Clone Name | bart08h04 |
---|---|
Clone Library Name | barley_pub |
>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence Length = 439641 Score = 93.7 bits (47), Expect = 2e-16 Identities = 58/62 (93%) Strand = Plus / Minus Query: 79 aagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtnaag 138 ||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||| ||| Sbjct: 233597 aagatgaagaccatcctggcgtcggagacaatggagatcctggaggaggtgacggtgaag 233538 Query: 139 gt 140 || Sbjct: 233537 gt 233536 Score = 85.7 bits (43), Expect = 5e-14 Identities = 57/62 (91%) Strand = Plus / Minus Query: 79 aagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtnaag 138 ||||||||||||||||||||||||||||| ||||| |||| |||||||||||| || ||| Sbjct: 343452 aagatgaagaccatcctggcgtcggagacaatggagatcctggaggaggtgacagtgaag 343393 Query: 139 gt 140 || Sbjct: 343392 gt 343391
>gb|AY323481.1| Oryza sativa (japonica cultivar-group) ribosomal L9-like protein mRNA, complete cds Length = 797 Score = 89.7 bits (45), Expect = 3e-15 Identities = 54/57 (94%) Strand = Plus / Plus Query: 78 gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||| Sbjct: 59 gaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacggt 115
>gb|AY072817.1| Oryza sativa ARE1 mRNA, partial cds Length = 218 Score = 89.7 bits (45), Expect = 3e-15 Identities = 54/57 (94%) Strand = Plus / Plus Query: 78 gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||| Sbjct: 59 gaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacggt 115
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 89.7 bits (45), Expect = 3e-15 Identities = 54/57 (94%) Strand = Plus / Minus Query: 78 gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||| Sbjct: 18585048 gaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacggt 18584992
>gb|BT016560.1| Zea mays clone Contig393 mRNA sequence Length = 747 Score = 83.8 bits (42), Expect = 2e-13 Identities = 45/46 (97%) Strand = Plus / Plus Query: 79 aagatgaagaccatcctggcgtcggagacgatggacatcccggagg 124 ||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 45 aagatgaagacgatcctggcgtcggagacgatggacatcccggagg 90
>gb|AY104547.1| Zea mays PCO113533 mRNA sequence Length = 927 Score = 83.8 bits (42), Expect = 2e-13 Identities = 45/46 (97%) Strand = Plus / Plus Query: 79 aagatgaagaccatcctggcgtcggagacgatggacatcccggagg 124 ||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 126 aagatgaagacgatcctggcgtcggagacgatggacatcccggagg 171
>dbj|D29705.1|RICYK17 Oryza sativa mRNA, partial homologous to GAmRNA (cloneF) Length = 207 Score = 81.8 bits (41), Expect = 7e-13 Identities = 53/57 (92%) Strand = Plus / Plus Query: 78 gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||||||||||||||||| ||||||||||| |||||||||| |||||||| Sbjct: 64 gaagatgaagaccatcctggcgtccgagacgatggagatcccggagggtgtgacggt 120
>dbj|AK064936.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000P02, full insert sequence Length = 886 Score = 81.8 bits (41), Expect = 7e-13 Identities = 53/57 (92%) Strand = Plus / Plus Query: 78 gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||||||||||||||| | ||||||||||| |||||||||| ||||||||| Sbjct: 76 gaagatgaagaccatcctggcgcccgagacgatggagatcccggagggggtgacggt 132
>dbj|D83527.1|RICGA3 Rice (YK426) mRNA, complete cds Length = 816 Score = 81.8 bits (41), Expect = 7e-13 Identities = 53/57 (92%) Strand = Plus / Plus Query: 78 gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||||||||||||||||| ||||||||||| |||||||||| | ||||||| Sbjct: 72 gaagatgaagaccatcctggcgtccgagacgatggagatcccggaggggttgacggt 128
>gb|AY107309.1| Zea mays PCO113532 mRNA sequence Length = 1063 Score = 79.8 bits (40), Expect = 3e-12 Identities = 81/95 (85%) Strand = Plus / Plus Query: 82 atgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtnaaggtg 141 ||||||||||||||||| ||||||||||||||||||| |||| ||| ||||| | |||| Sbjct: 154 atgaagaccatcctggccacggagacgatggacatccccgagggggtcacggtcacggtg 213 Query: 142 tcggccaagatgatctcggtgacggggccgcgcgg 176 |||||||| || | ||||| |||||||||||| Sbjct: 214 gcggccaagctggtgacggtggaggggccgcgcgg 248
>gb|BT016425.1| Zea mays clone Contig258 mRNA sequence Length = 1002 Score = 71.9 bits (36), Expect = 7e-10 Identities = 80/95 (84%) Strand = Plus / Plus Query: 82 atgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtnaaggtg 141 ||||||||||||||||| | ||||||||||||||||| |||| ||| ||||| | |||| Sbjct: 57 atgaagaccatcctggccaccgagacgatggacatccccgagggggtcacggtcacggtg 116 Query: 142 tcggccaagatgatctcggtgacggggccgcgcgg 176 |||||||| || | ||||| |||||||||||| Sbjct: 117 gcggccaagctggtgacggtggaggggccgcgcgg 151
>ref|XM_463799.1| Oryza sativa (japonica cultivar-group), mRNA Length = 823 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||| ||| |||| |||||||||||||| |||||| || ||||||||| Sbjct: 80 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 134
>ref|XM_506675.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1435_F07.31 mRNA Length = 914 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||| ||| |||| |||||||||||||| |||||| || ||||||||| Sbjct: 85 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 139
>gb|AY020397.1| Oryza sativa microsatellite MRG2722 containing (GA)X16, genomic sequence Length = 232 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||| ||| |||| |||||||||||||| |||||| || ||||||||| Sbjct: 138 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 192
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||| ||| |||| |||||||||||||| |||||| || ||||||||| Sbjct: 183357 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 183303
>dbj|AP004187.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1435_F07 Length = 139041 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||| ||| |||| |||||||||||||| |||||| || ||||||||| Sbjct: 132384 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 132330
>dbj|AK102186.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086N17, full insert sequence Length = 914 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||| ||| |||| |||||||||||||| |||||| || ||||||||| Sbjct: 85 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 139
>dbj|AK062502.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-A12, full insert sequence Length = 823 Score = 54.0 bits (27), Expect = 2e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134 |||||||||| ||| |||| |||||||||||||| |||||| || ||||||||| Sbjct: 80 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 134
>gb|AY910750.1| Gallus gallus glycerophosphodiester phosphodiesterase 2 (GDE2) mRNA, complete cds Length = 4525 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Plus Query: 83 tgaagaccatcctggcgtcgg 103 ||||||||||||||||||||| Sbjct: 1265 tgaagaccatcctggcgtcgg 1285
>ref|XM_424003.1| PREDICTED: Gallus gallus similar to hypothetical protein PP1665 (LOC426346), partial mRNA Length = 394 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Plus Query: 83 tgaagaccatcctggcgtcgg 103 ||||||||||||||||||||| Sbjct: 195 tgaagaccatcctggcgtcgg 215
>gb|AY567837.1| Homo sapiens adrenergic, beta-1-, receptor (ADRB1) gene, complete cds Length = 16612 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 gaagatgaagaccatcctggc 98 ||||||||||||||||||||| Sbjct: 14000 gaagatgaagaccatcctggc 13980
>emb|AL390760.25| Human DNA sequence from clone RP11-370F5 on chromosome 9 Contains the 3' emd of novel gene (MGC11115), the NINJ1 gene for ninjurin 1, a novel gene, the 5' end of the PRKWNK2 gene for protein kinase, lysine deficient 2 (WNK2, NY-CO-43, SDCCAG43, P/OKcl.13) and two CpG islands, complete sequence Length = 175797 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 gaagatgaagaccatcctggc 98 ||||||||||||||||||||| Sbjct: 71406 gaagatgaagaccatcctggc 71386
