ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart09a02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_380543.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 72 2e-09
2emb|BX066731.1|CNS09NNJ Single read from an extremity of a full-... 68 3e-08
3emb|BX058317.1|CNS09H5T Single read from an extremity of a full-... 68 3e-08
4emb|BX055561.1|CNS09F19 Single read from an extremity of a full-... 68 3e-08
5emb|BX052254.1|CNS09CHE Single read from an extremity of a full-... 68 3e-08
6emb|BX052019.1|CNS09CAV Single read from an extremity of a full-... 68 3e-08
7emb|BX050272.1|CNS09AYC Single read from an extremity of a full-... 68 3e-08
8emb|BX048768.1|CNS099SK Single read from an extremity of a full-... 68 3e-08
9emb|BX047124.1|CNS098IW Single read from an extremity of a full-... 68 3e-08
10emb|BX047123.1|CNS098IV Single read from an extremity of a full-... 68 3e-08
11emb|BX040677.1|CNS093JT Single read from an extremity of a full-... 68 3e-08
12emb|BX039299.1|CNS092HJ Single read from an extremity of a full-... 68 3e-08
13emb|BX033313.1|CNS08XV9 Single read from an extremity of a full-... 68 3e-08
14emb|BX026775.1|CNS08STN Single read from an extremity of a full-... 68 3e-08
15emb|BX023278.1|CNS08Q4I Single read from an extremity of a full-... 68 3e-08
16emb|BX023277.1|CNS08Q4H Single read from an extremity of a full-... 68 3e-08
17emb|BX022509.1|CNS08PJ5 Single read from an extremity of a full-... 68 3e-08
18emb|BX014947.1|CNS08JP3 Single read from an extremity of a full-... 68 3e-08
19emb|BX013712.1|CNS08IQS Single read from an extremity of a full-... 68 3e-08
20emb|BX011561.1|CNS08H31 Single read from an extremity of a full-... 68 3e-08
21emb|BX008945.1|CNS08F2D Single read from an extremity of a full-... 68 3e-08
22emb|BX008389.1|CNS08EMX Single read from an extremity of a full-... 68 3e-08
23emb|BX058318.1|CNS09H5U Single read from an extremity of a full-... 60 7e-06
24emb|BX055562.1|CNS09F1A Single read from an extremity of a full-... 60 7e-06
25emb|BX040678.1|CNS093JU Single read from an extremity of a full-... 60 7e-06
26emb|BX039300.1|CNS092HK Single read from an extremity of a full-... 60 7e-06
27emb|BX014948.1|CNS08JP4 Single read from an extremity of a full-... 60 7e-06
28emb|BX011562.1|CNS08H32 Single read from an extremity of a full-... 60 7e-06
29emb|BX008390.1|CNS08EMY Single read from an extremity of a full-... 60 7e-06
30ref|XM_569684.1| Cryptococcus neoformans var. neoformans JEC21 p... 56 1e-04
31emb|BX048088.1|CNS0999O Single read from an extremity of a full-... 56 1e-04
32emb|BX010310.1|CNS08G4A Single read from an extremity of a full-... 56 1e-04
33emb|BX010309.1|CNS08G49 Single read from an extremity of a full-... 56 1e-04
34gb|AY440017.1| Armigeres subalbatus ASAP ID: 43889 proteasome en... 52 0.002
35ref|XM_756589.1| Ustilago maydis 521 hypothetical protein (UM055... 52 0.002
36ref|XM_476072.1| Oryza sativa (japonica cultivar-group), predic... 48 0.028
37gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chr... 48 0.028
38dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.028
39dbj|AK103126.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.028
40gb|AC093954.2| Oryza sativa (japonica cultivar-group) chromosome... 48 0.028
41dbj|AB026564.1| Oryza sativa (japonica cultivar-group) OsPBB1 mR... 48 0.028
42gb|AC093497.2| Drosophila melanogaster 3L BAC RP98-1H12 (Roswell... 46 0.11
43gb|AC091209.3| Drosophila melanogaster 3L BAC RP98-3G6 (Roswell ... 46 0.11
44ref|NM_079352.2| Drosophila melanogaster Proteasome 2 subunit CG... 46 0.11
45gb|AY051976.1| Drosophila melanogaster LD44234 full length cDNA 46 0.11
46gb|AF025792.1|AF025792 Drosophila melanogaster 20S proteasome be... 46 0.11
47gb|AF025791.1|AF025791 Drosophila melanogaster 20S proteasome be... 46 0.11
48gb|AE003532.3| Drosophila melanogaster chromosome 3L, section 53... 46 0.11
49ref|XM_365218.1| Magnaporthe grisea 70-15 hypothetical protein (... 44 0.43
50gb|DQ444460.1| Sus scrofa proteasome beta 10 subunit (PSMB10) mR... 44 0.43
51ref|XM_691474.1| PREDICTED: Danio rerio similar to KH domain con... 44 0.43
52dbj|AK062648.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.43
53ref|XM_654597.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 1.7
54gb|AE017140.1| Yersinia pestis biovar Medievalis str. 91001 sect... 40 6.8
55gb|AC009909.6| Drosophila melanogaster clone BACR30P05, complete... 40 6.8
56gb|AE009952.1| Yersinia pestis KIM, complete genome 40 6.8
57emb|AL928921.21| Human DNA sequence from clone RP13-392I16 on ch... 40 6.8
58ref|XM_501440.1| Yarrowia lipolytica CLIB122, YALI0C04411g predi... 40 6.8
59emb|BX007235.1|CNS08DQV Single read from an extremity of a full-... 40 6.8
60emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 40 6.8
61emb|AJ414145.1| Yersinia pestis strain CO92 complete genome; seg... 40 6.8
62gb|AC023725.5| Drosophila melanogaster X BAC RP98-9I10 (Roswell ... 40 6.8
63gb|AE005853.1| Caulobacter crescentus CB15 section 179 of 359 of... 40 6.8
64gb|AC105352.2| Drosophila melanogaster X BAC RP98-45O17 (Roswell... 40 6.8
65gb|AC107403.6| Drosophila melanogaster X BAC RP98-21M21 (Roswell... 40 6.8
66tpg|BK003291.1| TPA: TPA_inf: Drosophila melanogaster HDC00427 (... 40 6.8
67gb|AC023687.3| Drosophila melanogaster X BAC RP98-36C7 (Roswell ... 40 6.8
68gb|L80131.1|DRO71DC60Z Drosophila melanogaster (subclone D71 2_e... 40 6.8
69gb|AE003582.4| Drosophila melanogaster chromosome 2L, section 9 ... 40 6.8
70gb|AE003488.3| Drosophila melanogaster chromosome X, section 40 ... 40 6.8
71gb|AE003429.4| Drosophila melanogaster chromosome X, section 13 ... 40 6.8
72gb|AC002444.1|AC002444 Drosophila melanogaster (P1 DS02782 (D71)... 40 6.8
73emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 40 6.8 
>ref|XM_380543.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG00367.1) partial mRNA
          Length = 813

