ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart08h04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, ... 94 2e-16
2gb|AY323481.1| Oryza sativa (japonica cultivar-group) ribosomal ... 90 3e-15
3gb|AY072817.1| Oryza sativa ARE1 mRNA, partial cds 90 3e-15
4dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 90 3e-15
5gb|BT016560.1| Zea mays clone Contig393 mRNA sequence 84 2e-13
6gb|AY104547.1| Zea mays PCO113533 mRNA sequence 84 2e-13
7dbj|D29705.1|RICYK17 Oryza sativa mRNA, partial homologous to GA... 82 7e-13
8dbj|AK064936.1| Oryza sativa (japonica cultivar-group) cDNA clon... 82 7e-13
9dbj|D83527.1|RICGA3 Rice (YK426) mRNA, complete cds 82 7e-13
10gb|AY107309.1| Zea mays PCO113532 mRNA sequence 80 3e-12
11gb|BT016425.1| Zea mays clone Contig258 mRNA sequence 72 7e-10
12ref|XM_463799.1| Oryza sativa (japonica cultivar-group), mRNA 54 2e-04
13ref|XM_506675.1| PREDICTED Oryza sativa (japonica cultivar-group... 54 2e-04
14gb|AY020397.1| Oryza sativa microsatellite MRG2722 containing (G... 54 2e-04
15dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 54 2e-04
16dbj|AP004187.3| Oryza sativa (japonica cultivar-group) genomic D... 54 2e-04
17dbj|AK102186.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
18dbj|AK062502.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
19gb|AY910750.1| Gallus gallus glycerophosphodiester phosphodieste... 42 0.62
20ref|XM_424003.1| PREDICTED: Gallus gallus similar to hypothetica... 42 0.62
21gb|AY567837.1| Homo sapiens adrenergic, beta-1-, receptor (ADRB1... 42 0.62
22emb|AL390760.25| Human DNA sequence from clone RP11-370F5 on chr... 42 0.62
23gb|AY130860.1| Homo sapiens SCDK4-binding protein p34SEI1 (SEI1)... 42 0.62
24gb|AC010271.8| Homo sapiens chromosome 19 clone CTC-492K19, comp... 42 0.62
25dbj|AK074652.1| Homo sapiens cDNA FLJ90171 fis, clone MAMMA10004... 42 0.62
26gb|AC025164.37| Homo sapiens 12 BAC RP11-796E2 (Roswell Park Can... 42 0.62
27gb|AC005886.2|AC005886 b240g16, complete sequence 42 0.62
28ref|NM_001037271.1| Gallus gallus glycerophosphodiester phosphod... 42 0.62
29emb|AL355543.13| Human DNA sequence from clone RP11-86E10 on chr... 42 0.62
30emb|AJ343217.1|HSA343217 Homo sapiens genomic sequence surroundi... 42 0.62
31gb|AC005353.1| Homo sapiens chromosome 5, BAC clone 24p24 (LBNL ... 40 2.4
32gb|AC006372.2| Homo sapiens BAC clone RP11-331D5 from 7, complet... 40 2.4
33emb|CR732637.2|CNS0GS8Y Tetraodon nigroviridis full-length cDNA 40 2.4
34emb|CR730462.2|CNS0GQKJ Tetraodon nigroviridis full-length cDNA 40 2.4
35emb|CR727111.2|CNS0GNZH Tetraodon nigroviridis full-length cDNA 40 2.4
36emb|CR724397.2|CNS0GLW3 Tetraodon nigroviridis full-length cDNA 40 2.4
37emb|CR724259.2|CNS0GLS9 Tetraodon nigroviridis full-length cDNA 40 2.4
38emb|CR723898.2|CNS0GLI8 Tetraodon nigroviridis full-length cDNA 40 2.4
39gb|CP000316.1| Polaromonas sp. JS666, complete genome 40 2.4
40gb|AC020894.5| Homo sapiens chromosome 5 clone CTC-293A9, comple... 40 2.4
41gb|AC135610.5| Pan troglodytes clone rp43-11n14, complete sequence 40 2.4
42gb|AC093259.2| Homo sapiens chromosome 5 clone RP11-229C3, compl... 40 2.4
43gb|AC106886.3| Homo sapiens chromosome 16 clone RP11-2C24, compl... 40 2.4
44gb|AC093249.4| Homo sapiens chromosome 16 clone RP11-146F11, com... 40 2.4
45emb|AL136296.3|CNS01DW0 Human chromosome 14 DNA sequence BAC R-5... 40 2.4
46emb|AL163151.1|CNS01RIC Human chromosome 14 DNA sequence BAC R-1... 40 2.4
47ref|XM_550647.1| Oryza sativa (japonica cultivar-group), mRNA 38 9.7
48gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 38 9.7
49gb|DP000014.1| Callithrix jacchus target 1 genomic scaffold 38 9.7
50gb|AC005593.1| Homo sapiens chromosome 5, P1 clone 1369f10 (LBNL... 38 9.7
51ref|NG_002433.1| Homo sapiens major histocompatibility complex, ... 38 9.7
52gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 38 9.7
53gb|AC163737.3| Pan troglodytes BAC clone CH251-547O12 from chrom... 38 9.7
54gb|AC183296.3| Pan troglodytes BAC clone CH251-352A17 from chrom... 38 9.7
55gb|AC185247.2| Pan troglodytes BAC clone CH251-7D5 from chromoso... 38 9.7
56gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 38 9.7
57gb|AC146113.3| Pan troglodytes BAC clone RP43-5I6 from 7, comple... 38 9.7
58gb|AC182396.3| Pan troglodytes BAC clone CH251-244D19 from chrom... 38 9.7
59gb|AC160564.2| Pan troglodytes BAC clone CH251-542C24 from chrom... 38 9.7
60gb|AY596305.1| Chlamydomonas reinhardtii cell wall protein GP2 (... 38 9.7
61gb|AF235103.5| Homo sapiens chromosome 8 multiple clones map q24... 38 9.7
62gb|AF130343.2| Homo sapiens chromosome 8 multiple clones map q23... 38 9.7
63gb|AF233439.7| Homo sapiens chromosome 8 clones GS1-24F4, CTD-26... 38 9.7
64gb|AF205406.5| Homo sapiens chromosome 8 clone SCb-633e22 map p2... 38 9.7
65gb|AF298854.5| Homo sapiens chromosome 8 clone SCb-207i3 map p23... 38 9.7
66gb|AC183680.3| Pan troglodytes BAC clone CH251-425K14 from chrom... 38 9.7
67gb|AC157088.2| Pan troglodytes BAC clone CH251-497H13 from chrom... 38 9.7
68gb|AF254983.3| Homo sapiens chromosome 21 clone RP11-589M2 map p... 38 9.7
69gb|AC005531.2| Homo sapiens PAC clone RP4-701O16 from 7, complet... 38 9.7
70gb|AC147336.2| Pan troglodytes BAC clone CH251-70I12 from Y, com... 38 9.7
71gb|AY261359.1| Bovine herpesvirus 5 strain SV507/99, complete ge... 38 9.7
72gb|AC146252.3| Pan troglodytes BAC clone RP43-31D18 from 7, comp... 38 9.7
73gb|AC131649.2| Homo sapiens chromosome 16 clone RP11-609N14, com... 38 9.7
74gb|AF030876.2| Homo sapiens chromosome X clone Qc-8D3, RP4-671D9... 38 9.7
75gb|AC127381.4| Homo sapiens BAC clone RP11-1360M22 from UL, comp... 38 9.7
76gb|AC026882.6| Homo sapiens chromosome 3 clone RP11-211K13 map 3... 38 9.7
77gb|AC146133.3| Pan troglodytes BAC clone RP43-38C10 from 7, comp... 38 9.7
78gb|AC093582.3| Homo sapiens BAC clone RP13-254B10 from 7, comple... 38 9.7
79gb|AC005589.1| Homo sapiens BAC clone RP11-161H12 from 7, comple... 38 9.7
80gb|AC095044.3| Homo sapiens BAC clone RP11-132B16 from 7, comple... 38 9.7
81gb|AC006333.3| Homo sapiens BAC clone RP11-390E23 from 7, comple... 38 9.7
82gb|AC073330.6| Homo sapiens BAC clone RP11-409J21 from 7, comple... 38 9.7
83gb|AC006088.1| Homo sapiens 12q24.1 PAC RP1-305I20 (Roswell Park... 38 9.7
84gb|AC145773.1| Pan troglodytes BAC clone RP43-32M11 from 7, comp... 38 9.7
85emb|AL034420.16|HS1112F19 Human DNA sequence from clone RP5-1112... 38 9.7
86emb|Z94161.5|HSN102C10 Human DNA sequence from clone LL22NC03-10... 38 9.7
87emb|Z82182.2|HSE90C2 Human DNA sequence from clone LL22NC01-90C2... 38 9.7
88gb|AC183832.3| Pan troglodytes BAC clone CH251-260G12 from chrom... 38 9.7
89emb|AL390248.10| Human DNA sequence from clone RP11-492M23 on ch... 38 9.7
90emb|BX296568.4| Human DNA sequence from clone DASS-233C19 on chr... 38 9.7
91emb|BX293535.3| Human DNA sequence from clone RP4-752I6 on chrom... 38 9.7
92emb|AL607035.12| Human DNA sequence from clone RP11-570G20 on ch... 38 9.7
93emb|AL591543.22| Human DNA sequence from clone RP13-198D9 on chr... 38 9.7
94emb|AL592525.10| Human DNA sequence from clone RP11-111G23 on ch... 38 9.7
95emb|AL590683.16| Human DNA sequence from clone RP11-10N16 on chr... 38 9.7
96gb|AC183767.2| Pan troglodytes BAC clone CH251-373L9 from chromo... 38 9.7
97emb|AL450364.12| Human DNA sequence from clone RP11-499P20 on ch... 38 9.7
98emb|AL449266.17| Human DNA sequence from clone RP11-475E11 on ch... 38 9.7
99emb|AL390065.20| Human DNA sequence from clone RP11-520M5 on chr... 38 9.7
100emb|AL365364.19| Human DNA sequence from clone RP11-624L12 on ch... 38 9.7
101emb|AL365357.12| Human DNA sequence from clone RP4-765C7 on chro... 38 9.7
102emb|AL390298.13| Human DNA sequence from clone RP11-75I24 on chr... 38 9.7
103emb|AL365356.13| Human DNA sequence from clone RP11-336A10 on ch... 38 9.7
104emb|AL390917.12| Human DNA sequence from clone RP11-247O12 on ch... 38 9.7
105emb|AL390071.9| Human DNA sequence from clone RP11-98D3 on chrom... 38 9.7
106emb|AL359180.17| Human DNA sequence from clone RP11-320G21 on ch... 38 9.7
107emb|AL359380.16| Human DNA sequence from clone RP11-642N5 on chr... 38 9.7
108emb|AL357974.16| Human DNA sequence from clone RP11-398M15 on ch... 38 9.7
109emb|AL358875.13| Human DNA sequence from clone RP11-312H18 on ch... 38 9.7
110gb|AC012046.11| Homo sapiens chromosome 10 clone RP11-312P12, co... 38 9.7
111emb|AL355529.21| Human DNA sequence from clone RP11-85C15 on chr... 38 9.7
112emb|AL353622.33| Human DNA sequence from clone RP5-1092A3 on chr... 38 9.7
113emb|AL353729.17| Human DNA sequence from clone RP11-290L7 on chr... 38 9.7
114emb|AL354857.13| Human DNA sequence from clone RP11-346N8 on chr... 38 9.7
115emb|AL353791.7| Human DNA sequence from clone RP11-475B17 on chr... 38 9.7
116emb|AL353626.5| Human DNA sequence from clone RP11-318K12 on chr... 38 9.7
117emb|AL353895.4| Human DNA sequence from clone RP11-503K16 on chr... 38 9.7
118emb|AL161450.14| Human DNA sequence from clone RP11-39K24 on chr... 38 9.7
119gb|AC183286.3| Pan troglodytes BAC clone CH251-56I13 from chromo... 38 9.7
120emb|AL159158.12| Human DNA sequence from clone RP11-81G4 on chro... 38 9.7
121emb|AL139801.17| Human DNA sequence from clone RP11-247M1 on chr... 38 9.7
122emb|AL139350.17| Human DNA sequence from clone RP11-307O10 on ch... 38 9.7
123gb|AC091134.7| Homo sapiens chromosome 17, clone RP11-646F1, com... 38 9.7
124emb|AL157782.8| Human DNA sequence from clone RP11-127E22 on chr... 38 9.7
125emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chr... 38 9.7
126gb|AC023951.19| Homo sapiens chromosome 15, clone RP11-815C16, c... 38 9.7
127emb|AL121781.38|HSJ1164C1 Human DNA sequence from clone RP5-1164... 38 9.7
128emb|AL118502.38|HSA371L19 Human DNA sequence from clone RP11-371... 38 9.7
129emb|AL121895.26|HSA234K24 Human DNA sequence from clone RP11-234... 38 9.7
130emb|AL121965.19|HSJ161I14 Human DNA sequence from clone RP1-161I... 38 9.7
131emb|AL133551.13| Human DNA sequence from clone RP11-57G10 on chr... 38 9.7
132emb|AL117375.12|HSDJ80E14 Human DNA sequence from clone RP1-80E1... 38 9.7
133emb|AL109811.40|HSJ635E18 Human DNA sequence from clone RP4-635E... 38 9.7
134emb|AL109935.39|HSJ1022P6 Human DNA sequence from clone RP5-1022... 38 9.7
135emb|AL109940.18|HSJ421D16 Human DNA sequence from clone RP3-421D... 38 9.7
136emb|AL109945.15|HSJ811H24 Human DNA sequence from clone RP4-811H... 38 9.7
137emb|AL050321.11|HSJ717M23 Human DNA sequence from clone RP4-717M... 38 9.7
138emb|AL049798.7|HSJ797M17 Human DNA sequence from clone RP4-797M1... 38 9.7
139emb|AL049647.7|HSJ1027G4 Human DNA sequence from clone RP5-1027G... 38 9.7
140emb|AL034417.14|HS215D11 Human DNA sequence from clone CTA-215D1... 38 9.7
141emb|AL031943.11|HS223B1 Human DNA sequence from clone RP1-223B1 ... 38 9.7