>gb|AY130860.1| Homo sapiens SCDK4-binding protein p34SEI1 (SEI1) gene, complete cds Length = 5917 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 gaagatgaagaccatcctggc 98 ||||||||||||||||||||| Sbjct: 5913 gaagatgaagaccatcctggc 5893
>gb|AC010271.8| Homo sapiens chromosome 19 clone CTC-492K19, complete sequence Length = 160643 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 gaagatgaagaccatcctggc 98 ||||||||||||||||||||| Sbjct: 117311 gaagatgaagaccatcctggc 117331
>dbj|AK074652.1| Homo sapiens cDNA FLJ90171 fis, clone MAMMA1000403, highly similar to Homo sapiens CDK4-binding protein p34SEI1 (SEI1) mRNA Length = 2113 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 gaagatgaagaccatcctggc 98 ||||||||||||||||||||| Sbjct: 1768 gaagatgaagaccatcctggc 1748
>gb|AC025164.37| Homo sapiens 12 BAC RP11-796E2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 216841 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 gaagatgaagaccatcctggc 98 ||||||||||||||||||||| Sbjct: 114852 gaagatgaagaccatcctggc 114872
>gb|AC005886.2|AC005886 b240g16, complete sequence Length = 134011 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 gaagatgaagaccatcctggc 98 ||||||||||||||||||||| Sbjct: 19593 gaagatgaagaccatcctggc 19613
>ref|NM_001037271.1| Gallus gallus glycerophosphodiester phosphodiesterase domain containing 5 (GDPD5), mRNA Length = 4525 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Plus Query: 83 tgaagaccatcctggcgtcgg 103 ||||||||||||||||||||| Sbjct: 1265 tgaagaccatcctggcgtcgg 1285
>emb|AL355543.13| Human DNA sequence from clone RP11-86E10 on chromosome 10 Contains the ADRB1 gene for adrenergic beta-1- receptor, a ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1) pseudogene, the gene for CTCL tumor antigen L14-2 (FLJ10188 DKFZp762M1412 FLJ32946 FLJ37179 FLJ21086 FLJ32946 FLJ35301), the 5' end of the TDRD1 gene for tudor domain containing 1 and three CpG islands, complete sequence Length = 179009 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 gaagatgaagaccatcctggc 98 ||||||||||||||||||||| Sbjct: 42366 gaagatgaagaccatcctggc 42346
>emb|AJ343217.1|HSA343217 Homo sapiens genomic sequence surrounding NotI site, clone NB6-706R Length = 1188 Score = 42.1 bits (21), Expect = 0.62 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 gaagatgaagaccatcctggc 98 ||||||||||||||||||||| Sbjct: 542 gaagatgaagaccatcctggc 562
>gb|AC005353.1| Homo sapiens chromosome 5, BAC clone 24p24 (LBNL H195), complete sequence Length = 87114 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 aagatgaagaccatcctggc 98 |||||||||||||||||||| Sbjct: 79599 aagatgaagaccatcctggc 79580
>gb|AC006372.2| Homo sapiens BAC clone RP11-331D5 from 7, complete sequence Length = 190846 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggcg 99 |||||||||||||||||||| Sbjct: 47157 agatgaagaccatcctggcg 47176
>emb|CR732637.2|CNS0GS8Y Tetraodon nigroviridis full-length cDNA Length = 1330 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 atcccggaggaggtgacggt 134 |||||||||||||||||||| Sbjct: 344 atcccggaggaggtgacggt 363
>emb|CR730462.2|CNS0GQKJ Tetraodon nigroviridis full-length cDNA Length = 1057 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 atcccggaggaggtgacggt 134 |||||||||||||||||||| Sbjct: 343 atcccggaggaggtgacggt 362
>emb|CR727111.2|CNS0GNZH Tetraodon nigroviridis full-length cDNA Length = 1062 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 atcccggaggaggtgacggt 134 |||||||||||||||||||| Sbjct: 343 atcccggaggaggtgacggt 362
>emb|CR724397.2|CNS0GLW3 Tetraodon nigroviridis full-length cDNA Length = 1341 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 atcccggaggaggtgacggt 134 |||||||||||||||||||| Sbjct: 345 atcccggaggaggtgacggt 364
>emb|CR724259.2|CNS0GLS9 Tetraodon nigroviridis full-length cDNA Length = 1010 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 atcccggaggaggtgacggt 134 |||||||||||||||||||| Sbjct: 303 atcccggaggaggtgacggt 322
>emb|CR723898.2|CNS0GLI8 Tetraodon nigroviridis full-length cDNA Length = 1056 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 atcccggaggaggtgacggt 134 |||||||||||||||||||| Sbjct: 343 atcccggaggaggtgacggt 362
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggcg 99 |||||||||||||||||||| Sbjct: 1524257 agatgaagaccatcctggcg 1524276
>gb|AC020894.5| Homo sapiens chromosome 5 clone CTC-293A9, complete sequence Length = 166983 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 aagatgaagaccatcctggc 98 |||||||||||||||||||| Sbjct: 77580 aagatgaagaccatcctggc 77599
>gb|AC135610.5| Pan troglodytes clone rp43-11n14, complete sequence Length = 154701 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 aagatgaagaccatcctggc 98 |||||||||||||||||||| Sbjct: 149508 aagatgaagaccatcctggc 149489
>gb|AC093259.2| Homo sapiens chromosome 5 clone RP11-229C3, complete sequence Length = 183380 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 aagatgaagaccatcctggc 98 |||||||||||||||||||| Sbjct: 54131 aagatgaagaccatcctggc 54150
>gb|AC106886.3| Homo sapiens chromosome 16 clone RP11-2C24, complete sequence Length = 207950 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 aagatgaagaccatcctggc 98 |||||||||||||||||||| Sbjct: 81101 aagatgaagaccatcctggc 81082 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 96766 agatgaagaccatcctggc 96748
>gb|AC093249.4| Homo sapiens chromosome 16 clone RP11-146F11, complete sequence Length = 185664 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 aagatgaagaccatcctggc 98 |||||||||||||||||||| Sbjct: 4940 aagatgaagaccatcctggc 4959
>emb|AL136296.3|CNS01DW0 Human chromosome 14 DNA sequence BAC R-588D7 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 192404 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 aagatgaagaccatcctggc 98 |||||||||||||||||||| Sbjct: 186062 aagatgaagaccatcctggc 186043
>emb|AL163151.1|CNS01RIC Human chromosome 14 DNA sequence BAC R-138H18 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 150572 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 aagatgaagaccatcctggc 98 |||||||||||||||||||| Sbjct: 142895 aagatgaagaccatcctggc 142914
>ref|XM_550647.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2274 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 4 accctcgcctcctcccccc 22 ||||||||||||||||||| Sbjct: 203 accctcgcctcctcccccc 221
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 157 tcggtgacggggccgcgcg 175 ||||||||||||||||||| Sbjct: 1013460 tcggtgacggggccgcgcg 1013478
>gb|DP000014.1| Callithrix jacchus target 1 genomic scaffold Length = 1952403 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 864934 agatgaagaccatcctggc 864916
>gb|AC005593.1| Homo sapiens chromosome 5, P1 clone 1369f10 (LBNL H28), complete sequence Length = 83666 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 33028 agatgaagaccatcctggc 33010
>ref|NG_002433.1| Homo sapiens major histocompatibility complex, class II, DR53 haplotype (DR53) on chromosome 6 Length = 150447 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 141217 agatgaagaccatcctggc 141199
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 4 accctcgcctcctcccccc 22 ||||||||||||||||||| Sbjct: 4091680 accctcgcctcctcccccc 4091662
>gb|AC163737.3| Pan troglodytes BAC clone CH251-547O12 from chromosome 6, complete sequence Length = 207116 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 206107 agatgaagaccatcctggc 206125
>gb|AC183296.3| Pan troglodytes BAC clone CH251-352A17 from chromosome 19, complete sequence Length = 180482 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 19132 agatgaagaccatcctggc 19114
>gb|AC185247.2| Pan troglodytes BAC clone CH251-7D5 from chromosome 15, complete sequence Length = 175295 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 166007 agatgaagaccatcctggc 166025