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 242 gacaagaactgcgaaaagatccattacatttcccctcanatccgctgctgtggtgccggt 301
           ||||||||||| || ||| | || |||||||||||||| ||  | |||  ||||||||||
Sbjct: 169 gacaagaactgtgagaagcttcactacatttcccctcagatttggtgcgctggtgccggt 228

                                  
Query: 302 acggctgccgataccgagttcac 324
           || ||||||||||||||||||||
Sbjct: 229 acagctgccgataccgagttcac 251
to top
>emb|BX066731.1|CNS09NNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 282 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 341

             
Query: 263 ca 264
           ||
Sbjct: 342 ca 343
to top
>emb|BX058317.1|CNS09H5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 139 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 198

             
Query: 263 ca 264
           ||
Sbjct: 199 ca 200
to top
>emb|BX055561.1|CNS09F19 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 256 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 315

             
Query: 263 ca 264
           ||
Sbjct: 316 ca 317



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 32/34 (94%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                             
Query: 286 ctgctgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||||||| ||||| ||||||
Sbjct: 339 ctgctgtggtgccggtacggc-gccgacaccgag 371
to top
>emb|BX052254.1|CNS09CHE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 635

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 139 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 198

             
Query: 263 ca 264
           ||
Sbjct: 199 ca 200
to top
>emb|BX052019.1|CNS09CAV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 136

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 66  ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 125

