctcttcttcctcttc 33607 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 33612 tcctcttcctcttcttcttcttct 33635
>gb|AC117239.4| Mus musculus BAC clone RP24-117K6 from chromosome 18, complete sequence Length = 150804 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 134424 tcctcttcctcttcttcctcttct 134447 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 134448 tcctcttcctcttcttcctc 134467 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 134436 tcttcctcttcttcctcttc 134455
>gb|AC132100.3| Mus musculus BAC clone RP24-294D10 from chromosome 18, complete sequence Length = 173949 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 43278 tcctcttcctcttcttcctcttct 43301 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 43302 tcctcttcctcttcttcctc 43321 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 43290 tcttcctcttcttcctcttc 43309
>gb|AC130543.3| Mus musculus BAC clone RP24-178J22 from chromosome 8, complete sequence Length = 147985 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 74571 ctcctcttcctcttcttcctcttc 74594 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 74634 ctcctcttcctcttcttcctc 74654 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 74625 ctcctcttcctcctcttcctcttct 74649 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 74607 ctcctcttcctcttcttcctc 74627 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 74598 ctcctcttcctcctcttcctcttct 74622 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 74562 ctcctcttcctcctcttcctcttct 74586
>gb|AC132242.2| Mus musculus BAC clone RP24-413O2 from chromosome 18, complete sequence Length = 177442 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 142091 ctcctcttcctcttcttcctcttc 142114
>gb|AC122821.4| Mus musculus BAC clone RP23-201I4 from chromosome 17, complete sequence Length = 220013 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 40982 ctcctcttcctcttcttcctcttc 40959 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 165 cttcctcttcttcctcttct 184 |||||||||||||||||||| Sbjct: 133303 cttcctcttcttcctcttct 133284 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||| |||||||||||||||||| Sbjct: 40942 tcctcctcctcttcttcctcttct 40919
>gb|AC110212.12| Mus musculus chromosome 19, clone RP23-183H23, complete sequence Length = 212687 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 63678 tcctcttcctcttcttcctcttct 63655 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 63762 tcttcctcttcttcctcttct 63742 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 63735 tcttcctcttcttcctcttct 63715 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 63726 tcttcctcttcttcctcttct 63706 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 63717 tcttcctcttcttcctcttct 63697 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 63708 tcttcctcttcttcctcttct 63688 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 63699 tcttcctcttcttcctcttct 63679 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 63666 tcttcctcttcttcctcttct 63646 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 63657 tcttcctcttcttcctcttct 63637 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 63648 tcttcctcttcttcctcttct 63628 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 63690 tcttcctcttcttcctcttc 63671 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 63331 tcctcttcctcttcttcctc 63312
>gb|BC060623.1| Mus musculus RIKEN cDNA E130013N09 gene, mRNA (cDNA clone IMAGE:6826655), partial cds Length = 5235 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 2380 tcctcttcctcttcttcctcttct 2403 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 2392 tcttcctcttcttcctcttct 2412 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 2401 tcttcctcttcttcctcttc 2420
>gb|AC125352.4| Mus musculus BAC clone RP23-451M13 from chromosome 8, complete sequence Length = 203416 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 75126 tcctcttcctcttcttcctcttct 75149 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 75138 tcttcctcttcttcctcttct 75158
>ref|XM_814622.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506763.30) partial mRNA Length = 774 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 362 tcctcttcctcttcttcctcttct 339
>gb|AC121889.3| Mus musculus BAC clone RP24-146D9 from chromosome 1, complete sequence Length = 160207 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 32724 tcctcttcctcttcttcctcttct 32747 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 32757 tcctcttcctcttcttcctcttc 32779 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||| |||||||||| Sbjct: 32772 tcctcttcctctttttcctcttct 32795 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 32712 tcttcctcttcttcctcttc 32731
