ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart07c09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC137928.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0040B10, complete sequence Length = 150825 Score = 69.9 bits (35), Expect = 7e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 73 tcctcgccaagccaccatcattgcgccaccgccgc 107 ||||||||||||||||||||||||||||||||||| Sbjct: 12469 tcctcgccaagccaccatcattgcgccaccgccgc 12503 Score = 46.1 bits (23), Expect = 0.095 Identities = 36/39 (92%), Gaps = 1/39 (2%) Strand = Plus / Plus Query: 245 ccacccacctccacgccc-ccattaaaggcgctcacgca 282 ||||||||| |||| ||| |||||||||||||||||||| Sbjct: 12699 ccacccaccaccacccccgccattaaaggcgctcacgca 12737 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 354 ttcctcccctcacgggagcagc 375 |||||||||||||||||||||| Sbjct: 12819 ttcctcccctcacgggagcagc 12840
>gb|AC105319.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1657_H11, complete sequence Length = 98103 Score = 69.9 bits (35), Expect = 7e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 73 tcctcgccaagccaccatcattgcgccaccgccgc 107 ||||||||||||||||||||||||||||||||||| Sbjct: 49396 tcctcgccaagccaccatcattgcgccaccgccgc 49430 Score = 46.1 bits (23), Expect = 0.095 Identities = 36/39 (92%), Gaps = 1/39 (2%) Strand = Plus / Plus Query: 245 ccacccacctccacgccc-ccattaaaggcgctcacgca 282 ||||||||| |||| ||| |||||||||||||||||||| Sbjct: 49626 ccacccaccaccacccccgccattaaaggcgctcacgca 49664 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 354 ttcctcccctcacgggagcagc 375 |||||||||||||||||||||| Sbjct: 49746 ttcctcccctcacgggagcagc 49767
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 69.9 bits (35), Expect = 7e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 73 tcctcgccaagccaccatcattgcgccaccgccgc 107 ||||||||||||||||||||||||||||||||||| Sbjct: 19684395 tcctcgccaagccaccatcattgcgccaccgccgc 19684429 Score = 46.1 bits (23), Expect = 0.095 Identities = 36/39 (92%), Gaps = 1/39 (2%) Strand = Plus / Plus Query: 245 ccacccacctccacgccc-ccattaaaggcgctcacgca 282 ||||||||| |||| ||| |||||||||||||||||||| Sbjct: 19684625 ccacccaccaccacccccgccattaaaggcgctcacgca 19684663 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 354 ttcctcccctcacgggagcagc 375 |||||||||||||||||||||| Sbjct: 19684745 ttcctcccctcacgggagcagc 19684766 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 19387241 ccatctccatctccatctcc 19387260 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 320344 catctccatctccatctcca 320325
>dbj|AK099640.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013060B14, full insert sequence Length = 2348 Score = 69.9 bits (35), Expect = 7e-09 Identities = 35/35 (100%) Strand = Plus / Plus Query: 73 tcctcgccaagccaccatcattgcgccaccgccgc 107 ||||||||||||||||||||||||||||||||||| Sbjct: 162 tcctcgccaagccaccatcattgcgccaccgccgc 196 Score = 46.1 bits (23), Expect = 0.095 Identities = 36/39 (92%), Gaps = 1/39 (2%) Strand = Plus / Plus Query: 245 ccacccacctccacgccc-ccattaaaggcgctcacgca 282 ||||||||| |||| ||| |||||||||||||||||||| Sbjct: 392 ccacccaccaccacccccgccattaaaggcgctcacgca 430 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 354 ttcctcccctcacgggagcagc 375 |||||||||||||||||||||| Sbjct: 512 ttcctcccctcacgggagcagc 533
>emb|AL022319.2|HS172B20 Human DNA sequence from clone RP1-172B20 on chromosome 22q12.3-13.1 Contains the 3' part of the CACNA1I gene for voltage-dependent calcium channel, alpha 1I subunit, ESTs, STSs, GSSs and a putative CpG island, complete sequence Length = 213721 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 285 accgccatctccatctccatctcc 308 |||||||||||||||||||||||| Sbjct: 26976 accgccatctccatctccatctcc 26999
>gb|AC122450.4| Mus musculus BAC clone RP24-249K4 from chromosome 1, complete sequence Length = 154695 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctccac 310 |||| |||||||||||||||||||||| Sbjct: 113242 cacctccatctccatctccatctccac 113216
>gb|AC182705.2| Populus trichocarpa clone Pop1-79A19, complete sequence Length = 100665 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctccac 310 |||| |||||||||||||||||||||| Sbjct: 23220 caccaccatctccatctccatctccac 23194
>gb|AC092221.1|AC092221 Drosophila melanogaster, chromosome 2L, region 22A-22C, BAC clone BACR16D07, complete sequence Length = 170868 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 287 cgccatctccatctccatctcca 309 ||||||||||||||||||||||| Sbjct: 148540 cgccatctccatctccatctcca 148562
>gb|AC104020.10| Homo sapiens chromosome 15, clone RP11-369K8, complete sequence Length = 171307 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctccac 310 |||| |||||||||||||||||||||| Sbjct: 126780 cacctccatctccatctccatctccac 126806 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctccac 310 |||| |||||||||||||||||||||| Sbjct: 126546 cacctccatctccatctccatctccac 126572 Score = 46.1 bits (23), Expect = 0.095 Identities = 26/27 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctccac 310 |||| |||||||||||||||||||||| Sbjct: 126321 cacctccatctccatctccatctccac 126347 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctccac 310 ||||||||||||||||||||| Sbjct: 126732 catctccatctccatctccac 126752
>gb|AE003586.3| Drosophila melanogaster chromosome 2L, section 5 of 83 of the complete sequence Length = 306696 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Plus Query: 287 cgccatctccatctccatctcca 309 ||||||||||||||||||||||| Sbjct: 221411 cgccatctccatctccatctcca 221433
>gb|AC004440.1|AC004440 Drosophila melanogaster (P1 DS04892 (D66)) DNA sequence, complete sequence Length = 62400 Score = 46.1 bits (23), Expect = 0.095 Identities = 23/23 (100%) Strand = Plus / Minus Query: 287 cgccatctccatctccatctcca 309 ||||||||||||||||||||||| Sbjct: 52594 cgccatctccatctccatctcca 52572
>ref|NM_104315.2| Arabidopsis thaliana sodium:hydrogen antiporter/ solute:hydrogen antiporter AT1G54370 mRNA, complete cds Length = 1768 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 1559 ccatctccatctccatctccac 1538
>ref|XM_479794.1| Oryza sativa (japonica cultivar-group), mRNA Length = 896 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctcca 309 |||| ||||||||||||||||||||| Sbjct: 62 cacctccatctccatctccatctcca 87 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 73 ccatctccatctccatctcc 92
>ref|XM_507100.1| PREDICTED Oryza sativa (japonica cultivar-group), P0470F10.20 mRNA Length = 931 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctcca 309 |||| ||||||||||||||||||||| Sbjct: 92 cacctccatctccatctccatctcca 117 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 103 ccatctccatctccatctcc 122
>gb|AC160456.8| Mus musculus chromosome 8, clone RP23-121F17, complete sequence Length = 221841 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 128756 ccatctccatctccatctccac 128735 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 128819 ccatctccatctccatctcca 128799 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 128792 ccatctccatctccatctcca 128772 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 128786 ccatctccatctccatctcca 128766 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 128780 ccatctccatctccatctcca 128760 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 128774 ccatctccatctccatctcca 128754 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 128768 ccatctccatctccatctcca 128748 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 128762 ccatctccatctccatctcca 128742 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 128797 catctccatctccatctcca 128778
>gb|AC104516.2| Drosophila melanogaster clone BACR20O17, complete sequence Length = 174404 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 127123 ccatctccatctccatctccac 127102
>gb|AC136786.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0027P09, complete sequence Length = 171861 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcca 309 |||| ||||||||||||||||||||| Sbjct: 143212 caccaccatctccatctccatctcca 143187 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 143201 ccatctccatctccatctcc 143182
>gb|AC008194.9| Drosophila melanogaster clone BACR49A05, complete sequence Length = 181437 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 16240 ccatctccatctccatctccac 16219
>gb|AC140182.2| Mus musculus BAC clone RP24-349I16 from chromosome 8, complete sequence Length = 151221 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 cgccgtgcctggctgcctgcct 169 |||||||||||||||||||||| Sbjct: 34996 cgccgtgcctggctgcctgcct 34975
>gb|AC102358.5| Mus musculus chromosome 8, clone RP23-451H9, complete sequence Length = 202151 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 cgccgtgcctggctgcctgcct 169 |||||||||||||||||||||| Sbjct: 176789 cgccgtgcctggctgcctgcct 176768
>ref|XM_446803.1| Candida glabrata CBS138, CAGL0G10175g partial mRNA Length = 1734 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 gccatctccatctccatctcca 309 |||||||||||||||||||||| Sbjct: 357 gccatctccatctccatctcca 378
>gb|AC005287.4| Arabidopsis thaliana chromosome I BAC F20D21 genomic sequence, complete sequence Length = 143186 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 64858 ccatctccatctccatctccac 64879
>gb|AC157348.25| Medicago truncatula clone mth2-133e20, complete sequence Length = 115475 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 286 ccgccatctccatctccatctc 307 |||||||||||||||||||||| Sbjct: 3815 ccgccatctccatctccatctc 3794
>gb|AC131026.11| Medicago truncatula clone mth2-6e18, complete sequence Length = 114815 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 308 ccatctccatctccatctccac 329 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 302 ccatctccatctccatctcca 322
>gb|AC136954.14| Medicago truncatula clone mth2-7i1, complete sequence Length = 113505 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 286 ccgccatctccatctccatctc 307 |||||||||||||||||||||| Sbjct: 24758 ccgccatctccatctccatctc 24779
>gb|AF254982.4| Homo sapiens chromosome 21 clone CTD-2503J9 map p11-q21.1, complete sequence Length = 211345 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 203 gcactggagtggagtggagtgg 224 |||||||||||||||||||||| Sbjct: 83188 gcactggagtggagtggagtgg 83209 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 tgcactggagtggagtggag 221 |||||||||||||||||||| Sbjct: 113750 tgcactggagtggagtggag 113769 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 205 actggagtggagtggagtgg 224 |||||||||||||||||||| Sbjct: 87224 actggagtggagtggagtgg 87243
>emb|CR380953.1| Candida glabrata strain CBS138 chromosome G complete sequence Length = 992211 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 288 gccatctccatctccatctcca 309 |||||||||||||||||||||| Sbjct: 977839 gccatctccatctccatctcca 977860
>emb|AL356014.1|ATF25L23 Arabidopsis thaliana DNA chromosome 3, BAC clone F25L23 Length = 114080 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 103267 ccatctccatctccatctccac 103246
>gb|AC144482.11| Medicago truncatula clone mth2-10p1, complete sequence Length = 121112 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 8123 ccatctccatctccatctccac 8102 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 8129 ccatctccatctccatctcca 8109
>tpg|BK003208.1| TPA: TPA_inf: Drosophila melanogaster HDC19653 (HDC19653) gene, complete cds Length = 180 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 91 ccatctccatctccatctccac 70