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 157 tcggtgacggggccgcgcg 175 ||||||||||||||||||| Sbjct: 2979476 tcggtgacggggccgcgcg 2979494
>gb|AC146113.3| Pan troglodytes BAC clone RP43-5I6 from 7, complete sequence Length = 223155 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 221458 agatgaagaccatcctggc 221440
>gb|AC182396.3| Pan troglodytes BAC clone CH251-244D19 from chromosome 16, complete sequence Length = 175231 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 26447 agatgaagaccatcctggc 26465
>gb|AC160564.2| Pan troglodytes BAC clone CH251-542C24 from chromosome 5, complete sequence Length = 177047 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 40757 agatgaagaccatcctggc 40739
>gb|AY596305.1| Chlamydomonas reinhardtii cell wall protein GP2 (GP2) mRNA, partial cds Length = 4218 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 ccctcgcctcctcccccct 23 ||||||||||||||||||| Sbjct: 2776 ccctcgcctcctcccccct 2794
>gb|AF235103.5| Homo sapiens chromosome 8 multiple clones map q24.3, complete sequence Length = 345524 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 147466 agatgaagaccatcctggc 147484
>gb|AF130343.2| Homo sapiens chromosome 8 multiple clones map q23.3, complete sequence Length = 292718 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 49825 agatgaagaccatcctggc 49843
>gb|AF233439.7| Homo sapiens chromosome 8 clones GS1-24F4, CTD-2629I16 map p23.1, complete sequences Length = 231283 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 98740 agatgaagaccatcctggc 98758
>gb|AF205406.5| Homo sapiens chromosome 8 clone SCb-633e22 map p23.1, complete sequence Length = 168907 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 51419 agatgaagaccatcctggc 51437
>gb|AF298854.5| Homo sapiens chromosome 8 clone SCb-207i3 map p23.1, complete sequence Length = 110283 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 61447 agatgaagaccatcctggc 61465
>gb|AC183680.3| Pan troglodytes BAC clone CH251-425K14 from chromosome 9, complete sequence Length = 163619 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 26319 agatgaagaccatcctggc 26301
>gb|AC157088.2| Pan troglodytes BAC clone CH251-497H13 from chromosome unknown, complete sequence Length = 220527 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 197754 agatgaagaccatcctggc 197772
>gb|AF254983.3| Homo sapiens chromosome 21 clone RP11-589M2 map p11-q21.1, complete sequence Length = 190711 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 54196 agatgaagaccatcctggc 54178
>gb|AC005531.2| Homo sapiens PAC clone RP4-701O16 from 7, complete sequence Length = 161910 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 80339 agatgaagaccatcctggc 80357
>gb|AC147336.2| Pan troglodytes BAC clone CH251-70I12 from Y, complete sequence Length = 194849 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 105774 agatgaagaccatcctggc 105792
>gb|AY261359.1| Bovine herpesvirus 5 strain SV507/99, complete genome Length = 138390 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 114 catcccggaggaggtgacg 132 ||||||||||||||||||| Sbjct: 33647 catcccggaggaggtgacg 33629
>gb|AC146252.3| Pan troglodytes BAC clone RP43-31D18 from 7, complete sequence Length = 155242 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 36077 agatgaagaccatcctggc 36095
>gb|AC131649.2| Homo sapiens chromosome 16 clone RP11-609N14, complete sequence Length = 182518 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 135472 agatgaagaccatcctggc 135490
>gb|AF030876.2| Homo sapiens chromosome X clone Qc-8D3, RP4-671D9, I104-219D, L110-C1837 map q28, complete sequence Length = 112752 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 71458 agatgaagaccatcctggc 71476
>gb|AC127381.4| Homo sapiens BAC clone RP11-1360M22 from UL, complete sequence Length = 241627 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 214288 agatgaagaccatcctggc 214306
>gb|AC026882.6| Homo sapiens chromosome 3 clone RP11-211K13 map 3p, complete sequence Length = 162422 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 15897 agatgaagaccatcctggc 15915
>gb|AC146133.3| Pan troglodytes BAC clone RP43-38C10 from 7, complete sequence Length = 168763 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 29358 agatgaagaccatcctggc 29340
>gb|AC093582.3| Homo sapiens BAC clone RP13-254B10 from 7, complete sequence Length = 91224 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 47290 agatgaagaccatcctggc 47308
>gb|AC005589.1| Homo sapiens BAC clone RP11-161H12 from 7, complete sequence Length = 132077 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 73720 agatgaagaccatcctggc 73738
>gb|AC095044.3| Homo sapiens BAC clone RP11-132B16 from 7, complete sequence Length = 134184 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 62013 agatgaagaccatcctggc 61995
>gb|AC006333.3| Homo sapiens BAC clone RP11-390E23 from 7, complete sequence Length = 187532 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 102492 agatgaagaccatcctggc 102474
>gb|AC073330.6| Homo sapiens BAC clone RP11-409J21 from 7, complete sequence Length = 155704 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 62251 agatgaagaccatcctggc 62269
>gb|AC006088.1| Homo sapiens 12q24.1 PAC RP1-305I20 (Roswell Park Cancer Institute Human PAC Library) complete sequence Length = 122605 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 21565 agatgaagaccatcctggc 21583
>gb|AC145773.1| Pan troglodytes BAC clone RP43-32M11 from 7, complete sequence Length = 190630 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 131724 agatgaagaccatcctggc 131742
>emb|AL034420.16|HS1112F19 Human DNA sequence from clone RP5-1112F19 on chromosome 20q13.13-13.2 Contains the SALL4 gene for sal-like 4 (Drosophila)and a putative CpG island, complete sequence Length = 116368 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 29743 agatgaagaccatcctggc 29725
>emb|Z94161.5|HSN102C10 Human DNA sequence from clone LL22NC03-102C10 on chromosome 22q13 Contains the first exon of the PPARA gene for peroxisome proliferative activated receptor alpha, an EST, GSSs and a putative CpG island, complete sequence Length = 44134 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 6626 agatgaagaccatcctggc 6608
>emb|Z82182.2|HSE90C2 Human DNA sequence from clone LL22NC01-90C2 on chromosome 22 Contains an STSs and GSSs, complete sequence Length = 39004 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 33797 agatgaagaccatcctggc 33779
>gb|AC183832.3| Pan troglodytes BAC clone CH251-260G12 from chromosome 7, complete sequence Length = 179012 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 48814 agatgaagaccatcctggc 48832
>emb|AL390248.10| Human DNA sequence from clone RP11-492M23 on chromosome 10 Contains the gene for a novel protein and a ribosomal protein L21 (RPL21)(L21) pseudogene, complete sequence Length = 125798 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 85305 agatgaagaccatcctggc 85323
>emb|BX296568.4| Human DNA sequence from clone DASS-233C19 on chromosome 6, complete sequence Length = 87738 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 53900 agatgaagaccatcctggc 53882
>emb|BX293535.3| Human DNA sequence from clone RP4-752I6 on chromosome 1 Contains the 5' end of the WASF2 gene for WAS protein family, member 2 and a novel gene, complete sequence Length = 71971 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 14030 agatgaagaccatcctggc 14048
>emb|AL607035.12| Human DNA sequence from clone RP11-570G20 on chromosome 10 Contains a ribosomal protein L15 (RPL15) pseudogene, the 5' end of a novel gene (CGI-18), a novel gene and a CpG island, complete sequence Length = 71903 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 17861 agatgaagaccatcctggc 17843
