ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart07e01
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_475461.1| Oryza sativa (japonica cultivar-group), predic... 92 1e-15
2gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome... 92 1e-15
3gb|AY459341.1| Oryza sativa (japonica cultivar-group) clone CL03... 92 1e-15
4dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 92 1e-15
5gb|AY106224.1| Zea mays PCO088072 mRNA sequence 74 2e-10
6gb|BT017777.1| Zea mays clone EL01N0503B10.c mRNA sequence 72 1e-09
7ref|NM_128260.3| Arabidopsis thaliana PAG1; endopeptidase/ pepti... 68 1e-08
8gb|AY124806.1| Arabidopsis thaliana At2g27020/T20P8.7 mRNA, comp... 68 1e-08
9gb|AC005623.3| Arabidopsis thaliana chromosome 2 clone T20P8 map... 68 1e-08
10gb|AF375455.1| Arabidopsis thaliana At2g27020/T20P8.7 mRNA, comp... 68 1e-08
11gb|AY088609.1| Arabidopsis thaliana clone 8342 mRNA, complete se... 68 1e-08
12gb|AY109645.1| Zea mays CL4356_2 mRNA sequence 68 1e-08
13gb|AF043528.1|AF043528 Arabidopsis thaliana 20S proteasome subun... 68 1e-08
14gb|BT017004.1| Zea mays clone EK07D2310A08.c mRNA sequence 64 2e-07
15emb|Y13693.1|ATY13693 Arabidopsis thaliana mRNA for proteasome s... 60 4e-06
16ref|NM_191042.1| Oryza sativa (japonica cultivar-group), predic... 58 1e-05
17dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 58 1e-05
18dbj|AP003260.5| Oryza sativa (japonica cultivar-group) genomic D... 58 1e-05
19dbj|AP003247.4| Oryza sativa (japonica cultivar-group) genomic D... 58 1e-05
20dbj|AK103541.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 1e-05
21dbj|AK061784.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 1e-05
22dbj|AB026562.1| Oryza sativa (japonica cultivar-group) OsPAG1 mR... 58 1e-05
23dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 0.85
24ref|NM_126597.2| Arabidopsis thaliana PAA2; endopeptidase/ pepti... 40 3.4
25ref|NM_001036263.1| Arabidopsis thaliana PAA2; endopeptidase/ pe... 40 3.4
26gb|AC112208.3| Oryza sativa (japonica cultivar-group) chromosome... 40 3.4
27ref|XM_367205.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 3.4
28ref|XM_386335.1| Gibberella zeae PH-1 chromosome 3 conserved hyp... 40 3.4
29gb|AY143829.1| Arabidopsis thaliana At2g05840/T6P5.4 mRNA, compl... 40 3.4
30gb|AY052679.1| Arabidopsis thaliana At2g05840/T6P5.4 mRNA, compl... 40 3.4
31dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.4
32dbj|AK099876.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 3.4
33gb|AF043519.1|AF043519 Arabidopsis thaliana 20S proteasome subun... 40 3.4
34gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 3.4 
>ref|XM_475461.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 750

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 77/88 (87%)
 Strand = Plus / Plus

                                                                       
Query: 173 atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
           ||||| |||| |||  |||| |||||||| ||||||||||| |||||||| || ||||||
Sbjct: 1   atgagtagcatagggactggttatgatctttccgtcaccaccttctccccagatggccgt 60

                                       
Query: 233 gtcttccaggtcgagtatgctggcnagg 260
           ||||||||||| |||||||||||| |||
Sbjct: 61  gtcttccaggttgagtatgctggcaagg 88
to top
>gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0088I06, complete sequence
          Length = 187651

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                         
Query: 173   atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
             ||||| |||| |||  |||| |||||||| ||||||||||| |||||||| || ||||||
Sbjct: 48978 atgagtagcatagggactggttatgatctttccgtcaccaccttctccccagatggccgt 48919

