ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart07f04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK101263.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 2e-80
2dbj|AK061141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 307 2e-80
3gb|AC104272.5| Oryza sativa (japonica cultivar-group) chromosome... 174 2e-40
4dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 174 2e-40
5dbj|AK070900.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 2e-40
6gb|AY106338.1| Zea mays PCO074336 mRNA sequence 133 6e-28
7gb|AC159817.2| Mus musculus BAC clone RP23-228E8 from chromosome... 50 0.007
8gb|AC120383.7| Mus musculus chromosome 12, clone RP24-273A7, com... 48 0.028
9gb|AC112866.5| Rattus norvegicus 1 BAC CH230-375M13 (Children's ... 46 0.11
10gb|AC133907.9| Mus musculus chromosome 1, clone RP24-239K20, com... 46 0.11
11gb|AC165347.4| Mus musculus BAC clone RP23-348B21 from chromosom... 46 0.11
12gb|AC140778.15| Mus musculus chromosome 1, clone RP24-446J17, co... 46 0.11
13gb|AC138156.3| Carollia perspicillata clone 41M6, complete sequence 46 0.11
14gb|DP000018.1| Carollia perspicillata target 1 genomic scaffold 46 0.11
15gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 44 0.44
16gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 44 0.44
17emb|AL591783.1|SME591783 Sinorhizobium meliloti 1021 complete ch... 44 0.44
18emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 44 0.44
19gb|AC129803.3| Homo sapiens 3 BAC RP11-15N24 (Roswell Park Cance... 44 0.44
20gb|BC093085.1| Homo sapiens cDNA clone IMAGE:30530427 44 0.44
21dbj|AB091435.1| Burkholderia multivorans genes for probable lipo... 44 0.44
22emb|AJ871581.1| Streptomyces achromogenes subsp. rubradiris comp... 44 0.44
23gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 44 0.44
24emb|CT033751.4| Mouse DNA sequence from clone RP24-236O3 on chro... 44 0.44
25gb|AC130547.5| Mus musculus BAC clone RP24-378G9 from 14, comple... 44 0.44
26gb|AC025501.19| Mus musculus chromosome 10, clone RP23-129O23, c... 42 1.7
27ref|XM_470141.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.7
28gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 42 1.7
29gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.7
30gb|AC117802.9| Mus musculus chromosome 15, clone RP24-560I8, com... 42 1.7
31gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.7
32gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 42 1.7
33gb|AC109247.14| Mus musculus chromosome 9, clone RP23-462C14, co... 42 1.7
34gb|AC102643.9| Mus musculus chromosome 8, clone RP23-304B22, com... 42 1.7
35gb|AC163628.5| Mus musculus BAC clone RP23-138F21 from chromosom... 42 1.7
36gb|AC162519.4| Mus musculus chromosome 8, clone RP24-146M21, com... 42 1.7
37emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.7
38gb|AC067751.7| Homo sapiens chromosome 10 clone RP11-357K14, com... 42 1.7
39gb|AC068207.6| Homo sapiens chromosome 8, clone RP11-26K8, compl... 42 1.7
40gb|DQ073386.1| Heliocidaris erythrogramma goosecoid (Gsc) mRNA, ... 42 1.7
41dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
42emb|AL603782.5| Mouse DNA sequence from clone RP23-480M4 on chro... 42 1.7
43gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic ... 42 1.7
44gb|AC129569.17| Mus musculus chromosome 5, clone RP23-121M13, co... 42 1.7
45gb|AF245690.1|AF245690 Streptomyces verticillus putative N-acety... 42 1.7
46dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 42 1.7
47dbj|AK102784.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
48gb|AC154828.2| Mus musculus BAC clone RP24-549A19 from 13, compl... 42 1.7
49dbj|AK069740.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
50dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1... 42 1.7
51gb|AC079682.29| Mus musculus strain C57BL/6J chromosome 3 clone ... 42 1.7
52gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 1.7
53gb|AC131122.4| Mus musculus BAC clone RP24-553B2 from 3, complet... 42 1.7
54gb|AC142415.4| Mus musculus BAC clone RP23-155F24 from 10, compl... 42 1.7
55gb|AC159126.4| Mus musculus chromosome 8, clone RP23-182M11, com... 42 1.7
56emb|AL844553.4| Mouse DNA sequence from clone RP23-255J15 on chr... 42 1.7
57emb|AL731795.11| Mouse DNA sequence from clone RP23-123M13 on ch... 42 1.7
58dbj|AP000071.1| Homo sapiens genomic DNA, chromosome 8p11.2, sen... 42 1.7
59ref|NM_119602.1| Arabidopsis thaliana ubiquitin-protein ligase/ ... 40 6.9
60ref|NM_111347.1| Arabidopsis thaliana unknown protein AT3G04750 ... 40 6.9
61gb|AY374476.1| Tetraodon nigroviridis class I helical cytokine r... 40 6.9
62gb|AC115972.13| Mus musculus chromosome 5, clone RP24-79A6, comp... 40 6.9
63ref|XM_465933.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.9
64gb|AC102834.8| Mus musculus chromosome 5, clone RP24-299N23, com... 40 6.9
65gb|AC175200.2| Sporobolomyces roseus clone JGIBAIF-29B10, comple... 40 6.9
66gb|AC185523.2| Pan troglodytes chromosome X clone PTB-124O20 map... 40 6.9
67gb|AC115843.10| Mus musculus chromosome 9, clone RP24-239P6, com... 40 6.9
68gb|AC092482.71| Mus musculus strain C57BL/6J clone rp23-60j11, c... 40 6.9
69gb|AC123678.19| Mus musculus chromosome 3, clone RP23-276A22, co... 40 6.9
70gb|AC110164.26| Mus musculus chromosome 3, clone RP23-167C5, com... 40 6.9
71gb|AC126426.3| Mus musculus BAC clone RP24-291G13 from chromosom... 40 6.9
72emb|CT009536.7| Mouse DNA sequence from clone RP23-25A7 on chrom... 40 6.9
73gb|AC131758.3| Mus musculus BAC clone RP24-211E5 from chromosome... 40 6.9
74gb|AC122336.4| Mus musculus BAC clone RP23-351K21 from chromosom... 40 6.9
75gb|AC011437.6|ATAC011437 Arabidopsis thaliana chromosome III BAC... 40 6.9
76gb|AC125399.3| Mus musculus BAC clone RP24-245C15 from chromosom... 40 6.9
77gb|AC124419.4| Mus musculus BAC clone RP24-319P11 from chromosom... 40 6.9
78gb|AC124359.3| Mus musculus BAC clone RP24-495G2 from chromosome... 40 6.9
79gb|AC127290.3| Mus musculus BAC clone RP23-364F13 from chromosom... 40 6.9
80gb|AC091173.10| Homo sapiens chromosome 8, clone RP11-280G9, com... 40 6.9
81gb|AC126277.3| Mus musculus BAC clone RP23-161L22 from 12, compl... 40 6.9
82gb|AC124178.3| Mus musculus BAC clone RP23-193J15 from 18, compl... 40 6.9
83gb|AC116578.3| Mus musculus BAC clone RP23-264P8 from 9, complet... 40 6.9
84gb|AC084391.1| Mus musculus BAC clone RP23-294I17 from 1, comple... 40 6.9
85gb|AC113481.12| Mus musculus chromosome 12, clone RP23-310G22, c... 40 6.9
86gb|AC119813.16| Mus musculus chromosome 14, clone RP23-298L20, c... 40 6.9
87gb|AC156398.13| Mus musculus 6 BAC RP24-279F16 (Roswell Park Can... 40 6.9
88emb|AL592151.13| Human DNA sequence from clone RP11-351N5 on chr... 40 6.9
89emb|AL591491.5| Human DNA sequence from clone RP11-435K1 on chro... 40 6.9
90emb|AL590725.5| Human DNA sequence from clone RP11-107L15 on chr... 40 6.9
91emb|AL133260.12| Human DNA sequence from clone RP1-292B18 on chr... 40 6.9
92gb|AC158756.4| Mus musculus chromosome 5, clone RP24-151L11, com... 40 6.9
93emb|AL021997.1|HS874C20 Human DNA sequence from clone RP5-874C20... 40 6.9
94gb|AY117264.1| Arabidopsis thaliana unknown protein (At4g34370) ... 40 6.9
95gb|AY050864.1| Arabidopsis thaliana unknown protein (At4g34370) ... 40 6.9
96emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, ... 40 6.9
97emb|AL035521.1|ATF10M10 Arabidopsis thaliana DNA chromosome 4, B... 40 6.9
98emb|AJ851422.1| Gallus gallus mRNA for hypothetical protein, clo... 40 6.9
99gb|AC091694.9| Mus musculus Strain C57BL6/J chromosome 11 BAC, R... 40 6.9
100emb|CR628311.1| Human DNA sequence from clone XX-NCIH2171_5AD01,... 40 6.9
101emb|CR626894.1| Human DNA sequence from clone XX-NCIH2171_3M21, ... 40 6.9
102dbj|AK123280.1| Homo sapiens cDNA FLJ41286 fis, clone BRAMY2038475 40 6.9
103gb|AC164576.4| Mus musculus 10 BAC RP23-50F14 (Roswell Park Canc... 40 6.9
104gb|AC067881.5| Homo sapiens chromosome 8, clone RP11-687K23, com... 40 6.9
105dbj|AK036494.1| Mus musculus adult male bone cDNA, RIKEN full-le... 40 6.9
106dbj|AK016941.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 6.9
107gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 40 6.9
108gb|AC157214.2| Mus musculus BAC clone RP23-35J2 from chromosome ... 40 6.9
109dbj|AK084742.1| Mus musculus 13 days embryo heart cDNA, RIKEN fu... 40 6.9
110gb|AC153485.9| Mus musculus 10 BAC RP23-319B13 (Roswell Park Can... 40 6.9
111dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
112dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
113dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
114dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
115emb|BX825075.1|CNS0A5SW Arabidopsis thaliana Full-length cDNA Co... 40 6.9
116gb|AC097473.3| Homo sapiens BAC clone RP11-75N20 from 4, complet... 40 6.9
117gb|AC156024.2| Mus musculus BAC clone RP23-89J1 from chromosome ... 40 6.9
118gb|AC005678.1|AC005678 Homo sapiens PAC clone RP11-569I24 from 7... 40 6.9
119gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 6.9
120gb|AC167467.1| Mus musculus BAC clone RP23-158E17 from chromosom... 40 6.9
121dbj|AP005919.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
122dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
123ref|NM_001012915.1| Gallus gallus ankyrin repeat domain 28-like ... 40 6.9
124dbj|AP004806.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
125dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
126dbj|AP005928.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
127dbj|AP004165.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
128gb|AC153612.6| Mus musculus 6 BAC RP23-435I4 (Roswell Park Cance... 40 6.9
129dbj|AP003808.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
130dbj|AP004861.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
131emb|AL805978.10| Mouse DNA sequence from clone RP23-344I3 on chr... 40 6.9
132emb|AL356364.18| Human DNA sequence from clone RP11-328I22 on ch... 40 6.9
133gb|AY103623.1| Zea mays PCO141453 mRNA sequence 40 6.9
134gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9
135emb|AL831808.4|CNS08CAL Oryza sativa chromosome 12, . BAC OSJNBa... 40 6.9
136emb|AL831802.5|CNS08CAF Oryza sativa chromosome 12, . Partial se... 40 6.9
137emb|BX255875.3|CNS09S4W Oryza sativa chromosome 12, . BAC OSJNBa... 40 6.9
138emb|AJ510204.1|ATH510204 Arabidopsis thaliana ari1 gene for ARIA... 40 6.9
139gb|AC133169.3| Mus musculus BAC clone RP24-259I15 from 9, comple... 40 6.9
140gb|AC132103.3| Mus musculus BAC clone RP24-363K20 from 9, comple... 40 6.9
141gb|AC141469.4| Mus musculus BAC clone RP24-439P5 from 5, complet... 40 6.9
142gb|AC149593.5| Mus musculus BAC clone RP23-34O23 from 7, complet... 40 6.9
143gb|AC124126.14| Mus musculus chromosome 18, clone RP23-377C8, co... 40 6.9
144emb|AL645542.13| Mouse DNA sequence from clone RP23-468A19 on ch... 40 6.9
145gb|L00026.1|YSCACT Yeast (S.cerevisiae) actin gene, complete cds 40 6.9
146dbj|D50617.1|YSCCHRVIN Saccharomyces cerevisiae chromosome VI co... 40 6.9