>gb|AC107029.4| Homo sapiens 3 BAC RP11-550H20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 182634 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 25 actcccaccgcaccaccaccac 46 |||||||||||||||||||||| Sbjct: 86256 actcccaccgcaccaccaccac 86277
>gb|AF490589.1| Arabidopsis thaliana Na+/H+ exchanger 5 (NHX5) mRNA, complete cds Length = 1554 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 1547 ccatctccatctccatctccac 1526
>gb|AC121318.17| Mus musculus chromosome 1, clone RP24-377P1, complete sequence Length = 179884 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 111153 ccatctccatctccatctccac 111132 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 111159 ccatctccatctccatctcca 111139
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcca 309 |||| ||||||||||||||||||||| Sbjct: 15733531 caccaccatctccatctccatctcca 15733506 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 15733520 ccatctccatctccatctcc 15733501 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 2280515 ccatctccatctccatctcc 2280496
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 26921041 ccatctccatctccatctccac 26921020 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcca 309 |||| ||||||||||||||||||||| Sbjct: 963812 cacctccatctccatctccatctcca 963787 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 29888 ccatctccatctccatctcca 29868 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 963801 ccatctccatctccatctcc 963782
>gb|AC007853.4|AC007853 Drosophila melanogaster, chromosome 3R, region 96B-96C, BAC clone BACR03L02, complete sequence Length = 162921 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcca 309 |||||||||||||||| ||||||||| Sbjct: 48314 caccgccatctccatccccatctcca 48289 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 14879 ccatctccatctccatctcca 14859 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 actggagtggagtggagtgg 224 |||||||||||||||||||| Sbjct: 129936 actggagtggagtggagtgg 129917 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 14884 catctccatctccatctcca 14865
>gb|AC142281.2| Homo sapiens fosmid clone XXFOS-86667F1 from 4, complete sequence Length = 5084 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 4590 ccatctccatctccatctccac 4611 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctcca 309 |||| ||||||||||||||||||||| Sbjct: 4503 cacctccatctccatctccatctcca 4528
>gb|AC008206.10|AC008206 Drosophila melanogaster, chromosome 3R, region 96B-96B, BAC clone BACR03I15, complete sequence Length = 181132 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcca 309 |||||||||||||||| ||||||||| Sbjct: 111646 caccgccatctccatccccatctcca 111621 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 78211 ccatctccatctccatctcca 78191 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 78216 catctccatctccatctcca 78197
>gb|AC103882.5| Homo sapiens BAC clone RP11-733G6 from 2, complete sequence Length = 159249 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 151467 ccatctccatctccatctccac 151446
>gb|AY190961.1| Drosophila willistoni clone DWIF01_25_A10 (D1458) genomic sequence Length = 36329 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcca 309 |||||||||||||||||||| ||||| Sbjct: 28851 caccgccatctccatctccacctcca 28826
>gb|AC104115.3| Homo sapiens chromosome 5 clone RP11-252I14, complete sequence Length = 115793 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 204 cactggagtggagtggagtggg 225 |||||||||||||||||||||| Sbjct: 29480 cactggagtggagtggagtggg 29501
>dbj|AP004592.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0666G10 Length = 150761 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 22441 ccatctccatctccatctccac 22420
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome Length = 6413771 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 25 actcccaccgcaccaccaccac 46 |||||||||||||||||||||| Sbjct: 498378 actcccaccgcaccaccaccac 498357
>dbj|AP004562.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0470F10 Length = 185294 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcca 309 |||| ||||||||||||||||||||| Sbjct: 126550 cacctccatctccatctccatctcca 126525 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 126539 ccatctccatctccatctcc 126520
>dbj|AK106730.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-114-H09, full insert sequence Length = 1999 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcca 309 |||| ||||||||||||||||||||| Sbjct: 275 caccaccatctccatctccatctcca 250 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 264 ccatctccatctccatctcc 245
>dbj|AK103863.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033149E23, full insert sequence Length = 896 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctcca 309 |||| ||||||||||||||||||||| Sbjct: 62 cacctccatctccatctccatctcca 87 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 73 ccatctccatctccatctcc 92
>emb|CR762435.19| Zebrafish DNA sequence from clone CH211-238C15 in linkage group 18, complete sequence Length = 157544 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 18469 ccatctccatctccatctccac 18490
>dbj|AK059891.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-D03, full insert sequence Length = 931 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctcca 309 |||| ||||||||||||||||||||| Sbjct: 92 cacctccatctccatctccatctcca 117 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 103 ccatctccatctccatctcc 122
>gb|AE003750.2| Drosophila melanogaster chromosome 3R, section 88 of 118 of the complete sequence Length = 227219 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcca 309 |||||||||||||||| ||||||||| Sbjct: 70833 caccgccatctccatccccatctcca 70808 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 37398 ccatctccatctccatctcca 37378 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 205 actggagtggagtggagtgg 224 |||||||||||||||||||| Sbjct: 152455 actggagtggagtggagtgg 152436 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 37403 catctccatctccatctcca 37384
>gb|AE003511.4| Drosophila melanogaster chromosome X, section 63 of 74 of the complete sequence Length = 297969 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 4622 ccatctccatctccatctccac 4601
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcca 309 |||| ||||||||||||||||||||| Sbjct: 15820908 caccaccatctccatctccatctcca 15820883 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 15820897 ccatctccatctccatctcc 15820878 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 2288296 ccatctccatctccatctcc 2288277
>gb|AC127288.4| Mus musculus BAC clone RP23-358J11 from 8, complete sequence Length = 210710 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 182008 ccatctccatctccatctccac 181987
>gb|AC139856.12| Mus musculus chromosome 8, clone RP23-52J10, complete sequence Length = 212906 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctccac 310 |||||||||||||||||||||| Sbjct: 18501 ccatctccatctccatctccac 18480 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 18564 ccatctccatctccatctcca 18544 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 18537 ccatctccatctccatctcca 18517 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 18531 ccatctccatctccatctcca 18511 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 18525 ccatctccatctccatctcca 18505 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 18519 ccatctccatctccatctcca 18499 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 18513 ccatctccatctccatctcca 18493 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 18507 ccatctccatctccatctcca 18487 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 18542 catctccatctccatctcca 18523
>gb|AC153609.2| Mus musculus 6 BAC RP23-77I23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 221782 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 119058 ccatctccatctccatctcca 119078 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 119052 ccatctccatctccatctcca 119072
>gb|AC022346.4| Drosophila melanogaster clone BACR22I24, complete sequence Length = 181052 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 51496 ccatctccatctccatctcca 51516 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcc 308 |||| |||||||||||||||||||| Sbjct: 22423 caccaccatctccatctccatctcc 22399
>ref|NM_120430.1| Arabidopsis thaliana unknown protein AT5G03500 mRNA, complete cds Length = 1332 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1171 ccatctccatctccatctcca 1151 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1165 ccatctccatctccatctcca 1145
>ref|NM_119005.2| Arabidopsis thaliana ATM1; ATPase, coupled to transmembrane movement of substances AT4G28630 (ATM1) mRNA, complete cds Length = 2276 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 208 ccatctccatctccatctcca 228
>gb|AC152952.1| Mus musculus 6 BAC RP23-86B3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 187484 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 34004 ccatctccatctccatctcca 34024 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 33998 ccatctccatctccatctcca 34018 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 33992 ccatctccatctccatctcca 34012
>gb|AC120348.9| Mus musculus chromosome 5, clone RP23-55P22, complete sequence Length = 244565 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 95800 ccatctccatctccatctcca 95780
>ref|XM_634292.1| Dictyostelium discoideum putative STE20 family protein kinase (DDB0229411), partial mRNA Length = 3540 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 2293 ccatctccatctccatctcca 2313
>gb|AC168882.3| Mus musculus BAC clone RP23-80D1 from chromosome 9, complete sequence Length = 210475 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 187276 ccatctccatctccatctcca 187296 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 187249 ccatctccatctccatctcca 187269 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 187243 ccatctccatctccatctcca 187263 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 187271 catctccatctccatctcca 187290 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 187238 catctccatctccatctcca 187257
>ref|XM_479640.1| Oryza sativa (japonica cultivar-group), mRNA Length = 4982 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 94 ccatctccatctccatctcca 74
>gb|AC148114.8| Mus musculus chromosome 8, clone RP24-134B6, complete sequence Length = 155465 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 2149 ccatctccatctccatctcca 2169 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 2143 ccatctccatctccatctcca 2163 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 2137 ccatctccatctccatctcca 2157 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 2131 ccatctccatctccatctcca 2151 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 2125 ccatctccatctccatctcca 2145 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 2119 ccatctccatctccatctcca 2139 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 2113 ccatctccatctccatctcca 2133
>gb|AC153856.23| Mus musculus 10 BAC RP23-468J15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 188027 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 114689 ccatctccatctccatctcca 114709
>gb|AC167725.9| Mus musculus BAC RP24-421G17 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 210774 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 203976 ccatctccatctccatctcca 203956 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 203970 ccatctccatctccatctcca 203950