142emb|AL034545.2|HS542O23 Human DNA sequence from clone RP4-542O23... 38 9.7
143emb|AL031846.2|HS742C19 Human DNA sequence from clone RP4-742C19... 38 9.7
144emb|AL031177.1|HS889N15 Human DNA sequence from clone RP5-889N15... 38 9.7
145emb|AL021997.1|HS874C20 Human DNA sequence from clone RP5-874C20... 38 9.7
146gb|AC079842.19| Homo sapiens 12q BAC RP11-989K8 (Roswell Park Ca... 38 9.7
147emb|AL163202.2|HS21C002 Homo sapiens chromosome 21 segment HS21C002 38 9.7
148gb|AC087499.12| Homo sapiens chromosome 17, clone RP11-218E15, c... 38 9.7
149gb|AC069045.11| Homo sapiens chromosome 15, clone RP11-111C2, co... 38 9.7
150emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome... 38 9.7
151emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 38 9.7
152emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 38 9.7
153emb|AL163201.2|HS21C001 Homo sapiens chromosome 21 segment HS21C001 38 9.7
154emb|AL133295.16| Human DNA sequence from clone RP5-1137O17 on ch... 38 9.7
155emb|AL137064.6| Human DNA sequence from clone RP5-863G3 on chrom... 38 9.7
156gb|AC074029.15| Homo sapiens 12 BAC RP11-474C8 (Roswell Park Can... 38 9.7
157gb|AC053481.13| Homo sapiens chromosome 17, clone RP11-51L5, com... 38 9.7
158gb|AC026634.11| Homo sapiens chromosome , clone RP11-639E23, com... 38 9.7
159emb|BX538311.1|HSM806575 Homo sapiens genomic DNA; cDNA DKFZp686... 38 9.7
160gb|AC024217.19| Homo sapiens 3 BAC RP11-18H7 (Roswell Park Cance... 38 9.7
161gb|AC009095.7| Homo sapiens chromosome 16 clone RP11-430J6, comp... 38 9.7
162emb|BX001034.6| Human DNA sequence from clone RP11-21H4 on chrom... 38 9.7
163gb|AC146768.3| Callithrix jacchus clone CH259-491G15, complete s... 38 9.7
164gb|AC010834.19| Homo sapiens chromosome 8, clone RP11-10N23, com... 38 9.7
165gb|AC079018.10| Homo sapiens chromosome 8, clone RP11-161B1, com... 38 9.7
166gb|AC126178.6| Homo sapiens 12 BAC RP11-567C2 (Roswell Park Canc... 38 9.7
167gb|AC105230.10| Homo sapiens chromosome 8, clone RP11-699F21, co... 38 9.7
168gb|AC060798.10| Homo sapiens chromosome 17, clone RP11-615P24, c... 38 9.7
169gb|AC125634.1| Homo sapiens 3 BAC RP11-512E23 (Roswell Park Canc... 38 9.7
170gb|AC008813.6| Homo sapiens chromosome 19 clone CTD-2102P23, com... 38 9.7
171gb|AC098964.4| Homo sapiens chromosome 8 clone RP11-141M14 map 8... 38 9.7
172gb|AF279873.4| Homo sapiens chromosome 8 clone RP1-25D10, RP1-27... 38 9.7
173dbj|BS000549.1| Pan troglodytes chromosome Y clone:PTB-240N05, c... 38 9.7
174gb|AC011031.12| Homo sapiens chromosome 8, clone RP11-345I19, co... 38 9.7
175gb|AC104127.2| Homo sapiens chromosome 5 clone RP11-69G16, compl... 38 9.7
176gb|AC079900.15| Homo sapiens 3 BAC RP11-456E14 (Roswell Park Can... 38 9.7
177gb|AC183380.3| Pan troglodytes BAC clone CH251-605G19 from chrom... 38 9.7
178gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 38 9.7
179gb|AC182642.2| Pan troglodytes BAC clone CH251-216C21 from chrom... 38 9.7
180gb|AC145338.7| Pan troglodytes clone rp43-47g15, complete sequence 38 9.7
181gb|AC110743.4| Homo sapiens chromosome 18, clone CTD-3153M21, co... 38 9.7
182gb|AC125393.6| Pan troglodytes clone rp43-22m15, complete sequence 38 9.7
183gb|AC129097.27| Papio anubis clone rp41-53o7, complete sequence 38 9.7
184gb|AC021558.10| Homo sapiens chromosome 8, clone RP11-746L20, co... 38 9.7
185gb|AC108456.7| Homo sapiens chromosome 11, clone CTD-2514C7, com... 38 9.7
186gb|AC091139.9| Homo sapiens chromosome 18, clone RP11-817B8, com... 38 9.7
187gb|AC114954.2| Homo sapiens chromosome 5 clone RP11-103A10, comp... 38 9.7
188gb|AC114941.2| Homo sapiens chromosome 5 clone CTD-2287M17, comp... 38 9.7
189gb|AC113422.2| Homo sapiens chromosome 5 clone RP11-5J18, comple... 38 9.7
190gb|AC104111.2| Homo sapiens chromosome 5 clone RP11-176O14, comp... 38 9.7
191gb|AC119407.15| Pan troglodytes clone ch251-541e23, complete seq... 38 9.7
192gb|AC113349.2| Homo sapiens chromosome 5 clone CTD-2544H17, comp... 38 9.7
193gb|AC182463.3| Pan troglodytes BAC clone CH251-511B8 from chromo... 38 9.7
194dbj|AK022466.1| Homo sapiens cDNA FLJ12404 fis, clone MAMMA1002833 38 9.7
195gb|AC118462.2| Homo sapiens chromosome 5 clone RP11-51J12, compl... 38 9.7
196gb|AC174000.3| Pan troglodytes BAC clone CH251-2O15 from chromos... 38 9.7
197dbj|AB111516.2| Oryza sativa (japonica cultivar-group) OsRadA mR... 38 9.7
198gb|AC166601.4| Nomascus leucogenys leucogenys clone CH271-401M10... 38 9.7
199gb|AC107943.4| Homo sapiens chromosome 8, clone RP11-11I1, compl... 38 9.7
200gb|AC109463.2| Homo sapiens chromosome 5 clone RP11-273E10, comp... 38 9.7
201gb|AC112191.2| Homo sapiens chromosome 5 clone RP11-34P1, comple... 38 9.7
202gb|AC024606.11| Homo sapiens chromosome 10 clone RP11-360I20, co... 38 9.7
203gb|AC108166.5| Homo sapiens BAC clone RP11-724L20 from 4, comple... 38 9.7
204gb|AC117528.2| Homo sapiens chromosome 5 clone RP11-22C17, compl... 38 9.7
205gb|AC104827.4| Homo sapiens BAC clone RP11-778J15 from 4, comple... 38 9.7
206gb|AC073160.8| Homo sapiens chromosome 10 clone RP11-348G8, comp... 38 9.7
207gb|AC025218.8| Homo sapiens chromosome 8, clone RP11-275J3, comp... 38 9.7
208gb|AC105001.3| Homo sapiens chromosome 8, clone CTD-2135J3, comp... 38 9.7
209gb|AC090152.4| Homo sapiens chromosome 8, clone RP11-554M1, comp... 38 9.7
210gb|AC113418.2| Homo sapiens chromosome 5 clone RP11-574H6, compl... 38 9.7
211gb|AC027288.26| Homo sapiens 12 BAC RP11-359M6 (Roswell Park Can... 38 9.7
212gb|AC011374.6| Homo sapiens chromosome 5 clone CTB-113P19, compl... 38 9.7
213gb|AC107992.3| Homo sapiens chromosome 15, clone RP11-150L8, com... 38 9.7
214gb|AC103863.2| Homo sapiens chromosome 8, clone RP11-185B9, comp... 38 9.7
215gb|AC015795.20| Homo sapiens chromosome 17, clone RP11-613C6, co... 38 9.7
216gb|AC182470.3| Pan troglodytes BAC clone CH251-440F19 from chrom... 38 9.7
217gb|AC093914.3| Homo sapiens BAC clone RP11-779N9 from 4, complet... 38 9.7
218gb|AC093887.3| Homo sapiens BAC clone RP11-667D12 from 4, comple... 38 9.7
219gb|AC093872.3| Homo sapiens BAC clone RP11-610P19 from 4, comple... 38 9.7
220gb|AC096751.3| Homo sapiens BAC clone RP11-440I14 from 4, comple... 38 9.7
221gb|AC093814.3| Homo sapiens BAC clone RP11-362I16 from 4, comple... 38 9.7
222gb|AC093804.3| Homo sapiens BAC clone RP11-326C15 from 4, comple... 38 9.7
223gb|AC079071.9| Homo sapiens chromosome 8, clone RP11-43G18, comp... 38 9.7
224gb|AC097712.3| Homo sapiens BAC clone RP11-216H12 from 4, comple... 38 9.7
225gb|AC148313.3| Pan troglodytes BAC clone CH251-565C10 from chrom... 38 9.7
226gb|AC012215.11| Homo sapiens chromosome , clone RP11-345N15, com... 38 9.7
227gb|AC015864.5| Homo sapiens chromosome 18, clone RP11-54A1, comp... 38 9.7
228gb|AC026003.10| Homo sapiens chromosome 18, clone RP11-715P20, c... 38 9.7
229gb|AC013545.8| Homo sapiens chromosome 8, clone RP11-414D17, com... 38 9.7
230gb|AC021500.6| Homo sapiens chromosome 8, clone RP11-135K1, comp... 38 9.7
231gb|AC008125.9| Homo sapiens 12 BAC RPCI11-25E2 (Roswell Park Can... 38 9.7
232gb|AC091996.3| Homo sapiens chromosome 5 clone RP11-96G10, compl... 38 9.7
233gb|AC034139.7| Homo sapiens BAC clone RP11-67M24 from 4, complet... 38 9.7
234gb|AC080082.4| Homo sapiens BAC clone RP11-531D14 from 4, comple... 38 9.7
235gb|AC105150.2| Homo sapiens chromosome 8, clone RP11-328K2, comp... 38 9.7
236gb|AC010256.6| Homo sapiens chromosome 5 clone CTC-445M6, comple... 38 9.7
237gb|AC098969.2| Homo sapiens chromosome 3 clone RP11-24O17, compl... 38 9.7
238gb|AC064800.8| Homo sapiens chromosome 18, clone CTD-2001I24, co... 38 9.7
239gb|AC021482.10| Homo sapiens chromosome , clone RP11-15K1, compl... 38 9.7
240gb|AC008567.5| Homo sapiens chromosome 19 clone CTC-543D15, comp... 38 9.7
241gb|AC016065.14| Homo sapiens chromosome 8, clone RP11-115C21, co... 38 9.7
242gb|AC011008.10| Homo sapiens chromosome 8, clone RP11-177H2, com... 38 9.7
243gb|AC018692.9| Homo sapiens BAC clone RP11-555K2 from 4, complet... 38 9.7
244gb|AC010735.11| Homo sapiens BAC clone RP11-395N3 from 2, comple... 38 9.7
245gb|AC093262.2| Homo sapiens chromosome 5 clone RP11-252F20, comp... 38 9.7
246gb|AC027279.4| Homo sapiens chromosome 16 clone RP11-319G9, comp... 38 9.7
247gb|AC024561.5| Homo sapiens chromosome 5 clone CTB-94B10, comple... 38 9.7
248gb|DP000005.1| Macaca mulatta target 1 genomic scaffold 38 9.7
249gb|AC093235.2| Homo sapiens chromosome 19 clone LLNLR-267A4, com... 38 9.7
250gb|AC022089.7| Homo sapiens chromosome 5 clone CTB-125N5, comple... 38 9.7
251gb|AC009032.8| Homo sapiens chromosome 16 clone RP11-140H17, com... 38 9.7
252gb|AC021081.5| Homo sapiens chromosome 5 clone CTC-213A3, comple... 38 9.7
253gb|AC025270.6| Homo sapiens chromosome 15 clone CTD-2165P21 map ... 38 9.7
254gb|AC013436.5| Homo sapiens BAC clone RP11-105B9 from 7, complet... 38 9.7
255gb|AC004985.2| Homo sapiens PAC clone RP5-1165K10 from 7, comple... 38 9.7
256gb|AC010428.7| Homo sapiens chromosome 5 clone CTD-2199C13, comp... 38 9.7
257emb|CR383659.1| Human chromosome 14 DNA sequence BAC R-587D12 of... 38 9.7
258gb|AF297219.1|AF297218S2 Homo sapiens adenomatous polyposis coli... 38 9.7
259gb|AC010530.8| Homo sapiens chromosome 16 clone RP11-167P11, com... 38 9.7
260gb|AC008575.7| Homo sapiens chromosome 5 clone CTC-554D6, comple... 38 9.7
261gb|AC008103.29| Homo sapiens chromosome 22 clone pac699j1 map 22... 38 9.7
262gb|AC092092.6| Homo sapiens chromosome 22 clone ctd-2642e18 map ... 38 9.7
263gb|AC008079.24| Homo sapiens chromosome 22 clone bac519d21 map 2... 38 9.7
264gb|AC007325.51| Homo sapiens chromosome 22 clone b48 map 22q11, ... 38 9.7
265gb|AC008018.20| Homo sapiens chromosome 22 clone b379n11 map 22q... 38 9.7
266gb|AC011718.2| Homo sapiens chromosome 22 clone b2280l11 map 22q... 38 9.7
267gb|AC000360.35| Homo sapiens Chromosome 2 BAC Clone 376a1, compl... 38 9.7
268gb|AC004462.4| Homo sapiens Chromosome 22q11.2 Cosmid Clone 18c3... 38 9.7
269gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 38 9.7
270tpg|BK001591.1| TPA: TPA_exp: Homo sapiens chromosome 17 proxima... 38 9.7
271gb|AC011403.4|AC011403 Homo sapiens chromosome 5 clone CTB-3P13,... 38 9.7
272gb|AC009996.7|AC009996 Homo sapiens chromosome 15 clone RP11-151... 38 9.7
273gb|AC022740.4|AC022740 Homo sapiens chromosome 15, clone RP11-61... 38 9.7
274gb|AC011731.8|AC011731 Homo sapiens, clone RP11-17J14, complete ... 38 9.7
275gb|AC100787.17| Homo sapiens chromosome 17, clone CTD-2589J4, co... 38 9.7
276dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 38 9.7
277dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 38 9.7
278gb|AC007374.6|AC007374 Homo sapiens chromosome 14 clone RP11-325... 38 9.7
279gb|AC024153.22| Homo sapiens 12 BAC RP13-359K18 (Roswell Park Ca... 38 9.7