>emb|AL591543.22| Human DNA sequence from clone RP13-198D9 on chromosome 9 Contains a novel gene (KIAA2015), a novel gene, a tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide (YWHAB) pseudogene and two CpG islands, complete sequence Length = 179501 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 158682 agatgaagaccatcctggc 158664
>emb|AL592525.10| Human DNA sequence from clone RP11-111G23 on chromosome 9 Contains a pseudogene similar to part of contactin associated protein-like 3 (CNTNAP3) and a pseudogene similar to part of vomeronasal 2 family, complete sequence Length = 142805 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 103418 agatgaagaccatcctggc 103436
>emb|AL590683.16| Human DNA sequence from clone RP11-10N16 on chromosome 1 Contains the 5' end of the IL22RA1 gene for interleukin 22 receptor alpha 1, the IL28RA gene for interleukin 28 receptor alpha (interferon, lambda receptor), a novel gene and the 3' end of a novel gene, complete sequence Length = 164684 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 13524 agatgaagaccatcctggc 13542
>gb|AC183767.2| Pan troglodytes BAC clone CH251-373L9 from chromosome 9, complete sequence Length = 162355 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 130360 agatgaagaccatcctggc 130342
>emb|AL450364.12| Human DNA sequence from clone RP11-499P20 on chromosome 10 Contains part of the CACNB2 gene for calcium channel voltage-dependent beta 2 subunit and the 3' end of a novel gene, complete sequence Length = 38089 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 22126 agatgaagaccatcctggc 22144
>emb|AL449266.17| Human DNA sequence from clone RP11-475E11 on chromosome 1 Contains the 3' end of the STXBP3 gene for syntaxin binding protein 3, a novel gene (MGC26989), a novel gene, the gene for LGN protein, the gene for Mid-1-related chloride channel 1 (MCLC) and the 3' end of novel gene (KIAA0893), complete sequence Length = 182553 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 62231 agatgaagaccatcctggc 62213
>emb|AL390065.20| Human DNA sequence from clone RP11-520M5 on chromosome 4, complete sequence Length = 157119 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 15983 agatgaagaccatcctggc 16001
>emb|AL365364.19| Human DNA sequence from clone RP11-624L12 on chromosome 10 Contains a ribosomal protein L17 (RPL17) pseudogene and the 3'end of the FER1L3 gene for fer-1-like 3, myoferlin (C. elegans), complete sequence Length = 173864 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 18765 agatgaagaccatcctggc 18747
>emb|AL365357.12| Human DNA sequence from clone RP4-765C7 on chromosome 1 Contains part of the RASAL2 gene for RAS protein activator like 2, a novel gene and a ribosomal protein S14 (RPS14) pseudogene, complete sequence Length = 108288 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 25598 agatgaagaccatcctggc 25616
>emb|AL390298.13| Human DNA sequence from clone RP11-75I24 on chromosome 20 Contains ESTs, STSs and GSSs, complete sequence Length = 49208 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 43019 agatgaagaccatcctggc 43001
>emb|AL365356.13| Human DNA sequence from clone RP11-336A10 on chromosome 10 Contains the ASB13 gene for ankyrin repeat and SOCS box-containing 13, the 5' end of gene FLJ20360 (KIAA2006 FLJ34073 FLJ12904 FLJ23361 FLJ21109), three novel genes, a ribosomal protein L23a (RPL23A) pseudogene, the 5' end of a novel gene and two CpG islands, complete sequence Length = 167676 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 80497 agatgaagaccatcctggc 80479
>emb|AL390917.12| Human DNA sequence from clone RP11-247O12 on chromosome X, complete sequence Length = 20318 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 1382 agatgaagaccatcctggc 1400
>emb|AL390071.9| Human DNA sequence from clone RP11-98D3 on chromosome 13 Contains part of the NEAB gene for neurobeachin (BCL8B FLJ10197 KIAA1544), the MAB21L1 gene for mab-21-like 1 (C. elegans) (CAGR1) and three CpG islands, complete sequence Length = 170998 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 16885 agatgaagaccatcctggc 16903
>emb|AL359180.17| Human DNA sequence from clone RP11-320G21 on chromosome 13, complete sequence Length = 159229 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 142994 agatgaagaccatcctggc 143012
>emb|AL359380.16| Human DNA sequence from clone RP11-642N5 on chromosome 6 Contains the 3' end of a novel gene and the 5' end of the TINAG gene for tubulointerstitial nephritis antigen, complete sequence Length = 188826 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 60954 agatgaagaccatcctggc 60972 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 49876 agatgaagaccatcctggc 49894
>emb|AL357974.16| Human DNA sequence from clone RP11-398M15 on chromosome 1 Contains a novel gene, complete sequence Length = 93165 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 90744 agatgaagaccatcctggc 90726
>emb|AL358875.13| Human DNA sequence from clone RP11-312H18 on chromosome 1, complete sequence Length = 171635 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 30029 agatgaagaccatcctggc 30047
>gb|AC012046.11| Homo sapiens chromosome 10 clone RP11-312P12, complete sequence Length = 198781 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 78843 agatgaagaccatcctggc 78861
>emb|AL355529.21| Human DNA sequence from clone RP11-85C15 on chromosome 10 Contains the 5' end of the MKI67 gene for antigen identified by monoclonal antibody Ki-67 and three CpG islands, complete sequence Length = 140466 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 98550 agatgaagaccatcctggc 98532
>emb|AL353622.33| Human DNA sequence from clone RP5-1092A3 on chromosome 1 Contains the 5' end of the DNAJC8 gene for DnaJ (Hsp40) homolog subfamily C member 8, the ATPIF1 gene for ATPase inhibitory factor 1, the SESN2 gene for sestrin 2, the gene for a novel protein (FLJ20045) and a CpG island, complete sequence Length = 157243 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 116370 agatgaagaccatcctggc 116352
>emb|AL353729.17| Human DNA sequence from clone RP11-290L7 on chromosome 9 Contains the 3' end of the CNTNAP3 gene for contactin associated protein-like 3, a TGF beta-inducible nuclear protein 1 (TINP1) pseudogene and a RNA binding motif protein 17 (RBM17) pseudogene, complete sequence Length = 195668 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 162623 agatgaagaccatcctggc 162641
>emb|AL354857.13| Human DNA sequence from clone RP11-346N8 on chromosome 6 Contains the 3' end of the EPHA7 gene for ephrin receptor A7, complete sequence Length = 199223 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 13550 agatgaagaccatcctggc 13568
>emb|AL353791.7| Human DNA sequence from clone RP11-475B17 on chromosome 9 Contains the 3' end of novel protein similar to contactin associated protein-like 3 (CNTNAP3) and a pseudogene similar to part of vomeronasal 2 family, complete sequence Length = 208233 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 52915 agatgaagaccatcctggc 52933
>emb|AL353626.5| Human DNA sequence from clone RP11-318K12 on chromosome 9 Contains a novel gene, a pseudogene similar to part of membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125) (M17S2), a pseudogene similar to part of novel gene (ankyrin-related UNQ2430) and a CpG island, complete sequence Length = 176470 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 68583 agatgaagaccatcctggc 68601
>emb|AL353895.4| Human DNA sequence from clone RP11-503K16 on chromosome 9 Contains the 3' end of the ADAMTSL1 gene for ADAMTS-like (ADAMTSR1, MGC40139) and a ras-related protein family pseudogene, complete sequence Length = 163163 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 107147 agatgaagaccatcctggc 107129