>gb|AC131751.2| Mus musculus BAC clone RP23-19P8 from 10, complete sequence Length = 185680 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 94611 tcctcttcctcttcttcctcttct 94634 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 94521 tcttcctcttcttcctcttct 94541
>gb|AC122864.3| Mus musculus BAC clone RP23-142M19 from 6, complete sequence Length = 210148 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 4332 tcctcttcctcttcttcctcttct 4309 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 4002 tcctcttcctcttcttcctcttct 3979 Score = 44.1 bits (22), Expect = 0.42 Identities = 28/30 (93%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttctgctcc 189 |||||| |||||||||||||||||| |||| Sbjct: 163237 ctcctcctcctcttcttcctcttcttctcc 163208 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4320 tcttcctcttcttcctcttct 4300 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4311 tcttcctcttcttcctcttct 4291 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4302 tcttcctcttcttcctcttct 4282 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4293 tcttcctcttcttcctcttct 4273 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4284 tcttcctcttcttcctcttct 4264 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4275 tcttcctcttcttcctcttct 4255 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4266 tcttcctcttcttcctcttct 4246 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4257 tcttcctcttcttcctcttct 4237 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4248 tcttcctcttcttcctcttct 4228 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4239 tcttcctcttcttcctcttct 4219 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4230 tcttcctcttcttcctcttct 4210 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4221 tcttcctcttcttcctcttct 4201 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4212 tcttcctcttcttcctcttct 4192 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 4203 tcttcctcttcttcctcttct 4183 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||| ||||||||||| Sbjct: 4099 ctcctcttcctcctcttcctcttc 4076 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 4090 ctcctcttcctcttcctcctcttc 4067 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 4014 tcttcctcttcttcctcttc 3995 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 3990 tcttcctcttcttcctcttc 3971
>gb|AC122268.5| Mus musculus BAC clone RP23-216B15 from 14, complete sequence Length = 207136 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 57133 tcctcttcctcttcttcctcttct 57110 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 57163 tcttcctcttcttcctcttct 57143 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 57154 tcttcctcttcttcctcttct 57134 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 57145 tcttcctcttcttcctcttc 57126
>gb|AC110508.8| Mus musculus chromosome 3, clone RP23-382L1, complete sequence Length = 224790 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 150033 tcctcttcctcttcttcctcttct 150010
>gb|AC114817.3| Mus musculus BAC clone RP23-28O15 from 14, complete sequence Length = 211624 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 151236 tcctcttcctcttcttcctcttct 151259
>gb|AC117198.3| Mus musculus BAC clone RP23-127K18 from 9, complete sequence Length = 193044 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 133442 ctcctcttcctcttcttcctcttc 133419 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||| ||||||||||| Sbjct: 133466 ctcctcttcctcctcttcctcttc 133443 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 133457 ctcctcttcctcttcctcctcttc 133434 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 133450 tcctcttcctcctcttcctcttct 133427
>gb|AC098731.3| Mus musculus BAC clone RP23-3L10 from 9, complete sequence Length = 220184 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 185334 ctcctcttcctcttcttcctcttc 185357 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 185299 tcttcctcttcttcctcttct 185319 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 185326 tcctcttcctcctcttcctcttct 185349 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 185308 tcttcctcttcttcctcttc 185327
>gb|AC112680.12| Mus musculus chromosome 9, clone RP23-203D1, complete sequence Length = 226883 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 130022 ctcctcttcctcttcttcctcttc 129999
>ref|XM_546592.2| PREDICTED: Canis familiaris similar to Zinc finger and BTB domain containing protein 4 (KAISO-like zinc finger protein 1) (KAISO-L1) (LOC489474), mRNA Length = 4845 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 2058 ctcctcttcctcttcttcctcttc 2081
>ref|XM_721979.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY06422) partial mRNA Length = 7950 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 1247 tcctcttcctcttcttcctcttct 1224