280gb|AY027896.1|AY027893S4 Homo sapiens voltage-dependent calcium ... 38 9.7
281gb|AC010531.8| Homo sapiens chromosome 16 clone RP11-178L8, comp... 38 9.7
282gb|AC011701.22|AC011701 Homo sapiens 12 BAC RP11-937I21 (Roswell... 38 9.7
283gb|AC096712.3| Homo sapiens BAC clone RP11-1I10 from 4, complete... 38 9.7
284gb|AC093744.2| Homo sapiens BAC clone RP11-25B14 from 4, complet... 38 9.7
285gb|AC104687.3| Homo sapiens BAC clone RP11-123J14 from 4, comple... 38 9.7
286gb|AC010317.5| Homo sapiens chromosome 5 clone CTB-88J14, comple... 38 9.7
287gb|AC078881.5| Homo sapiens BAC clone RP11-130F10 from 4, comple... 38 9.7
288gb|AC097652.2| Homo sapiens BAC clone RP11-138B4 from 4, complet... 38 9.7
289gb|AC017099.11| Homo sapiens BAC clone RP11-542D13 from 2, compl... 38 9.7
290gb|AC015982.9| Homo sapiens BAC clone RP11-554J4 from 2, complet... 38 9.7
291gb|AC017104.8| Homo sapiens BAC clone RP11-562I5 from 2, complet... 38 9.7
292gb|AC098826.4| Homo sapiens BAC clone RP11-629P16 from 2, comple... 38 9.7
293gb|AC097532.3| Homo sapiens BAC clone RP11-725P16 from 2, comple... 38 9.7
294gb|AC079807.5| Homo sapiens BAC clone RP11-760G15 from 2, comple... 38 9.7
295gb|AC093113.4| Homo sapiens BAC clone RP11-789A18 from 2, comple... 38 9.7
296gb|AC079353.5| Homo sapiens BAC clone RP11-1136K13 from 2, compl... 38 9.7
297gb|AC005104.1| Homo sapiens BAC clone CTA-442F18 from 2, complet... 38 9.7
298gb|AC158171.2| Pan troglodytes BAC clone CH251-434I6 from chromo... 38 9.7
299gb|AC145543.3| Homo sapiens chromosome UNKNOWN clone RP11-1278L2... 38 9.7
300gb|AC022079.16|AC022079 Homo sapiens 12 BAC RP11-425D17 (Roswell... 38 9.7
301gb|AC099518.3| Homo sapiens chromosome 16 clone RP11-626G11, com... 38 9.7
302dbj|AP000056.1| Homo sapiens genomic DNA, chromosome 21q22.1, se... 38 9.7
303gb|AC009486.4| Homo sapiens BAC clone RP11-333O1 from 2, complet... 38 9.7
304gb|AC007560.4| Homo sapiens BAC clone RP11-386G20 from 2, comple... 38 9.7
305gb|AC010149.8| Homo sapiens BAC clone RP11-395A23 from 2, comple... 38 9.7
306gb|AC017078.8| Homo sapiens BAC clone RP11-457N9 from 2, complet... 38 9.7
307gb|AC004801.2| Homo sapiens 12 PAC RP1-228P16 (Roswell Park Canc... 38 9.7
308gb|AC015818.32| Homo sapiens chromosome 17, clone RP11-434D2, co... 38 9.7
309gb|AC027277.5| Homo sapiens chromosome 16 clone RP11-27M24, comp... 38 9.7
310gb|AC016647.7| Homo sapiens chromosome 16 clone RP11-89G14, comp... 38 9.7
311gb|AC008436.5|AC008436 Homo sapiens chromosome 5 clone CTC-327B1... 38 9.7
312gb|AC008537.5|AC008537 Homo sapiens chromosome 19 clone CTC-490E... 38 9.7
313gb|AF277315.6| Homo sapiens chromosome X clone RP5-865E18, RP5-1... 38 9.7
314gb|AC107450.5| Homo sapiens chromosome X clone CTD-2173L12 map q... 38 9.7
315gb|AC008121.43| Homo sapiens 12 BAC RP11-407N8 (Roswell Park Can... 38 9.7
316gb|AC139530.3| Homo sapiens chromosome 17, clone RP13-1032I1, co... 38 9.7
317gb|AC139618.3| Homo sapiens 3 BAC RP11-320G10 (Roswell Park Canc... 38 9.7
318gb|AC005007.1|AC005007 Homo sapiens BAC clone GS1-51M12 from 7p2... 38 9.7
319gb|AC005283.2|AC005283 Homo sapiens PAC clone RP5-1039L24 from 7... 38 9.7
320gb|AC008269.4| Homo sapiens BAC clone RP11-95H11 from 2, complet... 38 9.7
321gb|AC132938.9| Homo sapiens chromosome 17, clone RP13-20L14, com... 38 9.7
322gb|AC104651.2| Homo sapiens BAC clone RP11-217P16 from 2, comple... 38 9.7
323gb|AC009235.4|AC009235 Homo sapiens BAC clone RP11-392F24 from Y... 38 9.7
324gb|AC138701.3| Homo sapiens chromosome 15, clone RP11-79C23, com... 38 9.7
325gb|AC124287.10| Homo sapiens chromosome 17, clone RP13-991F5, co... 38 9.7
326gb|AC068769.19| Homo sapiens 3 BAC RP11-14I2 (Roswell Park Cance... 38 9.7
327gb|AC079193.10| Homo sapiens chromosome 8, clone RP11-468H14, co... 38 9.7
328gb|AC106858.12| Homo sapiens chromosome 17, clone RP11-347L15, c... 38 9.7
329gb|AC009268.10| Homo sapiens chromosome 15, clone RP11-74D7, com... 38 9.7
330gb|AC131055.10| Homo sapiens chromosome 17, clone RP11-846F4, co... 38 9.7
331gb|AC011739.7| Homo sapiens BAC clone RP11-68H19 from 2, complet... 38 9.7
332gb|AC007207.22| Homo sapiens 12 BAC RP11-320N7 (Roswell Park Can... 38 9.7
333gb|AY206718.1| Homo sapiens peroxisome proliferative activated r... 38 9.7
334gb|AC024619.16| Homo sapiens chromosome 17, clone RP11-321A17, c... 38 9.7
335gb|AC055863.16| Homo sapiens chromosome 17, clone RP11-478P5, co... 38 9.7
336gb|AC068889.35| Homo sapiens 12 BAC RP11-774I22 (Roswell Park Ca... 38 9.7
337gb|AC107940.13| Homo sapiens chromosome 17, clone RP11-158C19, c... 38 9.7
338gb|AC005183.3| Homo sapiens 12 BAC RP11-288K12 (Roswell Park Can... 38 9.7
339gb|AC024901.29| Homo sapiens 12 BAC RP11-684M17 (Roswell Park Ca... 38 9.7
340gb|AC124159.3| Macaca mulatta clone CH250-392A16, complete sequence 38 9.7
341dbj|AP003252.4| Oryza sativa (japonica cultivar-group) genomic D... 38 9.7
342gb|AC091050.3| Homo sapiens chromosome 8, clone RP11-242F4, comp... 38 9.7
343gb|AC093132.2| Papio anubis clone RP41-51M7, complete sequence 38 9.7
344gb|AC125796.2| Homo sapiens chromosome 16 clone RP11-420N3, comp... 38 9.7
345gb|AC079068.11| Homo sapiens chromosome 15, clone RP11-90A19, co... 38 9.7
346gb|AC024057.5| Homo sapiens chromosome 3 clone RP11-299N3 map 3p... 38 9.7
347gb|AC006011.2| Homo sapiens PAC clone RP5-935K16 from 2, complet... 38 9.7
348gb|AC092567.4| Homo sapiens BAC clone CTD-2010B19 from 2, comple... 38 9.7
349gb|AC006030.2| Homo sapiens BAC clone RP11-1P9 from 2, complete ... 38 9.7
350gb|AC007653.5|AC007653 Homo sapiens chromosome , clone RP11-51A1... 38 9.7
351gb|AC009024.6|AC009024 Homo sapiens chromosome 16 clone RP11-112... 38 9.7
352dbj|AP003734.3| Oryza sativa (japonica cultivar-group) genomic D... 38 9.7
353gb|AC008806.4|AC008806 Homo sapiens chromosome 19 clone CTD-2086... 38 9.7
354dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility co... 38 9.7
355gb|AC009145.4|AC009145 Homo sapiens chromosome 16 clone RP11-556... 38 9.7
356dbj|AP004806.3| Oryza sativa (japonica cultivar-group) genomic D... 38 9.7
357dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic D... 38 9.7
358dbj|BS000239.1| Pan troglodytes chromosome 22 clone:PTB-153E07, ... 38 9.7
359dbj|BS000192.1| Pan troglodytes chromosome 22 clone:PTB-125M11, ... 38 9.7
360dbj|BS000191.1| Pan troglodytes chromosome 22 clone:PTB-015O01, ... 38 9.7
361dbj|BS000123.1| Pan troglodytes chromosome 22 clone:PTB-109N23, ... 38 9.7
362dbj|BS000153.1| Pan troglodytes chromosome 22 clone:RP43-069E18,... 38 9.7
363emb|AL356585.7| Human DNA sequence from clone RP11-341D18 on chr... 38 9.7
364gb|AC007533.2|AC007533 Homo sapiens chromosome 16 clone RPCI-11_... 38 9.7
365gb|AC006530.4|AC006530 Homo sapiens chromosome 14 clone BAC 316E... 38 9.7
366dbj|AK102866.1| Oryza sativa (japonica cultivar-group) cDNA clon... 38 9.7
367gb|AC006020.2|AC006020 Homo sapiens PAC clone RP5-1049N15 from 7... 38 9.7
368emb|AL163303.2|HS21C103 Homo sapiens chromosome 21 segment HS21C103 38 9.7
369dbj|AK067616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 38 9.7
370emb|BX681416.9| Zebrafish DNA sequence from clone CH211-45M15 in... 38 9.7
371gb|AC007687.17| Homo sapiens 3 BAC RP11-494H4 (Roswell Park Canc... 38 9.7
372emb|AL592216.7| Human DNA sequence from clone RP11-402D7 on chro... 38 9.7
373emb|Z82246.2|HSN104C7 Human DNA sequence from clone LL22NC03-104... 38 9.7
374gb|AC007055.3|AC007055 Homo sapiens chromosome 14 clone BAC 201F... 38 9.7
375emb|AL136522.6|CNS01DWA Human chromosome 14 DNA sequence BAC R-1... 38 9.7
376emb|AL121784.5|CNS01DSH Human chromosome 14 DNA sequence BAC R-3... 38 9.7
377dbj|AP003387.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 9.7
378emb|AL121594.6|CNS01DRY Human chromosome 14 DNA sequence BAC R-1... 38 9.7
379emb|AL049780.4|CNS00007 Human chromosome 14 DNA sequence BAC R-9... 38 9.7
380dbj|AP003384.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 9.7
381dbj|AP001720.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 38 9.7
382gb|AC005553.1|AC005553 Homo sapiens chromosome 17, clone hRPK.11... 38 9.7
383dbj|AP000330.3| Homo sapiens genomic DNA, chromosome 21 clone:RP... 38 9.7
384dbj|AP006300.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1... 38 9.7
385dbj|AP003056.2| Homo sapiens genomic DNA, chromosome 11q clone:R... 38 9.7
386dbj|AP006217.1| Homo sapiens genomic DNA, chromosome 18, clone:C... 38 9.7
387dbj|AP006207.1| Homo sapiens genomic DNA, chromosome 8, clone:RP... 38 9.7
388gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 38 9.7
389gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 38 9.7
390gb|L77570.1|HUMDGCRCEN Homo sapiens DiGeorge syndrome critical r... 38 9.7
391gb|DQ196111.1| Chlamydomonas reinhardtii pherophorin-C5 protein ... 38 9.7
392gb|AC005358.1|AC005358 Homo sapiens chromosome 17, clone hRPK.74... 38 9.7
393emb|AL133493.3|HS53I10 Homo sapiens chromosome 21sequence from B... 38 9.7
394emb|AL133492.2|HS101D08 Homo sapiens chromosome 21 sequence from... 38 9.7
395gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome 38 9.7
396gb|AF207953.5| Homo sapiens chromosome 8 clone CTA-389B map q21.... 38 9.7
397ref|NG_000002.1| Homo sapiens immunoglobulin lambda locus (IGL@)... 38 9.7
398emb|AL805899.20| Mouse DNA sequence from clone RP23-400P11 on ch... 38 9.7
399gb|AC005261.2| Homo sapiens chromosome 19, CIT-HSP-444n24, compl... 38 9.7
400emb|BX000449.4| Human DNA sequence from clone RP11-287N12 on chr... 38 9.7
401emb|AL078476.2|HSB7L1C4 Homo sapiens chromosome 21 BAC B7L1C4, c... 38 9.7
402emb|AL137918.4|CNS01DWQ Human chromosome 14 DNA sequence BAC R-4... 38 9.7
403emb|Z68756.1|HSL191F1 Human DNA sequence from clone LA04NC01-191... 38 9.7
404gb|AC090939.2| Homo sapiens chromosome 3 clone RP11-127I14 map 3... 38 9.7
405gb|AC107050.3| Homo sapiens BAC clone RP11-182A9 from 4, complet... 38 9.7
406gb|AC090699.10| Homo sapiens chromosome 17, clone RP11-794C22, c... 38 9.7
407gb|AC134050.2| Homo sapiens chromosome 3 clone RP11-624D20, comp... 38 9.7
408dbj|AP000550.1| Homo sapiens genomic DNA, chromosome 22q11.2, BC... 38 9.7
409dbj|AP000170.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 38 9.7
410dbj|AP004282.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 38 9.7
411dbj|D86246.1| Homo sapiens MHC HLA-DRB1*04 gene, intron 1, parti... 38 9.7
412dbj|AP001169.1| Homo sapiens genomic DNA, chromosome 18q21, dele... 38 9.7
413dbj|AP001464.1| Homo sapiens genomic DNA, chromosome 21q11.1, cl... 38 9.7
414dbj|D87009.1| Homo sapiens immunoglobulin lambda gene locus DNA,... 38 9.7
415dbj|AB020859.1| Homo sapiens genomic DNA of 8p21.3-p22 anti-onco... 38 9.7
416dbj|AP001269.4| Homo sapiens genomic DNA, chromosome 18 clone:RP... 38 9.7
417dbj|AP001160.4| Homo sapiens genomic DNA, chromosome 11q clone:R... 38 9.7