                                         
Query: 233   gtcttccaggtcgagtatgctggcnagg 260
             ||||||||||| |||||||||||| |||
Sbjct: 48918 gtcttccaggttgagtatgctggcaagg 48891
to top
>gb|AY459341.1| Oryza sativa (japonica cultivar-group) clone CL031105.6 R2R3-MYB gene
             region
          Length = 58956

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 77/88 (87%)
 Strand = Plus / Plus

                                                                         
Query: 173   atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
             ||||| |||| |||  |||| |||||||| ||||||||||| |||||||| || ||||||
Sbjct: 31913 atgagtagcatagggactggttatgatctttccgtcaccaccttctccccagatggccgt 31972

                                         
Query: 233   gtcttccaggtcgagtatgctggcnagg 260
             ||||||||||| |||||||||||| |||
Sbjct: 31973 gtcttccaggttgagtatgctggcaagg 32000
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                            
Query: 173      atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
                ||||| |||| |||  |||| |||||||| ||||||||||| |||||||| || ||||||
Sbjct: 23980489 atgagtagcatagggactggttatgatctttccgtcaccaccttctccccagatggccgt 23980430

                                            
Query: 233      gtcttccaggtcgagtatgctggcnagg 260
                ||||||||||| |||||||||||| |||
Sbjct: 23980429 gtcttccaggttgagtatgctggcaagg 23980402
to top
>gb|AY106224.1| Zea mays PCO088072 mRNA sequence
          Length = 479

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                       
Query: 173 atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
           |||||||||| |||  | || ||||||||||| |||||||| ||||| || || ||||| 
Sbjct: 238 atgagcagcataggcacaggttatgatctgtctgtcaccaccttctctcccgatggccgc 297

                               
Query: 233 gtcttccaggtcgagtatgc 252
           ||||||||||||||||||||
Sbjct: 298 gtcttccaggtcgagtatgc 317
to top
>gb|BT017777.1| Zea mays clone EL01N0503B10.c mRNA sequence
          Length = 1266

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 170 accatgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggc 229
           ||||||||||||| |||  | || || ||| |||| ||||| ||||||||||| || || 
Sbjct: 184 accatgagcagcataggcacaggttacgatttgtctgtcacgactttctccccagatggt 243

                                  
Query: 230 cgtgtcttccaggtcgagtatgc 252
           |||||||||||||||||||||||
Sbjct: 244 cgtgtcttccaggtcgagtatgc 266
to top
>ref|NM_128260.3| Arabidopsis thaliana PAG1; endopeptidase/ peptidase/ threonine
           endopeptidase AT2G27020 (PAG1) mRNA, complete cds
          Length = 1024

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 185 gganctgggtatgatctgtccgtcaccactttctccccggacggccgtgtcttccaggtc 244
           ||| ||||||| ||||| ||||||||||||||||| || || |||||||| |||||| ||
Sbjct: 131 ggaactgggtacgatctctccgtcaccactttctctcccgatggccgtgttttccagatc 190

                
Query: 245 gagta 249
           |||||
Sbjct: 191 gagta 195
to top
>gb|AY124806.1| Arabidopsis thaliana At2g27020/T20P8.7 mRNA, complete cds
          Length = 750

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 185 gganctgggtatgatctgtccgtcaccactttctccccggacggccgtgtcttccaggtc 244
           ||| ||||||| ||||| ||||||||||||||||| || || |||||||| |||||| ||
Sbjct: 13  ggaactgggtacgatctctccgtcaccactttctctcccgatggccgtgttttccagatc 72

                
Query: 245 gagta 249
           |||||
Sbjct: 73  gagta 77
to top
>gb|AC005623.3| Arabidopsis thaliana chromosome 2 clone T20P8 map B68, complete
             sequence
          Length = 99345

