>emb|Z67734.1|CEB0198 Caenorhabditis elegans Cosmid B0198, complete sequence
          Length = 31278

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 263   tgctgctaaaactgcaactga 283
             |||||||||||||||||||||
Sbjct: 29538 tgctgctaaaactgcaactga 29558

>dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 DNA, complete
               genome
          Length = 2516575

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 468     gtttctcttgctaatgaagct 488
               |||||||||||||||||||||
Sbjct: 1108800 gtttctcttgctaatgaagct 1108780

>gb|AC136977.4| Homo sapiens 12 BAC RP11-439H13 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 33795

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 657   tgctgaaatggattcagtactgtta 681
             ||||||||||||||||||| |||||
Sbjct: 22553 tgctgaaatggattcagtaatgtta 22577

>emb|BX284615.6| Mouse DNA sequence from clone RP23-20B20 on chromosome 2, complete
            sequence
          Length = 98233

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 361  ttaaaatggaagcttctcctg 381
            |||||||||||||||||||||
Sbjct: 2098 ttaaaatggaagcttctcctg 2118

>emb|AL772167.13| Mouse DNA sequence from clone RP23-203A12 on chromosome 4, complete
              sequence
          Length = 205104

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 352    agccagatattaaaatggaag 372
              |||||||||||||||||||||
Sbjct: 121819 agccagatattaaaatggaag 121799


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,988,811
Number of Sequences: 3902068
Number of extensions: 6988811
Number of successful extensions: 129664
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 129633
Number of HSP's gapped (non-prelim): 31
length of query: 737
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 714
effective length of database: 17,143,297,704
effective search space: 12240314560656
effective search space used: 12240314560656
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)