>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence
          Length = 439641

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 58/62 (93%)
 Strand = Plus / Minus

                                                                          
Query: 79     aagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtnaag 138
              ||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||| |||
Sbjct: 233597 aagatgaagaccatcctggcgtcggagacaatggagatcctggaggaggtgacggtgaag 233538

                
Query: 139    gt 140
              ||
Sbjct: 233537 gt 233536



 Score = 85.7 bits (43), Expect = 5e-14
 Identities = 57/62 (91%)
 Strand = Plus / Minus

                                                                          
Query: 79     aagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtnaag 138
              ||||||||||||||||||||||||||||| ||||| |||| |||||||||||| || |||
Sbjct: 343452 aagatgaagaccatcctggcgtcggagacaatggagatcctggaggaggtgacagtgaag 343393

                
Query: 139    gt 140
              ||
Sbjct: 343392 gt 343391



to top

>gb|AY323481.1| Oryza sativa (japonica cultivar-group) ribosomal L9-like protein
           mRNA, complete cds
          Length = 797

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 54/57 (94%)
 Strand = Plus / Plus

                                                                    
Query: 78  gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
           |||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||
Sbjct: 59  gaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacggt 115



to top

>gb|AY072817.1| Oryza sativa ARE1 mRNA, partial cds
          Length = 218

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 54/57 (94%)
 Strand = Plus / Plus

                                                                    
Query: 78  gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
           |||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||
Sbjct: 59  gaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacggt 115



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 54/57 (94%)
 Strand = Plus / Minus

                                                                         
Query: 78       gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
                |||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||
Sbjct: 18585048 gaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacggt 18584992



to top

>gb|BT016560.1| Zea mays clone Contig393 mRNA sequence
          Length = 747

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                         
Query: 79  aagatgaagaccatcctggcgtcggagacgatggacatcccggagg 124
           ||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 45  aagatgaagacgatcctggcgtcggagacgatggacatcccggagg 90



to top

>gb|AY104547.1| Zea mays PCO113533 mRNA sequence
          Length = 927

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 45/46 (97%)
 Strand = Plus / Plus

                                                         
Query: 79  aagatgaagaccatcctggcgtcggagacgatggacatcccggagg 124
           ||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 126 aagatgaagacgatcctggcgtcggagacgatggacatcccggagg 171



to top

>dbj|D29705.1|RICYK17 Oryza sativa mRNA, partial homologous to GAmRNA (cloneF)
          Length = 207

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                    
Query: 78  gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
           |||||||||||||||||||||||| ||||||||||| ||||||||||  ||||||||
Sbjct: 64  gaagatgaagaccatcctggcgtccgagacgatggagatcccggagggtgtgacggt 120



to top

>dbj|AK064936.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000P02, full
           insert sequence
          Length = 886

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                    
Query: 78  gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
           |||||||||||||||||||||| | ||||||||||| |||||||||| |||||||||
Sbjct: 76  gaagatgaagaccatcctggcgcccgagacgatggagatcccggagggggtgacggt 132



to top

>dbj|D83527.1|RICGA3 Rice (YK426) mRNA, complete cds
          Length = 816

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                    
Query: 78  gaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
           |||||||||||||||||||||||| ||||||||||| |||||||||| | |||||||
Sbjct: 72  gaagatgaagaccatcctggcgtccgagacgatggagatcccggaggggttgacggt 128



to top

>gb|AY107309.1| Zea mays PCO113532 mRNA sequence
          Length = 1063

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 82  atgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtnaaggtg 141
           |||||||||||||||||  ||||||||||||||||||| |||| ||| ||||| | ||||
Sbjct: 154 atgaagaccatcctggccacggagacgatggacatccccgagggggtcacggtcacggtg 213

                                              
Query: 142 tcggccaagatgatctcggtgacggggccgcgcgg 176
            |||||||| || |  |||||  ||||||||||||
Sbjct: 214 gcggccaagctggtgacggtggaggggccgcgcgg 248



to top

>gb|BT016425.1| Zea mays clone Contig258 mRNA sequence
          Length = 1002

 Score = 71.9 bits (36), Expect = 7e-10
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 82  atgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtnaaggtg 141
           |||||||||||||||||  | ||||||||||||||||| |||| ||| ||||| | ||||
Sbjct: 57  atgaagaccatcctggccaccgagacgatggacatccccgagggggtcacggtcacggtg 116

                                              
Query: 142 tcggccaagatgatctcggtgacggggccgcgcgg 176
            |||||||| || |  |||||  ||||||||||||
Sbjct: 117 gcggccaagctggtgacggtggaggggccgcgcgg 151



to top

>ref|XM_463799.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 823

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 80  agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
           |||||||||| ||| |||| |||||||||||||| ||||||  || |||||||||
Sbjct: 80  agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 134



to top

>ref|XM_506675.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1435_F07.31
           mRNA
          Length = 914

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 80  agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
           |||||||||| ||| |||| |||||||||||||| ||||||  || |||||||||
Sbjct: 85  agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 139



to top

>gb|AY020397.1| Oryza sativa microsatellite MRG2722 containing (GA)X16, genomic
           sequence
          Length = 232

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 80  agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
           |||||||||| ||| |||| |||||||||||||| ||||||  || |||||||||
Sbjct: 138 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 192



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 80     agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
              |||||||||| ||| |||| |||||||||||||| ||||||  || |||||||||
Sbjct: 183357 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 183303



to top

>dbj|AP004187.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1435_F07
          Length = 139041

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                     
Query: 80     agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
              |||||||||| ||| |||| |||||||||||||| ||||||  || |||||||||
Sbjct: 132384 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 132330



to top

>dbj|AK102186.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086N17, full
           insert sequence
          Length = 914

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 80  agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
           |||||||||| ||| |||| |||||||||||||| ||||||  || |||||||||
Sbjct: 85  agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 139



to top

>dbj|AK062502.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-A12, full
           insert sequence
          Length = 823

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 80  agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggt 134
           |||||||||| ||| |||| |||||||||||||| ||||||  || |||||||||
Sbjct: 80  agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggt 134



to top

>gb|AY910750.1| Gallus gallus glycerophosphodiester phosphodiesterase 2 (GDE2) mRNA,
            complete cds
          Length = 4525

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 83   tgaagaccatcctggcgtcgg 103
            |||||||||||||||||||||
Sbjct: 1265 tgaagaccatcctggcgtcgg 1285



to top

>ref|XM_424003.1| PREDICTED: Gallus gallus similar to hypothetical protein PP1665
           (LOC426346), partial mRNA
          Length = 394

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 83  tgaagaccatcctggcgtcgg 103
           |||||||||||||||||||||
Sbjct: 195 tgaagaccatcctggcgtcgg 215



to top

>gb|AY567837.1| Homo sapiens adrenergic, beta-1-, receptor (ADRB1) gene, complete cds
          Length = 16612

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 78    gaagatgaagaccatcctggc 98
             |||||||||||||||||||||
Sbjct: 14000 gaagatgaagaccatcctggc 13980



to top

>emb|AL390760.25| Human DNA sequence from clone RP11-370F5 on chromosome 9 Contains the
             3' emd of novel gene (MGC11115), the NINJ1 gene for
             ninjurin 1, a novel gene, the 5' end of the PRKWNK2 gene
             for protein kinase, lysine deficient 2 (WNK2, NY-CO-43,
             SDCCAG43, P/OKcl.13) and two CpG islands, complete
             sequence
          Length = 175797

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 78    gaagatgaagaccatcctggc 98
             |||||||||||||||||||||
Sbjct: 71406 gaagatgaagaccatcctggc 71386



to top

>gb|AY130860.1| Homo sapiens SCDK4-binding protein p34SEI1 (SEI1) gene, complete cds
          Length = 5917

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 78   gaagatgaagaccatcctggc 98
            |||||||||||||||||||||
Sbjct: 5913 gaagatgaagaccatcctggc 5893



to top

>gb|AC010271.8| Homo sapiens chromosome 19 clone CTC-492K19, complete sequence
          Length = 160643

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 78     gaagatgaagaccatcctggc 98
              |||||||||||||||||||||
Sbjct: 117311 gaagatgaagaccatcctggc 117331



to top

>dbj|AK074652.1| Homo sapiens cDNA FLJ90171 fis, clone MAMMA1000403, highly similar to
            Homo sapiens CDK4-binding protein p34SEI1 (SEI1) mRNA
          Length = 2113

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 78   gaagatgaagaccatcctggc 98
            |||||||||||||||||||||
Sbjct: 1768 gaagatgaagaccatcctggc 1748



to top

>gb|AC025164.37| Homo sapiens 12 BAC RP11-796E2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 216841

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 78     gaagatgaagaccatcctggc 98
              |||||||||||||||||||||
Sbjct: 114852 gaagatgaagaccatcctggc 114872



to top

>gb|AC005886.2|AC005886 b240g16, complete sequence
          Length = 134011

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 78    gaagatgaagaccatcctggc 98
             |||||||||||||||||||||
Sbjct: 19593 gaagatgaagaccatcctggc 19613



to top

>ref|NM_001037271.1| Gallus gallus glycerophosphodiester phosphodiesterase domain
            containing 5 (GDPD5), mRNA
          Length = 4525

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 83   tgaagaccatcctggcgtcgg 103
            |||||||||||||||||||||
Sbjct: 1265 tgaagaccatcctggcgtcgg 1285



to top

>emb|AL355543.13| Human DNA sequence from clone RP11-86E10 on chromosome 10 Contains the
             ADRB1 gene for adrenergic beta-1- receptor, a
             ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1)
             pseudogene, the gene for CTCL tumor antigen L14-2
             (FLJ10188 DKFZp762M1412 FLJ32946 FLJ37179 FLJ21086
             FLJ32946 FLJ35301), the 5' end of the TDRD1 gene for tudor
             domain containing 1 and three CpG islands, complete
             sequence
          Length = 179009

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 78    gaagatgaagaccatcctggc 98
             |||||||||||||||||||||
Sbjct: 42366 gaagatgaagaccatcctggc 42346



to top

>emb|AJ343217.1|HSA343217 Homo sapiens genomic sequence surrounding NotI site, clone NB6-706R
          Length = 1188

 Score = 42.1 bits (21), Expect = 0.62
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 78  gaagatgaagaccatcctggc 98
           |||||||||||||||||||||
Sbjct: 542 gaagatgaagaccatcctggc 562



to top

>gb|AC005353.1| Homo sapiens chromosome 5, BAC clone 24p24 (LBNL H195), complete
             sequence
          Length = 87114