>dbj|AK101263.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033032J06, full
           insert sequence
          Length = 1287

 Score =  307 bits (155), Expect = 2e-80
 Identities = 236/260 (90%), Gaps = 6/260 (2%)
 Strand = Plus / Plus

                                                                       
Query: 139 aggcgcctgcagtcccgctacgatctgtacatggggttcgacgacgcggacgccg---gc 195
           |||||||||||| | |||||||||||||||||||||||||||||||||||||| |   ||
Sbjct: 210 aggcgcctgcaggcgcgctacgatctgtacatggggttcgacgacgcggacgcggcgggc 269

                                                                       
Query: 196 ggggacgaggtggaggcgcgcgg-ggcgg--aggcctacaactgccccttttgcggcgag 252
           | ||| ||||||||||||||||| |||||  |||| |||||||||||||| |||||||||
Sbjct: 270 gtggaggaggtggaggcgcgcggcggcggggaggcgtacaactgccccttctgcggcgag 329

                                                                       
Query: 253 gatttcgatttcgtaggcctctgctgccacatcgacgacgagcacgccgtcgaggccaag 312
           || ||||| ||||| | | ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 330 gacttcgacttcgtcgccttctgctgccacgtcgacgacgagcacgccgtcgaggccaag 389

                                                                       
Query: 313 agcgggatatgccccatctgtgctacgagggttggggtggacttgataggccacttgaca 372
           |||||| |||| |||||||||||||| |||||||| |||||||||||||| |||||||||
Sbjct: 390 agcggggtatgtcccatctgtgctacaagggttggagtggacttgataggtcacttgaca 449

                               
Query: 373 atgcagcatggaagttactt 392
           ||||||||||||||||||||
Sbjct: 450 atgcagcatggaagttactt 469



 Score =  153 bits (77), Expect = 7e-34
 Identities = 101/109 (92%)
 Strand = Plus / Plus

                                                                       
Query: 400 agagtccgaaaagtatctcctgggtcccattctttgctgtctttgttgagaaaggattta 459
           |||||||||||| ||||| | ||||||||||||||| ||||||||||||||||||| |||
Sbjct: 489 agagtccgaaaaatatcttcagggtcccattctttgttgtctttgttgagaaaggactta 548

                                                            
Query: 460 agagacggcagattgcagtcctttcttggtggatcatcctatgtatcta 508
           ||||| |||||  ||||||||||||||||||||||||||||||||||||
Sbjct: 549 agagatggcagtctgcagtcctttcttggtggatcatcctatgtatcta 597



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 35  gaggcgaggctagggtttcg 54
           ||||||||||||||||||||
Sbjct: 108 gaggcgaggctagggtttcg 127



to top

>dbj|AK061141.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-C03, full
           insert sequence
          Length = 1248

 Score =  307 bits (155), Expect = 2e-80
 Identities = 236/260 (90%), Gaps = 6/260 (2%)
 Strand = Plus / Plus

                                                                       
Query: 139 aggcgcctgcagtcccgctacgatctgtacatggggttcgacgacgcggacgccg---gc 195
           |||||||||||| | |||||||||||||||||||||||||||||||||||||| |   ||
Sbjct: 141 aggcgcctgcaggcgcgctacgatctgtacatggggttcgacgacgcggacgcggcgggc 200

                                                                       
Query: 196 ggggacgaggtggaggcgcgcgg-ggcgg--aggcctacaactgccccttttgcggcgag 252
           | ||| ||||||||||||||||| |||||  |||| |||||||||||||| |||||||||
Sbjct: 201 gtggaggaggtggaggcgcgcggcggcggggaggcgtacaactgccccttctgcggcgag 260

                                                                       
Query: 253 gatttcgatttcgtaggcctctgctgccacatcgacgacgagcacgccgtcgaggccaag 312
           || ||||| ||||| | | ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 261 gacttcgacttcgtcgccttctgctgccacgtcgacgacgagcacgccgtcgaggccaag 320

                                                                       
Query: 313 agcgggatatgccccatctgtgctacgagggttggggtggacttgataggccacttgaca 372
           |||||| |||| |||||||||||||| |||||||| |||||||||||||| |||||||||
Sbjct: 321 agcggggtatgtcccatctgtgctacaagggttggagtggacttgataggtcacttgaca 380