             
Query: 263 ca 264
           ||
Sbjct: 126 ca 127
to top
>emb|BX050272.1|CNS09AYC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 314

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 233 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 292

             
Query: 263 ca 264
           ||
Sbjct: 293 ca 294
to top
>emb|BX048768.1|CNS099SK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 264 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 323

             
Query: 263 ca 264
           ||
Sbjct: 324 ca 325
to top
>emb|BX047124.1|CNS098IW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 339

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 261 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 202

             
Query: 263 ca 264
           ||
Sbjct: 201 ca 200



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 286 ctgctgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||||||| ||||| ||||||
Sbjct: 178 ctgctgtggtgccggtacggccgccgacaccgag 145
to top
>emb|BX047123.1|CNS098IV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 269

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 128 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 187

             
Query: 263 ca 264
           ||
Sbjct: 188 ca 189
to top
>emb|BX040677.1|CNS093JT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 261 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 320

             
Query: 263 ca 264
           ||
Sbjct: 321 ca 322
to top
>emb|BX039299.1|CNS092HJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 258 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 317

             
Query: 263 ca 264
           ||
Sbjct: 318 ca 319
to top
>emb|BX033313.1|CNS08XV9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 282 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 341

             
Query: 263 ca 264
           ||
Sbjct: 342 ca 343
to top
>emb|BX026775.1|CNS08STN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 675

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 246 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 305

             
Query: 263 ca 264
           ||
Sbjct: 306 ca 307
to top
>emb|BX023278.1|CNS08Q4I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 800 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 741

             
Query: 263 ca 264
           ||
Sbjct: 740 ca 739



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 286 ctgctgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||||||| ||||| ||||||
Sbjct: 717 ctgctgtggtgccggtacggccgccgacaccgag 684
to top
>emb|BX023277.1|CNS08Q4H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1046

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 275 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 334

             
Query: 263 ca 264
           ||
Sbjct: 335 ca 336
to top
>emb|BX022509.1|CNS08PJ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 253 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 312

             
Query: 263 ca 264
           ||
Sbjct: 313 ca 314
to top
>emb|BX014947.1|CNS08JP3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 264 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 323

             
Query: 263 ca 264
           ||
Sbjct: 324 ca 325
to top
>emb|BX013712.1|CNS08IQS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 659

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 255 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 314

             
Query: 263 ca 264
           ||
Sbjct: 315 ca 316



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 32/34 (94%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                             
Query: 286 ctgctgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||||||| ||||| ||||||
Sbjct: 338 ctgctgtggtgccggtacggc-gccgacaccgag 370
to top
>emb|BX011561.1|CNS08H31 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 250 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 309

             
Query: 263 ca 264
           ||
Sbjct: 310 ca 311
to top
>emb|BX008945.1|CNS08F2D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 249 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 308

             
Query: 263 ca 264
           ||
Sbjct: 309 ca 310
to top
>emb|BX008389.1|CNS08EMX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 107 ggtgccgatacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 166

             
Query: 263 ca 264
           ||
Sbjct: 167 ca 168
to top
>emb|BX058318.1|CNS09H5U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||| ||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 763 ggtgccgaaacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 704

             
Query: 263 ca 264
           ||
Sbjct: 703 ca 702



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 286 ctgctgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||||||| ||||| ||||||
Sbjct: 680 ctgctgtggtgccggtacggccgccgacaccgag 647
to top
>emb|BX055562.1|CNS09F1A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||| ||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 790 ggtgccgaaacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 731

             
Query: 263 ca 264
           ||
Sbjct: 730 ca 729



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 286 ctgctgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||||||| ||||| ||||||
Sbjct: 707 ctgctgtggtgccggtacggccgccgacaccgag 674
to top
>emb|BX040678.1|CNS093JU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||| ||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 787 ggtgccgaaacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 728

             
Query: 263 ca 264
           ||
Sbjct: 727 ca 726



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 286 ctgctgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||||||| ||||| ||||||
Sbjct: 704 ctgctgtggtgccggtacggccgccgacaccgag 671
to top
>emb|BX039300.1|CNS092HK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC1AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||| ||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 780 ggtgccgaaacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 721