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    aagatgaagaccatcctggc 98
             ||||||||||||||||||||
Sbjct: 79599 aagatgaagaccatcctggc 79580



to top

>gb|AC006372.2| Homo sapiens BAC clone RP11-331D5 from 7, complete sequence
          Length = 190846

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    agatgaagaccatcctggcg 99
             ||||||||||||||||||||
Sbjct: 47157 agatgaagaccatcctggcg 47176



to top

>emb|CR732637.2|CNS0GS8Y Tetraodon nigroviridis full-length cDNA
          Length = 1330

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 atcccggaggaggtgacggt 134
           ||||||||||||||||||||
Sbjct: 344 atcccggaggaggtgacggt 363



to top

>emb|CR730462.2|CNS0GQKJ Tetraodon nigroviridis full-length cDNA
          Length = 1057

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 atcccggaggaggtgacggt 134
           ||||||||||||||||||||
Sbjct: 343 atcccggaggaggtgacggt 362



to top

>emb|CR727111.2|CNS0GNZH Tetraodon nigroviridis full-length cDNA
          Length = 1062

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 atcccggaggaggtgacggt 134
           ||||||||||||||||||||
Sbjct: 343 atcccggaggaggtgacggt 362



to top

>emb|CR724397.2|CNS0GLW3 Tetraodon nigroviridis full-length cDNA
          Length = 1341

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 atcccggaggaggtgacggt 134
           ||||||||||||||||||||
Sbjct: 345 atcccggaggaggtgacggt 364



to top

>emb|CR724259.2|CNS0GLS9 Tetraodon nigroviridis full-length cDNA
          Length = 1010

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 atcccggaggaggtgacggt 134
           ||||||||||||||||||||
Sbjct: 303 atcccggaggaggtgacggt 322



to top

>emb|CR723898.2|CNS0GLI8 Tetraodon nigroviridis full-length cDNA
          Length = 1056

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 115 atcccggaggaggtgacggt 134
           ||||||||||||||||||||
Sbjct: 343 atcccggaggaggtgacggt 362



to top

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 80      agatgaagaccatcctggcg 99
               ||||||||||||||||||||
Sbjct: 1524257 agatgaagaccatcctggcg 1524276



to top

>gb|AC020894.5| Homo sapiens chromosome 5 clone CTC-293A9, complete sequence
          Length = 166983

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    aagatgaagaccatcctggc 98
             ||||||||||||||||||||
Sbjct: 77580 aagatgaagaccatcctggc 77599



to top

>gb|AC135610.5| Pan troglodytes clone rp43-11n14, complete sequence
          Length = 154701

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 79     aagatgaagaccatcctggc 98
              ||||||||||||||||||||
Sbjct: 149508 aagatgaagaccatcctggc 149489



to top

>gb|AC093259.2| Homo sapiens chromosome 5 clone RP11-229C3, complete sequence
          Length = 183380

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    aagatgaagaccatcctggc 98
             ||||||||||||||||||||
Sbjct: 54131 aagatgaagaccatcctggc 54150



to top

>gb|AC106886.3| Homo sapiens chromosome 16 clone RP11-2C24, complete sequence
          Length = 207950

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    aagatgaagaccatcctggc 98
             ||||||||||||||||||||
Sbjct: 81101 aagatgaagaccatcctggc 81082



 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 96766 agatgaagaccatcctggc 96748



to top

>gb|AC093249.4| Homo sapiens chromosome 16 clone RP11-146F11, complete sequence
          Length = 185664

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 79   aagatgaagaccatcctggc 98
            ||||||||||||||||||||
Sbjct: 4940 aagatgaagaccatcctggc 4959



to top

>emb|AL136296.3|CNS01DW0 Human chromosome 14 DNA sequence BAC R-588D7 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 192404

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 79     aagatgaagaccatcctggc 98
              ||||||||||||||||||||
Sbjct: 186062 aagatgaagaccatcctggc 186043



to top

>emb|AL163151.1|CNS01RIC Human chromosome 14 DNA sequence BAC R-138H18 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 150572

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     aagatgaagaccatcctggc 98
              ||||||||||||||||||||
Sbjct: 142895 aagatgaagaccatcctggc 142914



to top

>ref|XM_550647.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2274

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 4   accctcgcctcctcccccc 22
           |||||||||||||||||||
Sbjct: 203 accctcgcctcctcccccc 221



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 157     tcggtgacggggccgcgcg 175
               |||||||||||||||||||
Sbjct: 1013460 tcggtgacggggccgcgcg 1013478



to top

>gb|DP000014.1| Callithrix jacchus target 1 genomic scaffold
          Length = 1952403

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 864934 agatgaagaccatcctggc 864916



to top

>gb|AC005593.1| Homo sapiens chromosome 5, P1 clone 1369f10 (LBNL H28), complete
             sequence
          Length = 83666

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 33028 agatgaagaccatcctggc 33010



to top

>ref|NG_002433.1| Homo sapiens major histocompatibility complex, class II, DR53 haplotype
              (DR53) on chromosome 6
          Length = 150447

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 141217 agatgaagaccatcctggc 141199



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 4       accctcgcctcctcccccc 22
               |||||||||||||||||||
Sbjct: 4091680 accctcgcctcctcccccc 4091662



to top

>gb|AC163737.3| Pan troglodytes BAC clone CH251-547O12 from chromosome 6, complete
              sequence
          Length = 207116

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 206107 agatgaagaccatcctggc 206125



to top

>gb|AC183296.3| Pan troglodytes BAC clone CH251-352A17 from chromosome 19, complete
             sequence
          Length = 180482

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 19132 agatgaagaccatcctggc 19114



to top

>gb|AC185247.2| Pan troglodytes BAC clone CH251-7D5 from chromosome 15, complete sequence
          Length = 175295

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 166007 agatgaagaccatcctggc 166025



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 157     tcggtgacggggccgcgcg 175
               |||||||||||||||||||
Sbjct: 2979476 tcggtgacggggccgcgcg 2979494



to top

>gb|AC146113.3| Pan troglodytes BAC clone RP43-5I6 from 7, complete sequence
          Length = 223155

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 221458 agatgaagaccatcctggc 221440



to top

>gb|AC182396.3| Pan troglodytes BAC clone CH251-244D19 from chromosome 16, complete
             sequence
          Length = 175231

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 26447 agatgaagaccatcctggc 26465



to top

>gb|AC160564.2| Pan troglodytes BAC clone CH251-542C24 from chromosome 5, complete
             sequence
          Length = 177047

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 40757 agatgaagaccatcctggc 40739



to top

>gb|AY596305.1| Chlamydomonas reinhardtii cell wall protein GP2 (GP2) mRNA, partial
            cds
          Length = 4218

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 5    ccctcgcctcctcccccct 23
            |||||||||||||||||||
Sbjct: 2776 ccctcgcctcctcccccct 2794



to top

>gb|AF235103.5| Homo sapiens chromosome 8 multiple clones map q24.3, complete sequence
          Length = 345524

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 147466 agatgaagaccatcctggc 147484



to top

>gb|AF130343.2| Homo sapiens chromosome 8 multiple clones map q23.3, complete sequence
          Length = 292718

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 49825 agatgaagaccatcctggc 49843



to top

>gb|AF233439.7| Homo sapiens chromosome 8 clones GS1-24F4, CTD-2629I16 map p23.1,
             complete sequences
          Length = 231283

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 98740 agatgaagaccatcctggc 98758



to top

>gb|AF205406.5| Homo sapiens chromosome 8 clone SCb-633e22 map p23.1, complete sequence
          Length = 168907

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 51419 agatgaagaccatcctggc 51437



to top

>gb|AF298854.5| Homo sapiens chromosome 8 clone SCb-207i3 map p23.1, complete sequence
          Length = 110283

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 61447 agatgaagaccatcctggc 61465



to top

>gb|AC183680.3| Pan troglodytes BAC clone CH251-425K14 from chromosome 9, complete
             sequence
          Length = 163619

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 26319 agatgaagaccatcctggc 26301



to top

>gb|AC157088.2| Pan troglodytes BAC clone CH251-497H13 from chromosome unknown, complete
              sequence
          Length = 220527

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 197754 agatgaagaccatcctggc 197772



to top

>gb|AF254983.3| Homo sapiens chromosome 21 clone RP11-589M2 map p11-q21.1, complete
             sequence
          Length = 190711

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 54196 agatgaagaccatcctggc 54178



to top

>gb|AC005531.2| Homo sapiens PAC clone RP4-701O16 from 7, complete sequence
          Length = 161910

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 80339 agatgaagaccatcctggc 80357



to top

>gb|AC147336.2| Pan troglodytes BAC clone CH251-70I12 from Y, complete sequence
          Length = 194849

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 105774 agatgaagaccatcctggc 105792



to top

>gb|AY261359.1| Bovine herpesvirus 5 strain SV507/99, complete genome
          Length = 138390

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 114   catcccggaggaggtgacg 132
             |||||||||||||||||||
Sbjct: 33647 catcccggaggaggtgacg 33629



to top

>gb|AC146252.3| Pan troglodytes BAC clone RP43-31D18 from 7, complete sequence
          Length = 155242

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 36077 agatgaagaccatcctggc 36095



to top

>gb|AC131649.2| Homo sapiens chromosome 16 clone RP11-609N14, complete sequence
          Length = 182518

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 135472 agatgaagaccatcctggc 135490



to top

>gb|AF030876.2| Homo sapiens chromosome X clone Qc-8D3, RP4-671D9, I104-219D,
             L110-C1837 map q28, complete sequence
          Length = 112752

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 71458 agatgaagaccatcctggc 71476



to top

>gb|AC127381.4| Homo sapiens BAC clone RP11-1360M22 from UL, complete sequence
          Length = 241627

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 214288 agatgaagaccatcctggc 214306



to top

>gb|AC026882.6| Homo sapiens chromosome 3 clone RP11-211K13 map 3p, complete sequence
          Length = 162422

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 15897 agatgaagaccatcctggc 15915



to top

>gb|AC146133.3| Pan troglodytes BAC clone RP43-38C10 from 7, complete sequence
          Length = 168763

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 29358 agatgaagaccatcctggc 29340



to top

>gb|AC093582.3| Homo sapiens BAC clone RP13-254B10 from 7, complete sequence
          Length = 91224

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 47290 agatgaagaccatcctggc 47308



to top

>gb|AC005589.1| Homo sapiens BAC clone RP11-161H12 from 7, complete sequence
          Length = 132077

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 73720 agatgaagaccatcctggc 73738



to top

>gb|AC095044.3| Homo sapiens BAC clone RP11-132B16 from 7, complete sequence
          Length = 134184

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 62013 agatgaagaccatcctggc 61995



to top

>gb|AC006333.3| Homo sapiens BAC clone RP11-390E23 from 7, complete sequence
          Length = 187532

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 102492 agatgaagaccatcctggc 102474



to top

>gb|AC073330.6| Homo sapiens BAC clone RP11-409J21 from 7, complete sequence
          Length = 155704

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 62251 agatgaagaccatcctggc 62269



to top

>gb|AC006088.1| Homo sapiens 12q24.1 PAC RP1-305I20 (Roswell Park Cancer Institute
             Human PAC Library) complete sequence
          Length = 122605

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 21565 agatgaagaccatcctggc 21583



to top

>gb|AC145773.1| Pan troglodytes BAC clone RP43-32M11 from 7, complete sequence
          Length = 190630

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 131724 agatgaagaccatcctggc 131742



to top

>emb|AL034420.16|HS1112F19 Human DNA sequence from clone RP5-1112F19 on chromosome 20q13.13-13.2
             Contains the SALL4 gene for sal-like 4 (Drosophila)and a
             putative CpG island, complete sequence
          Length = 116368

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 29743 agatgaagaccatcctggc 29725



to top

>emb|Z94161.5|HSN102C10 Human DNA sequence from clone LL22NC03-102C10 on chromosome 22q13
            Contains the first exon of the PPARA gene for peroxisome
            proliferative activated receptor alpha, an EST, GSSs and
            a putative CpG island, complete sequence
          Length = 44134

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 80   agatgaagaccatcctggc 98
            |||||||||||||||||||
Sbjct: 6626 agatgaagaccatcctggc 6608



to top

>emb|Z82182.2|HSE90C2 Human DNA sequence from clone LL22NC01-90C2 on chromosome 22 Contains
             an STSs and GSSs, complete sequence
          Length = 39004

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 33797 agatgaagaccatcctggc 33779



to top

>gb|AC183832.3| Pan troglodytes BAC clone CH251-260G12 from chromosome 7, complete
             sequence
          Length = 179012

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 48814 agatgaagaccatcctggc 48832



to top

>emb|AL390248.10| Human DNA sequence from clone RP11-492M23 on chromosome 10 Contains the
             gene for a novel protein and a ribosomal protein L21
             (RPL21)(L21) pseudogene, complete sequence
          Length = 125798

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 85305 agatgaagaccatcctggc 85323



to top

>emb|BX296568.4| Human DNA sequence from clone DASS-233C19 on chromosome 6, complete
             sequence
          Length = 87738

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 53900 agatgaagaccatcctggc 53882



to top

>emb|BX293535.3| Human DNA sequence from clone RP4-752I6 on chromosome 1 Contains the 5'
             end of the WASF2 gene for WAS protein family, member 2 and
             a novel gene, complete sequence
          Length = 71971

