ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd27o16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|U76895.1|TAU76895 Triticum aestivum beta-tubulin 4 (Tubb4) mR... 430 e-117
2ref|NM_184995.1| Oryza sativa (japonica cultivar-group), mRNA 309 3e-81
3gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 309 3e-81
4gb|AC084320.10| Oryza sativa chromosome 3 BAC OSJNBa0091J19 geno... 309 3e-81
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 309 3e-81
6dbj|AK120180.1| Oryza sativa (japonica cultivar-group) cDNA clon... 309 3e-81
7dbj|D13224.1|RICBETAT Oryza sativa (japonica cultivar-group) mRN... 301 6e-79
8dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 293 2e-76
9dbj|AP005610.3| Oryza sativa (japonica cultivar-group) genomic D... 293 2e-76
10dbj|AP005192.3| Oryza sativa (japonica cultivar-group) genomic D... 293 2e-76
11dbj|AK069237.1| Oryza sativa (japonica cultivar-group) cDNA clon... 293 2e-76
12ref|XM_464246.1| Oryza sativa (japonica cultivar-group), mRNA 281 6e-73
13emb|X79367.1|OSBETATU O.sativa mRNA for beta-tubulin 281 6e-73
14dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 281 6e-73
15dbj|AP005804.2| Oryza sativa (japonica cultivar-group) genomic D... 281 6e-73
16dbj|AK121574.1| Oryza sativa (japonica cultivar-group) cDNA clon... 281 6e-73
17dbj|D30717.1|RICBTB Oryza sativa (japonica cultivar-group) mRNA ... 281 6e-73
18gb|AF059287.1|AF059287 Eleusine indica beta-tubulin 1 (TUB1) mRN... 274 1e-70
19gb|BT016750.1| Zea mays clone Contig583 mRNA sequence 262 5e-67
20gb|U76744.1|TAU76744 Triticum aestivum beta-tubulin 1 (tubb1) mR... 260 2e-66
21gb|L10634.1|MZEBTUB7A Zea mays beta-7 tubulin (tub7) mRNA, compl... 254 1e-64
22emb|AJ586807.1| Setaria viridis tub2 gene for beta tubulin, exon... 252 5e-64
23gb|AF059289.1|AF059289 Eleusine indica beta-tubulin 3 (TUB3) mRN... 246 3e-62
24gb|U76746.1|TAU76746 Triticum aestivum beta-tubulin 3 (tubb3) mR... 246 3e-62
25emb|X52878.1|ZMB1TUB Maize gene for beta 1 tubulin 238 8e-60
26ref|NM_187707.1| Oryza sativa (japonica cultivar-group), predic... 234 1e-58
27emb|X74654.1|ZMB3TUB Z.mays mRNA for beta 3 tubulin 234 1e-58
28dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 234 1e-58
29dbj|AP003631.3| Oryza sativa (japonica cultivar-group) genomic D... 234 1e-58
30dbj|AK122127.1| Oryza sativa (japonica cultivar-group) cDNA clon... 234 1e-58
31dbj|AK065323.1| Oryza sativa (japonica cultivar-group) cDNA clon... 234 1e-58
32gb|L33263.1|RICBTUBULI Oryza sativa beta-tubulin mRNA 234 1e-58
33dbj|AP003018.2| Oryza sativa (japonica cultivar-group) genomic D... 234 1e-58
34gb|AC107224.2| Oryza sativa (japonica cultivar-group) chromosome... 224 1e-55
35ref|NM_187634.1| Oryza sativa (japonica cultivar-group), predic... 222 5e-55
36gb|AC130607.2| Oryza sativa (japonica cultivar-group) chromosome... 208 7e-51
37dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 208 7e-51
38dbj|AB104732.1| Oryza sativa (japonica cultivar-group) OsTUB6 mR... 208 7e-51
39dbj|AK122099.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 7e-51
40gb|U22050.1|PCU22050 Phytophthora cinnamomi beta-tubulin gene, c... 188 6e-45
41emb|X52879.1|ZMB2TUBR Maize mRNA for beta 2 tubulin 180 2e-42
42gb|AY110929.1| Zea mays CL2242_8 mRNA sequence 180 2e-42
43gb|AF059290.1|AF059290 Eleusine indica beta-tubulin 4 (TUB4) mRN... 178 6e-42
44gb|DQ217196.1| Taeniopygia guttata clone 0058P0025C05 tubulin be... 170 1e-39
45gb|DQ217195.1| Taeniopygia guttata clone 0058P0057H05 tubulin be... 170 1e-39
46gb|DQ217194.1| Taeniopygia guttata clone 0063P0007D06 tubulin be... 170 1e-39
47gb|DQ217192.1| Taeniopygia guttata clone 0058P0058E06 tubulin be... 170 1e-39
48gb|DQ217191.1| Taeniopygia guttata clone 0058P0048B01 tubulin be... 170 1e-39
49gb|DQ217187.1| Taeniopygia guttata clone 0058P0053E12 tubulin be... 170 1e-39