>gb|AY022043.1| Oryza sativa microsatellite MRG4368 containing (TC)X13, closest to marker S10074, genomic sequence Length = 226 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 19 ccatctccatctccatctcca 39 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 13 ccatctccatctccatctcca 33
>gb|AC149291.1| Solanum demissum chromosome 5 clone PGEC568H16 map MAP_LOC, complete sequence Length = 146091 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 25987 ccatctccatctccatctcca 25967
>gb|AC149288.1| Solanum demissum chromosome 5 clone PGEC446J10 map MAP_LOC, complete sequence Length = 102692 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctcc 308 |||| |||||||||||||||||||| Sbjct: 79770 caccaccatctccatctccatctcc 79794 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctcc 308 |||| |||||||||||||||||||| Sbjct: 37458 caccaccatctccatctccatctcc 37482 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 37958 ccatctccatctccatctcc 37977
>gb|AY730338.1| Solanum tuberosum strain P6/210 clone BAC BA47f2, complete sequence Length = 81567 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctcc 308 |||| |||||||||||||||||||| Sbjct: 32153 caccaccatctccatctccatctcc 32177
>gb|AY730337.1| Solanum tuberosum strain P6/210 clone BAC BA27c1, complete sequence Length = 91283 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 284 caccgccatctccatctccatctcc 308 |||| |||||||||||||||||||| Sbjct: 19583 caccaccatctccatctccatctcc 19559 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 19083 ccatctccatctccatctcc 19064
>gb|AC125370.4| Mus musculus BAC clone RP24-399O5 from chromosome 9, complete sequence Length = 174033 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 37504 ccatctccatctccatctcca 37524 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 37477 ccatctccatctccatctcca 37497 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 37471 ccatctccatctccatctcca 37491 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 37499 catctccatctccatctcca 37518 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 37466 catctccatctccatctcca 37485
>gb|AC119252.10| Mus musculus chromosome 8, clone RP24-279M13, complete sequence Length = 176594 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106211 ccatctccatctccatctcca 106231 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106205 ccatctccatctccatctcca 106225 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106199 ccatctccatctccatctcca 106219 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106193 ccatctccatctccatctcca 106213 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106187 ccatctccatctccatctcca 106207 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106181 ccatctccatctccatctcca 106201 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106175 ccatctccatctccatctcca 106195 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106169 ccatctccatctccatctcca 106189 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106163 ccatctccatctccatctcca 106183 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106157 ccatctccatctccatctcca 106177 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106151 ccatctccatctccatctcca 106171 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106145 ccatctccatctccatctcca 106165 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 106139 ccatctccatctccatctcca 106159
>gb|AC138641.10| Mus musculus chromosome 5, clone RP23-466K15, complete sequence Length = 175628 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 5055 ccatctccatctccatctcca 5075
>gb|AC008334.8| Drosophila melanogaster clone BACR08K05, complete sequence Length = 154336 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctcc 308 |||| |||||||||||||||||||| Sbjct: 937 caccaccatctccatctccatctcc 961
>gb|AC007578.6| Drosophila melanogaster clone BACR09A11, complete sequence Length = 170684 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctccac 310 ||||||||||||||||||||| Sbjct: 128415 catctccatctccatctccac 128395
>gb|AC115301.7| Mus musculus BAC clone RP24-83E2 from chromosome 7, complete sequence Length = 175603 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 47445 ccatctccatctccatctcca 47425 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 47439 ccatctccatctccatctcca 47419 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 47433 ccatctccatctccatctcca 47413 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 47427 ccatctccatctccatctcca 47407
>gb|AC119825.11| Mus musculus chromosome 3, clone RP23-358O22, complete sequence Length = 205291 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 9651 ccatctccatctccatctcca 9631 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 9645 ccatctccatctccatctcca 9625 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 9639 ccatctccatctccatctcca 9619 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 9633 ccatctccatctccatctcca 9613
>ref|XM_958916.1| Neurospora crassa OR74A hypothetical protein (NCU02053.1) partial mRNA Length = 4044 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 3743 ccatctccatctccatctcca 3723
>ref|XM_329242.1| Neurospora crassa OR74A hypothetical protein (NCU02053.1) partial mRNA Length = 4044 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 3743 ccatctccatctccatctcca 3723
>gb|AC132421.4| Mus musculus BAC clone RP23-294G5 from chromosome 18, complete sequence Length = 229447 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53584 ccatctccatctccatctcca 53604 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53578 ccatctccatctccatctcca 53598 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53572 ccatctccatctccatctcca 53592 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53527 ccatctccatctccatctcca 53547 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53452 ccatctccatctccatctcca 53472 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53446 ccatctccatctccatctcca 53466 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53440 ccatctccatctccatctcca 53460 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53434 ccatctccatctccatctcca 53454 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53428 ccatctccatctccatctcca 53448 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53422 ccatctccatctccatctcca 53442 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53416 ccatctccatctccatctcca 53436 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53410 ccatctccatctccatctcca 53430 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53404 ccatctccatctccatctcca 53424 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53398 ccatctccatctccatctcca 53418 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53392 ccatctccatctccatctcca 53412
>ref|XM_652748.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0236.2), mRNA Length = 3150 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 2579 ccatctccatctccatctcca 2559 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 2573 ccatctccatctccatctcc 2554
>gb|AC153010.3| Mus musculus BAC clone RP23-325H1 from chromosome 15, complete sequence Length = 230097 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 24802 ccatctccatctccatctcca 24822 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 24796 ccatctccatctccatctcca 24816 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 24790 ccatctccatctccatctcca 24810 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 24784 ccatctccatctccatctcca 24804 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 24778 ccatctccatctccatctcca 24798 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 24772 ccatctccatctccatctcca 24792 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 24766 ccatctccatctccatctcca 24786 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 24760 ccatctccatctccatctcca 24780 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 24754 ccatctccatctccatctcca 24774 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 24748 ccatctccatctccatctcca 24768 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 24742 ccatctccatctccatctcca 24762
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 207 tggagtggagtggagtgggcg 227 ||||||||||||||||||||| Sbjct: 5813173 tggagtggagtggagtgggcg 5813193 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 286 ccgccatctccatctccatct 306 ||||||||||||||||||||| Sbjct: 4500077 ccgccatctccatctccatct 4500097 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 10390144 ccatctccatctccatctcc 10390163
>gb|AC114990.8| Mus musculus chromosome 16, clone RP24-361F11, complete sequence Length = 179887 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 118401 ccatctccatctccatctcca 118421 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 118395 ccatctccatctccatctcca 118415 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 118389 ccatctccatctccatctcca 118409 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 118383 ccatctccatctccatctcca 118403 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 118377 ccatctccatctccatctcca 118397 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 118371 ccatctccatctccatctcca 118391
>ref|XM_841567.1| Trypanosoma brucei TREU927 hypothetical protein (Tb927.1.1510) partial mRNA Length = 408 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 29 ccatctccatctccatctcca 49
>ref|XM_753784.1| Ustilago maydis 521 hypothetical protein (UM02730.1) partial mRNA Length = 4119 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1321 ccatctccatctccatctcca 1341 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1315 ccatctccatctccatctcca 1335 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1309 ccatctccatctccatctcca 1329 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 1327 ccatctccatctccatctcc 1346
>emb|CR962136.2| Medicago truncatula chromosome 5 clone mth2-52n22, COMPLETE SEQUENCE Length = 87738 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 75586 ccatctccatctccatctcca 75606
>gb|AC116119.12| Mus musculus chromosome 12, clone RP23-76D19, complete sequence Length = 264410 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 123182 ccatctccatctccatctcca 123162 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 123176 ccatctccatctccatctcca 123156 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 123170 ccatctccatctccatctcca 123150 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 123164 ccatctccatctccatctcca 123144
>gb|AC099948.9| Mus musculus chromosome 10, clone RP23-19D21, complete sequence Length = 203086 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92302 ccatctccatctccatctcca 92282
>ref|XM_445219.1| Candida glabrata CBS138, CAGL0C00847g partial mRNA Length = 2373 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1036 ccatctccatctccatctcca 1056
>gb|AC133503.4| Mus musculus BAC clone RP24-301O19 from chromosome 19, complete sequence Length = 161150 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 139547 ccatctccatctccatctcca 139527