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                         
Query: 185   gganctgggtatgatctgtccgtcaccactttctccccggacggccgtgtcttccaggtc 244
             ||| ||||||| ||||| ||||||||||||||||| || || |||||||| |||||| ||
Sbjct: 30321 ggaactgggtacgatctctccgtcaccactttctctcccgatggccgtgttttccagatc 30262

                  
Query: 245   gagta 249
             |||||
Sbjct: 30261 gagta 30257
to top
>gb|AF375455.1| Arabidopsis thaliana At2g27020/T20P8.7 mRNA, complete cds
          Length = 935

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 185 gganctgggtatgatctgtccgtcaccactttctccccggacggccgtgtcttccaggtc 244
           ||| ||||||| ||||| ||||||||||||||||| || || |||||||| |||||| ||
Sbjct: 46  ggaactgggtacgatctctccgtcaccactttctctcccgatggccgtgttttccagatc 105

                
Query: 245 gagta 249
           |||||
Sbjct: 106 gagta 110
to top
>gb|AY088609.1| Arabidopsis thaliana clone 8342 mRNA, complete sequence
          Length = 1022

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 185 gganctgggtatgatctgtccgtcaccactttctccccggacggccgtgtcttccaggtc 244
           ||| ||||||| ||||| ||||||||||||||||| || || |||||||| |||||| ||
Sbjct: 134 ggaactgggtacgatctctccgtcaccactttctctcccgatggccgtgttttccagatc 193

                
Query: 245 gagta 249
           |||||
Sbjct: 194 gagta 198
to top
>gb|AY109645.1| Zea mays CL4356_2 mRNA sequence
          Length = 1252

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                        
Query: 173  atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
            |||||||||| |||  | || || |||||||| |||||||| |||||||| || || |||
Sbjct: 1036 atgagcagcataggcacaggttacgatctgtctgtcaccaccttctccccagatggtcgt 977

                                 
Query: 233  gtcttccaggtcgagtatgct 253
            |||||||||||||| ||||||
Sbjct: 976  gtcttccaggtcgaatatgct 956
to top
>gb|AF043528.1|AF043528 Arabidopsis thaliana 20S proteasome subunit PAG1 (PAG1) mRNA,
           complete cds
          Length = 958

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 185 gganctgggtatgatctgtccgtcaccactttctccccggacggccgtgtcttccaggtc 244
           ||| ||||||| ||||| ||||||||||||||||| || || |||||||| |||||| ||
Sbjct: 56  ggaactgggtacgatctctccgtcaccactttctctcccgatggccgtgttttccagatc 115

                
Query: 245 gagta 249
           |||||
Sbjct: 116 gagta 120
to top
>gb|BT017004.1| Zea mays clone EK07D2310A08.c mRNA sequence
          Length = 1256

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 170 accatgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggc 229
           ||||||||||| | |||  | || || ||| |||| ||||| ||||||||||| || || 
Sbjct: 178 accatgagcaggataggcacaggttacgatttgtctgtcacgactttctccccagatggt 237

                                  
Query: 230 cgtgtcttccaggtcgagtatgc 252
           |||||||||||||||||||||||
Sbjct: 238 cgtgtcttccaggtcgagtatgc 260
to top
>emb|Y13693.1|ATY13693 Arabidopsis thaliana mRNA for proteasome subunit prc8
          Length = 958

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 185 gganctgggtatgatctgtccgtcaccactttctccccggacggccgtgtcttccaggtc 244
           ||| ||||||| ||||| ||||||||||||||||| || || ||| |||| |||||| ||
Sbjct: 56  ggaactgggtacgatctctccgtcaccactttctctcccgatggcggtgttttccagatc 115

                
Query: 245 gagta 249
           |||||
Sbjct: 116 gagta 120
to top
>ref|NM_191042.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 750

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
           |||||||||| |||  | || || ||||||||||| ||||| ||||| ||||| || || 
Sbjct: 1   atgagcagcataggcacaggatacgatctgtccgttaccaccttctctccggatggtcgc 60