             
Query: 263 ca 264
           ||
Sbjct: 720 ca 719



 Score = 44.1 bits (22), Expect = 0.43
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 290 tgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||| ||||| ||||||
Sbjct: 693 tgtggtgccggtacggccgccgacaccgag 664
to top
>emb|BX014948.1|CNS08JP4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||||||| | || |||||||| ||||| || | ||||||||||||||| ||||||
Sbjct: 783 ggtgccgatacgcgcgccaccgagggaccgatcgtggtggacaagaactgcgagaagatc 724

             
Query: 263 ca 264
           ||
Sbjct: 723 ca 722



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 286 ctgctgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||||||| ||||| ||||||
Sbjct: 700 ctgctgtggtgccggtacggccgccgacaccgag 667
to top
>emb|BX011562.1|CNS08H32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||| ||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 794 ggtgccgaaacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 735

             
Query: 263 ca 264
           ||
Sbjct: 734 ca 733



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 286 ctgctgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||||||| ||||| ||||||
Sbjct: 711 ctgctgtggtgccggtacggccgccgacaccgag 678
to top
>emb|BX008390.1|CNS08EMY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           |||||||| ||| | || |||||||| ||||| || ||||||||||||||||| ||||||
Sbjct: 818 ggtgccgaaacgcgcgccaccgagggaccgatcgtggcggacaagaactgcgagaagatc 759

             
Query: 263 ca 264
           ||
Sbjct: 758 ca 757



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 286 ctgctgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||||||| ||||| ||||||
Sbjct: 735 ctgctgtggtgccggtacggccgccgacaccgag 702
to top
>ref|XM_569684.1| Cryptococcus neoformans var. neoformans JEC21 proteasome subunit,
           beta type, 7 (CNC03530) partial mRNA
          Length = 1067

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 254 gaaaagatccattacatttcccctcanatccgctgctgtggtgccggtacggctgccga 312
           ||||||||||||||| |  ||||||| ||| | ||||||||||| ||||| ||||||||
Sbjct: 246 gaaaagatccattacttagcccctcacatcagatgctgtggtgctggtactgctgccga 304
to top
>emb|BX048088.1|CNS0999O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 498

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 221 accgagggtccgatagtagcggacaagaactgcgaaaagatcca 264
           |||||||| ||||| || ||||||||||||||||| ||||||||
Sbjct: 148 accgagggaccgatcgtggcggacaagaactgcgagaagatcca 191
to top
>emb|BX010310.1|CNS08G4A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 221 accgagggtccgatagtagcggacaagaactgcgaaaagatcca 264
           |||||||| ||||| || ||||||||||||||||| ||||||||
Sbjct: 771 accgagggaccgatcgtggcggacaagaactgcgagaagatcca 728



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 286 ctgctgtggtgccggtacggctgccgataccgag 319
           ||||||||||||||||||||| ||||| ||||||
Sbjct: 706 ctgctgtggtgccggtacggccgccgacaccgag 673
to top
>emb|BX010309.1|CNS08G49 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 435

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 221 accgagggtccgatagtagcggacaagaactgcgaaaagatcca 264
           |||||||| ||||| || ||||||||||||||||| ||||||||
Sbjct: 282 accgagggaccgatcgtggcggacaagaactgcgagaagatcca 325
to top
>gb|AY440017.1| Armigeres subalbatus ASAP ID: 43889 proteasome endopeptidase mRNA
           sequence
          Length = 600

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 203 ggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatc 262
           ||||| ||||| ||||| || ||||| || || || ||||| ||||| ||||||||||||
Sbjct: 273 ggtgctgataccagggctacggaggggccaattgtggcggataagaattgcgaaaagatc 332

                 
Query: 263 cattac 268
           ||||||
Sbjct: 333 cattac 338
to top
>ref|XM_756589.1| Ustilago maydis 521 hypothetical protein (UM05535.1) partial mRNA
          Length = 750

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 gtccttggtgccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaa 256
           ||||| |||||||||||  | || ||||| || || || || || |||||||||||||||
Sbjct: 169 gtcctcggtgccgatacacgagctaccgaaggacctatcgtggccgacaagaactgcgaa 228

                         
Query: 257 aagatccattacat 270
           |||||||| |||||
Sbjct: 229 aagatccactacat 242
to top
>ref|XM_476072.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 819