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 14030 agatgaagaccatcctggc 14048



to top

>emb|AL607035.12| Human DNA sequence from clone RP11-570G20 on chromosome 10 Contains a
             ribosomal protein L15 (RPL15) pseudogene, the 5' end of a
             novel gene (CGI-18), a novel gene and a CpG island,
             complete sequence
          Length = 71903

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 17861 agatgaagaccatcctggc 17843



to top

>emb|AL591543.22| Human DNA sequence from clone RP13-198D9 on chromosome 9 Contains a novel
               gene (KIAA2015), a novel gene, a tyrosine
              3-monooxygenase/tryptophan 5-monooxygenase activation
              protein, beta polypeptide (YWHAB) pseudogene and two CpG
              islands, complete sequence
          Length = 179501

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 158682 agatgaagaccatcctggc 158664



to top

>emb|AL592525.10| Human DNA sequence from clone RP11-111G23 on chromosome 9 Contains a
              pseudogene similar to part of contactin associated
              protein-like 3 (CNTNAP3) and a pseudogene similar to part
              of vomeronasal 2 family, complete sequence
          Length = 142805

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 103418 agatgaagaccatcctggc 103436



to top

>emb|AL590683.16| Human DNA sequence from clone RP11-10N16 on chromosome 1 Contains the
             5' end of the IL22RA1 gene for interleukin 22 receptor
             alpha 1, the IL28RA gene for interleukin 28 receptor alpha
             (interferon, lambda receptor), a novel gene and the 3' end
             of a novel gene, complete sequence
          Length = 164684

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 13524 agatgaagaccatcctggc 13542



to top

>gb|AC183767.2| Pan troglodytes BAC clone CH251-373L9 from chromosome 9, complete
              sequence
          Length = 162355

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 130360 agatgaagaccatcctggc 130342



to top

>emb|AL450364.12| Human DNA sequence from clone RP11-499P20 on chromosome 10 Contains
             part of the CACNB2 gene for calcium channel
             voltage-dependent beta 2 subunit and the 3' end of a novel
             gene, complete sequence
          Length = 38089

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 22126 agatgaagaccatcctggc 22144



to top

>emb|AL449266.17| Human DNA sequence from clone RP11-475E11 on chromosome 1 Contains the
             3' end of the STXBP3 gene for syntaxin binding protein 3,
             a novel gene (MGC26989), a novel gene, the gene for LGN
             protein, the gene for Mid-1-related chloride channel 1
             (MCLC) and the 3' end of novel gene (KIAA0893), complete
             sequence
          Length = 182553

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 62231 agatgaagaccatcctggc 62213



to top

>emb|AL390065.20| Human DNA sequence from clone RP11-520M5 on chromosome 4, complete
             sequence
          Length = 157119

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 15983 agatgaagaccatcctggc 16001



to top

>emb|AL365364.19| Human DNA sequence from clone RP11-624L12 on chromosome 10 Contains a
             ribosomal protein L17 (RPL17) pseudogene and the 3'end of
             the FER1L3 gene for fer-1-like 3, myoferlin (C. elegans),
             complete sequence
          Length = 173864

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 18765 agatgaagaccatcctggc 18747



to top

>emb|AL365357.12| Human DNA sequence from clone RP4-765C7 on chromosome 1 Contains part
             of the RASAL2 gene for RAS protein activator like 2, a
             novel gene and a ribosomal protein S14 (RPS14) pseudogene,
             complete sequence
          Length = 108288

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 25598 agatgaagaccatcctggc 25616



to top

>emb|AL390298.13| Human DNA sequence from clone RP11-75I24 on chromosome 20 Contains
             ESTs, STSs and GSSs, complete sequence
          Length = 49208

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 43019 agatgaagaccatcctggc 43001



to top

>emb|AL365356.13| Human DNA sequence from clone RP11-336A10 on chromosome 10 Contains the
             ASB13 gene for ankyrin repeat and SOCS box-containing 13,
             the 5' end of gene FLJ20360 (KIAA2006 FLJ34073 FLJ12904
             FLJ23361 FLJ21109), three novel genes, a ribosomal protein
             L23a (RPL23A) pseudogene, the 5' end of a novel gene and
             two CpG islands, complete sequence
          Length = 167676

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 80497 agatgaagaccatcctggc 80479



to top

>emb|AL390917.12| Human DNA sequence from clone RP11-247O12 on chromosome X, complete
            sequence
          Length = 20318

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 80   agatgaagaccatcctggc 98
            |||||||||||||||||||
Sbjct: 1382 agatgaagaccatcctggc 1400



to top

>emb|AL390071.9| Human DNA sequence from clone RP11-98D3 on chromosome 13 Contains part
             of the NEAB gene for neurobeachin (BCL8B FLJ10197
             KIAA1544), the MAB21L1 gene for mab-21-like 1 (C. elegans)
             (CAGR1) and three CpG islands, complete sequence
          Length = 170998

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 16885 agatgaagaccatcctggc 16903



to top

>emb|AL359180.17| Human DNA sequence from clone RP11-320G21 on chromosome 13, complete
              sequence
          Length = 159229

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 142994 agatgaagaccatcctggc 143012



to top

>emb|AL359380.16| Human DNA sequence from clone RP11-642N5 on chromosome 6 Contains the
             3' end of a novel gene and the 5' end of the TINAG gene
             for tubulointerstitial nephritis antigen, complete
             sequence
          Length = 188826

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 60954 agatgaagaccatcctggc 60972



 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 49876 agatgaagaccatcctggc 49894



to top

>emb|AL357974.16| Human DNA sequence from clone RP11-398M15 on chromosome 1 Contains a
             novel gene, complete sequence
          Length = 93165

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 90744 agatgaagaccatcctggc 90726



to top

>emb|AL358875.13| Human DNA sequence from clone RP11-312H18 on chromosome 1, complete
             sequence
          Length = 171635

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 30029 agatgaagaccatcctggc 30047



to top

>gb|AC012046.11| Homo sapiens chromosome 10 clone RP11-312P12, complete sequence
          Length = 198781

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 78843 agatgaagaccatcctggc 78861



to top

>emb|AL355529.21| Human DNA sequence from clone RP11-85C15 on chromosome 10 Contains the
             5' end of the MKI67 gene for antigen identified by
             monoclonal antibody Ki-67 and three CpG islands, complete
             sequence
          Length = 140466

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 98550 agatgaagaccatcctggc 98532



to top

>emb|AL353622.33| Human DNA sequence from clone RP5-1092A3 on chromosome 1 Contains the 5'
              end of the DNAJC8 gene for DnaJ (Hsp40) homolog subfamily C
              member 8, the ATPIF1 gene for ATPase inhibitory factor 1,
              the SESN2 gene for sestrin 2, the gene for a novel protein
              (FLJ20045) and a CpG island, complete sequence
          Length = 157243

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 116370 agatgaagaccatcctggc 116352



to top

>emb|AL353729.17| Human DNA sequence from clone RP11-290L7 on chromosome 9 Contains the 3'
              end of the CNTNAP3 gene for contactin associated
              protein-like 3, a TGF beta-inducible nuclear protein 1
              (TINP1) pseudogene and a RNA binding motif protein 17
              (RBM17) pseudogene, complete sequence
          Length = 195668

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 162623 agatgaagaccatcctggc 162641



to top

>emb|AL354857.13| Human DNA sequence from clone RP11-346N8 on chromosome 6 Contains the
             3' end of the EPHA7 gene for ephrin receptor A7, complete
             sequence
          Length = 199223

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 13550 agatgaagaccatcctggc 13568



to top

>emb|AL353791.7| Human DNA sequence from clone RP11-475B17 on chromosome 9 Contains the
             3' end of novel protein similar to contactin associated
             protein-like 3 (CNTNAP3) and a pseudogene similar to part
             of vomeronasal 2 family, complete sequence
          Length = 208233

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 52915 agatgaagaccatcctggc 52933



to top

>emb|AL353626.5| Human DNA sequence from clone RP11-318K12 on chromosome 9 Contains a
             novel gene, a pseudogene similar to part of membrane
             component, chromosome 17, surface marker 2 (ovarian
             carcinoma antigen CA125) (M17S2), a pseudogene similar to
             part of novel gene (ankyrin-related UNQ2430) and a CpG
             island, complete sequence
          Length = 176470

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 68583 agatgaagaccatcctggc 68601



to top

>emb|AL353895.4| Human DNA sequence from clone RP11-503K16 on chromosome 9 Contains the 3'
              end of the ADAMTSL1 gene for ADAMTS-like (ADAMTSR1,
              MGC40139) and a ras-related protein family pseudogene,
              complete sequence
          Length = 163163

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 107147 agatgaagaccatcctggc 107129



to top

>emb|AL161450.14| Human DNA sequence from clone RP11-39K24 on chromosome 9 Contains the
             3' end of the JAK2 gene for Janus kinase 2 (a protein
             tyrosine kinase), a casein kinase pseudogene, a
             trans-prenyltransferase (TPT) pseudogene, a NADH
             dehydrogenase 6 (MTND6) pseuodgene, a  NADH dehydrogenase
             1 (MTND1) pseudogene, a cytochrome c oxidase I (MTCO1)
             pseudogene, a  cytochrome c oxidase II (MTCO2) pseudogene,
             an ATP synthase 6 (MTATP6) pseudogene, a cytochrome c
             oxidase III (MTCO3) pseudogene, a NADH dehydrogenase 4
             (MTND4)pseudogene, a pseudogene similar to part of NADH
             dehydrogenase 5 (MTND5), a transcription factor 3 (E2A
             immunoglobulin enhancer binding factors E12/E47) (TCF3)
             pseudogene, an immunoglobulin heavy constant epsilon
             pseudogene 2 (IGHEP2), a novel gene, the INSL6 gene for
             insulin-like 6 (RIF1) and 4 CpG islands, complete sequence
          Length = 171146

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 80211 agatgaagaccatcctggc 80193



to top

>gb|AC183286.3| Pan troglodytes BAC clone CH251-56I13 from chromosome 15, complete
             sequence
          Length = 164317

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 88636 agatgaagaccatcctggc 88654



to top

>emb|AL159158.12| Human DNA sequence from clone RP11-81G4 on chromosome 13 Contains the
             5' end of a novel gene (KIAA0916) and two CpG islands,
             complete sequence
          Length = 154682

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 36768 agatgaagaccatcctggc 36786



to top

>emb|AL139801.17| Human DNA sequence from clone RP11-247M1 on chromosome 13 Contains a
             novel FLJ21562 containing gene, a novel gene, a novel
             pseudogene and a CpG island, complete sequence
          Length = 145481

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 77449 agatgaagaccatcctggc 77431



to top

>emb|AL139350.17| Human DNA sequence from clone RP11-307O10 on chromosome 20 Contains part
              of a novel gene, an EST, an STS and GSSs, complete sequence
          Length = 181585

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 135429 agatgaagaccatcctggc 135447



to top

>gb|AC091134.7| Homo sapiens chromosome 17, clone RP11-646F1, complete sequence
          Length = 156583

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 78354 agatgaagaccatcctggc 78336



to top

>emb|AL157782.8| Human DNA sequence from clone RP11-127E22 on chromosome 10 Contains
             part of a novel gene (LOC196051), complete sequence
          Length = 46185

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 17660 agatgaagaccatcctggc 17678



to top

>emb|AL136981.22| Human DNA sequence from clone RP11-526D8 on chromosome 9 Contains the
             5' end of the gene for coiled-coil protein (BICD2)
             (KIAA0699), a novel gene, a eukaryotic translation
             elongation factor 1 delta (guanine nucleotide exchange
             protein) (EEF1D) pseudogene, the gene for a novel KRAB
             box-containing C2H2 type zinc finger protein, a novel
             gene, a pseudogene similar to part of sorting nexin
             associated golgi protein 1 (SNAG1), a novel pseudogene, a
             melanoma antigen pseudogene and three CpG islands,
             complete sequence
          Length = 182280

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 46321 agatgaagaccatcctggc 46339



 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 14271 agatgaagaccatcctggc 14289



to top

>gb|AC023951.19| Homo sapiens chromosome 15, clone RP11-815C16, complete sequence
          Length = 186341

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 131550 agatgaagaccatcctggc 131532



to top

>emb|AL121781.38|HSJ1164C1 Human DNA sequence from clone RP5-1164C1 on chromosome 20 Contains
             (part of) two putative novel genes, ESTs, STSs and GSSs,
             complete sequence
          Length = 178568

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 40367 agatgaagaccatcctggc 40385



to top

>emb|AL118502.38|HSA371L19 Human DNA sequence from clone RP11-371L19 on chromosome 20 Contains the
             C20orf54 gene, the C20orf55 gene, the RPS10L gene for
             ribosomal protein S10-like and five CpG islands, complete
             sequence
          Length = 126259

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 50954 agatgaagaccatcctggc 50936



to top

>emb|AL121895.26|HSA234K24 Human DNA sequence from clone RP11-234K24 on chromosome 20 Contains a
             novel gene, the 3' end of the EPB41L1 gene for the
             erythrocyte membrane protein band 4.1-like protein, the
             C20orf4 gene for chromosome 20 open reading frame 4 and a
             CpG island, complete sequence
          Length = 153192

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 14871 agatgaagaccatcctggc 14889



to top

>emb|AL121965.19|HSJ161I14 Human DNA sequence from clone RP1-161I14 on chromosome 6q16.1-16.3
             Contains part of the RNAH gene for an RNA helicase,
             complete sequence
          Length = 113022