                               
Query: 373 atgcagcatggaagttactt 392
           ||||||||||||||||||||
Sbjct: 381 atgcagcatggaagttactt 400



 Score =  153 bits (77), Expect = 7e-34
 Identities = 101/109 (92%)
 Strand = Plus / Plus

                                                                       
Query: 400 agagtccgaaaagtatctcctgggtcccattctttgctgtctttgttgagaaaggattta 459
           |||||||||||| ||||| | ||||||||||||||| ||||||||||||||||||| |||
Sbjct: 420 agagtccgaaaaatatcttcagggtcccattctttgttgtctttgttgagaaaggactta 479

                                                            
Query: 460 agagacggcagattgcagtcctttcttggtggatcatcctatgtatcta 508
           ||||| |||||  ||||||||||||||||||||||||||||||||||||
Sbjct: 480 agagatggcagtctgcagtcctttcttggtggatcatcctatgtatcta 528



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 35 gaggcgaggctagggtttcg 54
          ||||||||||||||||||||
Sbjct: 39 gaggcgaggctagggtttcg 58



to top

>gb|AC104272.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06,
             complete sequence
          Length = 143130

 Score =  174 bits (88), Expect = 2e-40
 Identities = 148/165 (89%), Gaps = 6/165 (3%)
 Strand = Plus / Minus

                                                                         
Query: 160   gatctgtacatggggttcgacgacgcggacgccg---gcggggacgaggtggaggcgcgc 216
             |||||||||||||||||||||||||||||||| |   ||| ||| |||||||||||||||
Sbjct: 70713 gatctgtacatggggttcgacgacgcggacgcggcgggcgtggaggaggtggaggcgcgc 70654

                                                                         
Query: 217   gg-ggcgg--aggcctacaactgccccttttgcggcgaggatttcgatttcgtaggcctc 273
             || |||||  |||| |||||||||||||| ||||||||||| ||||| ||||| | | ||
Sbjct: 70653 ggcggcggggaggcgtacaactgccccttctgcggcgaggacttcgacttcgtcgccttc 70594

                                                          
Query: 274   tgctgccacatcgacgacgagcacgccgtcgaggccaagagcggg 318
             ||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 70593 tgctgccacgtcgacgacgagcacgccgtcgaggccaagagcggg 70549



 Score =  153 bits (77), Expect = 7e-34
 Identities = 101/109 (92%)
 Strand = Plus / Minus

                                                                         
Query: 400   agagtccgaaaagtatctcctgggtcccattctttgctgtctttgttgagaaaggattta 459
             |||||||||||| ||||| | ||||||||||||||| ||||||||||||||||||| |||
Sbjct: 67354 agagtccgaaaaatatcttcagggtcccattctttgttgtctttgttgagaaaggactta 67295

                                                              
Query: 460   agagacggcagattgcagtcctttcttggtggatcatcctatgtatcta 508
             ||||| |||||  ||||||||||||||||||||||||||||||||||||
Sbjct: 67294 agagatggcagtctgcagtcctttcttggtggatcatcctatgtatcta 67246



 Score =  113 bits (57), Expect = 6e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                         
Query: 320   tatgccccatctgtgctacgagggttggggtggacttgataggccacttgacaatgcagc 379
             |||| |||||||||||||| |||||||| |||||||||||||| ||||||||||||||||
Sbjct: 67584 tatgtcccatctgtgctacaagggttggagtggacttgataggtcacttgacaatgcagc 67525

                          
Query: 380   atggaagttactt 392
             |||||||||||||
Sbjct: 67524 atggaagttactt 67512



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    gaggcgaggctagggtttcg 54
             ||||||||||||||||||||
Sbjct: 70964 gaggcgaggctagggtttcg 70945



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  174 bits (88), Expect = 2e-40
 Identities = 148/165 (89%), Gaps = 6/165 (3%)
 Strand = Plus / Minus

                                                                            
Query: 160      gatctgtacatggggttcgacgacgcggacgccg---gcggggacgaggtggaggcgcgc 216
                |||||||||||||||||||||||||||||||| |   ||| ||| |||||||||||||||
Sbjct: 16858217 gatctgtacatggggttcgacgacgcggacgcggcgggcgtggaggaggtggaggcgcgc 16858158

                                                                            
Query: 217      gg-ggcgg--aggcctacaactgccccttttgcggcgaggatttcgatttcgtaggcctc 273
                || |||||  |||| |||||||||||||| ||||||||||| ||||| ||||| | | ||
Sbjct: 16858157 ggcggcggggaggcgtacaactgccccttctgcggcgaggacttcgacttcgtcgccttc 16858098

                                                             
Query: 274      tgctgccacatcgacgacgagcacgccgtcgaggccaagagcggg 318
                ||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 16858097 tgctgccacgtcgacgacgagcacgccgtcgaggccaagagcggg 16858053



 Score =  153 bits (77), Expect = 7e-34
 Identities = 101/109 (92%)
 Strand = Plus / Minus

                                                                            
Query: 400      agagtccgaaaagtatctcctgggtcccattctttgctgtctttgttgagaaaggattta 459
                |||||||||||| ||||| | ||||||||||||||| ||||||||||||||||||| |||
Sbjct: 16854858 agagtccgaaaaatatcttcagggtcccattctttgttgtctttgttgagaaaggactta 16854799

                                                                 
Query: 460      agagacggcagattgcagtcctttcttggtggatcatcctatgtatcta 508
                ||||| |||||  ||||||||||||||||||||||||||||||||||||
Sbjct: 16854798 agagatggcagtctgcagtcctttcttggtggatcatcctatgtatcta 16854750



 Score =  113 bits (57), Expect = 6e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                            
Query: 320      tatgccccatctgtgctacgagggttggggtggacttgataggccacttgacaatgcagc 379
                |||| |||||||||||||| |||||||| |||||||||||||| ||||||||||||||||
Sbjct: 16855088 tatgtcccatctgtgctacaagggttggagtggacttgataggtcacttgacaatgcagc 16855029

                             
Query: 380      atggaagttactt 392
                |||||||||||||
Sbjct: 16855028 atggaagttactt 16855016



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 35       gaggcgaggctagggtttcg 54
                ||||||||||||||||||||
Sbjct: 16858468 gaggcgaggctagggtttcg 16858449



to top

>dbj|AK070900.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023073C10, full
            insert sequence
          Length = 3331

 Score =  174 bits (88), Expect = 2e-40
 Identities = 148/165 (89%), Gaps = 6/165 (3%)
 Strand = Plus / Plus

                                                                        
Query: 160  gatctgtacatggggttcgacgacgcggacgccg---gcggggacgaggtggaggcgcgc 216
            |||||||||||||||||||||||||||||||| |   ||| ||| |||||||||||||||
Sbjct: 1942 gatctgtacatggggttcgacgacgcggacgcggcgggcgtggaggaggtggaggcgcgc 2001

                                                                        
Query: 217  gg-ggcgg--aggcctacaactgccccttttgcggcgaggatttcgatttcgtaggcctc 273
            || |||||  |||| |||||||||||||| ||||||||||| ||||| ||||| | | ||
Sbjct: 2002 ggcggcggggaggcgtacaactgccccttctgcggcgaggacttcgacttcgtcgccttc 2061

                                                         
Query: 274  tgctgccacatcgacgacgagcacgccgtcgaggccaagagcggg 318
            ||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 2062 tgctgccacgtcgacgacgagcacgccgtcgaggccaagagcggg 2106



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 35   gaggcgaggctagggtttcg 54
            ||||||||||||||||||||
Sbjct: 1691 gaggcgaggctagggtttcg 1710



to top

>gb|AY106338.1| Zea mays PCO074336 mRNA sequence
          Length = 849

 Score =  133 bits (67), Expect = 6e-28
 Identities = 100/111 (90%)
 Strand = Plus / Plus

                                                                       
Query: 396 gcgcagagtccgaaaagtatctcctgggtcccattctttgctgtctttgttgagaaagga 455
           |||||||||||||||||||||| ||||||||||||||||  | |||||||||||||||||
Sbjct: 148 gcgcagagtccgaaaagtatcttctgggtcccattctttattatctttgttgagaaagga 207

                                                              
Query: 456 tttaagagacggcagattgcagtcctttcttggtggatcatcctatgtatc 506
            || ||| | ||||| |||||||| ||||| ||||||||||||||||||||
Sbjct: 208 cttgagaaatggcagtttgcagtcatttctcggtggatcatcctatgtatc 258