50gb|DQ217186.1| Taeniopygia guttata clone 0058P0032D04 tubulin be... 170 1e-39
51gb|DQ217184.1| Taeniopygia guttata clone 0058P0057D03 tubulin be... 170 1e-39
52gb|DQ217183.1| Taeniopygia guttata clone 0058P0030E11 tubulin be... 170 1e-39
53gb|DQ217181.1| Taeniopygia guttata clone 0058P0029E09 tubulin be... 170 1e-39
54gb|DQ217193.1| Taeniopygia guttata clone 0058P0055C09 tubulin be... 163 4e-37
55gb|DQ217190.1| Taeniopygia guttata clone 0058P0005H01 tubulin be... 163 4e-37
56gb|DQ217188.1| Taeniopygia guttata clone 0058P0005C05 tubulin be... 163 4e-37
57gb|DQ217185.1| Taeniopygia guttata clone 0058P0031E02 tubulin be... 163 4e-37
58gb|BT016769.1| Zea mays clone Contig602 mRNA sequence 163 4e-37
59gb|AY103690.1| Zea mays PCO144028 mRNA sequence 155 9e-35
60gb|L10636.1|MZEBTUB8A Zea mays beta-8 tubulin (tub8) mRNA, compl... 155 9e-35
61gb|AF064849.1| Homo sapiens map 4q35 repeat region, complete seq... 151 1e-33
62gb|BC071888.1| Homo sapiens cDNA clone IMAGE:3958193, **** WARNI... 151 1e-33
63gb|AY167990.1| Homo sapiens class IVb beta tubulin mRNA, complet... 151 1e-33
64emb|BX648521.1|HSM808669 Homo sapiens mRNA; cDNA DKFZp686F0685 (... 151 1e-33
65dbj|AK026167.1| Homo sapiens cDNA: FLJ22514 fis, clone HRC12119,... 151 1e-33
66dbj|AK000560.1| Homo sapiens cDNA FLJ20553 fis, clone KAT11806, ... 151 1e-33
67dbj|AK098686.1| Homo sapiens cDNA FLJ25820 fis, clone TST07642, ... 151 1e-33
68dbj|AK026609.1| Homo sapiens cDNA: FLJ22956 fis, clone KAT09938,... 151 1e-33
69dbj|AK026594.1| Homo sapiens cDNA: FLJ22941 fis, clone KAT08078,... 151 1e-33
70gb|BC029529.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
71gb|BC071889.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
72gb|BC002783.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
73gb|BC039175.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
74gb|BC019829.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
75gb|BC002885.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
76gb|BC001911.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
77gb|BC007889.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
78gb|BC019359.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
79gb|BC024038.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
80gb|BC012835.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
81gb|BC004188.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone M... 151 1e-33
82ref|NM_006088.5| Homo sapiens tubulin, beta 2C (TUBB2C), mRNA 151 1e-33
83gb|AF095840.1|AF095840 Entosiphon sulcatum b-tubulin (tub-b) gen... 147 2e-32
84gb|AY729820.1| Pavlova lutheri beta-tubulin gene, partial cds 145 9e-32
85gb|M79341.1|ECRBTUBB Ectocarpus variabilis beta-tubulin mRNA, co... 145 9e-32
86dbj|AK021414.1| Homo sapiens cDNA FLJ11352 fis, clone HEMBA10000... 143 3e-31
87emb|AL832497.1|HSM803805 Homo sapiens mRNA; cDNA DKFZp686J1451 (... 143 3e-31
88gb|M21297.1|SOYSB2TUB Soybean (G.max L.) beta-tubulin (S-beta-2)... 143 3e-31
89ref|XM_469133.1| Oryza sativa (japonica cultivar-group), mRNA 141 1e-30
90gb|AC137991.3| Oryza sativa chromosome 3 BAC OSJNBa0034D21 genom... 141 1e-30
91gb|AC139174.3| Oryza sativa chromosome 3 BAC OSJNBb0065L20 genom... 141 1e-30
92gb|AY382291.2| Physcomitrella patens beta-tubulin 5 (Tub5) gene,... 141 1e-30
93dbj|AB104733.1| Oryza sativa (japonica cultivar-group) OsTUB8 mR... 141 1e-30
94dbj|AK121321.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 1e-30
95gb|BC000748.2| Homo sapiens tubulin, beta 3, mRNA (cDNA clone MG... 139 5e-30
96gb|BC003021.1| Homo sapiens tubulin, beta 3, mRNA (cDNA clone MG... 139 5e-30
97ref|NM_006086.2| Homo sapiens tubulin, beta 3 (TUBB3), mRNA 139 5e-30
98gb|BC064975.1| Homo sapiens tubulin, beta 3, mRNA (cDNA clone IM... 139 5e-30
99emb|X74656.1|ZMB5TUB Z.mays mRNA for beta 5 tubulin 139 5e-30