>ref|XM_724266.1| Plasmodium yoelii yoelii str. 17XNL casein kinase II subunit beta (PY01577) partial mRNA Length = 1059 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 224 tcctcttcctcttcttcctcttct 201
>gb|AC073094.11| Homo sapiens BAC clone RP11-369D24 from 7, complete sequence Length = 189126 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 29534 ctcctcttcctcttcttcctcttc 29511 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 29402 ctcctcttcctcttcttcctcttc 29379 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctctt 182 |||||||||||||||||||||| Sbjct: 29467 tcctcttcctcttcttcctctt 29446 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 29498 ctcctcttcctcttcttcctc 29478 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcct 179 |||||||||||||||||||| Sbjct: 29624 ctcctcttcctcttcttcct 29605 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 29440 tcctcttcctcctcttcctcttct 29417 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||| ||||| Sbjct: 29432 ctcctcttcctcttcttcgtcttc 29409 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 29410 tcctcttcctcctcttcctcttct 29387
>ref|XM_733967.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000739.03.0) partial mRNA Length = 750 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 257 tcctcttcctcttcttcctcttct 234
>ref|XM_735356.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000845.00.0) partial mRNA Length = 360 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 56 tcctcttcctcttcttcctcttct 33
>ref|XM_737002.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000351.03.0) partial mRNA Length = 855 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 257 tcctcttcctcttcttcctcttct 234
>ref|XM_669806.1| Plasmodium berghei strain ANKA Casein kinase II regulatory subunit (PB000663.03.0) partial mRNA Length = 1035 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 221 tcctcttcctcttcttcctcttct 198
>gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, complete sequence Length = 137137 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 56419 ctcctcttcctcttcttcctcttc 56396 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 14733 tcctcttcctcttcttcctcttc 14755
>ref|XM_662725.1| Cryptosporidium hominis TU502 DNA polymerase epsilon catalytic subunit -related (Chro.80147) partial mRNA Length = 4983 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 3171 ctcctcttcctcttcttcctcttc 3148 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 3155 tcctcttcctcttcttcctcttc 3133 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 3180 ctcctcttcctcctcttcctcttct 3156
>ref|NM_012993.1| Rattus norvegicus nardilysin, N-arginine dibasic convertase 1 (Nrd1), mRNA Length = 3581 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 511 ctcctcttcctcttcttcctcttc 488
>gb|AC138270.12| Mus musculus chromosome 7, clone RP23-323F17, complete sequence Length = 213855 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 42008 tcctcttcctcttcttcctcttct 42031 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctctt 182 |||||||||||||||||||||| Sbjct: 42032 tcctcttcctcttcttcctctt 42053 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 42020 tcttcctcttcttcctcttc 42039 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 41996 tcttcctcttcttcctcttc 42015 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 41929 tcctcttcttcttcttcctcttct 41952
>gb|AC123687.20| Mus musculus chromosome 5, clone RP23-314A12, complete sequence Length = 189230 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 37092 tcctcttcctcttcttcctcttct 37069 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 37017 tcctcttcctcttcttcttcttct 36994
>gb|AC154864.2| Mus musculus BAC clone RP23-7A5 from chromosome 12, complete sequence Length = 208597 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 173655 tcctcttcctcttcttcctcttct 173632
>gb|AC156564.3| Mus musculus BAC clone RP24-81G20 from chromosome 8, complete sequence Length = 196445 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 63123 ctcctcttcctcttcttcctcttc 63146 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 63114 ctcctcttcctcctcttcctcttct 63138
>ref|NM_001040149.1| Macaca mulatta proline, glutamic acid and leucine rich protein 1 (PELP1), mRNA Length = 3393 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 2720 tcctcttcctcttcttcctcttct 2697 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 2783 tcttcctcttcttcctcttc 2764
>gb|BC094956.1| Rattus norvegicus cDNA clone IMAGE:7368168, **** WARNING: chimeric clone **** Length = 3392 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 2509 ctcctcttcctcttcttcctcttc 2532 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 2500 ctcctcttcctcctcttcctcttct 2524