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 321 atgccccatctgtgctacgagggttggggtggacttgataggccacttgacaatgcagca 380
           |||||||||||||||||| ||||| ||  ||||||||||||| || ||||| ||||| ||
Sbjct: 61  atgccccatctgtgctacaagggtcggaatggacttgataggacatttgactatgcaaca 120

                           
Query: 381 tggaagttacttcaag 396
           ||||||||| ||||||
Sbjct: 121 tggaagttatttcaag 136



to top

>gb|AC159817.2| Mus musculus BAC clone RP23-228E8 from chromosome 9, complete sequence
          Length = 193445

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 14     ggaaaggggaaaggagagagagagg 38
              |||||||||||||||||||||||||
Sbjct: 145116 ggaaaggggaaaggagagagagagg 145140



to top

>gb|AC120383.7| Mus musculus chromosome 12, clone RP24-273A7, complete sequence
          Length = 216796

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 16    aaaggggaaaggagagagagaggcgagg 43
             ||||||||||||||||||||||| ||||
Sbjct: 63452 aaaggggaaaggagagagagaggagagg 63425



to top

>gb|AC112866.5| Rattus norvegicus 1 BAC CH230-375M13 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 147079

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 15    gaaaggggaaaggagagagagag 37
             |||||||||||||||||||||||
Sbjct: 56063 gaaaggggaaaggagagagagag 56041



to top

>gb|AC133907.9| Mus musculus chromosome 1, clone RP24-239K20, complete sequence
          Length = 150662

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 15     gaaaggggaaaggagagagagag 37
              |||||||||||||||||||||||
Sbjct: 116990 gaaaggggaaaggagagagagag 117012



to top

>gb|AC165347.4| Mus musculus BAC clone RP23-348B21 from chromosome 13, complete sequence
          Length = 205783

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 15     gaaaggggaaaggagagagagag 37
              |||||||||||||||||||||||
Sbjct: 149798 gaaaggggaaaggagagagagag 149820



to top

>gb|AC140778.15| Mus musculus chromosome 1, clone RP24-446J17, complete sequence
          Length = 160859

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 15     gaaaggggaaaggagagagagag 37
              |||||||||||||||||||||||
Sbjct: 132902 gaaaggggaaaggagagagagag 132880



to top

>gb|AC138156.3| Carollia perspicillata clone 41M6, complete sequence
          Length = 123894

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 15    gaaaggggaaaggagagagagag 37
             |||||||||||||||||||||||
Sbjct: 79342 gaaaggggaaaggagagagagag 79320



to top

>gb|DP000018.1| Carollia perspicillata target 1 genomic scaffold
          Length = 1501503

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 15    gaaaggggaaaggagagagagag 37
             |||||||||||||||||||||||
Sbjct: 79342 gaaaggggaaaggagagagagag 79320



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 284     tcgacgacgagcacgccgtcga 305
               ||||||||||||||||||||||
Sbjct: 2435102 tcgacgacgagcacgccgtcga 2435123



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 284     tcgacgacgagcacgccgtcga 305
               ||||||||||||||||||||||
Sbjct: 1014475 tcgacgacgagcacgccgtcga 1014496



to top

>emb|AL591783.1|SME591783 Sinorhizobium meliloti 1021 complete chromosome; segment 2/12
          Length = 306650

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 178    gacgacgcggacgccggcgggg 199
              ||||||||||||||||||||||
Sbjct: 129733 gacgacgcggacgccggcgggg 129754



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 284     tcgacgacgagcacgccgtcga 305
               ||||||||||||||||||||||
Sbjct: 2331966 tcgacgacgagcacgccgtcga 2331987



to top

>gb|AC129803.3| Homo sapiens 3 BAC RP11-15N24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 185721

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 418    cctgggtcccattctttgctgt 439
              ||||||||||||||||||||||
Sbjct: 132739 cctgggtcccattctttgctgt 132718



to top

>gb|BC093085.1| Homo sapiens cDNA clone IMAGE:30530427
          Length = 2560

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 418 cctgggtcccattctttgctgt 439
           ||||||||||||||||||||||
Sbjct: 69  cctgggtcccattctttgctgt 48



to top

>dbj|AB091435.1| Burkholderia multivorans genes for probable lipoprotein transmembrane,
             3-isopropylmalate dehydratase large and small subunits,
             3-isopropylmalate dehydrogenase oxidoreductase,
             aspartate-semialdehyde dehydrogenase, probable
             transmembrane protein, tRNA pseudouridine synthase,
             N-(5'-phosphoribosyl) anthranilate isomerase, tryptophan
             synthase beta chain, probable DNA-methyltransferasee,
             tryptophan synthase alpha chain, acetyl-CoA carboxylase
             beta subunit, partial and complete cds
          Length = 12977

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 284   tcgacgacgagcacgccgtcga 305
             ||||||||||||||||||||||
Sbjct: 12225 tcgacgacgagcacgccgtcga 12204



to top

>emb|AJ871581.1| Streptomyces achromogenes subsp. rubradiris complete rubradirin gene
            cluster, strain NRRL 3061
          Length = 105657

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 176  tcgacgacgcggacgccggcgg 197
            ||||||||||||||||||||||
Sbjct: 6193 tcgacgacgcggacgccggcgg 6214



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 284    tcgacgacgagcacgccgtcga 305
              ||||||||||||||||||||||
Sbjct: 797596 tcgacgacgagcacgccgtcga 797575



to top

>emb|CT033751.4| Mouse DNA sequence from clone RP24-236O3 on chromosome 17, complete
             sequence
          Length = 171391

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 15    gaaaggggaaaggagagagaga 36
             ||||||||||||||||||||||
Sbjct: 49505 gaaaggggaaaggagagagaga 49484



to top

>gb|AC130547.5| Mus musculus BAC clone RP24-378G9 from 14, complete sequence
          Length = 163269

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 16    aaaggggaaaggagagagagag 37
             ||||||||||||||||||||||
Sbjct: 98583 aaaggggaaaggagagagagag 98604



to top

>gb|AC025501.19| Mus musculus chromosome 10, clone RP23-129O23, complete sequence
          Length = 218156

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 18    aggggaaaggagagagagagg 38
             |||||||||||||||||||||
Sbjct: 85154 aggggaaaggagagagagagg 85134



to top

>ref|XM_470141.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2522

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                       
Query: 25 aggagagagagaggcgaggctagggtttc 53
          |||||||||||||  ||||||||||||||
Sbjct: 42 aggagagagagagaggaggctagggtttc 14



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 284     tcgacgacgagcacgccgtcg 304
               |||||||||||||||||||||
Sbjct: 2401306 tcgacgacgagcacgccgtcg 2401286



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 284     tcgacgacgagcacgccgtcg 304
               |||||||||||||||||||||
Sbjct: 1633087 tcgacgacgagcacgccgtcg 1633067



to top

>gb|AC117802.9| Mus musculus chromosome 15, clone RP24-560I8, complete sequence
          Length = 165241

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 15    gaaaggggaaaggagagagag 35
             |||||||||||||||||||||
Sbjct: 99198 gaaaggggaaaggagagagag 99178



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 284     tcgacgacgagcacgccgtcg 304
               |||||||||||||||||||||
Sbjct: 2879801 tcgacgacgagcacgccgtcg 2879781



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 25       aggagagagagaggcgaggctagggtttc 53
                |||||||||||||  ||||||||||||||
Sbjct: 34142516 aggagagagagagaggaggctagggtttc 34142488



to top

>gb|AC109247.14| Mus musculus chromosome 9, clone RP23-462C14, complete sequence
          Length = 225020

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 16     aaaggggaaaggagagagaga 36
              |||||||||||||||||||||
Sbjct: 106064 aaaggggaaaggagagagaga 106084



to top

>gb|AC102643.9| Mus musculus chromosome 8, clone RP23-304B22, complete sequence
          Length = 210037

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    aaggggaaaggagagagagag 37
             |||||||||||||||||||||
Sbjct: 15303 aaggggaaaggagagagagag 15283



to top

>gb|AC163628.5| Mus musculus BAC clone RP23-138F21 from chromosome 3, complete sequence
          Length = 194400

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 14     ggaaaggggaaaggagagagagagg 38
              |||||||||| ||||||||||||||
Sbjct: 139425 ggaaaggggagaggagagagagagg 139401



to top

>gb|AC162519.4| Mus musculus chromosome 8, clone RP24-146M21, complete sequence
          Length = 150115