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 36130 agatgaagaccatcctggc 36112



to top

>emb|AL133551.13| Human DNA sequence from clone RP11-57G10 on chromosome 10 Contains a
             ribosomal protein L21 (RPL21) pseudogene, the gene for
             J-domain containing protein 1 (JDP1), a ribosomal protein
             L12 (RPL12) pseudogene, a novel pseudogene, the SIRT1 gene
             for sirtuin (silent mating type information regulation 2
             homolog) 1 (S. cerevisiae), the 3' end of the gene for a
             novel protein (KIAA0032) and two CpG island, complete
             sequence
          Length = 175940

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 83335 agatgaagaccatcctggc 83353



to top

>emb|AL117375.12|HSDJ80E14 Human DNA sequence from clone RP1-80E14 on chromosome 20 Contains ESTs,
             STSs and GSSs, complete sequence
          Length = 114856

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 72253 agatgaagaccatcctggc 72271



to top

>emb|AL109811.40|HSJ635E18 Human DNA sequence from clone RP4-635E18 on chromosome 1p36.11-36.31
            Contains the TARDBP gene for TAR DNA binding protein, the
            MASP2 gene for mannan-binding lectin serine protease 2,
            the SRM gene for spermidine synthase, the PMSCL2 gene for
            100kDa  polymyositis/scleroderma autoantigen 2 (FLJ41371,
            FLJ36636, two novel genes (FLJ30609), the 3' end of the
            FRAP1 gene for FK506 binding protein 12-rapamycin
            associated protein 1 and a CpG island, complete sequence
          Length = 112769

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 80   agatgaagaccatcctggc 98
            |||||||||||||||||||
Sbjct: 2845 agatgaagaccatcctggc 2863



to top

>emb|AL109935.39|HSJ1022P6 Human DNA sequence from clone RP5-1022P6 on chromosome 20 Contains the
              RPS18P1 gene for ribosomal protein S18 pseudogene 1, the
              gene for a novel protein (KIAA1434), an EIF4E (eukaryotic
              translation initiation factor 4E) pseudogene, three novel
              genes and two CpG islands, complete sequence
          Length = 178601

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 128857 agatgaagaccatcctggc 128875



to top

>emb|AL109940.18|HSJ421D16 Human DNA sequence from clone RP3-421D16 on chromosome 6q26-27 Contains
             part of the gene for smooth muscle cell associated protein
             2 (SMAP2) or secreted modular calcium binding protein 2
             (SMOC2) and two CpG islands, complete sequence
          Length = 110603

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 40919 agatgaagaccatcctggc 40901



to top

>emb|AL109945.15|HSJ811H24 Human DNA sequence from clone RP4-811H24 on chromosome 1p34.1-34.3
             Contains the 3' end of LCK gene for lymphocyte-specific
             protein tyrosine kinase, HDAC1 gene for histone
             deacetylase 1, the MLP gene for MARCKS-like protein,
             STK22C gene for serine/threonine kinase 22C
             (spermiogenesis associated), a novel gene (FLJ43105), five
             novel genes and four CpG islands, complete sequence
          Length = 110526

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 75269 agatgaagaccatcctggc 75251



to top

>emb|AL050321.11|HSJ717M23 Human DNA sequence from clone RP4-717M23 on chromosome 20 Contains the
             CSRP2BP gene for CSRP2 binding protein, a chromosome 7
             open reading frame 24 (C7orf24) pseudogene and two CpG
             islands, complete sequence
          Length = 101589

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 80017 agatgaagaccatcctggc 80035



to top

>emb|AL049798.7|HSJ797M17 Human DNA sequence from clone RP4-797M17 on chromosome 1q22-24.3
             Contains the DPT gene for dermatopontin, complete sequence
          Length = 74822

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 55273 agatgaagaccatcctggc 55255



to top

>emb|AL049647.7|HSJ1027G4 Human DNA sequence from clone RP5-1027G4 on chromosome 20 Contains part
              of the SLC24A3 gene for solute carrier family 24
              (sodium/potassium/calcium exchanger) member 3 and a novel
              gene, complete sequence
          Length = 164845

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 159825 agatgaagaccatcctggc 159843



to top

>emb|AL034417.14|HS215D11 Human DNA sequence from clone CTA-215D11 on chromosome 1p36.12-36.33
             Contains the PARK7 gene for Parkinson disease (autosomal
             recessive, early onset) 7, a novel gene, gene 33/Mig-6
             (MIG-6), a ribosomal protein L7a (RPL7A) pseudogene, the
             5' end of a novel gene (FLJ26758) and two CpG islands,
             complete sequence
          Length = 122279

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 50658 agatgaagaccatcctggc 50640



to top

>emb|AL031943.11|HS223B1 Human DNA sequence from clone RP1-223B1 on chromosome 6p24.1-25.3
             Contains the 3' end of a putative novel gene, complete
             sequence
          Length = 126281

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 17736 agatgaagaccatcctggc 17754



to top

>emb|AL034545.2|HS542O23 Human DNA sequence from clone RP4-542O23 on chromosome Xq21.1-21.33,
             complete sequence
          Length = 76277

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 29493 agatgaagaccatcctggc 29475



to top

>emb|AL031846.2|HS742C19 Human DNA sequence from clone RP4-742C19 on chromosome 22q12.3-13.1,
            complete sequence
          Length = 122748

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 80   agatgaagaccatcctggc 98
            |||||||||||||||||||
Sbjct: 7133 agatgaagaccatcctggc 7115



to top

>emb|AL031177.1|HS889N15 Human DNA sequence from clone RP5-889N15 on chromosome Xq22.1-22.3
             Contains the 3' end of a novel gene (MGC44287), the PSMD10
             gene for proteasome (prosome, macropain) 26S subunit,
             non-ATPase, 10 (p28), the AUTL2 gene for AUT-like 2,
             cysteine endopeptidase (S. cerevisiae) (APG4A, MGC43691),
             the 3' end of the COL4A6 gene for collagen, type IV, alpha
             6 and a CpG island, complete sequence
          Length = 123395

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 65599 agatgaagaccatcctggc 65581



to top

>emb|AL021997.1|HS874C20 Human DNA sequence from clone RP5-874C20 on chromosome 6p22.1-22.3
             Contains the 5' end of a novel protein similar to zinc
             finger protein 306 (ZNF306, ZFP47), the gene for a novel
             C2H2 type zinc finger protein, a novel gene, a zinc finger
             protein SRE-ZBP pseudogene and a CpG island, complete
             sequence
          Length = 97847

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 45234 agatgaagaccatcctggc 45216



to top

>gb|AC079842.19| Homo sapiens 12q BAC RP11-989K8 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 133000

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 51886 agatgaagaccatcctggc 51904



to top

>emb|AL163202.2|HS21C002 Homo sapiens chromosome 21 segment HS21C002
          Length = 340000

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 37728 agatgaagaccatcctggc 37710



to top

>gb|AC087499.12| Homo sapiens chromosome 17, clone RP11-218E15, complete sequence
          Length = 195591

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 27294 agatgaagaccatcctggc 27312



to top

>gb|AC069045.11| Homo sapiens chromosome 15, clone RP11-111C2, complete sequence
          Length = 154859

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 14999 agatgaagaccatcctggc 15017



to top

>emb|BX842583.1| Mycobacterium tuberculosis H37Rv complete genome; segment 12/13
          Length = 349606

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 4      accctcgcctcctcccccc 22
              |||||||||||||||||||
Sbjct: 282246 accctcgcctcctcccccc 282228



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 157     tcggtgacggggccgcgcg 175
               |||||||||||||||||||
Sbjct: 1158215 tcggtgacggggccgcgcg 1158233



to top

>emb|BX248346.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 13/14
          Length = 316050

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 4      accctcgcctcctcccccc 22
              |||||||||||||||||||
Sbjct: 285769 accctcgcctcctcccccc 285751



to top

>emb|AL163201.2|HS21C001 Homo sapiens chromosome 21 segment HS21C001
          Length = 281116

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 102755 agatgaagaccatcctggc 102737



to top

>emb|AL133295.16| Human DNA sequence from clone RP5-1137O17 on chromosome 11p12-14.2
             Contains part of a gene similar to putative
             mitochondrialninner membrane protease subnunit 2, a novel
             mRNA, ESTs and GSSs, complete sequence
          Length = 104333

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 54553 agatgaagaccatcctggc 54571



to top

>emb|AL137064.6| Human DNA sequence from clone RP5-863G3 on chromosome 6 Contains the
             HLA-DRB1*04011 (major histocompatibility complex, class
             II, DR beta 1) gene, an autosomal highly conserved
             pseudogene, ESTs, STSs and GSSs, complete sequence
          Length = 95642

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 50770 agatgaagaccatcctggc 50752



to top

>gb|AC074029.15| Homo sapiens 12 BAC RP11-474C8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 160943

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 45835 agatgaagaccatcctggc 45817



to top

>gb|AC053481.13| Homo sapiens chromosome 17, clone RP11-51L5, complete sequence
          Length = 176235

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 81217 agatgaagaccatcctggc 81199



to top

>gb|AC026634.11| Homo sapiens chromosome , clone RP11-639E23, complete sequence
          Length = 164858

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 164523 agatgaagaccatcctggc 164541



to top

>emb|BX538311.1|HSM806575 Homo sapiens genomic DNA; cDNA DKFZp686E08130 (from clone
            DKFZp686E08130)
          Length = 4431

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 80   agatgaagaccatcctggc 98
            |||||||||||||||||||
Sbjct: 4362 agatgaagaccatcctggc 4380



to top

>gb|AC024217.19| Homo sapiens 3 BAC RP11-18H7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 19501

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 10951 agatgaagaccatcctggc 10933



to top

>gb|AC009095.7| Homo sapiens chromosome 16 clone RP11-430J6, complete sequence
          Length = 84166

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 60574 agatgaagaccatcctggc 60592



to top

>emb|BX001034.6| Human DNA sequence from clone RP11-21H4 on chromosome 9 Contains a
             novel pseudogene and a novel zinc finger pseudogene,
             complete sequence
          Length = 173100

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 66203 agatgaagaccatcctggc 66185



to top

>gb|AC146768.3| Callithrix jacchus clone CH259-491G15, complete sequence
          Length = 119777

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 105207 agatgaagaccatcctggc 105189



to top

>gb|AC010834.19| Homo sapiens chromosome 8, clone RP11-10N23, complete sequence
          Length = 175967

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 96444 agatgaagaccatcctggc 96462



to top

>gb|AC079018.10| Homo sapiens chromosome 8, clone RP11-161B1, complete sequence
          Length = 168702

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 32765 agatgaagaccatcctggc 32783



to top

>gb|AC126178.6| Homo sapiens 12 BAC RP11-567C2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 127439

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 17760 agatgaagaccatcctggc 17778



to top

>gb|AC105230.10| Homo sapiens chromosome 8, clone RP11-699F21, complete sequence
          Length = 151517

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 68987 agatgaagaccatcctggc 69005



to top

>gb|AC060798.10| Homo sapiens chromosome 17, clone RP11-615P24, complete sequence
          Length = 171994

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 74426 agatgaagaccatcctggc 74444



to top

>gb|AC125634.1| Homo sapiens 3 BAC RP11-512E23 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 162478

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 87568 agatgaagaccatcctggc 87586



to top

>gb|AC008813.6| Homo sapiens chromosome 19 clone CTD-2102P23, complete sequence
          Length = 162914

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 32887 agatgaagaccatcctggc 32905



to top

>gb|AC098964.4| Homo sapiens chromosome 8 clone RP11-141M14 map 8p21-p11, complete
             sequence
          Length = 151646

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 35241 agatgaagaccatcctggc 35259



to top

>gb|AF279873.4| Homo sapiens chromosome 8 clone RP1-25D10, RP1-273G13, RP1-103E7 map
              8p21-p11, complete sequence
          Length = 301232

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 242692 agatgaagaccatcctggc 242710



to top

>dbj|BS000549.1| Pan troglodytes chromosome Y clone:PTB-240N05, complete sequences
          Length = 148562

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 113249 agatgaagaccatcctggc 113231



to top

>gb|AC011031.12| Homo sapiens chromosome 8, clone RP11-345I19, complete sequence
          Length = 183771

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 62336 agatgaagaccatcctggc 62318



to top

>gb|AC104127.2| Homo sapiens chromosome 5 clone RP11-69G16, complete sequence
          Length = 161764

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 141118 agatgaagaccatcctggc 141136



to top

>gb|AC079900.15| Homo sapiens 3 BAC RP11-456E14 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 74817

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 17694 agatgaagaccatcctggc 17712



to top

>gb|AC183380.3| Pan troglodytes BAC clone CH251-605G19 from chromosome 7, complete
             sequence
          Length = 223844

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 30981 agatgaagaccatcctggc 30999



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 80       agatgaagaccatcctggc 98
                |||||||||||||||||||
Sbjct: 16502129 agatgaagaccatcctggc 16502147



to top

>gb|AC182642.2| Pan troglodytes BAC clone CH251-216C21 from chromosome 21, complete
             sequence
          Length = 187371

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 42192 agatgaagaccatcctggc 42174



to top

>gb|AC145338.7| Pan troglodytes clone rp43-47g15, complete sequence
          Length = 202653

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 37130 agatgaagaccatcctggc 37112



to top

>gb|AC110743.4| Homo sapiens chromosome 18, clone CTD-3153M21, complete sequence
          Length = 78507

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 18897 agatgaagaccatcctggc 18879



to top

>gb|AC125393.6| Pan troglodytes clone rp43-22m15, complete sequence
          Length = 187256