>emb|AL161450.14| Human DNA sequence from clone RP11-39K24 on chromosome 9 Contains the 3' end of the JAK2 gene for Janus kinase 2 (a protein tyrosine kinase), a casein kinase pseudogene, a trans-prenyltransferase (TPT) pseudogene, a NADH dehydrogenase 6 (MTND6) pseuodgene, a NADH dehydrogenase 1 (MTND1) pseudogene, a cytochrome c oxidase I (MTCO1) pseudogene, a cytochrome c oxidase II (MTCO2) pseudogene, an ATP synthase 6 (MTATP6) pseudogene, a cytochrome c oxidase III (MTCO3) pseudogene, a NADH dehydrogenase 4 (MTND4)pseudogene, a pseudogene similar to part of NADH dehydrogenase 5 (MTND5), a transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) (TCF3) pseudogene, an immunoglobulin heavy constant epsilon pseudogene 2 (IGHEP2), a novel gene, the INSL6 gene for insulin-like 6 (RIF1) and 4 CpG islands, complete sequence Length = 171146 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 80211 agatgaagaccatcctggc 80193
>gb|AC183286.3| Pan troglodytes BAC clone CH251-56I13 from chromosome 15, complete sequence Length = 164317 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 88636 agatgaagaccatcctggc 88654
>emb|AL159158.12| Human DNA sequence from clone RP11-81G4 on chromosome 13 Contains the 5' end of a novel gene (KIAA0916) and two CpG islands, complete sequence Length = 154682 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 36768 agatgaagaccatcctggc 36786
>emb|AL139801.17| Human DNA sequence from clone RP11-247M1 on chromosome 13 Contains a novel FLJ21562 containing gene, a novel gene, a novel pseudogene and a CpG island, complete sequence Length = 145481 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 77449 agatgaagaccatcctggc 77431
>emb|AL139350.17| Human DNA sequence from clone RP11-307O10 on chromosome 20 Contains part of a novel gene, an EST, an STS and GSSs, complete sequence Length = 181585 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 135429 agatgaagaccatcctggc 135447
>gb|AC091134.7| Homo sapiens chromosome 17, clone RP11-646F1, complete sequence Length = 156583 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 78354 agatgaagaccatcctggc 78336
>emb|AL157782.8| Human DNA sequence from clone RP11-127E22 on chromosome 10 Contains part of a novel gene (LOC196051), complete sequence Length = 46185 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 17660 agatgaagaccatcctggc 17678
>emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chromosome 9 Contains the 5' end of the gene for coiled-coil protein (BICD2) (KIAA0699), a novel gene, a eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) (EEF1D) pseudogene, the gene for a novel KRAB box-containing C2H2 type zinc finger protein, a novel gene, a pseudogene similar to part of sorting nexin associated golgi protein 1 (SNAG1), a novel pseudogene, a melanoma antigen pseudogene and three CpG islands, complete sequence Length = 182280 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 46321 agatgaagaccatcctggc 46339 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 14271 agatgaagaccatcctggc 14289
>gb|AC023951.19| Homo sapiens chromosome 15, clone RP11-815C16, complete sequence Length = 186341 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 131550 agatgaagaccatcctggc 131532
>emb|AL121781.38|HSJ1164C1 Human DNA sequence from clone RP5-1164C1 on chromosome 20 Contains (part of) two putative novel genes, ESTs, STSs and GSSs, complete sequence Length = 178568 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 40367 agatgaagaccatcctggc 40385
>emb|AL118502.38|HSA371L19 Human DNA sequence from clone RP11-371L19 on chromosome 20 Contains the C20orf54 gene, the C20orf55 gene, the RPS10L gene for ribosomal protein S10-like and five CpG islands, complete sequence Length = 126259 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 50954 agatgaagaccatcctggc 50936
>emb|AL121895.26|HSA234K24 Human DNA sequence from clone RP11-234K24 on chromosome 20 Contains a novel gene, the 3' end of the EPB41L1 gene for the erythrocyte membrane protein band 4.1-like protein, the C20orf4 gene for chromosome 20 open reading frame 4 and a CpG island, complete sequence Length = 153192 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 14871 agatgaagaccatcctggc 14889
>emb|AL121965.19|HSJ161I14 Human DNA sequence from clone RP1-161I14 on chromosome 6q16.1-16.3 Contains part of the RNAH gene for an RNA helicase, complete sequence Length = 113022 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 36130 agatgaagaccatcctggc 36112
>emb|AL133551.13| Human DNA sequence from clone RP11-57G10 on chromosome 10 Contains a ribosomal protein L21 (RPL21) pseudogene, the gene for J-domain containing protein 1 (JDP1), a ribosomal protein L12 (RPL12) pseudogene, a novel pseudogene, the SIRT1 gene for sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae), the 3' end of the gene for a novel protein (KIAA0032) and two CpG island, complete sequence Length = 175940 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 83335 agatgaagaccatcctggc 83353
>emb|AL117375.12|HSDJ80E14 Human DNA sequence from clone RP1-80E14 on chromosome 20 Contains ESTs, STSs and GSSs, complete sequence Length = 114856 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 72253 agatgaagaccatcctggc 72271
>emb|AL109811.40|HSJ635E18 Human DNA sequence from clone RP4-635E18 on chromosome 1p36.11-36.31 Contains the TARDBP gene for TAR DNA binding protein, the MASP2 gene for mannan-binding lectin serine protease 2, the SRM gene for spermidine synthase, the PMSCL2 gene for 100kDa polymyositis/scleroderma autoantigen 2 (FLJ41371, FLJ36636, two novel genes (FLJ30609), the 3' end of the FRAP1 gene for FK506 binding protein 12-rapamycin associated protein 1 and a CpG island, complete sequence Length = 112769 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 2845 agatgaagaccatcctggc 2863
>emb|AL109935.39|HSJ1022P6 Human DNA sequence from clone RP5-1022P6 on chromosome 20 Contains the RPS18P1 gene for ribosomal protein S18 pseudogene 1, the gene for a novel protein (KIAA1434), an EIF4E (eukaryotic translation initiation factor 4E) pseudogene, three novel genes and two CpG islands, complete sequence Length = 178601 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 128857 agatgaagaccatcctggc 128875
>emb|AL109940.18|HSJ421D16 Human DNA sequence from clone RP3-421D16 on chromosome 6q26-27 Contains part of the gene for smooth muscle cell associated protein 2 (SMAP2) or secreted modular calcium binding protein 2 (SMOC2) and two CpG islands, complete sequence Length = 110603 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 40919 agatgaagaccatcctggc 40901
>emb|AL109945.15|HSJ811H24 Human DNA sequence from clone RP4-811H24 on chromosome 1p34.1-34.3 Contains the 3' end of LCK gene for lymphocyte-specific protein tyrosine kinase, HDAC1 gene for histone deacetylase 1, the MLP gene for MARCKS-like protein, STK22C gene for serine/threonine kinase 22C (spermiogenesis associated), a novel gene (FLJ43105), five novel genes and four CpG islands, complete sequence Length = 110526 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 75269 agatgaagaccatcctggc 75251
>emb|AL050321.11|HSJ717M23 Human DNA sequence from clone RP4-717M23 on chromosome 20 Contains the CSRP2BP gene for CSRP2 binding protein, a chromosome 7 open reading frame 24 (C7orf24) pseudogene and two CpG islands, complete sequence Length = 101589 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 80017 agatgaagaccatcctggc 80035
>emb|AL049798.7|HSJ797M17 Human DNA sequence from clone RP4-797M17 on chromosome 1q22-24.3 Contains the DPT gene for dermatopontin, complete sequence Length = 74822 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 55273 agatgaagaccatcctggc 55255