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aaggggaaaggagagagagag 37
             |||||||||||||||||||||
Sbjct: 49077 aaggggaaaggagagagagag 49097



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 284     tcgacgacgagcacgccgtcg 304
               |||||||||||||||||||||
Sbjct: 2609962 tcgacgacgagcacgccgtcg 2609942



to top

>gb|AC067751.7| Homo sapiens chromosome 10 clone RP11-357K14, complete sequence
          Length = 180882

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 14     ggaaaggggaaaggagagaga 34
              |||||||||||||||||||||
Sbjct: 122936 ggaaaggggaaaggagagaga 122956



to top

>gb|AC068207.6| Homo sapiens chromosome 8, clone RP11-26K8, complete sequence
          Length = 168843

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 435   gctgtctttgttgagaaagga 455
             |||||||||||||||||||||
Sbjct: 91590 gctgtctttgttgagaaagga 91570



to top

>gb|DQ073386.1| Heliocidaris erythrogramma goosecoid (Gsc) mRNA, complete cds
          Length = 3438

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 17   aaggggaaaggagagagagag 37
            |||||||||||||||||||||
Sbjct: 2374 aaggggaaaggagagagagag 2354



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 25       aggagagagagaggcgaggctagggtttc 53
                |||||||||||||  ||||||||||||||
Sbjct: 34232988 aggagagagagagaggaggctagggtttc 34232960



to top

>emb|AL603782.5| Mouse DNA sequence from clone RP23-480M4 on chromosome 8, complete
             sequence
          Length = 175157

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 18    aggggaaaggagagagagagg 38
             |||||||||||||||||||||
Sbjct: 52979 aggggaaaggagagagagagg 52959



to top

>gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic sequence, complete
              sequence
          Length = 163828

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 25     aggagagagagaggcgaggctagggtttc 53
              |||||||||||||  ||||||||||||||
Sbjct: 106328 aggagagagagagaggaggctagggtttc 106300



to top

>gb|AC129569.17| Mus musculus chromosome 5, clone RP23-121M13, complete sequence
          Length = 199799

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 14     ggaaaggggaaaggagagaga 34
              |||||||||||||||||||||
Sbjct: 145369 ggaaaggggaaaggagagaga 145349



to top

>gb|AF245690.1|AF245690 Streptomyces verticillus putative N-acetyl-glucosamine transferase
            gene, partial cds; and putative N-acetyl-glucosamine
            2-epimerase and hypothetical protein genes, complete cds
          Length = 5222

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 171  ggggttcgacgacgcggacgc 191
            |||||||||||||||||||||
Sbjct: 2549 ggggttcgacgacgcggacgc 2529



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 202     gaggtggaggcgcgcggggcg 222
               |||||||||||||||||||||
Sbjct: 4765305 gaggtggaggcgcgcggggcg 4765285



to top

>dbj|AK102784.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K19,
          full insert sequence
          Length = 2370

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                       
Query: 25 aggagagagagaggcgaggctagggtttc 53
          |||||||||||||  ||||||||||||||
Sbjct: 75 aggagagagagagaggaggctagggtttc 47



to top

>gb|AC154828.2| Mus musculus BAC clone RP24-549A19 from 13, complete sequence
          Length = 138426

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aaggggaaaggagagagagag 37
             |||||||||||||||||||||
Sbjct: 72172 aaggggaaaggagagagagag 72192



to top

>dbj|AK069740.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023030D03,
          full insert sequence
          Length = 2282

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                       
Query: 25 aggagagagagaggcgaggctagggtttc 53
          |||||||||||||  ||||||||||||||
Sbjct: 77 aggagagagagagaggaggctagggtttc 49



to top

>dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-53I21, complete
             sequence
          Length = 156583

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 435   gctgtctttgttgagaaagga 455
             |||||||||||||||||||||
Sbjct: 22760 gctgtctttgttgagaaagga 22740



to top

>gb|AC079682.29| Mus musculus strain C57BL/6J chromosome 3 clone rp23-463h24, complete
              sequence
          Length = 181082

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 14     ggaaaggggaaaggagagagagagg 38
              |||||||||| ||||||||||||||
Sbjct: 153266 ggaaaggggagaggagagagagagg 153290



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 284     tcgacgacgagcacgccgtcg 304
               |||||||||||||||||||||
Sbjct: 2279117 tcgacgacgagcacgccgtcg 2279137



to top

>gb|AC131122.4| Mus musculus BAC clone RP24-553B2 from 3, complete sequence
          Length = 183750

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 14    ggaaaggggaaaggagagagagagg 38
             |||||||||| ||||||||||||||
Sbjct: 28790 ggaaaggggagaggagagagagagg 28814



to top

>gb|AC142415.4| Mus musculus BAC clone RP23-155F24 from 10, complete sequence
          Length = 209693

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 18    aggggaaaggagagagagagg 38
             |||||||||||||||||||||
Sbjct: 98610 aggggaaaggagagagagagg 98630



to top

>gb|AC159126.4| Mus musculus chromosome 8, clone RP23-182M11, complete sequence
          Length = 238838

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 18     aggggaaaggagagagagagg 38
              |||||||||||||||||||||
Sbjct: 233678 aggggaaaggagagagagagg 233698



to top

>emb|AL844553.4| Mouse DNA sequence from clone RP23-255J15 on chromosome 2, complete
             sequence
          Length = 82080

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    aaggggaaaggagagagagag 37
             |||||||||||||||||||||
Sbjct: 26381 aaggggaaaggagagagagag 26401



to top

>emb|AL731795.11| Mouse DNA sequence from clone RP23-123M13 on chromosome 2, complete
              sequence
          Length = 177282

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 14     ggaaaggggaaaggagagaga 34
              |||||||||||||||||||||
Sbjct: 146337 ggaaaggggaaaggagagaga 146357



to top

>dbj|AP000071.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region,
             section 7/19
          Length = 100000

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 435   gctgtctttgttgagaaagga 455
             |||||||||||||||||||||
Sbjct: 39003 gctgtctttgttgagaaagga 39023



to top

>ref|NM_119602.1| Arabidopsis thaliana ubiquitin-protein ligase/ zinc ion binding
           AT4G34370 mRNA, complete cds
          Length = 2280

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 432 tttgctgtctttgttgagaaagga 455
           |||||||| |||||||||||||||
Sbjct: 470 tttgctgtgtttgttgagaaagga 493



to top

>ref|NM_111347.1| Arabidopsis thaliana unknown protein AT3G04750 mRNA, complete cds
          Length = 1986

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 243 ttgcggcgaggatttcgatt 262
           ||||||||||||||||||||
Sbjct: 19  ttgcggcgaggatttcgatt 38



to top

>gb|AY374476.1| Tetraodon nigroviridis class I helical cytokine receptor member 4
           (CRFA4) mRNA, complete cds
          Length = 2476

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 cggacgccggcggggacgag 204
           ||||||||||||||||||||
Sbjct: 945 cggacgccggcggggacgag 964



to top

>gb|AC115972.13| Mus musculus chromosome 5, clone RP24-79A6, complete sequence
          Length = 235928

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     aggggaaaggagagagagag 37
              ||||||||||||||||||||
Sbjct: 209713 aggggaaaggagagagagag 209694



to top

>ref|XM_465933.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tcgacgacgagcacgccgtc 303
           ||||||||||||||||||||
Sbjct: 731 tcgacgacgagcacgccgtc 712



to top

>gb|AC102834.8| Mus musculus chromosome 5, clone RP24-299N23, complete sequence
          Length = 170365

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 15     gaaaggggaaaggagagagagagg 38
              |||||||| |||||||||||||||
Sbjct: 104408 gaaagggggaaggagagagagagg 104431



to top

>gb|AC175200.2| Sporobolomyces roseus clone JGIBAIF-29B10, complete sequence
          Length = 40413

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    aaggggaaaggagagagaga 36
             ||||||||||||||||||||
Sbjct: 19686 aaggggaaaggagagagaga 19705



to top

>gb|AC185523.2| Pan troglodytes chromosome X clone PTB-124O20 map human ortholog p11.3,
              complete sequence
          Length = 209530

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 14     ggaaaggggaaaggagagagagag 37
              |||||||| |||||||||||||||
Sbjct: 131560 ggaaagggaaaaggagagagagag 131583



to top

>gb|AC115843.10| Mus musculus chromosome 9, clone RP24-239P6, complete sequence
          Length = 215265