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 212 acgagggcgaccgagggtccgatagtagcggacaagaactgcga 255
           |||||||| ||||||||||| ||||| || || |||||||||||
Sbjct: 166 acgagggccaccgagggtcctatagttgctgataagaactgcga 209
to top
>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete
               sequence
          Length = 2105742

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                      
Query: 258     agatccattacatttcccctcanatccgctgctgtggtgccggtacggctgccga 312
               ||||||||||| |  ||||||| ||| | ||||||||||| ||||| ||||||||
Sbjct: 1118922 agatccattacttagcccctcacatcagatgctgtggtgctggtactgctgccga 1118868
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                           
Query: 212     acgagggcgaccgagggtccgatagtagcggacaagaactgcga 255
               |||||||| ||||||||||| ||||| || || |||||||||||
Sbjct: 5278665 acgagggccaccgagggtcctatagttgctgataagaactgcga 5278708
to top
>dbj|AK103126.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033119N09, full
           insert sequence
          Length = 1195

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 212 acgagggcgaccgagggtccgatagtagcggacaagaactgcga 255
           |||||||| ||||||||||| ||||| || || |||||||||||
Sbjct: 383 acgagggccaccgagggtcctatagttgctgataagaactgcga 426
to top
>gb|AC093954.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1097_A12,
             complete sequence
          Length = 88725

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 212   acgagggcgaccgagggtccgatagtagcggacaagaactgcga 255
             |||||||| ||||||||||| ||||| || || |||||||||||
Sbjct: 15366 acgagggccaccgagggtcctatagttgctgataagaactgcga 15409
to top
>dbj|AB026564.1| Oryza sativa (japonica cultivar-group) OsPBB1 mRNA for beta 2
           subunit of 20S proteasome, complete cds
          Length = 1122

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 212 acgagggcgaccgagggtccgatagtagcggacaagaactgcga 255
           |||||||| ||||||||||| ||||| || || |||||||||||
Sbjct: 276 acgagggccaccgagggtcctatagttgctgataagaactgcga 319
to top
>gb|AC093497.2| Drosophila melanogaster 3L BAC RP98-1H12 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 170071

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                          
Query: 206    gccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatccat 265
              ||||||||| | || |||||||| || || ||  |||||||||||||||  |||||||||
Sbjct: 105614 gccgatacgcgagccaccgagggacccattgtctcggacaagaactgcgccaagatccat 105673

                 
Query: 266    tac 268
              |||
Sbjct: 105674 tac 105676
to top
>gb|AC091209.3| Drosophila melanogaster 3L BAC RP98-3G6 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 194979

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                         
Query: 206   gccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatccat 265
             ||||||||| | || |||||||| || || ||  |||||||||||||||  |||||||||
Sbjct: 18147 gccgatacgcgagccaccgagggacccattgtctcggacaagaactgcgccaagatccat 18206

                
Query: 266   tac 268
             |||
Sbjct: 18207 tac 18209
to top
>ref|NM_079352.2| Drosophila melanogaster Proteasome 2 subunit CG3329-RA (Prosbeta2),
           mRNA
          Length = 1031

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 206 gccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatccat 265
           ||||||||| | || |||||||| || || ||  |||||||||||||||  |||||||||
Sbjct: 275 gccgatacgcgagccaccgagggacccattgtctcggacaagaactgcgccaagatccat 334

              
Query: 266 tac 268
           |||
Sbjct: 335 tac 337
to top
>gb|AY051976.1| Drosophila melanogaster LD44234 full length cDNA
          Length = 1038

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 206 gccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatccat 265
           ||||||||| | || |||||||| || || ||  |||||||||||||||  |||||||||
Sbjct: 265 gccgatacgcgagccaccgagggacccattgtctcggacaagaactgcgccaagatccat 324

              
Query: 266 tac 268
           |||
Sbjct: 325 tac 327
to top
>gb|AF025792.1|AF025792 Drosophila melanogaster 20S proteasome beta2 subunit (beta2_dm)
           gene, complete cds
          Length = 1550

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 206 gccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatccat 265
           ||||||||| | || |||||||| || || ||  |||||||||||||||  |||||||||
Sbjct: 482 gccgatacgcgagccaccgagggacccattgtctcggacaagaactgcgccaagatccat 541