>emb|AL049647.7|HSJ1027G4 Human DNA sequence from clone RP5-1027G4 on chromosome 20 Contains part of the SLC24A3 gene for solute carrier family 24 (sodium/potassium/calcium exchanger) member 3 and a novel gene, complete sequence Length = 164845 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 159825 agatgaagaccatcctggc 159843
>emb|AL034417.14|HS215D11 Human DNA sequence from clone CTA-215D11 on chromosome 1p36.12-36.33 Contains the PARK7 gene for Parkinson disease (autosomal recessive, early onset) 7, a novel gene, gene 33/Mig-6 (MIG-6), a ribosomal protein L7a (RPL7A) pseudogene, the 5' end of a novel gene (FLJ26758) and two CpG islands, complete sequence Length = 122279 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 50658 agatgaagaccatcctggc 50640
>emb|AL031943.11|HS223B1 Human DNA sequence from clone RP1-223B1 on chromosome 6p24.1-25.3 Contains the 3' end of a putative novel gene, complete sequence Length = 126281 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 17736 agatgaagaccatcctggc 17754
>emb|AL034545.2|HS542O23 Human DNA sequence from clone RP4-542O23 on chromosome Xq21.1-21.33, complete sequence Length = 76277 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 29493 agatgaagaccatcctggc 29475
>emb|AL031846.2|HS742C19 Human DNA sequence from clone RP4-742C19 on chromosome 22q12.3-13.1, complete sequence Length = 122748 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 7133 agatgaagaccatcctggc 7115
>emb|AL031177.1|HS889N15 Human DNA sequence from clone RP5-889N15 on chromosome Xq22.1-22.3 Contains the 3' end of a novel gene (MGC44287), the PSMD10 gene for proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 (p28), the AUTL2 gene for AUT-like 2, cysteine endopeptidase (S. cerevisiae) (APG4A, MGC43691), the 3' end of the COL4A6 gene for collagen, type IV, alpha 6 and a CpG island, complete sequence Length = 123395 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 65599 agatgaagaccatcctggc 65581
>emb|AL021997.1|HS874C20 Human DNA sequence from clone RP5-874C20 on chromosome 6p22.1-22.3 Contains the 5' end of a novel protein similar to zinc finger protein 306 (ZNF306, ZFP47), the gene for a novel C2H2 type zinc finger protein, a novel gene, a zinc finger protein SRE-ZBP pseudogene and a CpG island, complete sequence Length = 97847 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 45234 agatgaagaccatcctggc 45216
>gb|AC079842.19| Homo sapiens 12q BAC RP11-989K8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 133000 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 51886 agatgaagaccatcctggc 51904
>emb|AL163202.2|HS21C002 Homo sapiens chromosome 21 segment HS21C002 Length = 340000 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 37728 agatgaagaccatcctggc 37710
>gb|AC087499.12| Homo sapiens chromosome 17, clone RP11-218E15, complete sequence Length = 195591 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 27294 agatgaagaccatcctggc 27312
>gb|AC069045.11| Homo sapiens chromosome 15, clone RP11-111C2, complete sequence Length = 154859 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 14999 agatgaagaccatcctggc 15017
>emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome; segment 12/13 Length = 349606 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 4 accctcgcctcctcccccc 22 ||||||||||||||||||| Sbjct: 282246 accctcgcctcctcccccc 282228
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 157 tcggtgacggggccgcgcg 175 ||||||||||||||||||| Sbjct: 1158215 tcggtgacggggccgcgcg 1158233
>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 13/14 Length = 316050 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 4 accctcgcctcctcccccc 22 ||||||||||||||||||| Sbjct: 285769 accctcgcctcctcccccc 285751
>emb|AL163201.2|HS21C001 Homo sapiens chromosome 21 segment HS21C001 Length = 281116 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 102755 agatgaagaccatcctggc 102737
>emb|AL133295.16| Human DNA sequence from clone RP5-1137O17 on chromosome 11p12-14.2 Contains part of a gene similar to putative mitochondrialninner membrane protease subnunit 2, a novel mRNA, ESTs and GSSs, complete sequence Length = 104333 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 54553 agatgaagaccatcctggc 54571
>emb|AL137064.6| Human DNA sequence from clone RP5-863G3 on chromosome 6 Contains the HLA-DRB1*04011 (major histocompatibility complex, class II, DR beta 1) gene, an autosomal highly conserved pseudogene, ESTs, STSs and GSSs, complete sequence Length = 95642 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 50770 agatgaagaccatcctggc 50752
>gb|AC074029.15| Homo sapiens 12 BAC RP11-474C8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 160943 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 45835 agatgaagaccatcctggc 45817
>gb|AC053481.13| Homo sapiens chromosome 17, clone RP11-51L5, complete sequence Length = 176235 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 81217 agatgaagaccatcctggc 81199
>gb|AC026634.11| Homo sapiens chromosome , clone RP11-639E23, complete sequence Length = 164858 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 164523 agatgaagaccatcctggc 164541
>emb|BX538311.1|HSM806575 Homo sapiens genomic DNA; cDNA DKFZp686E08130 (from clone DKFZp686E08130) Length = 4431 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 4362 agatgaagaccatcctggc 4380
>gb|AC024217.19| Homo sapiens 3 BAC RP11-18H7 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 19501 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 10951 agatgaagaccatcctggc 10933
>gb|AC009095.7| Homo sapiens chromosome 16 clone RP11-430J6, complete sequence Length = 84166 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 60574 agatgaagaccatcctggc 60592
>emb|BX001034.6| Human DNA sequence from clone RP11-21H4 on chromosome 9 Contains a novel pseudogene and a novel zinc finger pseudogene, complete sequence Length = 173100 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 66203 agatgaagaccatcctggc 66185
>gb|AC146768.3| Callithrix jacchus clone CH259-491G15, complete sequence Length = 119777 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 105207 agatgaagaccatcctggc 105189
>gb|AC010834.19| Homo sapiens chromosome 8, clone RP11-10N23, complete sequence Length = 175967 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 96444 agatgaagaccatcctggc 96462
>gb|AC079018.10| Homo sapiens chromosome 8, clone RP11-161B1, complete sequence Length = 168702 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 32765 agatgaagaccatcctggc 32783
>gb|AC126178.6| Homo sapiens 12 BAC RP11-567C2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 127439 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 17760 agatgaagaccatcctggc 17778
>gb|AC105230.10| Homo sapiens chromosome 8, clone RP11-699F21, complete sequence Length = 151517 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 68987 agatgaagaccatcctggc 69005
>gb|AC060798.10| Homo sapiens chromosome 17, clone RP11-615P24, complete sequence Length = 171994 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 74426 agatgaagaccatcctggc 74444
>gb|AC125634.1| Homo sapiens 3 BAC RP11-512E23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 162478 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 87568 agatgaagaccatcctggc 87586
>gb|AC008813.6| Homo sapiens chromosome 19 clone CTD-2102P23, complete sequence Length = 162914 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 32887 agatgaagaccatcctggc 32905
>gb|AC098964.4| Homo sapiens chromosome 8 clone RP11-141M14 map 8p21-p11, complete sequence Length = 151646 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 35241 agatgaagaccatcctggc 35259
