>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete
           cds
          Length = 1343

 Score = 63.9 bits (32), Expect = 2e-08
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                               
Query: 3   cccggcggggagtacgcggcccaggactactccgac 38
           ||||||||||||||||||||| ||||||||||||||
Sbjct: 101 cccggcggggagtacgcggccaaggactactccgac 136

>emb|AL939119.1|SCO939119 Streptomyces coelicolor A3(2) complete genome; segment 16/29
          Length = 299050

 Score = 38.2 bits (19), Expect = 1.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 6      ggcggggagtacgcggccc 24
              |||||||||||||||||||
Sbjct: 177248 ggcggggagtacgcggccc 177230

>gb|AC044864.6| Mus musculus chromosome 3, clone RP23-168E14, complete sequence
          Length = 224119

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 18    gcggcccaggactactcc 35
             ||||||||||||||||||
Sbjct: 34810 gcggcccaggactactcc 34827

>gb|AC137525.3| Mus musculus BAC clone RP23-68H24 from chromosome 3, complete sequence
          Length = 203159

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 18     gcggcccaggactactcc 35
              ||||||||||||||||||
Sbjct: 182297 gcggcccaggactactcc 182314

>gb|AC116051.4| Mus musculus BAC clone RP23-4L11 from 3, complete sequence
          Length = 224674

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 18    gcggcccaggactactcc 35
             ||||||||||||||||||
Sbjct: 91944 gcggcccaggactactcc 91961

>gb|DQ127822.1| Aeromonas hydrophila strain PHP99 extracellular serine proteinase
            (ESP30) gene, complete cds
          Length = 2647

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1    cccccggcggggagtacg 18
            ||||||||||||||||||
Sbjct: 1204 cccccggcggggagtacg 1221

>dbj|AK008852.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched
           library, clone:2210408E11 product:unclassifiable, full
           insert sequence
          Length = 981

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 18  gcggcccaggactactcc 35
           ||||||||||||||||||
Sbjct: 119 gcggcccaggactactcc 102

>dbj|AK007191.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
          library, clone:1700113A16 product:unclassifiable, full
          insert sequence
          Length = 564

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 18 gcggcccaggactactcc 35
          ||||||||||||||||||
Sbjct: 43 gcggcccaggactactcc 26

>gb|DQ189993.1| Aeromonas hydrophila strain XS91-4-1 extracellular serine
            protease-like (ahpA) gene, partial sequence
          Length = 1222

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1    cccccggcggggagtacg 18
            ||||||||||||||||||
Sbjct: 1101 cccccggcggggagtacg 1118


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 127,075
Number of Sequences: 3902068
Number of extensions: 127075
Number of successful extensions: 24373
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24356
Number of HSP's gapped (non-prelim): 17
length of query: 38
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 18
effective length of database: 17,155,003,908
effective search space: 308790070344
effective search space used: 308790070344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)