              
Query: 266 tac 268
           |||
Sbjct: 542 tac 544
to top
>gb|AF025791.1|AF025791 Drosophila melanogaster 20S proteasome beta2 subunit (beta2_dm)
           mRNA, complete cds
          Length = 994

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 206 gccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatccat 265
           ||||||||| | || |||||||| || || ||  |||||||||||||||  |||||||||
Sbjct: 243 gccgatacgcgagccaccgagggacccattgtctcggacaagaactgcgccaagatccat 302

              
Query: 266 tac 268
           |||
Sbjct: 303 tac 305
to top
>gb|AE003532.3| Drosophila melanogaster chromosome 3L, section 53 of 83 of the complete
             sequence
          Length = 295875

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                         
Query: 206   gccgatacgagggcgaccgagggtccgatagtagcggacaagaactgcgaaaagatccat 265
             ||||||||| | || |||||||| || || ||  |||||||||||||||  |||||||||
Sbjct: 78700 gccgatacgcgagccaccgagggacccattgtctcggacaagaactgcgccaagatccat 78759

                
Query: 266   tac 268
             |||
Sbjct: 78760 tac 78762
to top
>ref|XM_365218.1| Magnaporthe grisea 70-15 hypothetical protein (MG01920.4) partial
            mRNA
          Length = 2982

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1    atccacatccacatcctcaccc 22
            ||||||||||||||||||||||
Sbjct: 1002 atccacatccacatcctcaccc 981
to top
>gb|DQ444460.1| Sus scrofa proteasome beta 10 subunit (PSMB10) mRNA, complete cds
          Length = 989

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 239 gcggacaagaactgcgaaaagatcca 264
           |||||||||| |||||||||||||||
Sbjct: 294 gcggacaagagctgcgaaaagatcca 319
to top
>ref|XM_691474.1| PREDICTED: Danio rerio similar to KH domain containing RNA
          binding signal transduction associated 1 like
          (LOC573666), mRNA
          Length = 2113

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 1  atccacatccacatcctcaccc 22
          ||||||||||||||||||||||
Sbjct: 30 atccacatccacatcctcaccc 9
to top
>dbj|AK062648.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-105-E04, full
           insert sequence
          Length = 1028

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 241 ggacaagaactgcgaaaagatccattacat 270
           |||||||||||| || ||||||||||||||
Sbjct: 268 ggacaagaactgtgagaagatccattacat 297
to top
>ref|XM_654597.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN2085.2), mRNA
          Length = 819

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 292 tggtgccggtacggctgccgataccgagttcac 324
           |||||| ||||| ||||| ||||||||||||||
Sbjct: 219 tggtgctggtacagctgctgataccgagttcac 251
to top
>gb|AE017140.1| Yersinia pestis biovar Medievalis str. 91001 section 14 of 16 of the
             complete genome
          Length = 290393

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 360   ctctcggcaccggtcgcaaa 379
             ||||||||||||||||||||
Sbjct: 52249 ctctcggcaccggtcgcaaa 52230
to top
>gb|AC009909.6| Drosophila melanogaster clone BACR30P05, complete sequence
          Length = 171772

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 1     atccacatccacatcctcacccat 24
             ||||||||||||||||||| ||||
Sbjct: 68047 atccacatccacatcctcatccat 68024
to top
>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 360     ctctcggcaccggtcgcaaa 379
               ||||||||||||||||||||
Sbjct: 3747028 ctctcggcaccggtcgcaaa 3747009
to top
>emb|AL928921.21| Human DNA sequence from clone RP13-392I16 on chromosome 1, complete
              sequence
          Length = 142916

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 10     cacatcctcacccatgtctaccaa 33
              |||||||||||||||| |||||||
Sbjct: 123913 cacatcctcacccatgcctaccaa 123890
to top
>ref|XM_501440.1| Yarrowia lipolytica CLIB122, YALI0C04411g predicted mRNA
          Length = 1710

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 445 tgctgctctcgttctgggtg 464
           ||||||||||||||||||||
Sbjct: 759 tgctgctctcgttctgggtg 778
to top
>emb|BX007235.1|CNS08DQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 294 gtgccggtacggctgccgat 313
           ||||||||||||||||||||
Sbjct: 626 gtgccggtacggctgccgat 607
to top
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 360     ctctcggcaccggtcgcaaa 379
               ||||||||||||||||||||
Sbjct: 3937023 ctctcggcaccggtcgcaaa 3937042
to top
>emb|AJ414145.1| Yersinia pestis strain CO92 complete genome; segment 5/20
          Length = 208050