                               
Query: 233 gtcttccaggtcgagtatgc 252
           ||||||||||| ||||||||
Sbjct: 61  gtcttccaggttgagtatgc 80
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                            
Query: 173      atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
                |||||||||| |||  | || || ||||||||||| ||||| ||||| ||||| || || 
Sbjct: 34464923 atgagcagcataggcacaggatacgatctgtccgttaccaccttctctccggatggtcgc 34464982

                                    
Query: 233      gtcttccaggtcgagtatgc 252
                ||||||||||| ||||||||
Sbjct: 34464983 gtcttccaggttgagtatgc 34465002
to top
>dbj|AP003260.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0468B07
          Length = 169071

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                          
Query: 173    atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
              |||||||||| |||  | || || ||||||||||| ||||| ||||| ||||| || || 
Sbjct: 147267 atgagcagcataggcacaggatacgatctgtccgttaccaccttctctccggatggtcgc 147326

                                  
Query: 233    gtcttccaggtcgagtatgc 252
              ||||||||||| ||||||||
Sbjct: 147327 gtcttccaggttgagtatgc 147346
to top
>dbj|AP003247.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0425G02
          Length = 155432

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                         
Query: 173   atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
             |||||||||| |||  | || || ||||||||||| ||||| ||||| ||||| || || 
Sbjct: 40642 atgagcagcataggcacaggatacgatctgtccgttaccaccttctctccggatggtcgc 40701

                                 
Query: 233   gtcttccaggtcgagtatgc 252
             ||||||||||| ||||||||
Sbjct: 40702 gtcttccaggttgagtatgc 40721
to top
>dbj|AK103541.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033132C12, full
           insert sequence
          Length = 1188

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
           |||||||||| |||  | || || ||||||||||| ||||| ||||| ||||| || || 
Sbjct: 255 atgagcagcataggcacaggatacgatctgtccgttaccaccttctctccggatggtcgc 314

                               
Query: 233 gtcttccaggtcgagtatgc 252
           ||||||||||| ||||||||
Sbjct: 315 gtcttccaggttgagtatgc 334
to top
>dbj|AK061784.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E06, full
           insert sequence
          Length = 1120

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
           |||||||||| |||  | || || ||||||||||| ||||| ||||| ||||| || || 
Sbjct: 188 atgagcagcataggcacaggatacgatctgtccgttaccaccttctctccggatggtcgc 247

                               
Query: 233 gtcttccaggtcgagtatgc 252
           ||||||||||| ||||||||
Sbjct: 248 gtcttccaggttgagtatgc 267
to top
>dbj|AB026562.1| Oryza sativa (japonica cultivar-group) OsPAG1 mRNA for alpha 7
           subunit of 20S proteasome, complete cds
          Length = 1091

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 173 atgagcagcaaagganctgggtatgatctgtccgtcaccactttctccccggacggccgt 232
           |||||||||| |||  | || || ||||||||||| ||||| ||||| ||||| || || 
Sbjct: 151 atgagcagcataggcacaggatacgatctgtccgttaccaccttctctccggatggtcgc 210

                               
Query: 233 gtcttccaggtcgagtatgc 252
           ||||||||||| ||||||||
Sbjct: 211 gtcttccaggttgagtatgc 230
to top
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 211     cactttctccccggacggccg 231
               |||||||||||||||||||||
Sbjct: 2693906 cactttctccccggacggccg 2693926
to top
>ref|NM_126597.2| Arabidopsis thaliana PAA2; endopeptidase/ peptidase/ threonine
           endopeptidase AT2G05840 (PAA2) transcript variant
           AT2G05840.1 mRNA, complete cds
          Length = 1093

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 214 tttctccccggacggccgtgtcttccaggtcgagtatgct 253
           |||||| ||||| || ||| ||||||| ||||||||||||
Sbjct: 161 tttctcaccggaaggtcgtctcttccaagtcgagtatgct 200
to top
>ref|NM_001036263.1| Arabidopsis thaliana PAA2; endopeptidase/ peptidase/ threonine
           endopeptidase AT2G05840 (PAA2) transcript variant
           AT2G05840.2 mRNA, complete cds
          Length = 1114