>gb|AC163208.2| Mus musculus chromosome 18, clone RP24-340O19, complete sequence Length = 203011 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 78896 ctcctcttcctcttcttcctcttc 78873
>gb|AC108554.8| Rattus norvegicus 7 BAC CH230-81L13 (Children's Hospital Oakland Research Institute) complete sequence Length = 157107 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 98097 tcctcttcctcttcttcctcttct 98074 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 98085 tcttcctcttcttcctcttct 98065 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 98076 tcttcctcttcttcctcttct 98056 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 98226 tcctcttcctcttcttcttcttct 98203
>gb|AC126071.5| Rattus norvegicus 10 BAC CH230-209B21 (Children's Hospital Oakland Research Institute) complete sequence Length = 227741 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 37767 tcctcttcctcttcttcctcttct 37790 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 54968 ctcctcttcctcttcttcctc 54988 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 54959 ctcctcttcctcctcttcctcttct 54983 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 37755 tcttcctcttcttcctcttc 37774
>emb|AL683813.10| Human DNA sequence from clone RP11-1114A5 on chromosome X Contains the 5' end of the ARHGEF6 gene for Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6, a ribosomal protein L7 (RPL7) pseudogene, a RAN member RAS oncogene family pseudogene, a novel gene, the RNMX gene for RNA binding motif protein (X chromosome), the 5' end of a novel gene and two CpG islands, complete sequence Length = 148654 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 143525 ctcctcttcctcttcttcctcttc 143548 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 143501 ctcctcttcctcttcttcctcttc 143524 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 143604 tcctcttcctcttcttcctcttc 143626 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||| |||||||||||||||| Sbjct: 143645 ctcctctacctcttcttcctcttc 143668 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 143517 tcctcttcctcctcttcctcttct 143540 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 143493 tcctcttcctcctcttcctcttct 143516 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 ||||||||||||||| |||||||| Sbjct: 143486 ctcctcttcctcttcctcctcttc 143509
>emb|AL445531.10| Human DNA sequence from clone RP11-546O6 on chromosome 9 Contains the 3' end of the NCBP1 gene for nuclear cap binding protein subunit 1, 80kDa (NCBP, CBP80), the XPA gene for xeroderma pigmentosum, complementation group A (XP1, XPAC), a keratin 18 (KRT18) pseudogene and two CpG islands, complete sequence Length = 111345 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 71746 tcctcttcctcttcttcctcttct 71723
>emb|AL365274.17| Human DNA sequence from clone RP11-298A17 on chromosome 9 Contains the DAB2IP gene for DAB2 interacting protein (AF9Q34, DIP1/2, KIAA1743) and four CpG islands, complete sequence Length = 171941 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 16346 tcctcttcctcttcttcctcttct 16323
>emb|AL390835.14| Human DNA sequence from clone RP5-1119O21 on chromosome 10 Contains the 5' end of a novel gene and a novel gene, complete sequence Length = 65508 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 41319 tcctcttcctcttcttcctcttct 41342
>emb|AL161932.15| Human DNA sequence from clone RP11-241I20 on chromosome 10 Contains a ribosomal protein L34 (RPL34) pseudogene, the KIF5B gene for kinesin family member 5B (kinesin 1 (110-120kD)), a ribosomal protein S4 pseudogene, part of a novel pseudogene, a pseudogene similar to part of RAB18 (RAB18, member RAS oncogene family) and a CpG island, complete sequence Length = 143423 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 140830 ctcctcttcctcttcttcctcttc 140853
>emb|AL161730.9| Human DNA sequence from clone RP11-441I5 on chromosome 9 Contains the DMRTA1 gene for DMRT-like family A1 (DMO) and a CpG island, complete sequence Length = 170066 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 94379 tcctcttcctcttcttcctcttct 94356 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 94409 tcttcctcttcttcctcttct 94389 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 94400 tcttcctcttcttcctcttct 94380 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 94367 tcttcctcttcttcctcttct 94347 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 94358 tcttcctcttcttcctcttct 94338 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 94349 tcttcctcttcttcctcttct 94329 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 94391 tcttcctcttcttcctcttc 94372