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    aggggaaaggagagagagag 37
             ||||||||||||||||||||
Sbjct: 49794 aggggaaaggagagagagag 49775



to top

>gb|AC092482.71| Mus musculus strain C57BL/6J clone rp23-60j11, complete sequence
          Length = 220334

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    aaggggaaaggagagagaga 36
             ||||||||||||||||||||
Sbjct: 96648 aaggggaaaggagagagaga 96667



to top

>gb|AC123678.19| Mus musculus chromosome 3, clone RP23-276A22, complete sequence
          Length = 198615

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    aaggggaaaggagagagaga 36
             ||||||||||||||||||||
Sbjct: 58132 aaggggaaaggagagagaga 58151



to top

>gb|AC110164.26| Mus musculus chromosome 3, clone RP23-167C5, complete sequence
          Length = 199235

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 15    gaaaggggaaaggagagagagagg 38
             ||||| ||||||||||||||||||
Sbjct: 26305 gaaagaggaaaggagagagagagg 26328



to top

>gb|AC126426.3| Mus musculus BAC clone RP24-291G13 from chromosome 13, complete sequence
          Length = 201051

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     aggggaaaggagagagagag 37
              ||||||||||||||||||||
Sbjct: 108801 aggggaaaggagagagagag 108782



to top

>emb|CT009536.7| Mouse DNA sequence from clone RP23-25A7 on chromosome 14, complete
              sequence
          Length = 239515

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     aggggaaaggagagagagag 37
              ||||||||||||||||||||
Sbjct: 148444 aggggaaaggagagagagag 148463



to top

>gb|AC131758.3| Mus musculus BAC clone RP24-211E5 from chromosome 19, complete sequence
          Length = 206288

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    ggggaaaggagagagagagg 38
             ||||||||||||||||||||
Sbjct: 25922 ggggaaaggagagagagagg 25941



to top

>gb|AC122336.4| Mus musculus BAC clone RP23-351K21 from chromosome 7, complete sequence
          Length = 189296

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     aggggaaaggagagagagag 37
              ||||||||||||||||||||
Sbjct: 167119 aggggaaaggagagagagag 167138



to top

>gb|AC011437.6|ATAC011437 Arabidopsis thaliana chromosome III BAC F7O18 genomic sequence,
             complete sequence
          Length = 95310

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   ttgcggcgaggatttcgatt 262
             ||||||||||||||||||||
Sbjct: 81711 ttgcggcgaggatttcgatt 81692



to top

>gb|AC125399.3| Mus musculus BAC clone RP24-245C15 from chromosome 14, complete
             sequence
          Length = 195425

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    gaaaggggaaaggagagaga 34
             ||||||||||||||||||||
Sbjct: 15503 gaaaggggaaaggagagaga 15522



to top

>gb|AC124419.4| Mus musculus BAC clone RP24-319P11 from chromosome 18, complete sequence
          Length = 140103

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     aggggaaaggagagagagag 37
              ||||||||||||||||||||
Sbjct: 117279 aggggaaaggagagagagag 117260



to top

>gb|AC124359.3| Mus musculus BAC clone RP24-495G2 from chromosome 1, complete sequence
          Length = 174750

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    ggggaaaggagagagagagg 38
             ||||||||||||||||||||
Sbjct: 81220 ggggaaaggagagagagagg 81201



to top

>gb|AC127290.3| Mus musculus BAC clone RP23-364F13 from chromosome 5, complete
            sequence
          Length = 187121

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 15   gaaaggggaaaggagagagagagg 38
            |||||||| |||||||||||||||
Sbjct: 8626 gaaagggggaaggagagagagagg 8649



to top

>gb|AC091173.10| Homo sapiens chromosome 8, clone RP11-280G9, complete sequence
          Length = 142265

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   aggcgcgcggggcggaggcc 228
             ||||||||||||||||||||
Sbjct: 69905 aggcgcgcggggcggaggcc 69924



to top

>gb|AC126277.3| Mus musculus BAC clone RP23-161L22 from 12, complete sequence
          Length = 191231

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     aggggaaaggagagagagag 37
              ||||||||||||||||||||
Sbjct: 129039 aggggaaaggagagagagag 129020



to top

>gb|AC124178.3| Mus musculus BAC clone RP23-193J15 from 18, complete sequence
          Length = 206833

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 14     ggaaaggggaaaggagagag 33
              ||||||||||||||||||||
Sbjct: 142675 ggaaaggggaaaggagagag 142694



to top

>gb|AC116578.3| Mus musculus BAC clone RP23-264P8 from 9, complete sequence
          Length = 151722

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     aggggaaaggagagagagag 37
              ||||||||||||||||||||
Sbjct: 132133 aggggaaaggagagagagag 132114



to top

>gb|AC084391.1| Mus musculus BAC clone RP23-294I17 from 1, complete sequence
          Length = 166182

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 469   agattgcagtcctttcttgg 488
             ||||||||||||||||||||
Sbjct: 31417 agattgcagtcctttcttgg 31436



to top

>gb|AC113481.12| Mus musculus chromosome 12, clone RP23-310G22, complete sequence
          Length = 199650

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    aggggaaaggagagagagag 37
             ||||||||||||||||||||
Sbjct: 84146 aggggaaaggagagagagag 84165



to top

>gb|AC119813.16| Mus musculus chromosome 14, clone RP23-298L20, complete sequence
          Length = 169207

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 15     gaaaggggaaaggagagaga 34
              ||||||||||||||||||||
Sbjct: 162658 gaaaggggaaaggagagaga 162677



to top

>gb|AC156398.13| Mus musculus 6 BAC RP24-279F16 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 170925

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 14    ggaaaggggaaaggagagagagag 37
             ||||||||||| ||||||||||||
Sbjct: 38399 ggaaaggggaagggagagagagag 38376



to top

>emb|AL592151.13| Human DNA sequence from clone RP11-351N5 on chromosome 1 Contains a
             novel gene, the 5' end of the AKT3 gene for  v-akt murine
             thymoma viral oncogene homolog 3 (protein kinase B, gamma)
             and a CpG island, complete sequence
          Length = 148345

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    aggggaaaggagagagagag 37
             ||||||||||||||||||||
Sbjct: 50397 aggggaaaggagagagagag 50378



to top

>emb|AL591491.5| Human DNA sequence from clone RP11-435K1 on chromosome Xp15.3-15.5
              Contains the 5' end of a novel gene (FLJ14103 FLJ37558) and
              the 5' end of a novel gene, complete sequence
          Length = 121720

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 14     ggaaaggggaaaggagagagagag 37
              |||||||| |||||||||||||||
Sbjct: 100656 ggaaagggaaaaggagagagagag 100679



to top

>emb|AL590725.5| Human DNA sequence from clone RP11-107L15 on chromosome 6 Contains the
             gene for G protein-coupled receptor slt
             (melanin-concentrating hormone 2) (SLT), the 3' end of a
             novel gene and a CpG island, complete sequence
          Length = 180708

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 14    ggaaaggggaaaggagagag 33
             ||||||||||||||||||||
Sbjct: 18339 ggaaaggggaaaggagagag 18320



to top

>emb|AL133260.12| Human DNA sequence from clone RP1-292B18 on chromosome 6q24.3-25.3
             Contains a 60S ribosomal protein L32 (RPL32) pseudogene,
             the 3' end of the gene for a novel protein similar to
             C1-tetrahydrofolate synthases (contains DKFZP586G1517
             protein and FLJ21145, contains a tetrahydrofolate
             dehydrogenase/cyclohydrolase domain), part of a novel gene
             and a novel gene, complete sequence
          Length = 109310

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    aggggaaaggagagagagag 37
             ||||||||||||||||||||
Sbjct: 47393 aggggaaaggagagagagag 47412



to top

>gb|AC158756.4| Mus musculus chromosome 5, clone RP24-151L11, complete sequence
          Length = 147858

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     aggggaaaggagagagagag 37
              ||||||||||||||||||||
Sbjct: 116267 aggggaaaggagagagagag 116286



to top

>emb|AL021997.1|HS874C20 Human DNA sequence from clone RP5-874C20 on chromosome 6p22.1-22.3
            Contains the 5' end of a novel protein similar to zinc
            finger protein 306 (ZNF306, ZFP47), the gene for a novel
            C2H2 type zinc finger protein, a novel gene, a zinc
            finger protein SRE-ZBP pseudogene and a CpG island,
            complete sequence
          Length = 97847