100emb|CR615967.1| full-length cDNA clone CS0DF038YF01 of Fetal bra... 139 5e-30
101emb|CR615850.1| full-length cDNA clone CS0DJ007YO19 of T cells (... 139 5e-30
102emb|CR615754.1| full-length cDNA clone CS0DF010YP09 of Fetal bra... 139 5e-30
103emb|CR625914.1| full-length cDNA clone CS0DN002YB01 of Adult bra... 139 5e-30
104emb|CR625315.1| full-length cDNA clone CS0DF005YP01 of Fetal bra... 139 5e-30
105emb|CR625137.1| full-length cDNA clone CS0DF011YI10 of Fetal bra... 139 5e-30
106emb|CR624879.1| full-length cDNA clone CS0DF012YA22 of Fetal bra... 139 5e-30
107emb|CR624252.1| full-length cDNA clone CS0DF009YA20 of Fetal bra... 139 5e-30
108emb|CR624149.1| full-length cDNA clone CS0DF009YJ19 of Fetal bra... 139 5e-30
109emb|CR623719.1| full-length cDNA clone CS0DG005YH11 of B cells (... 139 5e-30
110emb|CR623384.1| full-length cDNA clone CS0DF036YB17 of Fetal bra... 139 5e-30
111emb|CR623379.1| full-length cDNA clone CS0DF036YB10 of Fetal bra... 139 5e-30
112emb|CR623445.1| full-length cDNA clone CS0DF005YB15 of Fetal bra... 139 5e-30
113emb|CR621602.1| full-length cDNA clone CS0DF001YC21 of Fetal bra... 139 5e-30
114emb|CR622839.1| full-length cDNA clone CS0DF026YC19 of Fetal bra... 139 5e-30
115emb|CR622759.1| full-length cDNA clone CS0DF014YK24 of Fetal bra... 139 5e-30
116emb|CR622595.1| full-length cDNA clone CS0DN001YL23 of Adult bra... 139 5e-30
117emb|CR620404.1| full-length cDNA clone CS0DF031YK19 of Fetal bra... 139 5e-30
118emb|CR619439.1| full-length cDNA clone CS0DG003YA16 of B cells (... 139 5e-30
119emb|CR619366.1| full-length cDNA clone CS0DF014YG24 of Fetal bra... 139 5e-30
120emb|CR618719.1| full-length cDNA clone CS0DF021YA06 of Fetal bra... 139 5e-30
121emb|CR618148.1| full-length cDNA clone CS0DF037YN17 of Fetal bra... 139 5e-30
122emb|CR617704.1| full-length cDNA clone CS0DF038YG23 of Fetal bra... 139 5e-30
123emb|CR617597.1| full-length cDNA clone CS0DF010YP23 of Fetal bra... 139 5e-30
124emb|CR616697.1| full-length cDNA clone CS0DA002YC18 of Neuroblas... 139 5e-30
125emb|CR615487.1| full-length cDNA clone CS0DF013YI09 of Fetal bra... 139 5e-30
126emb|CR615484.1| full-length cDNA clone CS0DF019YG07 of Fetal bra... 139 5e-30
127emb|CR614854.1| full-length cDNA clone CS0DF007YO04 of Fetal bra... 139 5e-30
128emb|CR614638.1| full-length cDNA clone CS0DA003YC13 of Neuroblas... 139 5e-30
129emb|CR614385.1| full-length cDNA clone CS0DF007YJ03 of Fetal bra... 139 5e-30
130emb|CR614150.1| full-length cDNA clone CS0DF015YJ10 of Fetal bra... 139 5e-30
131emb|CR613956.1| full-length cDNA clone CS0DG004YH19 of B cells (... 139 5e-30
132emb|CR609561.1| full-length cDNA clone CS0DG006YC09 of B cells (... 139 5e-30
133emb|CR613333.1| full-length cDNA clone CS0DF011YA14 of Fetal bra... 139 5e-30
134emb|CR613212.1| full-length cDNA clone CS0DF015YN09 of Fetal bra... 139 5e-30
135emb|CR612703.1| full-length cDNA clone CS0DF037YH20 of Fetal bra... 139 5e-30
136emb|CR612113.1| full-length cDNA clone CS0DF036YH23 of Fetal bra... 139 5e-30
137emb|CR611692.1| full-length cDNA clone CS0DF009YI18 of Fetal bra... 139 5e-30
138emb|CR611346.1| full-length cDNA clone CS0DF008YG23 of Fetal bra... 139 5e-30
139emb|CR610945.1| full-length cDNA clone CS0DA008YC09 of Neuroblas... 139 5e-30
140emb|CR610920.1| full-length cDNA clone CS0DF013YA15 of Fetal bra... 139 5e-30
141emb|CR610428.1| full-length cDNA clone CS0DF001YP17 of Fetal bra... 139 5e-30
142emb|CR609931.1| full-length cDNA clone CS0DF014YG03 of Fetal bra... 139 5e-30
143emb|CR609873.1| full-length cDNA clone CS0DF009YH14 of Fetal bra... 139 5e-30
144emb|CR609372.1| full-length cDNA clone CS0DF002YL02 of Fetal bra... 139 5e-30
145emb|CR609285.1| full-length cDNA clone CS0DF030YE09 of Fetal bra... 139 5e-30
146emb|CR609278.1| full-length cDNA clone CS0DF007YC21 of Fetal bra... 139 5e-30
