Clone Information

Sequence Data

Clone Name	bast05e12
Clone Library Name	barley_pub
Definition	emb\|Z93942.1\|HS230I19 Human DNA sequence from clone RP1-230I19 on chromosome 20q12-13.12 Contains part of the PTPRT gene for protein tyrosine phosphatase receptor type T, genomic marker D20S858, a ca repeat polymorphism, ESTs, STS and GSSs, complete seque

AACATCCATTGCATCCATCTCTCGAGTGAGCAGCAATGGGTTCCCTTCACAAGGGTGGGG
TTTGGTGGTTGC

Download to file. (under entry)