>emb|AL139136.17| Human DNA sequence from clone RP11-53I24 on chromosome 1 Contains the 3' end of the CRB1 gene for crumbs homolog 1 (Drosophila) and the 3' end of a novel gene, complete sequence Length = 181596 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 72475 ctcctcttcctcttcttcctcttc 72452 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctc 180 ||||||||||||||||||||| Sbjct: 72580 ctcctcttcctcttcttcctc 72560 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 165 cttcctcttcttcctcttct 184 |||||||||||||||||||| Sbjct: 72602 cttcctcttcttcctcttct 72583 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||| ||||| Sbjct: 72562 ctcctcttcctcttcttcttcttc 72539
>emb|AL139216.14| Human DNA sequence from clone RP5-1017J17 on chromosome 1p31.2-32.2 Contains the 5' end of the gene for a novel protein (FLJ23129) and the 5' end of the gene for mesoderm induction early response 1 (MI-ER1), complete sequence Length = 112515 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 35375 ctcctcttcctcttcttcctcttc 35352 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 102746 tcttcctcttcttcctcttc 102727 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||| ||||| Sbjct: 35249 ctcctcttcctcttcttcttcttc 35226 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||| ||||||||||||||| Sbjct: 35242 tcctcttcttcttcttcctcttct 35219
>emb|AL139241.11| Human DNA sequence from clone RP11-34A14 on chromosome 10 Contains the 3' end of gene FLJ37160, the LOXL4 gene for lysyl oxidase-like 4, a novel gene and a CpG island, complete sequence Length = 188192 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 108982 ctcctcttcctcttcttcctcttc 108959
>emb|AL157895.8| Human DNA sequence from clone RP11-354E11 on chromosome 10 Contains the 5' end of a novel gene and a novel gene, complete sequence Length = 166317 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 148397 tcctcttcctcttcttcctcttct 148374 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 148412 tcctcttcctcttcttcctcttc 148390 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 148361 tcctcttcctcttcttcttcttct 148338
>gb|AC124658.5| Homo sapiens chromosome 11, clone RP11-655D12, complete sequence Length = 163126 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 70590 tcctcttcctcttcttcctcttct 70567
>gb|AC124914.3| Homo sapiens chromosome 3 clone RP11-146K16, complete sequence Length = 187803 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 71668 tcctcttcctcttcttcctcttct 71691
>gb|AC126567.8| Homo sapiens 3 BAC RP11-656G9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 150746 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 53273 ctcctcttcctcttcttcctcttc 53296
>gb|AC119420.12| Mus musculus strain 129S6/SvEvTac clone rp22-121i21 map 11, complete sequence Length = 168186 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 73649 ctcctcttcctcttcttcctcttc 73626
>emb|AL133380.5| Human DNA sequence from clone RP5-862P8 on chromosome 1q42.2-43 Contains a ribosomal protein S7 (RPS7) pseudogene, pecanex homolog (Drosophila) (PCNX) pseudogene and the gene for mixed lineage kinase 4 (KIAA1804), complete sequence Length = 118632 Score = 48.1 bits (24), Expect = 0.027 Identities = 30/32 (93%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttctgctccctc 192 |||||||| ||||||||||||||| ||||||| Sbjct: 52300 tcctcttcttcttcttcctcttcttctccctc 52331
>emb|AL031774.1|HS298J15 Human DNA sequence from clone RP1-298J15 on chromosome 6p22.3-23 Contains the DEK gene for an oncogene (DNA binding), part of a novel gene and CpG islands, complete sequence Length = 109488 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 12984 ctcctcttcctcttcttcctcttc 12961
>gb|AY152827.1| Felis catus clone BAC 186b21 major histocompatiblity complex extended class II region, partial sequence Length = 146453 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 76014 ctcctcttcctcttcttcctcttc 75991
>emb|Y15943.1|DMAAR2B Didelphis marsupialis gene encoding alpha adrenergic receptor subtype 2B, partial Length = 1147 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 841 ctcctcttcctcttcttcctcttc 818
>gb|DQ447200.1| Macaca mulatta modulator of nongenomic activity of estrogen receptor mRNA, complete cds Length = 3393 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 2720 tcctcttcctcttcttcctcttct 2697 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 2783 tcttcctcttcttcctcttc 2764
>ref|XM_781838.1| PREDICTED: Strongylocentrotus purpuratus similar to tuberous sclerosis 2 isoform 2 (LOC581860), mRNA Length = 4629 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 2558 tcctcttcctcttcttcctcttct 2535