147emb|CR607915.1| full-length cDNA clone CS0DF038YE04 of Fetal bra... 139 5e-30
148emb|CR607807.1| full-length cDNA clone CS0DF030YI19 of Fetal bra... 139 5e-30
149emb|CR608519.1| full-length cDNA clone CS0DF026YL16 of Fetal bra... 139 5e-30
150emb|CR604723.1| full-length cDNA clone CS0DF026YA06 of Fetal bra... 139 5e-30
151emb|CR604583.1| full-length cDNA clone CS0DF003YG20 of Fetal bra... 139 5e-30
152emb|CR605022.1| full-length cDNA clone CS0DF016YA20 of Fetal bra... 139 5e-30
153emb|CR605928.1| full-length cDNA clone CS0DF006YM22 of Fetal bra... 139 5e-30
154emb|CR605372.1| full-length cDNA clone CS0DF021YG18 of Fetal bra... 139 5e-30
155emb|CR605687.1| full-length cDNA clone CS0DF017YL06 of Fetal bra... 139 5e-30
156emb|CR605618.1| full-length cDNA clone CS0DF004YP17 of Fetal bra... 139 5e-30
157emb|CR605315.1| full-length cDNA clone CS0DF008YL08 of Fetal bra... 139 5e-30
158emb|CR604865.1| full-length cDNA clone CS0DF006YI05 of Fetal bra... 139 5e-30
159emb|CR604211.1| full-length cDNA clone CS0DF001YA09 of Fetal bra... 139 5e-30
160emb|CR604086.1| full-length cDNA clone CS0DN003YP17 of Adult bra... 139 5e-30
161emb|CR604020.1| full-length cDNA clone CS0DF034YG16 of Fetal bra... 139 5e-30
162emb|CR603943.1| full-length cDNA clone CS0DF038YG17 of Fetal bra... 139 5e-30
163emb|CR603741.1| full-length cDNA clone CS0DN003YK16 of Adult bra... 139 5e-30
164emb|CR603509.1| full-length cDNA clone CS0DF015YF07 of Fetal bra... 139 5e-30
165emb|CR603504.1| full-length cDNA clone CS0DF019YF15 of Fetal bra... 139 5e-30
166emb|CR601978.1| full-length cDNA clone CS0DF031YB04 of Fetal bra... 139 5e-30
167emb|CR601914.1| full-length cDNA clone CS0DF029YG22 of Fetal bra... 139 5e-30
168emb|CR601754.1| full-length cDNA clone CS0DF015YO08 of Fetal bra... 139 5e-30
169emb|CR601082.1| full-length cDNA clone CS0DF004YG09 of Fetal bra... 139 5e-30
170emb|CR600381.1| full-length cDNA clone CS0DF002YJ17 of Fetal bra... 139 5e-30
171emb|CR600906.1| full-length cDNA clone CS0DF011YB14 of Fetal bra... 139 5e-30
172emb|CR600096.1| full-length cDNA clone CL0BB012ZA10 of Neuroblas... 139 5e-30
173emb|CR600094.1| full-length cDNA clone CS0DI080YH19 of Placenta ... 139 5e-30
174emb|CR599992.1| full-length cDNA clone CS0DA010YF14 of Neuroblas... 139 5e-30
175emb|CR599272.1| full-length cDNA clone CS0DF025YB17 of Fetal bra... 139 5e-30
176emb|CR598551.1| full-length cDNA clone CS0DF013YG06 of Fetal bra... 139 5e-30
177emb|CR598043.1| full-length cDNA clone CS0DF001YN08 of Fetal bra... 139 5e-30
178emb|CR598025.1| full-length cDNA clone CS0DF032YL01 of Fetal bra... 139 5e-30
179emb|CR597505.1| full-length cDNA clone CS0DF014YA10 of Fetal bra... 139 5e-30
180emb|CR596786.1| full-length cDNA clone CS0DF005YF08 of Fetal bra... 139 5e-30
181emb|CR596505.1| full-length cDNA clone CS0DF034YM19 of Fetal bra... 139 5e-30
182emb|CR596446.1| full-length cDNA clone CS0DF002YK07 of Fetal bra... 139 5e-30
183emb|CR596211.1| full-length cDNA clone CS0DF004YN22 of Fetal bra... 139 5e-30
184emb|CR595964.1| full-length cDNA clone CL0BB005ZB01 of Neuroblas... 139 5e-30
185emb|CR595448.1| full-length cDNA clone CS0DF003YE06 of Fetal bra... 139 5e-30
186emb|CR594063.1| full-length cDNA clone CS0DF001YC03 of Fetal bra... 139 5e-30
187emb|CR594636.1| full-length cDNA clone CS0DF028YG23 of Fetal bra... 139 5e-30
188emb|CR594431.1| full-length cDNA clone CS0DF005YN20 of Fetal bra... 139 5e-30
189emb|CR593464.1| full-length cDNA clone CS0DF018YM13 of Fetal bra... 139 5e-30
190emb|CR593269.1| full-length cDNA clone CS0DF017YJ19 of Fetal bra... 139 5e-30
191emb|CR592535.1| full-length cDNA clone CS0DF020YG13 of Fetal bra... 139 5e-30
192emb|CR592791.1| full-length cDNA clone CS0DF033YO08 of Fetal bra... 139 5e-30