>gb|AC127322.4| Mus musculus BAC clone RP23-238A8 from chromosome 6, complete sequence Length = 179698 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 3377 ccatctccatctccatctcca 3397 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 3345 ccatctccatctccatctcca 3365 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 3319 ccatctccatctccatctcca 3339 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 3313 ccatctccatctccatctcca 3333 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 3307 ccatctccatctccatctcca 3327 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 3301 ccatctccatctccatctcca 3321
>gb|AC121963.3| Mus musculus BAC clone RP24-257C17 from chromosome 3, complete sequence Length = 148813 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 90403 ccatctccatctccatctcca 90423 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 90397 ccatctccatctccatctcca 90417 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 90391 ccatctccatctccatctcca 90411 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 90385 ccatctccatctccatctcca 90405
>gb|AC123036.3| Mus musculus BAC clone RP24-512B13 from chromosome 10, complete sequence Length = 195692 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 152953 ccatctccatctccatctcca 152973
>gb|AC125517.4| Mus musculus BAC clone RP24-261P6 from chromosome 3, complete sequence Length = 193517 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 73835 ccatctccatctccatctcca 73815 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 73829 ccatctccatctccatctcca 73809 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 73823 ccatctccatctccatctcca 73803 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 73817 ccatctccatctccatctcca 73797 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 73811 ccatctccatctccatctcca 73791 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 73805 ccatctccatctccatctcca 73785 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 73799 ccatctccatctccatctcca 73779 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 73793 ccatctccatctccatctcca 73773 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 73787 ccatctccatctccatctcca 73767
>gb|AC121814.3| Mus musculus BAC clone RP23-457H19 from chromosome 15, complete sequence Length = 188928 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 91454 ccatctccatctccatctcca 91474 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 91448 ccatctccatctccatctcca 91468 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 91442 ccatctccatctccatctcca 91462 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 91436 ccatctccatctccatctcca 91456 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 91430 ccatctccatctccatctcca 91450 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 91424 ccatctccatctccatctcca 91444 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 91418 ccatctccatctccatctcca 91438
>gb|AC124455.6| Mus musculus BAC clone RP24-129J9 from chromosome 15, complete sequence Length = 167059 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92844 ccatctccatctccatctcca 92824 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92838 ccatctccatctccatctcca 92818 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92832 ccatctccatctccatctcca 92812 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92826 ccatctccatctccatctcca 92806 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92820 ccatctccatctccatctcca 92800 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92814 ccatctccatctccatctcca 92794 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92808 ccatctccatctccatctcca 92788 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92802 ccatctccatctccatctcca 92782 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92796 ccatctccatctccatctcca 92776 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92790 ccatctccatctccatctcca 92770 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 92784 ccatctccatctccatctcca 92764
>gb|AC124463.2| Mus musculus BAC clone RP24-152K14 from chromosome 1, complete sequence Length = 153199 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36591 ccatctccatctccatctcca 36611 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36585 ccatctccatctccatctcca 36605 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36579 ccatctccatctccatctcca 36599 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36573 ccatctccatctccatctcca 36593 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36567 ccatctccatctccatctcca 36587 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36561 ccatctccatctccatctcca 36581 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36555 ccatctccatctccatctcca 36575 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36549 ccatctccatctccatctcca 36569 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36543 ccatctccatctccatctcca 36563 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36537 ccatctccatctccatctcca 36557 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36531 ccatctccatctccatctcca 36551 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36525 ccatctccatctccatctcca 36545 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36519 ccatctccatctccatctcca 36539 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36435 ccatctccatctccatctcca 36455 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36429 ccatctccatctccatctcca 36449 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36399 ccatctccatctccatctcca 36419 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36369 ccatctccatctccatctcca 36389 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 36597 ccatctccatctccatctcc 36616 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 36477 ccatctccatctccatctcc 36496 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 36441 ccatctccatctccatctcc 36460 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 36405 ccatctccatctccatctcc 36424 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 36375 ccatctccatctccatctcc 36394
>gb|AC122919.3| Mus musculus BAC clone RP23-30C12 from 10, complete sequence Length = 221920 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctccac 310 ||||||||||||||||||||| Sbjct: 90621 catctccatctccatctccac 90641
>gb|AC122845.4| Mus musculus BAC clone RP23-155G2 from 1, complete sequence Length = 215455 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 182152 ccatctccatctccatctcca 182172
>gb|AC123061.4| Mus musculus BAC clone RP23-216H22 from 14, complete sequence Length = 193093 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121763 ccatctccatctccatctcca 121783 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121757 ccatctccatctccatctcca 121777 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121751 ccatctccatctccatctcca 121771 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121745 ccatctccatctccatctcca 121765 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121739 ccatctccatctccatctcca 121759 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121733 ccatctccatctccatctcca 121753 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121727 ccatctccatctccatctcca 121747 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121721 ccatctccatctccatctcca 121741 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121715 ccatctccatctccatctcca 121735 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121690 ccatctccatctccatctcca 121710 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121684 ccatctccatctccatctcca 121704 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121678 ccatctccatctccatctcca 121698 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 121696 ccatctccatctccatctcc 121715
>gb|AC127325.4| Mus musculus BAC clone RP23-250E15 from 9, complete sequence Length = 160846 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 48699 ccatctccatctccatctcca 48719 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 48693 ccatctccatctccatctcca 48713 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 48687 ccatctccatctccatctcca 48707 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 48681 ccatctccatctccatctcca 48701 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 48675 ccatctccatctccatctcca 48695
>gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, complete sequence Length = 202733 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36238 ccatctccatctccatctcca 36218 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36232 ccatctccatctccatctcca 36212
>gb|AC113999.3| Mus musculus BAC clone RP23-148D9 from 16, complete sequence Length = 209083 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 48768 ccatctccatctccatctcca 48788
>gb|AC117225.3| Mus musculus BAC clone RP23-366F3 from 19, complete sequence Length = 149854 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 72404 ccatctccatctccatctcca 72384
>gb|AC121986.2| Mus musculus BAC clone RP24-293I7 from 10, complete sequence Length = 182686 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 168621 ccatctccatctccatctcca 168601 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 168615 ccatctccatctccatctcc 168596
>gb|AC019028.13| Mus musculus chromosome 5, clone RP23-88A22, complete sequence Length = 264425 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 257082 ccatctccatctccatctcca 257102
>ref|XM_660564.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.20379) partial mRNA Length = 1326 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 595 ccatctccatctccatctcca 615 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 590 catctccatctccatctcca 609
>ref|XM_661004.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.50470) partial mRNA Length = 543 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 320 ccatctccatctccatctcca 300 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 325 catctccatctccatctcca 306
>gb|AC163650.2| Mus musculus BAC clone RP24-383A20 from chromosome 13, complete sequence Length = 210177 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140959 ccatctccatctccatctcca 140979 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140953 ccatctccatctccatctcca 140973 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140947 ccatctccatctccatctcca 140967 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140941 ccatctccatctccatctcca 140961 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140935 ccatctccatctccatctcca 140955 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140929 ccatctccatctccatctcca 140949 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140923 ccatctccatctccatctcca 140943 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140917 ccatctccatctccatctcca 140937 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140911 ccatctccatctccatctcca 140931 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140905 ccatctccatctccatctcca 140925 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140899 ccatctccatctccatctcca 140919 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140893 ccatctccatctccatctcca 140913
>gb|AC166997.1| Mus musculus BAC clone RP23-107H9 from chromosome 14, complete sequence Length = 201316 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 197147 ccatctccatctccatctcca 197127 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 197141 ccatctccatctccatctcca 197121 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 197135 ccatctccatctccatctcca 197115 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 197129 ccatctccatctccatctcca 197109 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 197123 ccatctccatctccatctcca 197103 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 197117 ccatctccatctccatctcca 197097