>gb|AF279873.4| Homo sapiens chromosome 8 clone RP1-25D10, RP1-273G13, RP1-103E7 map 8p21-p11, complete sequence Length = 301232 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 242692 agatgaagaccatcctggc 242710
>dbj|BS000549.1| Pan troglodytes chromosome Y clone:PTB-240N05, complete sequences Length = 148562 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 113249 agatgaagaccatcctggc 113231
>gb|AC011031.12| Homo sapiens chromosome 8, clone RP11-345I19, complete sequence Length = 183771 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 62336 agatgaagaccatcctggc 62318
>gb|AC104127.2| Homo sapiens chromosome 5 clone RP11-69G16, complete sequence Length = 161764 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 141118 agatgaagaccatcctggc 141136
>gb|AC079900.15| Homo sapiens 3 BAC RP11-456E14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 74817 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 17694 agatgaagaccatcctggc 17712
>gb|AC183380.3| Pan troglodytes BAC clone CH251-605G19 from chromosome 7, complete sequence Length = 223844 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 30981 agatgaagaccatcctggc 30999
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 16502129 agatgaagaccatcctggc 16502147
>gb|AC182642.2| Pan troglodytes BAC clone CH251-216C21 from chromosome 21, complete sequence Length = 187371 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 42192 agatgaagaccatcctggc 42174
>gb|AC145338.7| Pan troglodytes clone rp43-47g15, complete sequence Length = 202653 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 37130 agatgaagaccatcctggc 37112
>gb|AC110743.4| Homo sapiens chromosome 18, clone CTD-3153M21, complete sequence Length = 78507 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 18897 agatgaagaccatcctggc 18879
>gb|AC125393.6| Pan troglodytes clone rp43-22m15, complete sequence Length = 187256 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 123657 agatgaagaccatcctggc 123675
>gb|AC129097.27| Papio anubis clone rp41-53o7, complete sequence Length = 186113 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 69833 agatgaagaccatcctggc 69851
>gb|AC021558.10| Homo sapiens chromosome 8, clone RP11-746L20, complete sequence Length = 171582 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 86790 agatgaagaccatcctggc 86772
>gb|AC108456.7| Homo sapiens chromosome 11, clone CTD-2514C7, complete sequence Length = 197665 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 85302 agatgaagaccatcctggc 85284
>gb|AC091139.9| Homo sapiens chromosome 18, clone RP11-817B8, complete sequence Length = 10252 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 1563 agatgaagaccatcctggc 1545
>gb|AC114954.2| Homo sapiens chromosome 5 clone RP11-103A10, complete sequence Length = 157980 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 156268 agatgaagaccatcctggc 156250
>gb|AC114941.2| Homo sapiens chromosome 5 clone CTD-2287M17, complete sequence Length = 159281 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 39954 agatgaagaccatcctggc 39936
>gb|AC113422.2| Homo sapiens chromosome 5 clone RP11-5J18, complete sequence Length = 72551 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 32128 agatgaagaccatcctggc 32110
>gb|AC104111.2| Homo sapiens chromosome 5 clone RP11-176O14, complete sequence Length = 171234 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 48563 agatgaagaccatcctggc 48581
>gb|AC119407.15| Pan troglodytes clone ch251-541e23, complete sequence Length = 204962 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 36271 agatgaagaccatcctggc 36289
>gb|AC113349.2| Homo sapiens chromosome 5 clone CTD-2544H17, complete sequence Length = 163806 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 71189 agatgaagaccatcctggc 71207
>gb|AC182463.3| Pan troglodytes BAC clone CH251-511B8 from chromosome 16, complete sequence Length = 194406 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 132117 agatgaagaccatcctggc 132099
>dbj|AK022466.1| Homo sapiens cDNA FLJ12404 fis, clone MAMMA1002833 Length = 1622 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 1410 agatgaagaccatcctggc 1428
>gb|AC118462.2| Homo sapiens chromosome 5 clone RP11-51J12, complete sequence Length = 14102 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 7178 agatgaagaccatcctggc 7160
>gb|AC174000.3| Pan troglodytes BAC clone CH251-2O15 from chromosome 7, complete sequence Length = 161527 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 125122 agatgaagaccatcctggc 125104
>dbj|AB111516.2| Oryza sativa (japonica cultivar-group) OsRadA mRNA for RadA-like protein, complete cds Length = 2223 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 4 accctcgcctcctcccccc 22 ||||||||||||||||||| Sbjct: 128 accctcgcctcctcccccc 146
>gb|AC166601.4| Nomascus leucogenys leucogenys clone CH271-401M10, complete sequence Length = 184404 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 57954 agatgaagaccatcctggc 57972
>gb|AC107943.4| Homo sapiens chromosome 8, clone RP11-11I1, complete sequence Length = 195110 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 108486 agatgaagaccatcctggc 108468
>gb|AC109463.2| Homo sapiens chromosome 5 clone RP11-273E10, complete sequence Length = 23936 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 10603 agatgaagaccatcctggc 10621
>gb|AC112191.2| Homo sapiens chromosome 5 clone RP11-34P1, complete sequence Length = 153248 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 38450 agatgaagaccatcctggc 38468
>gb|AC024606.11| Homo sapiens chromosome 10 clone RP11-360I20, complete sequence Length = 186533 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 49762 agatgaagaccatcctggc 49780
>gb|AC108166.5| Homo sapiens BAC clone RP11-724L20 from 4, complete sequence Length = 89882 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 23317 agatgaagaccatcctggc 23335
>gb|AC117528.2| Homo sapiens chromosome 5 clone RP11-22C17, complete sequence Length = 144236 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 75752 agatgaagaccatcctggc 75734
>gb|AC104827.4| Homo sapiens BAC clone RP11-778J15 from 4, complete sequence Length = 157262 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 69604 agatgaagaccatcctggc 69586
>gb|AC073160.8| Homo sapiens chromosome 10 clone RP11-348G8, complete sequence Length = 189817 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 106972 agatgaagaccatcctggc 106990
>gb|AC025218.8| Homo sapiens chromosome 8, clone RP11-275J3, complete sequence Length = 132202 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 90826 agatgaagaccatcctggc 90808
>gb|AC105001.3| Homo sapiens chromosome 8, clone CTD-2135J3, complete sequence Length = 157442 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 111385 agatgaagaccatcctggc 111367
>gb|AC090152.4| Homo sapiens chromosome 8, clone RP11-554M1, complete sequence Length = 118755 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 116082 agatgaagaccatcctggc 116100
>gb|AC113418.2| Homo sapiens chromosome 5 clone RP11-574H6, complete sequence Length = 182740 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 180452 agatgaagaccatcctggc 180470
>gb|AC027288.26| Homo sapiens 12 BAC RP11-359M6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 177080 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 166708 agatgaagaccatcctggc 166726
>gb|AC011374.6| Homo sapiens chromosome 5 clone CTB-113P19, complete sequence Length = 203961 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 22188 agatgaagaccatcctggc 22206
>gb|AC107992.3| Homo sapiens chromosome 15, clone RP11-150L8, complete sequence Length = 149015 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 61160 agatgaagaccatcctggc 61142