193emb|CR592610.1| full-length cDNA clone CS0DG007YG24 of B cells (... 139 5e-30
194emb|CR592245.1| full-length cDNA clone CS0DF025YG13 of Fetal bra... 139 5e-30
195emb|CR591503.1| full-length cDNA clone CS0DF031YG23 of Fetal bra... 139 5e-30
196emb|CR590783.1| full-length cDNA clone CS0DF011YL22 of Fetal bra... 139 5e-30
197emb|CR590708.1| full-length cDNA clone CS0DF008YA03 of Fetal bra... 139 5e-30
198emb|CR590351.1| full-length cDNA clone CS0DF015YL09 of Fetal bra... 139 5e-30
199emb|CR590075.1| full-length cDNA clone CS0DF024YN18 of Fetal bra... 139 5e-30
200dbj|AK223039.1| Homo sapiens mRNA for tubulin, beta, 4 variant, ... 139 5e-30
201dbj|AK058140.1| Homo sapiens cDNA FLJ25411 fis, clone TST03333, ... 139 5e-30
202emb|Y09741.1|HVBTUBI Hordeum vulgare mRNA for beta-tubulin 1 139 5e-30
203emb|AJ586806.1| Setaria viridis tub1 gene for beta tubulin, exon... 137 2e-29
204emb|X74655.1|ZMB4TUB Z.mays mRNA for beta 4 tubulin 133 3e-28
205gb|U76896.1|TAU76896 Triticum aestivum beta-tubulin 5 (Tubb5) mR... 133 3e-28
206gb|L10635.1|MZEBTUB4A Zea mays beta-4 tubulin (tub4) mRNA, compl... 133 3e-28
207dbj|AB169662.1| Macaca fascicularis brain cDNA, clone: QccE-1518... 131 1e-27
208dbj|AB125205.1| Macaca fascicularis TUBB4 mRNA for tubulin, beta... 131 1e-27
209gb|U76745.1|TAU76745 Triticum aestivum beta-tubulin 2 (tubb2) mR... 131 1e-27
210gb|AY382286.2| Physcomitrella patens beta-tubulin 6 (Tub6) gene,... 129 5e-27
211dbj|AB239681.1| Pyrus pyrifolia var. culta PsTUB-b2 mRNA for bet... 127 2e-26
212gb|DQ217182.1| Taeniopygia guttata clone 0058P0009G11 tubulin be... 123 3e-25
213gb|AY382287.1| Physcomitrella patens beta-tubulin 1 (Tub1) gene,... 123 3e-25
214gb|AY729818.1| Isochrysis galbana beta-tubulin gene, partial cds 123 3e-25
215gb|AY944863.1| Dissophora decumbens strain FSU801 clone 3 beta-t... 121 1e-24
216gb|BC111295.1| Bos taurus cDNA clone MGC:134115 IMAGE:8062346, c... 121 1e-24
217gb|AF030547.1|AF030547 Manduca sexta beta-1 tubulin mRNA, comple... 121 1e-24
218gb|BC101270.2| Homo sapiens tubulin, beta 8, mRNA (cDNA clone IM... 117 2e-23
219ref|NM_177987.1| Homo sapiens tubulin, beta 8 (TUBB8), mRNA 117 2e-23
220emb|CR626121.1| full-length cDNA clone CS0DG001YJ06 of B cells (... 117 2e-23
221emb|CR621858.1| full-length cDNA clone CS0DK003YK14 of HeLa cell... 117 2e-23
222emb|CR614889.1| full-length cDNA clone CS0DA005YB05 of Neuroblas... 117 2e-23
223emb|CR612709.1| full-length cDNA clone CS0DG007YM03 of B cells (... 117 2e-23
224emb|CR606225.1| full-length cDNA clone CS0DE004YD15 of Placenta ... 117 2e-23
225emb|CR605516.1| full-length cDNA clone CS0DM002YL01 of Fetal liv... 117 2e-23
226emb|CR603378.1| full-length cDNA clone CS0DF031YO21 of Fetal bra... 117 2e-23
227emb|CR603249.1| full-length cDNA clone CS0DE002YA12 of Placenta ... 117 2e-23
228emb|CR601851.1| full-length cDNA clone CS0DN002YJ23 of Adult bra... 117 2e-23
229emb|CR599052.1| full-length cDNA clone CS0DI014YN15 of Placenta ... 117 2e-23
230emb|CR592383.1| full-length cDNA clone CS0DF003YG14 of Fetal bra... 117 2e-23
231emb|CR592639.1| full-length cDNA clone CS0DF037YA21 of Fetal bra... 117 2e-23
232emb|CR592105.1| full-length cDNA clone CS0DI014YF15 of Placenta ... 117 2e-23
233emb|CR591556.1| full-length cDNA clone CS0DK009YJ04 of HeLa cell... 117 2e-23
234emb|CR590375.1| full-length cDNA clone CS0DF038YG05 of Fetal bra... 117 2e-23
235gb|AF482414.1| Heterocapsa triquetra beta-tubulin (btub2) mRNA, ... 117 2e-23
236gb|BC088749.1| Mus musculus tubulin, beta 3, mRNA (cDNA clone MG... 115 8e-23
237gb|AF459021.1| Rattus norvegicus neuron-specific class III beta-... 115 8e-23
238ref|NM_023279.2| Mus musculus tubulin, beta 3 (Tubb3), mRNA 115 8e-23
239gb|BC031357.1| Mus musculus tubulin, beta 3, mRNA (cDNA clone MG... 115 8e-23
240ref|NM_139254.1| Rattus norvegicus tubulin, beta 3 (Tubb3), mRNA 115 8e-23