>gb|AC146619.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNAa0021B21, from chromosome 3, complete sequence Length = 139208 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 207 tggagtggagtggagtgggcg 227 ||||||||||||||||||||| Sbjct: 42003 tggagtggagtggagtgggcg 42023
>emb|AL445669.9| Human DNA sequence from clone RP11-163G10 on chromosome 1 Contains the 5' end of the ZMYND12 gene for zinc finger MYND domain containing 12, a novel gene, the 5' end of a novel gene, a ribosomal protein S3a (RPS3A) pseudogene, a thymosin, beta 4, X-linked (TMSB4X) pseudogene, a novel pseudogene (DC2) and two CpG islands, complete sequence Length = 153640 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 5402 ccatctccatctccatctcca 5422 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 5396 ccatctccatctccatctcca 5416 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 5391 catctccatctccatctcca 5410
>gb|BT010035.1| Drosophila melanogaster LD47819 full insert cDNA Length = 6628 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 4982 ccatctccatctccatctcca 4962
>emb|AL356419.10| Human DNA sequence from clone RP11-99L6 on chromosome 10, complete sequence Length = 126232 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 125874 ccatctccatctccatctcca 125854
>emb|AL355526.9| Human DNA sequence from clone RP11-152L7 on chromosome 1 Contains two novel genes (IMAGE:4831124) and a CpG island, complete sequence Length = 142179 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 16319 ccatctccatctccatctcca 16339
>emb|AL157414.19| Human DNA sequence from clone RP11-560A15 on chromosome 20 Contains two novel genes, the 3' part of the BMP7 for bone morphogenetic protein 7 and a CpG island, complete sequence Length = 124849 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 46555 ccatctccatctccatctcca 46575 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 46549 ccatctccatctccatctcca 46569
>emb|AL139121.11| Human DNA sequence from clone RP11-328K15 on chromosome 10 Contains a novel gene and a CpG island, complete sequence Length = 41927 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1642 ccatctccatctccatctcca 1622
>gb|AC027037.6| Oryza sativa chromosome 10 BAC OSJNBa0035H01 genomic sequence, complete sequence Length = 64582 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 40061 ccatctccatctccatctcca 40041 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 40055 ccatctccatctccatctcca 40035 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 47689 ccatctccatctccatctcc 47708 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 47684 catctccatctccatctcca 47703
>gb|BT008789.1| Arabidopsis thaliana At4g28630 gene, complete cds Length = 2037 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 145 ccatctccatctccatctcca 165
>emb|CR380949.1| Candida glabrata strain CBS138 chromosome C complete sequence Length = 558804 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 87165 ccatctccatctccatctcca 87185
>emb|BX842623.1| Neurospora crassa DNA linkage group I BAC clone B2I10 Length = 83703 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 4570 ccatctccatctccatctcca 4550
>gb|AC153511.4| Mus musculus 10 BAC RP23-102N12 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 196715 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctccac 310 ||||||||||||||||||||| Sbjct: 34323 catctccatctccatctccac 34303
>gb|AC124351.3| Mus musculus BAC clone RP24-467D20 from chromosome 8, complete sequence Length = 122811 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 64310 ccatctccatctccatctcca 64290 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 64304 ccatctccatctccatctcca 64284 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 64298 ccatctccatctccatctcca 64278
>emb|AL162751.1|ATF12E4 Arabidopsis thaliana DNA chromosome 5, BAC clone F12E4 (ESSA project) Length = 121552 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 87465 ccatctccatctccatctcca 87485 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 87459 ccatctccatctccatctcca 87479
>emb|AL161573.2|ATCHRIV69 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 69 Length = 197655 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 61485 ccatctccatctccatctcca 61465
>gb|AC078925.18| Homo sapiens 12q BAC RP11-76C10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 153284 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 117241 ccatctccatctccatctcca 117261
>emb|AL928931.15| Mouse DNA sequence from clone RP23-419H3 on chromosome 2, complete sequence Length = 148740 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144464 ccatctccatctccatctcca 144444 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144458 ccatctccatctccatctcca 144438 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144452 ccatctccatctccatctcca 144432 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144446 ccatctccatctccatctcca 144426 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144440 ccatctccatctccatctcca 144420 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144434 ccatctccatctccatctcca 144414 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144428 ccatctccatctccatctcca 144408 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144422 ccatctccatctccatctcca 144402 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144416 ccatctccatctccatctcca 144396 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144410 ccatctccatctccatctcca 144390 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144404 ccatctccatctccatctcca 144384 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144398 ccatctccatctccatctcca 144378 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 144392 ccatctccatctccatctcca 144372
>emb|CR931742.1| Medicago truncatula chromosome 5 clone mth2-28i20, COMPLETE SEQUENCE Length = 115743 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 40115 ccatctccatctccatctcca 40135
>gb|AC063968.5| Genomic sequence for Mus musculus, clone RP23-105K11, complete sequence Length = 222520 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctccac 310 ||||||||||||||||||||| Sbjct: 83094 catctccatctccatctccac 83114
>gb|AC159188.2| Mus musculus BAC clone RP24-247J24 from chromosome 13, complete sequence Length = 197018 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121151 ccatctccatctccatctcca 121171 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121145 ccatctccatctccatctcca 121165
>gb|AC161059.4| Mus musculus BAC clone RP23-82L9 from chromosome 6, complete sequence Length = 294389 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 166696 ccatctccatctccatctcca 166716 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 166664 ccatctccatctccatctcca 166684 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 166638 ccatctccatctccatctcca 166658 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 166632 ccatctccatctccatctcca 166652 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 166626 ccatctccatctccatctcca 166646 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 166620 ccatctccatctccatctcca 166640
>gb|AC093500.2| Drosophila melanogaster 3L BAC RP98-29P5 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 173558 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 88279 ccatctccatctccatctcca 88259
>gb|AC011907.4| Drosophila melanogaster 3L BAC RP98-18B21 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 164597 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 134839 ccatctccatctccatctcca 134819 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 134833 ccatctccatctccatctcca 134813
>gb|AC023728.5| Drosophila melanogaster X BAC RP98-6J12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 175674 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctccac 310 ||||||||||||||||||||| Sbjct: 115356 catctccatctccatctccac 115336
>tpg|BK001847.1| TPA: TPA_inf: Drosophila melanogaster HDC07779 (HDC07779) gene, complete cds Length = 1044 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 344 ccatctccatctccatctcca 324 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 338 ccatctccatctccatctcca 318
>tpg|BK003723.1| TPA: TPA_inf: Drosophila melanogaster HDC05797 (HDC05797) gene, complete cds Length = 850 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctccac 310 ||||||||||||||||||||| Sbjct: 808 catctccatctccatctccac 828
>gb|DQ387976.1| Fenneropenaeus merguiensis clone CT15 microsatellite sequence Length = 311 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 230 ccatctccatctccatctcca 250 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 224 ccatctccatctccatctcca 244
>ref|NM_167685.1| Drosophila melanogaster CG12701-RB, transcript variant B (CG12701), mRNA Length = 6597 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 4969 ccatctccatctccatctcca 4949
>ref|NM_166117.1| Drosophila melanogaster CG30321-RA (CG30321), mRNA Length = 267 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 217 ccatctccatctccatctcca 197
>gb|AC153566.12| Mus musculus 10 BAC RP23-5H4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 208610 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 172750 ccatctccatctccatctcca 172770 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 172756 ccatctccatctccatctcc 172775
>ref|NM_134512.4| Drosophila melanogaster CG12701-RA, transcript variant A (CG12701), mRNA Length = 6610 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 4982 ccatctccatctccatctcca 4962
>ref|NM_133159.1| Drosophila melanogaster CG14200-RA (CG14200), mRNA Length = 6114 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 5110 ccatctccatctccatctcca 5090
>gb|AC083813.29| Homo sapiens 12q BAC RP11-304C10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 216123 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 95236 ccatctccatctccatctcca 95256 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 95231 catctccatctccatctcca 95250
>dbj|AK139215.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:A730071I02 product:unclassifiable, full insert sequence Length = 5212 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1033 ccatctccatctccatctcca 1053 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1027 ccatctccatctccatctcca 1047 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1021 ccatctccatctccatctcca 1041 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1015 ccatctccatctccatctcca 1035 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1009 ccatctccatctccatctcca 1029 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1003 ccatctccatctccatctcca 1023 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 997 ccatctccatctccatctcca 1017 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 991 ccatctccatctccatctcca 1011 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 985 ccatctccatctccatctcca 1005 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 960 ccatctccatctccatctcca 980 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 954 ccatctccatctccatctcca 974 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 948 ccatctccatctccatctcca 968 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 966 ccatctccatctccatctcc 985