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 214 tttctccccggacggccgtgtcttccaggtcgagtatgct 253
           |||||| ||||| || ||| ||||||| ||||||||||||
Sbjct: 179 tttctcaccggaaggtcgtctcttccaagtcgagtatgct 218
to top
>gb|AC112208.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0015P05 map C53961S, complete sequence
          Length = 175121

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 209   accactttctccccggacggccgtgtcttccaggtcgagtatgc 252
             |||| |||||| | |||||| ||| | |||||||||||||||||
Sbjct: 94339 accattttctcactggacgggcgtctgttccaggtcgagtatgc 94382
to top
>ref|XM_367205.1| Magnaporthe grisea 70-15 hypothetical protein (MG07130.4) partial
           mRNA
          Length = 738

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 215 ttctccccggacggccgtgtcttccaggtcga 246
           ||||||||||| || ||| |||||||||||||
Sbjct: 43  ttctccccggaaggtcgtctcttccaggtcga 74
to top
>ref|XM_386335.1| Gibberella zeae PH-1 chromosome 3 conserved hypothetical protein
           (FG06159.1) partial mRNA
          Length = 732

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 215 ttctccccggacggccgtgtcttccaggtcga 246
           |||||||| || |||||| |||||||||||||
Sbjct: 37  ttctcccccgaaggccgtctcttccaggtcga 68
to top
>gb|AY143829.1| Arabidopsis thaliana At2g05840/T6P5.4 mRNA, complete cds
          Length = 741

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 214 tttctccccggacggccgtgtcttccaggtcgagtatgct 253
           |||||| ||||| || ||| ||||||| ||||||||||||
Sbjct: 45  tttctcaccggaaggtcgtctcttccaagtcgagtatgct 84
to top
>gb|AY052679.1| Arabidopsis thaliana At2g05840/T6P5.4 mRNA, complete cds
          Length = 1014

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 214 tttctccccggacggccgtgtcttccaggtcgagtatgct 253
           |||||| ||||| || ||| ||||||| ||||||||||||
Sbjct: 104 tttctcaccggaaggtcgtctcttccaagtcgagtatgct 143
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 209      accactttctccccggacggccgtgtcttccaggtcgagtatgc 252
                |||| |||||| | |||||| ||| | |||||||||||||||||
Sbjct: 11307981 accattttctcactggacgggcgtctgttccaggtcgagtatgc 11308024
to top
>dbj|AK099876.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013111H14, full
           insert sequence
          Length = 1567

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 209 accactttctccccggacggccgtgtcttccaggtcgagtatgc 252
           |||| |||||| | |||||| ||| | |||||||||||||||||
Sbjct: 751 accattttctcactggacgggcgtctgttccaggtcgagtatgc 794
to top
>gb|AF043519.1|AF043519 Arabidopsis thaliana 20S proteasome subunit PAA2 (PAA2) mRNA,
           complete cds
          Length = 1113

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 214 tttctccccggacggccgtgtcttccaggtcgagtatgct 253
           |||||| ||||| || ||| ||||||| ||||||||||||
Sbjct: 161 tttctcaccggaaggtcgtctcttccaagtcgagtatgct 200
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 209      accactttctccccggacggccgtgtcttccaggtcgagtatgc 252
                |||| |||||| | |||||| ||| | |||||||||||||||||
Sbjct: 11387170 accattttctcactggacgggcgtctgttccaggtcgagtatgc 11387213


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 926,096
Number of Sequences: 3902068
Number of extensions: 926096
Number of successful extensions: 11622
Number of sequences better than 10.0: 34
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11554
Number of HSP's gapped (non-prelim): 68
length of query: 260
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 238
effective length of database: 17,147,199,772
effective search space: 4081033545736
effective search space used: 4081033545736
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top