241gb|BC097281.1| Rattus norvegicus tubulin, beta 3, mRNA (cDNA clo... 115 8e-23
242dbj|AK149014.1| Mus musculus 2 days neonate sympathetic ganglion... 115 8e-23
243dbj|AK051298.1| Mus musculus 12 days embryo spinal ganglion cDNA... 115 8e-23
244dbj|AK012528.1| Mus musculus 11 days embryo whole body cDNA, RIK... 115 8e-23
245dbj|AK082942.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 115 8e-23
246gb|AF312873.1|AF312873 Mus musculus tubulin beta-3 mRNA, complet... 115 8e-23
247ref|XM_579666.1| PREDICTED: Rattus norvegicus tubulin, beta 3 (T... 115 8e-23
248ref|XM_418971.1| PREDICTED: Gallus gallus similar to tubulin bet... 113 3e-22
249ref|XM_851157.1| PREDICTED: Canis familiaris similar to tubulin,... 113 3e-22
250ref|XM_843368.1| PREDICTED: Canis familiaris similar to tubulin,... 113 3e-22
251gb|AF092952.1|AF092952 Cyanophora paradoxa beta 1 tubulin (tubB1... 113 3e-22
252gb|M11442.1|CHKTUBB1 Chicken beta-1 tubulin gene, complete cds 113 3e-22
253gb|DQ450531.1| Bodo saltans alpha tubulin and beta tubulin genes... 111 1e-21
254gb|AF267188.1|AF267188 Reclinomonas americana clone 14 beta-tubu... 111 1e-21
255dbj|AB194979.1| Chrysochromulina sp. TKB79 btub gene for putativ... 111 1e-21
256gb|U76897.1|TAU76897 Triticum aestivum beta-tubulin 6 (Tubb6) mR... 111 1e-21
257gb|AF345947.1| Leishmania mexicana beta-tubulin mRNA, complete cds 111 1e-21
258ref|XM_529284.1| PREDICTED: Pan troglodytes LOC450251 (LOC450251... 109 5e-21
259gb|BC097977.1| Rattus norvegicus tubulin, beta 6, mRNA (cDNA clo... 109 5e-21
260ref|NM_001025675.1| Rattus norvegicus tubulin, beta 6 (Tubb6), mRNA 109 5e-21
261gb|BC039717.1| Homo sapiens mRNA similar to tubulin beta-5 (cDNA... 109 5e-21
262emb|X07011.1|GGCB7TUB Chicken mRNA for c(beta)7 tubulin 109 5e-21
263emb|CR616368.1| full-length cDNA clone CS0DF032YF04 of Fetal bra... 109 5e-21
264emb|CR614714.1| full-length cDNA clone CS0DE009YN18 of Placenta ... 109 5e-21
265emb|CR607214.1| full-length cDNA clone CS0DM013YJ18 of Fetal liv... 109 5e-21
266emb|CR605380.1| full-length cDNA clone CS0DI048YB17 of Placenta ... 109 5e-21
267emb|CR595733.1| full-length cDNA clone CS0DI013YI23 of Placenta ... 109 5e-21
268emb|CR593961.1| full-length cDNA clone CS0DI006YL18 of Placenta ... 109 5e-21
269emb|CR594370.1| full-length cDNA clone CS0DI069YN20 of Placenta ... 109 5e-21
270emb|CR593665.1| full-length cDNA clone CS0DI062YL07 of Placenta ... 109 5e-21
271dbj|AK001295.1| Homo sapiens cDNA FLJ10433 fis, clone NT2RP10004... 109 5e-21
272dbj|AK022340.1| Homo sapiens cDNA FLJ12278 fis, clone MAMMA10017... 109 5e-21
273ref|NM_032525.1| Homo sapiens tubulin, beta 6 (TUBB6), mRNA 109 5e-21
274dbj|AK098440.1| Homo sapiens cDNA FLJ25574 fis, clone JTH07516, ... 109 5e-21
275gb|BC002654.1| Homo sapiens tubulin, beta 6, mRNA (cDNA clone MG... 109 5e-21
276ref|NM_205315.1| Gallus gallus tubulin, beta (TUBB), mRNA 109 5e-21
277emb|CR726053.3|CNS0GN63 Tetraodon nigroviridis full-length cDNA 107 2e-20
278emb|CR665263.3|CNS0FCAD Tetraodon nigroviridis full-length cDNA 107 2e-20
279emb|Z67992.1|PPTUBB2MR Oomycete-like MacKay2000 TubB2 mRNA for b... 107 2e-20
280emb|X93567.1|LMBT2 L.major mRNA for beta-tubulin (1404bp) 107 2e-20
281gb|DQ080028.1| Trypanosoma danilewskyi beta-tubulin mRNA, comple... 105 7e-20
282gb|BC095770.1| Danio rerio zgc:112335, mRNA (cDNA clone MGC:1123... 105 7e-20
283ref|NM_001024422.1| Danio rerio zgc:112335 (zgc:112335), mRNA 105 7e-20
284gb|AY103542.1| Zea mays PCO095713 mRNA sequence 105 7e-20
285gb|BC105181.1| Bos taurus tubulin, beta 2A, mRNA (cDNA clone MGC... 103 3e-19
286ref|NM_001034663.1| Bos taurus tubulin, beta 2A (TUBB2A), mRNA 103 3e-19
287gb|AF267190.1|AF267190 Reclinomonas americana clone 22 beta-tubu... 103 3e-19
288gb|L10633.1|MZEBTUB6A Zea mays beta-6 tubulin (tub6) gene and mR... 103 3e-19