>gb|AC108129.2| Homo sapiens chromosome 5 clone RP11-802E10, complete sequence Length = 105649 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36134 ccatctccatctccatctcca 36154 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36128 ccatctccatctccatctcca 36148 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 36122 ccatctccatctccatctcca 36142
>gb|AC104179.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0021B21, from chromosome 3, complete sequence Length = 166777 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 207 tggagtggagtggagtgggcg 227 ||||||||||||||||||||| Sbjct: 17998 tggagtggagtggagtgggcg 17978
>gb|AC099024.1| Drosophila melanogaster, chromosome 2R, region 52X-53A, BAC clone BACR04J01, complete sequence Length = 182560 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 101707 ccatctccatctccatctcca 101687
>gb|AF396866.1|AF396866 Bacteriophage Mx8, complete genome Length = 49534 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 9960 ccatctccatctccatctcca 9940
>gb|AC091219.2| Drosophila melanogaster 3L BAC RP98-4C3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 168047 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 5801 ccatctccatctccatctcca 5781 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 5795 ccatctccatctccatctcca 5775
>gb|AC150899.3| Mus musculus BAC clone RP23-179F8 from chromosome 10, complete sequence Length = 202346 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctccac 310 ||||||||||||||||||||| Sbjct: 137038 catctccatctccatctccac 137058
>dbj|AK016006.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930540C21 product:hypothetical protein, full insert sequence Length = 1307 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1127 ccatctccatctccatctcca 1107 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1121 ccatctccatctccatctcca 1101 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1115 ccatctccatctccatctcca 1095 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1109 ccatctccatctccatctcca 1089 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1103 ccatctccatctccatctcca 1083 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1097 ccatctccatctccatctcca 1077 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1091 ccatctccatctccatctcca 1071
>gb|AC092233.1|AC092233 Drosophila melanogaster, chromosome 2L, region 30F-31B, BAC clone BACR29P12, complete sequence Length = 161446 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 29765 ccatctccatctccatctcca 29785 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 29759 ccatctccatctccatctcca 29779
>gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, region 18C-18D, BAC clone BACR27L16, complete sequence Length = 182623 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 118898 ccatctccatctccatctcca 118878
>gb|DQ350731.1| Ajellomyces capsulatus nitrosative stress induced transcription 77 (NIT77) gene, partial sequence Length = 909 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 269 ccatctccatctccatctcca 289
>gb|AC160061.6| Mus musculus 10 BAC RP24-496L10 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 174662 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 27810 ccatctccatctccatctcca 27830 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 27804 ccatctccatctccatctcca 27824 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 27798 ccatctccatctccatctcca 27818 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 27792 ccatctccatctccatctcca 27812
>gb|AC010671.8|AC010671 Drosophila melanogaster, chromosome X, region 18E-18F, BAC clone BACR33M08, complete sequence Length = 180263 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 174618 ccatctccatctccatctcca 174638
>emb|AL115836.1|CNS01CPW Botrytis cinerea strain T4 cDNA library Length = 480 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 418 ccatctccatctccatctcca 398
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 26175227 ccatctccatctccatctcca 26175207 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 26175221 ccatctccatctccatctcca 26175201 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 cgccatctccatctccatct 306 |||||||||||||||||||| Sbjct: 1301452 cgccatctccatctccatct 1301471
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 22524343 ccatctccatctccatctcca 22524323 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 22524337 ccatctccatctccatctcca 22524317 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 22531971 ccatctccatctccatctcc 22531990 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 22531966 catctccatctccatctcca 22531985
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 17009444 ccatctccatctccatctcca 17009424 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 18155289 catctccatctccatctcca 18155270
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 28134266 ccatctccatctccatctcca 28134246 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 28134260 ccatctccatctccatctcca 28134240 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 4102306 ccatctccatctccatctcca 4102286 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 28134254 ccatctccatctccatctcc 28134235 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 287 cgccatctccatctccatctccac 310 ||||||||||||||||| |||||| Sbjct: 423906 cgccatctccatctccacctccac 423929
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 29185937 ccatctccatctccatctcca 29185957 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 29185931 ccatctccatctccatctcca 29185951 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 29185925 ccatctccatctccatctcca 29185945 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 29185919 ccatctccatctccatctcca 29185939
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 207 tggagtggagtggagtgggcg 227 ||||||||||||||||||||| Sbjct: 5812386 tggagtggagtggagtgggcg 5812406 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 286 ccgccatctccatctccatct 306 ||||||||||||||||||||| Sbjct: 4500192 ccgccatctccatctccatct 4500212 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 10388245 ccatctccatctccatctcc 10388264
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 42946588 ccatctccatctccatctcca 42946608 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 42946582 ccatctccatctccatctcca 42946602 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 42242925 ccatctccatctccatctcca 42242945 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 26571302 ccatctccatctccatctcca 26571282 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 26571296 ccatctccatctccatctcca 26571276 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 26571290 ccatctccatctccatctcca 26571270 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 26571284 ccatctccatctccatctcc 26571265 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 9781308 ccatctccatctccatctcc 9781289 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctc 307 |||| ||||||||||||||||||| Sbjct: 3036269 cacctccatctccatctccatctc 3036292
>gb|AC010847.11|AC010847 Drosophila melanogaster, chromosome X, region 18D-18D, BAC clone BACR10M08, complete sequence Length = 180213 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 57378 ccatctccatctccatctcca 57358
>gb|AC009460.4|AC009460 Drosophila melanogaster, chromosome 2R, region 60B-60C, BAC clone BACR04P18, complete sequence Length = 159455 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 83079 ccatctccatctccatctcca 83099
>gb|AC012165.6|AC012165 Drosophila melanogaster, chromosome X, region 18F-18F, BAC clone BACR48P17, complete sequence Length = 176195 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 57978 ccatctccatctccatctcca 57998
>gb|AC009849.7|AC009849 Drosophila melanogaster, chromosome 2L, region 31B-31C, BAC clone BACR07H08, complete sequence Length = 153505 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 20226 ccatctccatctccatctcca 20206 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 20220 ccatctccatctccatctcca 20200
>gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, region 59E3-59F4, BAC clone BACR48M01, complete sequence Length = 188272 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 134440 ccatctccatctccatctcca 134460 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 122205 catctccatctccatctcca 122224
>gb|AY900632.1| Drosophila buzzatii clone BAC 40C11, complete sequence Length = 132938 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121310 ccatctccatctccatctcca 121290 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121304 ccatctccatctccatctcca 121284
>gb|AC011615.4|AC011615 Drosophila melanogaster, chromosome 3R, region 89D-89D, BAC clone BACR01H23, complete sequence Length = 199653 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 155560 ccatctccatctccatctcca 155540
>gb|AC009733.5|AC009733 Drosophila melanogaster, chromosome 3R, region 99E-99E, BAC clone BACR05L15, complete sequence Length = 181056 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 25014 ccatctccatctccatctcca 24994
>gb|AC125471.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0042J17, complete sequence Length = 171442 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 286 ccgccatctccatctccatct 306 ||||||||||||||||||||| Sbjct: 105369 ccgccatctccatctccatct 105389
>gb|AC093894.2| Homo sapiens BAC clone RP11-714E5 from 2, complete sequence Length = 105489 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 44076 ccatctccatctccatctcca 44096
>gb|AC016748.3| Homo sapiens BAC clone RP11-494M7 from 2, complete sequence Length = 182776 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 16962 ccatctccatctccatctcca 16982 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 16957 catctccatctccatctcca 16976
>dbj|AP003238.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0401G10 Length = 160704 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 14882 ccatctccatctccatctcca 14902
>dbj|AP004326.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1294_F06 Length = 121088 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 116123 ccatctccatctccatctcca 116143
>dbj|AP003298.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0698H10 Length = 153449 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 47467 ccatctccatctccatctcca 47487 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 47461 ccatctccatctccatctcca 47481
>dbj|AP003277.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518C01 Length = 173555 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140322 ccatctccatctccatctcca 140342 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 140316 ccatctccatctccatctcca 140336
>gb|AC079244.29| Mus musculus strain C57BL/6J chromosome 9 clone rp23-343k17, complete sequence Length = 223861 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 103922 ccatctccatctccatctcca 103902 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 103916 ccatctccatctccatctcca 103896 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 103910 ccatctccatctccatctcca 103890 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 103904 ccatctccatctccatctcca 103884 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 103898 ccatctccatctccatctcca 103878 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 103892 ccatctccatctccatctcca 103872