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 123657 agatgaagaccatcctggc 123675



to top

>gb|AC129097.27| Papio anubis clone rp41-53o7, complete sequence
          Length = 186113

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 69833 agatgaagaccatcctggc 69851



to top

>gb|AC021558.10| Homo sapiens chromosome 8, clone RP11-746L20, complete sequence
          Length = 171582

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 86790 agatgaagaccatcctggc 86772



to top

>gb|AC108456.7| Homo sapiens chromosome 11, clone CTD-2514C7, complete sequence
          Length = 197665

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 85302 agatgaagaccatcctggc 85284



to top

>gb|AC091139.9| Homo sapiens chromosome 18, clone RP11-817B8, complete sequence
          Length = 10252

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 80   agatgaagaccatcctggc 98
            |||||||||||||||||||
Sbjct: 1563 agatgaagaccatcctggc 1545



to top

>gb|AC114954.2| Homo sapiens chromosome 5 clone RP11-103A10, complete sequence
          Length = 157980

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 156268 agatgaagaccatcctggc 156250



to top

>gb|AC114941.2| Homo sapiens chromosome 5 clone CTD-2287M17, complete sequence
          Length = 159281

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 39954 agatgaagaccatcctggc 39936



to top

>gb|AC113422.2| Homo sapiens chromosome 5 clone RP11-5J18, complete sequence
          Length = 72551

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 32128 agatgaagaccatcctggc 32110



to top

>gb|AC104111.2| Homo sapiens chromosome 5 clone RP11-176O14, complete sequence
          Length = 171234

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 48563 agatgaagaccatcctggc 48581



to top

>gb|AC119407.15| Pan troglodytes clone ch251-541e23, complete sequence
          Length = 204962

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 36271 agatgaagaccatcctggc 36289



to top

>gb|AC113349.2| Homo sapiens chromosome 5 clone CTD-2544H17, complete sequence
          Length = 163806

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 71189 agatgaagaccatcctggc 71207



to top

>gb|AC182463.3| Pan troglodytes BAC clone CH251-511B8 from chromosome 16, complete
              sequence
          Length = 194406

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 132117 agatgaagaccatcctggc 132099



to top

>dbj|AK022466.1| Homo sapiens cDNA FLJ12404 fis, clone MAMMA1002833
          Length = 1622

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 80   agatgaagaccatcctggc 98
            |||||||||||||||||||
Sbjct: 1410 agatgaagaccatcctggc 1428



to top

>gb|AC118462.2| Homo sapiens chromosome 5 clone RP11-51J12, complete sequence
          Length = 14102

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 80   agatgaagaccatcctggc 98
            |||||||||||||||||||
Sbjct: 7178 agatgaagaccatcctggc 7160



to top

>gb|AC174000.3| Pan troglodytes BAC clone CH251-2O15 from chromosome 7, complete sequence
          Length = 161527

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 125122 agatgaagaccatcctggc 125104



to top

>dbj|AB111516.2| Oryza sativa (japonica cultivar-group) OsRadA mRNA for RadA-like
           protein, complete cds
          Length = 2223

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 4   accctcgcctcctcccccc 22
           |||||||||||||||||||
Sbjct: 128 accctcgcctcctcccccc 146



to top

>gb|AC166601.4| Nomascus leucogenys leucogenys clone CH271-401M10, complete sequence
          Length = 184404

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 57954 agatgaagaccatcctggc 57972



to top

>gb|AC107943.4| Homo sapiens chromosome 8, clone RP11-11I1, complete sequence
          Length = 195110

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 108486 agatgaagaccatcctggc 108468



to top

>gb|AC109463.2| Homo sapiens chromosome 5 clone RP11-273E10, complete sequence
          Length = 23936

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 10603 agatgaagaccatcctggc 10621



to top

>gb|AC112191.2| Homo sapiens chromosome 5 clone RP11-34P1, complete sequence
          Length = 153248

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 38450 agatgaagaccatcctggc 38468



to top

>gb|AC024606.11| Homo sapiens chromosome 10 clone RP11-360I20, complete sequence
          Length = 186533

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 49762 agatgaagaccatcctggc 49780



to top

>gb|AC108166.5| Homo sapiens BAC clone RP11-724L20 from 4, complete sequence
          Length = 89882

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 23317 agatgaagaccatcctggc 23335



to top

>gb|AC117528.2| Homo sapiens chromosome 5 clone RP11-22C17, complete sequence
          Length = 144236

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 75752 agatgaagaccatcctggc 75734



to top

>gb|AC104827.4| Homo sapiens BAC clone RP11-778J15 from 4, complete sequence
          Length = 157262

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 69604 agatgaagaccatcctggc 69586



to top

>gb|AC073160.8| Homo sapiens chromosome 10 clone RP11-348G8, complete sequence
          Length = 189817

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 106972 agatgaagaccatcctggc 106990



to top

>gb|AC025218.8| Homo sapiens chromosome 8, clone RP11-275J3, complete sequence
          Length = 132202

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 90826 agatgaagaccatcctggc 90808



to top

>gb|AC105001.3| Homo sapiens chromosome 8, clone CTD-2135J3, complete sequence
          Length = 157442

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 111385 agatgaagaccatcctggc 111367



to top

>gb|AC090152.4| Homo sapiens chromosome 8, clone RP11-554M1, complete sequence
          Length = 118755

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 116082 agatgaagaccatcctggc 116100



to top

>gb|AC113418.2| Homo sapiens chromosome 5 clone RP11-574H6, complete sequence
          Length = 182740

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 180452 agatgaagaccatcctggc 180470



to top

>gb|AC027288.26| Homo sapiens 12 BAC RP11-359M6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 177080

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 166708 agatgaagaccatcctggc 166726



to top

>gb|AC011374.6| Homo sapiens chromosome 5 clone CTB-113P19, complete sequence
          Length = 203961

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 22188 agatgaagaccatcctggc 22206



to top

>gb|AC107992.3| Homo sapiens chromosome 15, clone RP11-150L8, complete sequence
          Length = 149015

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 61160 agatgaagaccatcctggc 61142



to top

>gb|AC103863.2| Homo sapiens chromosome 8, clone RP11-185B9, complete sequence
          Length = 168424

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 91036 agatgaagaccatcctggc 91018



to top

>gb|AC015795.20| Homo sapiens chromosome 17, clone RP11-613C6, complete sequence
          Length = 170862

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 90053 agatgaagaccatcctggc 90071



to top

>gb|AC182470.3| Pan troglodytes BAC clone CH251-440F19 from chromosome 2, complete
             sequence
          Length = 163061

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 54318 agatgaagaccatcctggc 54300



to top

>gb|AC093914.3| Homo sapiens BAC clone RP11-779N9 from 4, complete sequence
          Length = 170536

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 157716 agatgaagaccatcctggc 157734



to top

>gb|AC093887.3| Homo sapiens BAC clone RP11-667D12 from 4, complete sequence
          Length = 192886

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 168485 agatgaagaccatcctggc 168467



to top

>gb|AC093872.3| Homo sapiens BAC clone RP11-610P19 from 4, complete sequence
          Length = 59406

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 13625 agatgaagaccatcctggc 13607



to top

>gb|AC096751.3| Homo sapiens BAC clone RP11-440I14 from 4, complete sequence
          Length = 174642

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 45469 agatgaagaccatcctggc 45487



to top

>gb|AC093814.3| Homo sapiens BAC clone RP11-362I16 from 4, complete sequence
          Length = 163201

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 87668 agatgaagaccatcctggc 87686



to top

>gb|AC093804.3| Homo sapiens BAC clone RP11-326C15 from 4, complete sequence
          Length = 177708

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 69306 agatgaagaccatcctggc 69288



to top

>gb|AC079071.9| Homo sapiens chromosome 8, clone RP11-43G18, complete sequence
          Length = 157811

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 56232 agatgaagaccatcctggc 56214



to top

>gb|AC097712.3| Homo sapiens BAC clone RP11-216H12 from 4, complete sequence
          Length = 184520

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 144688 agatgaagaccatcctggc 144670



to top

>gb|AC148313.3| Pan troglodytes BAC clone CH251-565C10 from chromosome 7, complete
             sequence
          Length = 183205

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 86888 agatgaagaccatcctggc 86870



to top

>gb|AC012215.11| Homo sapiens chromosome , clone RP11-345N15, complete sequence
          Length = 210723

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 80   agatgaagaccatcctggc 98
            |||||||||||||||||||
Sbjct: 2440 agatgaagaccatcctggc 2422



to top

>gb|AC015864.5| Homo sapiens chromosome 18, clone RP11-54A1, complete sequence
          Length = 177410

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 137396 agatgaagaccatcctggc 137378



 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 116067 agatgaagaccatcctggc 116085



to top

>gb|AC026003.10| Homo sapiens chromosome 18, clone RP11-715P20, complete sequence
          Length = 178733

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 75456 agatgaagaccatcctggc 75438



to top

>gb|AC013545.8| Homo sapiens chromosome 8, clone RP11-414D17, complete sequence
          Length = 200208

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 73712 agatgaagaccatcctggc 73730



to top

>gb|AC021500.6| Homo sapiens chromosome 8, clone RP11-135K1, complete sequence
          Length = 160348

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 155871 agatgaagaccatcctggc 155853



to top

>gb|AC008125.9| Homo sapiens 12 BAC RPCI11-25E2 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 189286

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 53718 agatgaagaccatcctggc 53736



to top

>gb|AC091996.3| Homo sapiens chromosome 5 clone RP11-96G10, complete sequence
          Length = 182797

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 18130 agatgaagaccatcctggc 18148



to top

>gb|AC034139.7| Homo sapiens BAC clone RP11-67M24 from 4, complete sequence
          Length = 176411

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 106244 agatgaagaccatcctggc 106262



to top

>gb|AC080082.4| Homo sapiens BAC clone RP11-531D14 from 4, complete sequence
          Length = 22690

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 80   agatgaagaccatcctggc 98
            |||||||||||||||||||
Sbjct: 8947 agatgaagaccatcctggc 8965



to top

>gb|AC105150.2| Homo sapiens chromosome 8, clone RP11-328K2, complete sequence
          Length = 201000

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 191295 agatgaagaccatcctggc 191277



to top

>gb|AC010256.6| Homo sapiens chromosome 5 clone CTC-445M6, complete sequence
          Length = 141488

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 21267 agatgaagaccatcctggc 21249



to top

>gb|AC098969.2| Homo sapiens chromosome 3 clone RP11-24O17, complete sequence
          Length = 158560

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 114863 agatgaagaccatcctggc 114845



to top

>gb|AC064800.8| Homo sapiens chromosome 18, clone CTD-2001I24, complete sequence
          Length = 131409

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 129448 agatgaagaccatcctggc 129430



to top

>gb|AC021482.10| Homo sapiens chromosome , clone RP11-15K1, complete sequence
          Length = 159075

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 17141 agatgaagaccatcctggc 17159



to top

>gb|AC008567.5| Homo sapiens chromosome 19 clone CTC-543D15, complete sequence
          Length = 153704

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 59384 agatgaagaccatcctggc 59402



to top

>gb|AC016065.14| Homo sapiens chromosome 8, clone RP11-115C21, complete sequence
          Length = 185463

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 184780 agatgaagaccatcctggc 184798



to top

>gb|AC011008.10| Homo sapiens chromosome 8, clone RP11-177H2, complete sequence
          Length = 162245

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 146086 agatgaagaccatcctggc 146104



to top

>gb|AC018692.9| Homo sapiens BAC clone RP11-555K2 from 4, complete sequence
          Length = 189789

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 152018 agatgaagaccatcctggc 152036



to top

>gb|AC010735.11| Homo sapiens BAC clone RP11-395N3 from 2, complete sequence
          Length = 211980

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 97973 agatgaagaccatcctggc 97955



to top

>gb|AC093262.2| Homo sapiens chromosome 5 clone RP11-252F20, complete sequence
          Length = 164513

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 98185 agatgaagaccatcctggc 98203



to top

>gb|AC027279.4| Homo sapiens chromosome 16 clone RP11-319G9, complete sequence
          Length = 194594

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 31665 agatgaagaccatcctggc 31683



to top

>gb|AC024561.5| Homo sapiens chromosome 5 clone CTB-94B10, complete sequence
          Length = 155125

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 66262 agatgaagaccatcctggc 66244



to top

>gb|DP000005.1| Macaca mulatta target 1 genomic scaffold
          Length = 1678549

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 80     agatgaagaccatcctggc 98
              |||||||||||||||||||
Sbjct: 919834 agatgaagaccatcctggc 919816



to top

>gb|AC093235.2| Homo sapiens chromosome 19 clone LLNLR-267A4, complete sequence
          Length = 38173

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 37176 agatgaagaccatcctggc 37194



to top

>gb|AC022089.7| Homo sapiens chromosome 5 clone CTB-125N5, complete sequence
          Length = 44504

 Score = 38.2 bits (19), Expect = 9.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 80    agatgaagaccatcctggc 98
             |||||||||||||||||||
Sbjct: 35807 agatgaagaccatcctggc 35789


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,043,054
Number of Sequences: 3902068
Number of extensions: 1043054
Number of successful extensions: 252114
Number of sequences better than 10.0: 417
Number of HSP's better than 10.0 without gapping: 417
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 247074
Number of HSP's gapped (non-prelim): 5040
length of query: 195
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 173
effective length of database: 17,147,199,772
effective search space: 2966465560556
effective search space used: 2966465560556
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top