289ref|XM_512200.1| PREDICTED: Pan troglodytes similar to tubulin b... 101 1e-18
290ref|NM_146116.1| Mus musculus tubulin, beta 2c (Tubb2c), mRNA 100 5e-18
291gb|AY226059.1| Proterospongia sp. ATCC 50818 beta-tubulin mRNA, ... 100 5e-18
292ref|XR_003542.1| PREDICTED: Mus musculus similar to tubulin, bet... 100 5e-18
293ref|XM_906250.2| PREDICTED: Mus musculus similar to tubulin, bet... 100 5e-18
294gb|BC090334.1| Rattus norvegicus tubulin, beta 2c, mRNA (cDNA cl... 100 5e-18
295gb|BC060597.1| Rattus norvegicus tubulin, beta 2c, mRNA (cDNA cl... 100 5e-18
296ref|NM_199094.1| Rattus norvegicus tubulin, beta 2c (Tubb2c), mRNA 100 5e-18
297dbj|AK146587.1| Mus musculus cDNA, RIKEN full-length enriched li... 100 5e-18
298dbj|AK167022.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 100 5e-18
299dbj|AK076895.1| Mus musculus adult male testis cDNA, RIKEN full-... 100 5e-18
300dbj|AK015901.1| Mus musculus adult male testis cDNA, RIKEN full-... 100 5e-18
301gb|AC133936.5| Mus musculus BAC clone RP24-399H1 from chromosome... 100 5e-18
302gb|BC083319.1| Mus musculus tubulin, beta 2c, mRNA (cDNA clone M... 100 5e-18
303gb|BC022919.1| Mus musculus tubulin, beta 2c, mRNA (cDNA clone M... 100 5e-18
304gb|BC005547.1| Mus musculus tubulin, beta 2c, mRNA (cDNA clone M... 100 5e-18
305emb|Z67991.1|PPTUBB1GN P.purpurea TubB1 gene 98 2e-17
306emb|X60216.1|GMTUBB G.max mRNA for beta-tubulin, partial cds 98 2e-17
307gb|AY382289.1| Physcomitrella patens beta-tubulin 3 (Tub3) gene,... 98 2e-17
308dbj|AP004982.1| Lotus japonicus genomic DNA, chromosome 6, clone... 98 2e-17
309gb|AY766220.1| Phytophthora cactorum strain CBS108.09 beta-tubul... 96 7e-17
310gb|AY742902.1| Lolium perenne strain Nui beta-tubulin (tub1) gen... 96 7e-17
311ref|NM_001032813.1| Macaca mulatta beta-tubulin (LOC574113), mRNA 96 7e-17
312ref|XM_532060.2| PREDICTED: Canis familiaris similar to tubulin,... 96 7e-17
313ref|XM_851116.1| PREDICTED: Canis familiaris similar to tubulin,... 96 7e-17
314gb|AY026071.1| Monosiga brevicollis beta-tubulin mRNA, complete cds 96 7e-17
315gb|AF147880.1|AF147880 Macaca mulatta beta-tubulin mRNA, complet... 96 7e-17
316dbj|AK006924.1| Mus musculus adult male testis cDNA, RIKEN full-... 96 7e-17
317gb|AF267189.1|AF267189 Reclinomonas americana clone 18 beta-tubu... 96 7e-17
318gb|AF267187.1|AF267187 Reclinomonas americana clone 12 beta-tubu... 96 7e-17
319dbj|AP004970.1| Lotus japonicus genomic DNA, chromosome 5, clone... 96 7e-17
320ref|XM_851149.1| PREDICTED: Canis familiaris similar to tubulin,... 94 3e-16
321ref|XM_851105.1| PREDICTED: Canis familiaris similar to tubulin,... 94 3e-16
322ref|XM_851058.1| PREDICTED: Canis familiaris similar to tubulin,... 94 3e-16
323ref|XM_843350.1| PREDICTED: Canis familiaris similar to tubulin,... 94 3e-16
324emb|X78143.1|OSABTUB2 O.sativa (Arborio) Beta Tubulin mRNA, clon... 94 3e-16
325emb|CR625248.1| full-length cDNA clone CL0BB014ZE04 of Neuroblas... 94 3e-16
326emb|CR616909.1| full-length cDNA clone CS0DN002YM12 of Adult bra... 94 3e-16
327emb|CR594555.1| full-length cDNA clone CS0DK011YO14 of HeLa cell... 94 3e-16
328emb|CR593643.1| full-length cDNA clone CS0DK010YK13 of HeLa cell... 94 3e-16
329emb|CR591699.1| full-length cDNA clone CS0DF038YJ21 of Fetal bra... 94 3e-16
330ref|XM_932731.1| PREDICTED: Homo sapiens similar to tubulin, bet... 94 3e-16
331ref|XM_932725.1| PREDICTED: Homo sapiens similar to tubulin, bet... 94 3e-16
332ref|XM_928232.1| PREDICTED: Homo sapiens similar to tubulin, bet... 94 3e-16
333ref|XM_932717.1| PREDICTED: Homo sapiens similar to tubulin, bet... 94 3e-16
334ref|XM_941232.1| PREDICTED: Homo sapiens similar to Tubulin beta... 94 3e-16
335gb|U83110.1|HUMTUB4Q02 Human beta-tubulin (TUB4q) mRNA, complete... 94 3e-16
