>gb|AY358234.1| Homo sapiens clone DNA142975 EPWW6493 (UNQ6493) mRNA, complete cds
          Length = 972

 Score = 40.1 bits (20), Expect = 0.74
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 21  ttctggctgcttcctcccgc 40
           ||||||||||||||||||||
Sbjct: 251 ttctggctgcttcctcccgc 232

>emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on chromosome 1 Contains the
             3' end of the PRKCZ gene for protein kinase C zeta, a
             novel gene, a novel gene (FLJ31031), the SKI gene for
             v-ski sarcoma viral oncogene homolog (avian) and five CpG
             islands, complete sequence
          Length = 179836

 Score = 40.1 bits (20), Expect = 0.74
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    ctggctgcttcctcccgcag 42
             ||||||||||||||||||||
Sbjct: 72403 ctggctgcttcctcccgcag 72422

>gb|AC104530.2| Homo sapiens chromosome 19 clone LLNL-FOS_25H9, complete sequence
          Length = 22752

 Score = 40.1 bits (20), Expect = 0.74
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 21   ttctggctgcttcctcccgc 40
            ||||||||||||||||||||
Sbjct: 9712 ttctggctgcttcctcccgc 9693

>gb|AC087725.8| Sequence of the Aflatoxin Biolsynthetic Custer region of Aspergillus
             flavus, complete sequence
          Length = 41361

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    tggctgcttcctcccgcag 42
             |||||||||||||||||||
Sbjct: 30333 tggctgcttcctcccgcag 30315

>dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038
          Length = 1725576

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 24    tggctgcttcctcccgcag 42
             |||||||||||||||||||
Sbjct: 79398 tggctgcttcctcccgcag 79380

>gb|L38482.1|RATSERINE Rattus norvegicus serine protease gene, complete cds
          Length = 3974

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 20   cttctggctgcttcctccc 38
            |||||||||||||||||||
Sbjct: 1573 cttctggctgcttcctccc 1591


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 501,130
Number of Sequences: 3902068
Number of extensions: 501130
Number of successful extensions: 36187
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36176
Number of HSP's gapped (non-prelim): 11
length of query: 73
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 52
effective length of database: 17,151,101,840
effective search space: 891857295680
effective search space used: 891857295680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)