>gb|AC103863.2| Homo sapiens chromosome 8, clone RP11-185B9, complete sequence Length = 168424 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 91036 agatgaagaccatcctggc 91018
>gb|AC015795.20| Homo sapiens chromosome 17, clone RP11-613C6, complete sequence Length = 170862 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 90053 agatgaagaccatcctggc 90071
>gb|AC182470.3| Pan troglodytes BAC clone CH251-440F19 from chromosome 2, complete sequence Length = 163061 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 54318 agatgaagaccatcctggc 54300
>gb|AC093914.3| Homo sapiens BAC clone RP11-779N9 from 4, complete sequence Length = 170536 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 157716 agatgaagaccatcctggc 157734
>gb|AC093887.3| Homo sapiens BAC clone RP11-667D12 from 4, complete sequence Length = 192886 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 168485 agatgaagaccatcctggc 168467
>gb|AC093872.3| Homo sapiens BAC clone RP11-610P19 from 4, complete sequence Length = 59406 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 13625 agatgaagaccatcctggc 13607
>gb|AC096751.3| Homo sapiens BAC clone RP11-440I14 from 4, complete sequence Length = 174642 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 45469 agatgaagaccatcctggc 45487
>gb|AC093814.3| Homo sapiens BAC clone RP11-362I16 from 4, complete sequence Length = 163201 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 87668 agatgaagaccatcctggc 87686
>gb|AC093804.3| Homo sapiens BAC clone RP11-326C15 from 4, complete sequence Length = 177708 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 69306 agatgaagaccatcctggc 69288
>gb|AC079071.9| Homo sapiens chromosome 8, clone RP11-43G18, complete sequence Length = 157811 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 56232 agatgaagaccatcctggc 56214
>gb|AC097712.3| Homo sapiens BAC clone RP11-216H12 from 4, complete sequence Length = 184520 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 144688 agatgaagaccatcctggc 144670
>gb|AC148313.3| Pan troglodytes BAC clone CH251-565C10 from chromosome 7, complete sequence Length = 183205 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 86888 agatgaagaccatcctggc 86870
>gb|AC012215.11| Homo sapiens chromosome , clone RP11-345N15, complete sequence Length = 210723 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 2440 agatgaagaccatcctggc 2422
>gb|AC015864.5| Homo sapiens chromosome 18, clone RP11-54A1, complete sequence Length = 177410 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 137396 agatgaagaccatcctggc 137378 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 116067 agatgaagaccatcctggc 116085
>gb|AC026003.10| Homo sapiens chromosome 18, clone RP11-715P20, complete sequence Length = 178733 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 75456 agatgaagaccatcctggc 75438
>gb|AC013545.8| Homo sapiens chromosome 8, clone RP11-414D17, complete sequence Length = 200208 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 73712 agatgaagaccatcctggc 73730
>gb|AC021500.6| Homo sapiens chromosome 8, clone RP11-135K1, complete sequence Length = 160348 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 155871 agatgaagaccatcctggc 155853
>gb|AC008125.9| Homo sapiens 12 BAC RPCI11-25E2 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 189286 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 53718 agatgaagaccatcctggc 53736
>gb|AC091996.3| Homo sapiens chromosome 5 clone RP11-96G10, complete sequence Length = 182797 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 18130 agatgaagaccatcctggc 18148
>gb|AC034139.7| Homo sapiens BAC clone RP11-67M24 from 4, complete sequence Length = 176411 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 106244 agatgaagaccatcctggc 106262
>gb|AC080082.4| Homo sapiens BAC clone RP11-531D14 from 4, complete sequence Length = 22690 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 8947 agatgaagaccatcctggc 8965
>gb|AC105150.2| Homo sapiens chromosome 8, clone RP11-328K2, complete sequence Length = 201000 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 191295 agatgaagaccatcctggc 191277
>gb|AC010256.6| Homo sapiens chromosome 5 clone CTC-445M6, complete sequence Length = 141488 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 21267 agatgaagaccatcctggc 21249
>gb|AC098969.2| Homo sapiens chromosome 3 clone RP11-24O17, complete sequence Length = 158560 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 114863 agatgaagaccatcctggc 114845
>gb|AC064800.8| Homo sapiens chromosome 18, clone CTD-2001I24, complete sequence Length = 131409 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 129448 agatgaagaccatcctggc 129430
>gb|AC021482.10| Homo sapiens chromosome , clone RP11-15K1, complete sequence Length = 159075 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 17141 agatgaagaccatcctggc 17159
>gb|AC008567.5| Homo sapiens chromosome 19 clone CTC-543D15, complete sequence Length = 153704 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 59384 agatgaagaccatcctggc 59402
>gb|AC016065.14| Homo sapiens chromosome 8, clone RP11-115C21, complete sequence Length = 185463 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 184780 agatgaagaccatcctggc 184798
>gb|AC011008.10| Homo sapiens chromosome 8, clone RP11-177H2, complete sequence Length = 162245 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 146086 agatgaagaccatcctggc 146104
>gb|AC018692.9| Homo sapiens BAC clone RP11-555K2 from 4, complete sequence Length = 189789 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 152018 agatgaagaccatcctggc 152036
>gb|AC010735.11| Homo sapiens BAC clone RP11-395N3 from 2, complete sequence Length = 211980 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 97973 agatgaagaccatcctggc 97955
>gb|AC093262.2| Homo sapiens chromosome 5 clone RP11-252F20, complete sequence Length = 164513 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 98185 agatgaagaccatcctggc 98203
>gb|AC027279.4| Homo sapiens chromosome 16 clone RP11-319G9, complete sequence Length = 194594 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 31665 agatgaagaccatcctggc 31683
>gb|AC024561.5| Homo sapiens chromosome 5 clone CTB-94B10, complete sequence Length = 155125 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 66262 agatgaagaccatcctggc 66244
>gb|DP000005.1| Macaca mulatta target 1 genomic scaffold Length = 1678549 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 919834 agatgaagaccatcctggc 919816
>gb|AC093235.2| Homo sapiens chromosome 19 clone LLNLR-267A4, complete sequence Length = 38173 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Plus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 37176 agatgaagaccatcctggc 37194
>gb|AC022089.7| Homo sapiens chromosome 5 clone CTB-125N5, complete sequence Length = 44504 Score = 38.2 bits (19), Expect = 9.7 Identities = 19/19 (100%) Strand = Plus / Minus Query: 80 agatgaagaccatcctggc 98 ||||||||||||||||||| Sbjct: 35807 agatgaagaccatcctggc 35789 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,043,054 Number of Sequences: 3902068 Number of extensions: 1043054 Number of successful extensions: 252114 Number of sequences better than 10.0: 417 Number of HSP's better than 10.0 without gapping: 417 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 247074 Number of HSP's gapped (non-prelim): 5040 length of query: 195 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 173 effective length of database: 17,147,199,772 effective search space: 2966465560556 effective search space used: 2966465560556 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)