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 350  tggacttgataggccacttgacaa 373
            |||| |||||||||||||||||||
Sbjct: 8175 tggatttgataggccacttgacaa 8198



to top

>gb|AY117264.1| Arabidopsis thaliana unknown protein (At4g34370) mRNA, complete cds
          Length = 1825

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 432 tttgctgtctttgttgagaaagga 455
           |||||||| |||||||||||||||
Sbjct: 256 tttgctgtgtttgttgagaaagga 279



to top

>gb|AY050864.1| Arabidopsis thaliana unknown protein (At4g34370) mRNA, complete cds
          Length = 2296

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 432 tttgctgtctttgttgagaaagga 455
           |||||||| |||||||||||||||
Sbjct: 470 tttgctgtgtttgttgagaaagga 493



to top

>emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 81
          Length = 195921

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 432   tttgctgtctttgttgagaaagga 455
             |||||||| |||||||||||||||
Sbjct: 80906 tttgctgtgtttgttgagaaagga 80929



to top

>emb|AL035521.1|ATF10M10 Arabidopsis thaliana DNA chromosome 4, BAC clone F10M10 (ESSA project)
          Length = 114367

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 432   tttgctgtctttgttgagaaagga 455
             |||||||| |||||||||||||||
Sbjct: 72387 tttgctgtgtttgttgagaaagga 72410



to top

>emb|AJ851422.1| Gallus gallus mRNA for hypothetical protein, clone 2g14
          Length = 5951

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 59   ccaatcccgccatggattcc 78
            ||||||||||||||||||||
Sbjct: 4922 ccaatcccgccatggattcc 4903



to top

>gb|AC091694.9| Mus musculus Strain C57BL6/J chromosome 11 BAC, RP23-316F3, Complete
             Sequence, complete sequence
          Length = 213119

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    aggggaaaggagagagagag 37
             ||||||||||||||||||||
Sbjct: 71048 aggggaaaggagagagagag 71067



to top

>emb|CR628311.1| Human DNA sequence from clone XX-NCIH2171_5AD01, complete sequence
          Length = 114317

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 209    aggcgcgcggggcggaggcc 228
              ||||||||||||||||||||
Sbjct: 102903 aggcgcgcggggcggaggcc 102922



to top

>emb|CR626894.1| Human DNA sequence from clone XX-NCIH2171_3M21, complete sequence
          Length = 126392

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 209    aggcgcgcggggcggaggcc 228
              ||||||||||||||||||||
Sbjct: 110219 aggcgcgcggggcggaggcc 110200



to top

>dbj|AK123280.1| Homo sapiens cDNA FLJ41286 fis, clone BRAMY2038475
          Length = 2313

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 350 tggacttgataggccacttgacaa 373
           |||| |||||||||||||||||||
Sbjct: 370 tggatttgataggccacttgacaa 393



to top

>gb|AC164576.4| Mus musculus 10 BAC RP23-50F14 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 205209

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 19   ggggaaaggagagagagagg 38
            ||||||||||||||||||||
Sbjct: 6750 ggggaaaggagagagagagg 6731



to top

>gb|AC067881.5| Homo sapiens chromosome 8, clone RP11-687K23, complete sequence
          Length = 186676

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 209    aggcgcgcggggcggaggcc 228
              ||||||||||||||||||||
Sbjct: 151994 aggcgcgcggggcggaggcc 151975



to top

>dbj|AK036494.1| Mus musculus adult male bone cDNA, RIKEN full-length enriched
            library, clone:9830118L20 product:unclassifiable, full
            insert sequence
          Length = 3083

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 14   ggaaaggggaaaggagagagagag 37
            ||||||||||| ||||||||||||
Sbjct: 1009 ggaaaggggaagggagagagagag 986



to top

>dbj|AK016941.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4933427B05 product:synuclein, alpha
            interacting protein (synphilin), full insert sequence
          Length = 1425

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 14   ggaaaggggaaaggagagag 33
            ||||||||||||||||||||
Sbjct: 1371 ggaaaggggaaaggagagag 1390



to top

>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete
              genome
          Length = 3570858

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    cggcggggacgaggtggagg 211
              ||||||||||||||||||||
Sbjct: 491600 cggcggggacgaggtggagg 491619



to top

>gb|AC157214.2| Mus musculus BAC clone RP23-35J2 from chromosome 19, complete sequence
          Length = 207625

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    ggggaaaggagagagagagg 38
             ||||||||||||||||||||
Sbjct: 29363 ggggaaaggagagagagagg 29344



to top

>dbj|AK084742.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:D330037H13 product:unclassifiable, full
           insert sequence
          Length = 1813

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 15  gaaaggggaaaggagagagagagg 38
           ||||| ||||||||||||||||||
Sbjct: 231 gaaagaggaaaggagagagagagg 254



to top

>gb|AC153485.9| Mus musculus 10 BAC RP23-319B13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 213412

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     ggggaaaggagagagagagg 38
              ||||||||||||||||||||
Sbjct: 101280 ggggaaaggagagagagagg 101261



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 194      gcggggacgaggtggaggcg 213
                ||||||||||||||||||||
Sbjct: 18961441 gcggggacgaggtggaggcg 18961460



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 19       ggggaaaggagagagagagg 38
                ||||||||||||||||||||
Sbjct: 13412205 ggggaaaggagagagagagg 13412186



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 19       ggggaaaggagagagagagg 38
                ||||||||||||||||||||
Sbjct: 13403269 ggggaaaggagagagagagg 13403250



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 19       ggggaaaggagagagagagg 38
                ||||||||||||||||||||
Sbjct: 13361482 ggggaaaggagagagagagg 13361501



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 18       aggggaaaggagagagagag 37
                ||||||||||||||||||||
Sbjct: 16677874 aggggaaaggagagagagag 16677893



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 232      aactgccccttttgcggcga 251
                ||||||||||||||||||||
Sbjct: 14882498 aactgccccttttgcggcga 14882517



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 18      aggggaaaggagagagagag 37
               ||||||||||||||||||||
Sbjct: 4240223 aggggaaaggagagagagag 4240204



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 19      ggggaaaggagagagagagg 38
               ||||||||||||||||||||
Sbjct: 2612775 ggggaaaggagagagagagg 2612756



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 20       gggaaaggagagagagaggc 39
                ||||||||||||||||||||
Sbjct: 29635416 gggaaaggagagagagaggc 29635435



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 284      tcgacgacgagcacgccgtc 303
                ||||||||||||||||||||
Sbjct: 18386042 tcgacgacgagcacgccgtc 18386023



to top

>emb|BX825075.1|CNS0A5SW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH93ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1716

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  ggagagagagaggcgaggct 45
           ||||||||||||||||||||
Sbjct: 550 ggagagagagaggcgaggct 569



to top

>gb|AC097473.3| Homo sapiens BAC clone RP11-75N20 from 4, complete sequence
          Length = 150573

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 203   aggtggaggcgcgcggggcg 222
             ||||||||||||||||||||
Sbjct: 26269 aggtggaggcgcgcggggcg 26288



to top

>gb|AC156024.2| Mus musculus BAC clone RP23-89J1 from chromosome 16, complete sequence
          Length = 240451

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 14     ggaaaggggaaaggagagagagag 37
              ||||||||||| ||||||||||||
Sbjct: 107691 ggaaaggggaagggagagagagag 107714



to top

>gb|AC005678.1|AC005678 Homo sapiens PAC clone RP11-569I24 from 7, complete sequence
          Length = 187543

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 350   tggacttgataggccacttgacaa 373
             |||| |||||||||||||||||||
Sbjct: 19603 tggatttgataggccacttgacaa 19580



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 208     gaggcgcgcggggcggaggc 227
               ||||||||||||||||||||
Sbjct: 3607177 gaggcgcgcggggcggaggc 3607158



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 184     gcggacgccggcggggacgaggtggagg 211
               |||| |||||||| ||||||||||||||
Sbjct: 3053483 gcggtcgccggcgtggacgaggtggagg 3053456



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 204    ggtggaggcgcgcggggcggaggc 227
              |||||||||||||| |||||||||
Sbjct: 152312 ggtggaggcgcgcgcggcggaggc 152335



to top

>gb|AC167467.1| Mus musculus BAC clone RP23-158E17 from chromosome 9, complete sequence
          Length = 212426