>gb|AC161231.7| Mus musculus chromosome 5, clone RP24-241P24, complete sequence Length = 193682 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 68017 ctcctcttcctcttcttcctcttc 68040
>gb|AC151985.2| Mus musculus BAC clone RP23-381C14 from chromosome 5, complete sequence Length = 204862 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 100824 tcctcttcctcttcttcctcttct 100801 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100950 tcttcctcttcttcctcttct 100930 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100941 tcttcctcttcttcctcttct 100921 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100932 tcttcctcttcttcctcttct 100912 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100923 tcttcctcttcttcctcttct 100903 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100914 tcttcctcttcttcctcttct 100894 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100905 tcttcctcttcttcctcttct 100885 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100896 tcttcctcttcttcctcttct 100876 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100887 tcttcctcttcttcctcttct 100867 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100812 tcttcctcttcttcctcttct 100792 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100803 tcttcctcttcttcctcttct 100783 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100794 tcttcctcttcttcctcttct 100774 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100785 tcttcctcttcttcctcttct 100765 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100776 tcttcctcttcttcctcttct 100756 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100767 tcttcctcttcttcctcttct 100747 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||||||||| |||||| Sbjct: 100702 ctcctcttcctcttcttcttcttct 100678 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100635 tcttcctcttcttcctcttct 100615 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100626 tcttcctcttcttcctcttct 100606 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100617 tcttcctcttcttcctcttct 100597 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100608 tcttcctcttcttcctcttct 100588 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100599 tcttcctcttcttcctcttct 100579 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100590 tcttcctcttcttcctcttct 100570 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100581 tcttcctcttcttcctcttct 100561 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100467 tcttcctcttcttcctcttct 100447 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100458 tcttcctcttcttcctcttct 100438 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100449 tcttcctcttcttcctcttct 100429 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100440 tcttcctcttcttcctcttct 100420 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 100431 tcttcctcttcttcctcttct 100411 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 100878 tcttcctcttcttcctcttc 100859 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 100758 tcttcctcttcttcctcttc 100739 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||| |||||||||||| Sbjct: 100710 tcctcttcctcctcttcctcttct 100687 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 100572 tcttcctcttcttcctcttc 100553 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 100518 tcctcttcctcttcttcttcttct 100495 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 100422 tcttcctcttcttcctcttc 100403 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 100350 tcctcttcctcttcttcttcttct 100327
>emb|AL645527.20| Mouse DNA sequence from clone RP23-26L6 on chromosome 11 Contains the Vamp2 gene for vesicle-associated membrane 2, the Per1 gene for period homolog 1 (Drosophila), the Hes7 gene for hairy and enhancer of split 7 (Drosophila), the Aloxe3 gene for arachidonate lipoxygenase 3, the Alox12b gene for arachidonate 12-lipoxygenase 12R type, the Alox15b gene for arachidonate 15-lipoxygenase second type, the Gucy2e gene for guanylate cyclase 2e, a novel gene, the gene for LYST-interacting protein LIP8 (Lip8-pending), the gene for the likely ortholog of H. sapiens trafficking protein particle complex 1 (TRAPPC1)), the Kcnab3 gene for potassium voltage-gated channel shaker-related subfamily beta member 3, a novel gene, the 3' end of the Chd3 gene for chromodomain helicase DNA binding protein 3 and six CpG islands, complete sequence Length = 261224 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 92706 ctcctcttcctcttcttcctcttc 92729
>gb|AC153523.7| Mus musculus 10 BAC RP23-463C2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 200141 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 164940 ctcctcttcctcttcttcctcttc 164917