>gb|AC010591.10| Homo sapiens chromosome 5 clone CTC-447K7, complete sequence Length = 172745 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121432 ccatctccatctccatctcca 121452 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121426 ccatctccatctccatctcca 121446 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 121420 ccatctccatctccatctcca 121440
>gb|AF287697.1|AF287697 Arabidopsis thaliana half-molecule ABC transporter ATM1 mRNA, complete cds Length = 2037 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 145 ccatctccatctccatctcca 165
>gb|AC023743.4| Drosophila melanogaster X BAC RP98-40O10 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 185405 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 128960 ccatctccatctccatctcca 128980
>gb|BT002506.1| Arabidopsis thaliana ABC transporter - like protein (At4g28630) mRNA, complete cds Length = 2261 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 208 ccatctccatctccatctcca 228
>dbj|AP003212.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0049H05 Length = 161934 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 45016 ccatctccatctccatctcca 44996 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 45010 ccatctccatctccatctcca 44990 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 45004 ccatctccatctccatctcca 44984 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 44998 ccatctccatctccatctcc 44979
>dbj|AP004324.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OJ1215_E11 Length = 105301 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53224 ccatctccatctccatctcca 53244 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53218 ccatctccatctccatctcca 53238 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53212 ccatctccatctccatctcca 53232 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 53206 ccatctccatctccatctcca 53226
>dbj|AK176568.1| Arabidopsis thaliana mRNA for putative protein, complete cds, clone: RAFL25-10-A09 Length = 1286 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 973 ccatctccatctccatctcca 953 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 967 ccatctccatctccatctcca 947
>dbj|AP005393.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0488D02 Length = 154537 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 139257 ccatctccatctccatctcca 139237
>dbj|AP005655.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0025H07 Length = 145605 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 3103 ccatctccatctccatctcca 3083
>emb|AL512582.7| Mouse DNA sequence from clone RP23-290H11 on chromosome 2, complete sequence Length = 115075 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 108232 ccatctccatctccatctcca 108252 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 108226 ccatctccatctccatctcca 108246 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 108220 ccatctccatctccatctcca 108240
>dbj|AP004274.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0450A04 Length = 162545 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 117562 ccatctccatctccatctcca 117542 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 117556 ccatctccatctccatctcca 117536 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 117550 ccatctccatctccatctcc 117531
>gb|AC153975.4| Mus musculus 10 BAC RP24-186L12 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 145072 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 138047 ccatctccatctccatctcca 138067 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 138041 ccatctccatctccatctcca 138061 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 138035 ccatctccatctccatctcca 138055 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 138029 ccatctccatctccatctcca 138049
>dbj|AP004307.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0534H07 Length = 144689 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 95164 ccatctccatctccatctcca 95144
>gb|AC158669.3| Mus musculus 6 BAC RP23-66K6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 242779 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 101283 ccatctccatctccatctcca 101263 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 101277 ccatctccatctccatctcca 101257
>emb|BX649229.2| Chicken DNA sequence from clone WAG-41C10, complete sequence Length = 147869 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 15766 ccatctccatctccatctcca 15786 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 15760 ccatctccatctccatctcca 15780 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 15754 ccatctccatctccatctcca 15774
>dbj|AP005406.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1147B12 Length = 127902 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 29888 ccatctccatctccatctcca 29868
>dbj|AK121117.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023074A22, full insert sequence Length = 2175 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1203 ccatctccatctccatctcca 1223
>dbj|AK120880.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023027K12, full insert sequence Length = 4982 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 94 ccatctccatctccatctcca 74
>dbj|AK120101.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013022K23, full insert sequence Length = 1548 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 6 ccatctccatctccatctcca 26 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 12 ccatctccatctccatctcc 31
>dbj|AK112037.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-D02, full insert sequence Length = 1789 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 286 ccgccatctccatctccatct 306 ||||||||||||||||||||| Sbjct: 1673 ccgccatctccatctccatct 1693
>dbj|AK111688.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013170G06, full insert sequence Length = 3994 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 286 ccgccatctccatctccatct 306 ||||||||||||||||||||| Sbjct: 3882 ccgccatctccatctccatct 3902
>dbj|AK107025.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-121-A05, full insert sequence Length = 1291 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 396 ccatctccatctccatctcca 376 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 390 ccatctccatctccatctcca 370 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 384 ccatctccatctccatctcca 364 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 378 ccatctccatctccatctcca 358
>dbj|AK106736.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-A05, full insert sequence Length = 2273 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1764 ccatctccatctccatctcca 1784 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1758 ccatctccatctccatctcca 1778 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1752 ccatctccatctccatctcca 1772 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1746 ccatctccatctccatctcca 1766
>dbj|AK105819.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-D04, full insert sequence Length = 1552 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 580 ccatctccatctccatctcca 600
>dbj|AK105426.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-C11, full insert sequence Length = 2895 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1743 ccatctccatctccatctcca 1763 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1737 ccatctccatctccatctcca 1757 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1731 ccatctccatctccatctcca 1751 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1725 ccatctccatctccatctcca 1745
>dbj|AK104805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-D12, full insert sequence Length = 972 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 83 ccatctccatctccatctcca 103 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 77 ccatctccatctccatctcca 97
>dbj|AK103593.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033133D12, full insert sequence Length = 1303 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 69 ccatctccatctccatctcca 89 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 63 ccatctccatctccatctcca 83
>dbj|AK102730.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033105P14, full insert sequence Length = 2834 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1734 ccatctccatctccatctcca 1754 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1728 ccatctccatctccatctcca 1748 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1722 ccatctccatctccatctcca 1742 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1716 ccatctccatctccatctcca 1736
>dbj|AK101045.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033005H20, full insert sequence Length = 2170 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1198 ccatctccatctccatctcca 1218
>dbj|AK098937.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013036H15, full insert sequence Length = 998 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 85 ccatctccatctccatctcca 105 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 79 ccatctccatctccatctcca 99
>dbj|AK065123.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001P02, full insert sequence Length = 2018 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 32 ccatctccatctccatctcca 12 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 26 ccatctccatctccatctcca 6
>dbj|AK059735.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-B02, full insert sequence Length = 1010 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 97 ccatctccatctccatctcca 117 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 91 ccatctccatctccatctcca 111
>gb|AC169371.2| Sorghum bicolor clone SB_BBc0127F08, complete sequence Length = 70712 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 54621 ccatctccatctccatctcca 54601
>gb|AC104928.8| Mus musculus chromosome 8, clone RP24-111K8, complete sequence Length = 177873 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 167059 ccatctccatctccatctcca 167079 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 167053 ccatctccatctccatctcca 167073 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 167047 ccatctccatctccatctcca 167067 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 167041 ccatctccatctccatctcca 167061 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 167035 ccatctccatctccatctcca 167055 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 167029 ccatctccatctccatctcca 167049 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 167023 ccatctccatctccatctcca 167043
>gb|AC116483.10| Mus musculus chromosome 1, clone RP23-424K5, complete sequence Length = 194546 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 32082 ccatctccatctccatctcca 32102 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 32088 ccatctccatctccatctcc 32107
>gb|AC008369.1|AC008369 Drosophila melanogaster, chromosome 2R, region 52A4-52B4, P1 clones BACR48C01 and DS08592, complete sequence Length = 192366 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 64530 ccatctccatctccatctcca 64550
>gb|AE003713.3| Drosophila melanogaster chromosome 3R, section 51 of 118 of the complete sequence Length = 226561 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 153728 ccatctccatctccatctcca 153708