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     aggggaaaggagagagagag 37
              ||||||||||||||||||||
Sbjct: 199041 aggggaaaggagagagagag 199022



to top

>dbj|AP005919.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0554A06
          Length = 165311

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    aggggaaaggagagagagag 37
             ||||||||||||||||||||
Sbjct: 85444 aggggaaaggagagagagag 85425



to top

>dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1191_G08
          Length = 172832

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 20   gggaaaggagagagagaggc 39
            ||||||||||||||||||||
Sbjct: 4395 gggaaaggagagagagaggc 4414



to top

>ref|NM_001012915.1| Gallus gallus ankyrin repeat domain 28-like (LOC424055), mRNA
          Length = 5951

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 59   ccaatcccgccatggattcc 78
            ||||||||||||||||||||
Sbjct: 4922 ccaatcccgccatggattcc 4903



to top

>dbj|AP004806.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0710H01
          Length = 187107

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    ggggaaaggagagagagagg 38
             ||||||||||||||||||||
Sbjct: 68116 ggggaaaggagagagagagg 68097



to top

>dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0529C07
          Length = 174011

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    ggggaaaggagagagagagg 38
             ||||||||||||||||||||
Sbjct: 24522 ggggaaaggagagagagagg 24503



to top

>dbj|AP005928.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0031F23
          Length = 128090

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 232   aactgccccttttgcggcga 251
             ||||||||||||||||||||
Sbjct: 97771 aactgccccttttgcggcga 97790



to top

>dbj|AP004165.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1479_B12
          Length = 127089

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 20    gggaaaggagagagagaggc 39
             ||||||||||||||||||||
Sbjct: 93137 gggaaaggagagagagaggc 93156



to top

>gb|AC153612.6| Mus musculus 6 BAC RP23-435I4 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 197401

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 14     ggaaaggggaaaggagagagagag 37
              ||||||||||| ||||||||||||
Sbjct: 155185 ggaaaggggaagggagagagagag 155162



to top

>dbj|AP003808.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1115_C05
          Length = 146585

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    aggggaaaggagagagagag 37
             ||||||||||||||||||||
Sbjct: 17786 aggggaaaggagagagagag 17805



to top

>dbj|AP004861.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0001A11
          Length = 153252

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 284   tcgacgacgagcacgccgtc 303
             ||||||||||||||||||||
Sbjct: 48966 tcgacgacgagcacgccgtc 48947



to top

>emb|AL805978.10| Mouse DNA sequence from clone RP23-344I3 on chromosome X, complete
              sequence
          Length = 190744

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     aggggaaaggagagagagag 37
              ||||||||||||||||||||
Sbjct: 167359 aggggaaaggagagagagag 167340



to top

>emb|AL356364.18| Human DNA sequence from clone RP11-328I22 on chromosome 1 Contains a
             novel gene (LOC388739) and a CpG island, complete sequence
          Length = 102634

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 14    ggaaaggggaaaggagagagagag 37
             |||||||| |||||||||||||||
Sbjct: 47841 ggaaagggaaaaggagagagagag 47818



to top

>gb|AY103623.1| Zea mays PCO141453 mRNA sequence
          Length = 1198

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 21 ggaaaggagagagagaggcg 40
          ||||||||||||||||||||
Sbjct: 48 ggaaaggagagagagaggcg 67



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 194      gcggggacgaggtggaggcg 213
                ||||||||||||||||||||
Sbjct: 18887668 gcggggacgaggtggaggcg 18887687



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 19       ggggaaaggagagagagagg 38
                ||||||||||||||||||||
Sbjct: 13366479 ggggaaaggagagagagagg 13366460



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 19       ggggaaaggagagagagagg 38
                ||||||||||||||||||||
Sbjct: 13357543 ggggaaaggagagagagagg 13357524



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 19       ggggaaaggagagagagagg 38
                ||||||||||||||||||||
Sbjct: 13315756 ggggaaaggagagagagagg 13315775



to top

>emb|AL831808.4|CNS08CAL Oryza sativa chromosome 12, . BAC OSJNBa0028H02 of library OSJNBa
            from chromosome 12 of cultivar Nipponbare of ssp.
            japonica of Oryza sativa (rice), complete sequence
          Length = 153064

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 194  gcggggacgaggtggaggcg 213
            ||||||||||||||||||||
Sbjct: 8938 gcggggacgaggtggaggcg 8919



to top

>emb|AL831802.5|CNS08CAF Oryza sativa chromosome 12, . Partial sequence from BAC OSJNBa0083D13
             of library OSJNBa from chromosome 12 of cultivar
             Nipponbare of ssp. japonica of Oryza sativa (rice),
             complete sequence
          Length = 104259

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    ggggaaaggagagagagagg 38
             ||||||||||||||||||||
Sbjct: 71498 ggggaaaggagagagagagg 71479



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    ggggaaaggagagagagagg 38
             ||||||||||||||||||||
Sbjct: 29711 ggggaaaggagagagagagg 29730



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    ggggaaaggagagagagagg 38
             ||||||||||||||||||||
Sbjct: 20775 ggggaaaggagagagagagg 20794



to top

>emb|BX255875.3|CNS09S4W Oryza sativa chromosome 12, . BAC OSJNBa0018L16 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 151203

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 194   gcggggacgaggtggaggcg 213
             ||||||||||||||||||||
Sbjct: 57558 gcggggacgaggtggaggcg 57577



to top

>emb|AJ510204.1|ATH510204 Arabidopsis thaliana ari1 gene for ARIADNE-like protein ARI1, exons
           1-6
          Length = 2491

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 432 tttgctgtctttgttgagaaagga 455
           |||||||| |||||||||||||||
Sbjct: 663 tttgctgtgtttgttgagaaagga 686



to top

>gb|AC133169.3| Mus musculus BAC clone RP24-259I15 from 9, complete sequence
          Length = 163930

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 18   aggggaaaggagagagagag 37
            ||||||||||||||||||||
Sbjct: 1878 aggggaaaggagagagagag 1859



to top

>gb|AC132103.3| Mus musculus BAC clone RP24-363K20 from 9, complete sequence
          Length = 192053

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 15     gaaaggggaaaggagagagagagg 38
              ||||||||||||||| ||||||||
Sbjct: 145704 gaaaggggaaaggagggagagagg 145681



to top

>gb|AC141469.4| Mus musculus BAC clone RP24-439P5 from 5, complete sequence
          Length = 183468

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 23    aaaggagagagagaggcgaggcta 46
             ||||||||||||||||| ||||||
Sbjct: 85268 aaaggagagagagaggctaggcta 85245



to top

>gb|AC149593.5| Mus musculus BAC clone RP23-34O23 from 7, complete sequence
          Length = 231000

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    aggggaaaggagagagagag 37
             ||||||||||||||||||||
Sbjct: 97290 aggggaaaggagagagagag 97309



to top

>gb|AC124126.14| Mus musculus chromosome 18, clone RP23-377C8, complete sequence
          Length = 192355

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     ggaaaggggaaaggagagag 33
              ||||||||||||||||||||
Sbjct: 176295 ggaaaggggaaaggagagag 176276



to top

>emb|AL645542.13| Mouse DNA sequence from clone RP23-468A19 on chromosome 11, complete
              sequence
          Length = 166100

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 18     aggggaaaggagagagagag 37
              ||||||||||||||||||||
Sbjct: 158705 aggggaaaggagagagagag 158686



to top

>gb|L00026.1|YSCACT Yeast (S.cerevisiae) actin gene, complete cds
          Length = 2509

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 23  aaaggagagagagaggcgag 42
           ||||||||||||||||||||
Sbjct: 413 aaaggagagagagaggcgag 394



to top

>dbj|D50617.1|YSCCHRVIN Saccharomyces cerevisiae chromosome VI complete DNA sequence
          Length = 270148

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    aaaggagagagagaggcgag 42
             ||||||||||||||||||||
Sbjct: 54955 aaaggagagagagaggcgag 54974


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,620,032
Number of Sequences: 3902068
Number of extensions: 7620032
Number of successful extensions: 100307
Number of sequences better than 10.0: 147
Number of HSP's better than 10.0 without gapping: 151
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 98233
Number of HSP's gapped (non-prelim): 2064
length of query: 508
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 486
effective length of database: 17,147,199,772
effective search space: 8333539089192
effective search space used: 8333539089192
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top