>gb|AC164614.3| Mus musculus BAC clone RP23-337L12 from chromosome 9, complete sequence Length = 215002 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 176048 tcctcttcctcttcttcctcttct 176025 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 176006 tcctcttcctcttcttcctcttct 175983 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 175982 tcctcttcctcttcttcctcttct 175959 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 175958 tcctcttcctcttcttcctcttct 175935 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 176036 tcttcctcttcttcctcttct 176016 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 175946 tcttcctcttcttcctcttct 175926 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 175994 tcttcctcttcttcctcttc 175975 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 175970 tcttcctcttcttcctcttc 175951 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctc 180 |||||||||||||||||||| Sbjct: 175877 tcctcttcctcttcttcctc 175858
>emb|AL929272.10| Mouse DNA sequence from clone RP23-69H10 on chromosome 11 Contains the 5' end of the Vrk2 gene for vaccinia related kinase 2 and a CpG island, complete sequence Length = 196753 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 67059 ctcctcttcctcttcttcctcttc 67036 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcctcttct 184 |||||||||||| |||||||||||| Sbjct: 67014 ctcctcttcctcctcttcctcttct 66990 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 ctcctcttcctcttcttcct 179 |||||||||||||||||||| Sbjct: 67005 ctcctcttcctcttcttcct 66986 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 44346 tcctcttcctcttcttcttcttct 44323
>emb|AL645904.13| Mouse DNA sequence from clone RP23-121P11 on chromosome 11 Contains the gene for a novel protein (1700121K02Rik), the Hnrph1 gene for heterogeneous nuclear ribonucleoprotein H1, the Rufy1 gene for RUN and FYVE domain containing 1, a novel pseudogene and three CpG islands, complete sequence Length = 193696 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 154113 ctcctcttcctcttcttcctcttc 154136
>emb|AL603842.9| Mouse DNA sequence from clone RP23-100P23 on chromosome 11 Contains the 5' end of a novel gene, three novel genes, the Slc6a4 gene for solute carrier family 6 (neurotransmitter transporter, serotonin) member 4, the Blmh gene for bleomycin hydrolase and three CpG islands, complete sequence Length = 229289 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 107065 tcctcttcctcttcttcctcttct 107088 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttc 183 ||||||||||||||||||||||| Sbjct: 107008 tcctcttcctcttcttcctcttc 107030 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcttcctcttcttcctcttc 183 |||||||||||||||||||| Sbjct: 107053 tcttcctcttcttcctcttc 107072 Score = 40.1 bits (20), Expect = 6.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 ||||||||||||||||| |||||| Sbjct: 107023 tcctcttcctcttcttcttcttct 107046
>emb|AL611937.6| Mouse DNA sequence from clone RP23-221M24 on chromosome 11 Contains the genes for olfactory receptors MOR255-2, -1 and -6, a novel KRAB box containing protein, a high mobility group box 1 (Hmgb1) pseudogene and a olfactory receptor MOR255 pseudogene, complete sequence Length = 109397 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 160 ctcctcttcctcttcttcctcttc 183 |||||||||||||||||||||||| Sbjct: 32213 ctcctcttcctcttcttcctcttc 32236
>emb|AL162873.1|ATF8F6 Arabidopsis thaliana DNA chromosome 5, BAC clone F8F6 (ESSA project) Length = 96936 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Minus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 36074 tcctcttcctcttcttcctcttct 36051 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 36062 tcttcctcttcttcctcttct 36042 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 tcttcctcttcttcctcttct 184 ||||||||||||||||||||| Sbjct: 36053 tcttcctcttcttcctcttct 36033
>emb|AJ400877.1|HSA400877 Homo sapiens ASCL3 gene, CEGP1 gene, C11orf14 gene, C11orf15 gene, C11orf16 gene and C11orf17 gene Length = 256164 Score = 48.1 bits (24), Expect = 0.027 Identities = 24/24 (100%) Strand = Plus / Plus Query: 161 tcctcttcctcttcttcctcttct 184 |||||||||||||||||||||||| Sbjct: 200468 tcctcttcctcttcttcctcttct 200491 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,740,837 Number of Sequences: 3902068 Number of extensions: 4740837 Number of successful extensions: 247677 Number of sequences better than 10.0: 5660 Number of HSP's better than 10.0 without gapping: 5680 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 196105 Number of HSP's gapped (non-prelim): 50791 length of query: 481 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 459 effective length of database: 17,147,199,772 effective search space: 7870564695348 effective search space used: 7870564695348 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