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 360    ctctcggcaccggtcgcaaa 379
              ||||||||||||||||||||
Sbjct: 207938 ctctcggcaccggtcgcaaa 207919
to top
>gb|AC023725.5| Drosophila melanogaster X BAC RP98-9I10 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 165928

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 1      atccacatccacatcctcacccatgtct 28
              |||||||||||||||| || ||||||||
Sbjct: 107227 atccacatccacatccacatccatgtct 107200
to top
>gb|AE005853.1| Caulobacter crescentus CB15 section 179 of 359 of the complete genome
          Length = 12095

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 93   cgtcctcggccggcgtcagc 112
            ||||||||||||||||||||
Sbjct: 8685 cgtcctcggccggcgtcagc 8704
to top
>gb|AC105352.2| Drosophila melanogaster X BAC RP98-45O17 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 172784

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 1      atccacatccacatcctcacccatgtct 28
              |||||||||||||||| || ||||||||
Sbjct: 142237 atccacatccacatccacatccatgtct 142210
to top
>gb|AC107403.6| Drosophila melanogaster X BAC RP98-21M21 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 181831

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 1      atccacatccacatcctcacccatgtct 28
              |||||||||||||||| || ||||||||
Sbjct: 161630 atccacatccacatccacatccatgtct 161657
to top
>tpg|BK003291.1| TPA: TPA_inf: Drosophila melanogaster HDC00427 (HDC00427) gene,
            complete cds
          Length = 1410

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 1    atccacatccacatcctcacccat 24
            ||||||||||||||||||| ||||
Sbjct: 1100 atccacatccacatcctcatccat 1077
to top
>gb|AC023687.3| Drosophila melanogaster X BAC RP98-36C7 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 185848

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     atccacatccacatcctcacccat 24
             |||||||||||||||| |||||||
Sbjct: 47215 atccacatccacatccacacccat 47238
to top
>gb|L80131.1|DRO71DC60Z Drosophila melanogaster (subclone D71 2_e1 from P1 DS02782) DNA
           sequence
          Length = 3321

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 1   atccacatccacatcctcacccat 24
           ||||||||||||||||||| ||||
Sbjct: 781 atccacatccacatcctcatccat 804
to top
>gb|AE003582.4| Drosophila melanogaster chromosome 2L, section 9 of 83 of the complete
             sequence
          Length = 295132

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 1     atccacatccacatcctcacccat 24
             ||||||||||||||||||| ||||
Sbjct: 90905 atccacatccacatcctcatccat 90882
to top
>gb|AE003488.3| Drosophila melanogaster chromosome X, section 40 of 74 of the complete
              sequence
          Length = 315134

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 1      atccacatccacatcctcacccat 24
              |||||||||||||||| |||||||
Sbjct: 302923 atccacatccacatccacacccat 302900
to top
>gb|AE003429.4| Drosophila melanogaster chromosome X, section 13 of 74 of the complete
              sequence
          Length = 326403

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 1      atccacatccacatcctcacccatgtct 28
              |||||||||||||||| || ||||||||
Sbjct: 322184 atccacatccacatccacatccatgtct 322211
to top
>gb|AC002444.1|AC002444 Drosophila melanogaster (P1 DS02782 (D71)) DNA sequence, complete
             sequence
          Length = 80124

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     atccacatccacatcctcacccat 24
             ||||||||||||||||||| ||||
Sbjct: 24837 atccacatccacatcctcatccat 24860
to top
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 445    tgctgctctcgttctgggtg 464
              ||||||||||||||||||||
Sbjct: 589370 tgctgctctcgttctgggtg 589389


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,687,045
Number of Sequences: 3902068
Number of extensions: 2687045
Number of successful extensions: 63321
Number of sequences better than 10.0: 73
Number of HSP's better than 10.0 without gapping: 73
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63104
Number of HSP's gapped (non-prelim): 213
length of query: 499
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 477
effective length of database: 17,147,199,772
effective search space: 8179214291244
effective search space used: 8179214291244
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top