>gb|AC007122.1|AC007122 Drosophila melanogaster, chromosome 2R, region 52C1-52C3, P1 clones DS00541, DS06972, and DS08188, complete sequence Length = 93829 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 43824 ccatctccatctccatctcca 43804
>gb|AE003627.4| Drosophila melanogaster chromosome 2L, section 36 of 83 of the complete sequence Length = 264225 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 218609 ccatctccatctccatctcca 218589 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 218603 ccatctccatctccatctcca 218583
>gb|AE003826.4| Drosophila melanogaster chromosome 2R, section 24 of 73 of the complete sequence Length = 310108 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctccac 310 ||||||||||||||||||||| Sbjct: 277755 catctccatctccatctccac 277775
>gb|AE003810.3| Drosophila melanogaster chromosome 2R, section 40 of 73 of the complete sequence Length = 271178 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 141888 ccatctccatctccatctcca 141908
>gb|AE003772.2| Drosophila melanogaster chromosome 3R, section 110 of 118 of the complete sequence Length = 228443 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 94555 ccatctccatctccatctcca 94535
>gb|AE003565.3| Drosophila melanogaster chromosome 3L, section 20 of 83 of the complete sequence Length = 284268 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 257516 ccatctccatctccatctcca 257496
>gb|AE003513.3| Drosophila melanogaster chromosome X, section 65 of 74 of the complete sequence Length = 207432 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 78117 ccatctccatctccatctcca 78137
>gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 of 74 of the complete sequence Length = 346474 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 163144 ccatctccatctccatctcca 163124
>gb|AE003496.4| Drosophila melanogaster chromosome X, section 48 of 74 of the complete sequence Length = 299868 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 284 caccgccatctccatctccatctcc 308 |||| |||||||||||||||||||| Sbjct: 185486 caccaccatctccatctccatctcc 185510 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 156413 ccatctccatctccatctcca 156393
>gb|AE003468.3| Drosophila melanogaster chromosome 3L, section 2 of 83 of the complete sequence Length = 307657 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 300078 ccatctccatctccatctcca 300058 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 300072 ccatctccatctccatctcca 300052
>gb|AE003463.2| Drosophila melanogaster chromosome 2R, section 70 of 73 of the complete sequence Length = 298827 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 182480 ccatctccatctccatctcca 182500
>gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69 of 73 of the complete sequence Length = 598988 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 167980 ccatctccatctccatctcca 168000 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 155745 catctccatctccatctcca 155764
>gb|AE003444.3| Drosophila melanogaster chromosome X, section 28 of 74 of the complete sequence Length = 299633 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 246005 ccatctccatctccatctcca 246025
>gb|AE003439.3| Drosophila melanogaster chromosome X, section 23 of 74 of the complete sequence Length = 331952 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 290 catctccatctccatctccac 310 ||||||||||||||||||||| Sbjct: 312616 catctccatctccatctccac 312596
>emb|AL109985.5|CNS018P2 Human chromosome 14 DNA sequence BAC R-370E23 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 186548 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 1686 ccatctccatctccatctcca 1706 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 1792 catctccatctccatctcca 1811 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 1681 catctccatctccatctcca 1700
>gb|AE003809.3| Drosophila melanogaster chromosome 2R, section 41 of 73 of the complete sequence Length = 262533 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 113275 ccatctccatctccatctcca 113255
>gb|AC121101.8| Mus musculus chromosome 8, clone RP24-511A8, complete sequence Length = 158957 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 82937 ccatctccatctccatctcca 82917 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 82931 ccatctccatctccatctcca 82911 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 82925 ccatctccatctccatctcca 82905 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 82919 ccatctccatctccatctcca 82899 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 82913 ccatctccatctccatctcca 82893 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 82907 ccatctccatctccatctcca 82887 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 82901 ccatctccatctccatctcca 82881 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 82895 ccatctccatctccatctcc 82876
>gb|AC108398.9| Mus musculus chromosome 13, clone RP24-350L19, complete sequence Length = 137487 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 94161 ccatctccatctccatctcca 94181
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 462010 ccatctccatctccatctcca 461990 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 462004 ccatctccatctccatctcca 461984 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 461998 ccatctccatctccatctcca 461978 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 461992 ccatctccatctccatctcca 461972
>dbj|AB089495.1| Neurospora crassa mus-42 gene, complete cds Length = 4619 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 3909 ccatctccatctccatctcca 3889
>emb|CT030705.12| Mouse DNA sequence from clone RP23-118N11 on chromosome 13, complete sequence Length = 125516 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 103276 ccatctccatctccatctcca 103256 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 103270 ccatctccatctccatctcca 103250 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 103264 ccatctccatctccatctcca 103244
>gb|AC161764.4| Mus musculus BAC clone RP23-193D1 from chromosome 14, complete sequence Length = 215230 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 46134 ccatctccatctccatctcca 46114 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 46128 ccatctccatctccatctcca 46108 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 46122 ccatctccatctccatctcca 46102 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 46116 ccatctccatctccatctcca 46096 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 46110 ccatctccatctccatctcca 46090 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 46104 ccatctccatctccatctcca 46084
>gb|AY785521.1| Arabidopsis thaliana At4g28640 gene, promoter region Length = 2500 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 964 ccatctccatctccatctcca 944
>gb|AC153639.4| Mus musculus 6 BAC RP23-124H2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 190211 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 186574 ccatctccatctccatctcca 186594 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 186568 ccatctccatctccatctcca 186588
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 22536811 ccatctccatctccatctcca 22536791 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 22536805 ccatctccatctccatctcca 22536785 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 22544439 ccatctccatctccatctcc 22544458 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 22544434 catctccatctccatctcca 22544453
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 26103403 ccatctccatctccatctcca 26103383 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 26103397 ccatctccatctccatctcca 26103377 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 cgccatctccatctccatct 306 |||||||||||||||||||| Sbjct: 1301452 cgccatctccatctccatct 1301471
>gb|AC003005.1|AC003005 Human DNA from chromosome 19-specific cosmid F25419 containing ZNF gene family members, genomic sequence, complete sequence Length = 45084 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 28328 ccatctccatctccatctcca 28348 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 catctccatctccatctcca 309 |||||||||||||||||||| Sbjct: 28323 catctccatctccatctcca 28342
>emb|BX000457.2|CNS08CDE Oryza sativa chromosome 12, . BAC OJ1388_B05 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 144241 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 65465 ccatctccatctccatctcca 65445 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 65459 ccatctccatctccatctcca 65439
>gb|AC134334.3| Mus musculus BAC clone RP24-143M4 from 9, complete sequence Length = 158518 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 132253 ccatctccatctccatctcca 132233 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 132247 ccatctccatctccatctcca 132227 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 132241 ccatctccatctccatctcca 132221 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 132235 ccatctccatctccatctcca 132215 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 132229 ccatctccatctccatctcca 132209 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 132223 ccatctccatctccatctcca 132203 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 132217 ccatctccatctccatctcca 132197 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 132211 ccatctccatctccatctcca 132191 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 132205 ccatctccatctccatctcca 132185 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 132199 ccatctccatctccatctcca 132179 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 132193 ccatctccatctccatctcca 132173
>gb|AC140553.3| Mus musculus BAC clone RP24-71M17 from 1, complete sequence Length = 217538 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 87629 ccatctccatctccatctcca 87649
>gb|AC132312.4| Mus musculus BAC clone RP24-298A20 from 12, complete sequence Length = 177464 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 37180 ccatctccatctccatctcca 37160 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 37174 ccatctccatctccatctcca 37154 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 37168 ccatctccatctccatctcca 37148 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 37162 ccatctccatctccatctcca 37142 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 37156 ccatctccatctccatctcca 37136 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 37150 ccatctccatctccatctcca 37130 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcc 308 |||||||||||||||||||| Sbjct: 37144 ccatctccatctccatctcc 37125
>gb|AC132143.3| Mus musculus BAC clone RP23-20J10 from 3, complete sequence Length = 205880 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 139712 ccatctccatctccatctcca 139692 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 289 ccatctccatctccatctcca 309 ||||||||||||||||||||| Sbjct: 139706 ccatctccatctccatctcca 139686 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,959,982 Number of Sequences: 3902068 Number of extensions: 3959982 Number of successful extensions: 99856 Number of sequences better than 10.0: 479 Number of HSP's better than 10.0 without gapping: 495 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 92469 Number of HSP's gapped (non-prelim): 7065 length of query: 435 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 413 effective length of database: 17,147,199,772 effective search space: 7081793505836 effective search space used: 7081793505836 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