336gb|AF482424.1| Dinophyceae sp. CCMP421 beta-tubulin (btub) gene,... 94 3e-16
337dbj|AP003232.3| Oryza sativa (japonica cultivar-group) genomic D... 94 3e-16
338dbj|AK072502.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 3e-16
339dbj|D30716.1|RICBTA Oryza sativa (japonica cultivar-group) mRNA ... 94 3e-16
340gb|L19598.1|RICRTUB1X Rice beta-tubulin (RTUB-1) mRNA, complete cds 94 3e-16
341ref|NM_190985.1| Oryza sativa (japonica cultivar-group), predic... 92 1e-15
342gb|DQ450538.1| Trypanosoma cyclops beta tubulin gene, partial cd... 92 1e-15
343gb|DQ450535.1| Neobodo designis alpha tubulin and beta tubulin g... 92 1e-15
344emb|CR699204.2|CNS0G2GG Tetraodon nigroviridis full-length cDNA 92 1e-15
345emb|CR698864.1|CNS0G270 Tetraodon nigroviridis full-length cDNA 92 1e-15
346gb|BC049004.1| Xenopus laevis tubulin, beta 5, mRNA (cDNA clone ... 90 4e-15
347emb|CR685507.2|CNS0FRVZ Tetraodon nigroviridis full-length cDNA 90 4e-15
348gb|BC101272.2| Homo sapiens cDNA clone IMAGE:40024144, **** WARN... 90 4e-15
349emb|X60784.1|CGTUBB1 Cricetulus griseus (chinese hamster) mRNA f... 90 4e-15
350ref|NM_173102.1| Rattus norvegicus tubulin, beta 5 (Tubb5), mRNA 90 4e-15
351gb|U15444.1|XLU15444 Xenopus laevis beta 5 tubulin mRNA, complet... 90 4e-15
352dbj|AB011679.1| Rattus norvegicus mRNA for class I beta-tubulin,... 90 4e-15
353ref|XM_879940.1| PREDICTED: Bos taurus similar to tubulin, beta ... 88 2e-14
354ref|XM_879915.1| PREDICTED: Bos taurus similar to tubulin, beta ... 88 2e-14
355ref|XM_879890.1| PREDICTED: Bos taurus similar to tubulin, beta ... 88 2e-14
356ref|XM_879861.1| PREDICTED: Bos taurus similar to tubulin, beta ... 88 2e-14
357ref|XM_867208.1| PREDICTED: Bos taurus similar to tubulin, beta ... 88 2e-14
358ref|XM_849512.1| PREDICTED: Canis familiaris similar to tubulin,... 88 2e-14
359gb|BC085007.1| Homo sapiens cDNA clone IMAGE:6598943, **** WARNI... 88 2e-14
360gb|BC105401.1| Bos taurus similar to tubulin, beta 5, mRNA (cDNA... 88 2e-14
361emb|CR859552.1| Pongo pygmaeus mRNA; cDNA DKFZp459E2213 (from cl... 88 2e-14
362emb|CR615817.1| full-length cDNA clone CS0DH004YE22 of T cells (... 88 2e-14
363emb|CR626833.1| full-length cDNA clone CS0DI015YI08 of Placenta ... 88 2e-14
364emb|CR626769.1| full-length cDNA clone CS0DF009YL09 of Fetal bra... 88 2e-14
365emb|CR626734.1| full-length cDNA clone CS0DA005YC15 of Neuroblas... 88 2e-14
366emb|CR626716.1| full-length cDNA clone CS0DF008YF14 of Fetal bra... 88 2e-14
367emb|CR626650.1| full-length cDNA clone CS0DM006YN23 of Fetal liv... 88 2e-14
368emb|CR626396.1| full-length cDNA clone CS0DI041YJ05 of Placenta ... 88 2e-14
369emb|CR626370.1| full-length cDNA clone CS0DF014YM21 of Fetal bra... 88 2e-14
370emb|CR626264.1| full-length cDNA clone CS0DF015YH24 of Fetal bra... 88 2e-14
371emb|CR624775.1| full-length cDNA clone CS0DG004YK07 of B cells (... 88 2e-14
372emb|CR624717.1| full-length cDNA clone CS0DN004YA22 of Adult bra... 88 2e-14
373emb|CR625193.1| full-length cDNA clone CS0DI031YP06 of Placenta ... 88 2e-14
374emb|CR624579.1| full-length cDNA clone CS0DA007YF22 of Neuroblas... 88 2e-14
375emb|CR624578.1| full-length cDNA clone CS0DA007YF20 of Neuroblas... 88 2e-14
376emb|CR624565.1| full-length cDNA clone CS0DF015YI04 of Fetal bra... 88 2e-14
377emb|CR624306.1| full-length cDNA clone CS0DF028YF17 of Fetal bra... 88 2e-14
378emb|CR624075.1| full-length cDNA clone CS0DF009YC06 of Fetal bra... 88 2e-14
379emb|CR623850.1| full-length cDNA clone CS0DF005YO21 of Fetal bra... 88 2e-14
380emb|CR622219.1| full-length cDNA clone CS0DA009YA19 of Neuroblas... 88 2e-14
381emb|CR621916.1| full-length cDNA clone CS0DF022YK06 of Fetal bra... 88 2e-14
382emb|CR621812.1| full-length cDNA clone CS0DG005YI17 of B cells (... 88 2e-14
383emb|CR622048.1| full-length cDNA clone CS0DF035YI18 of Fetal bra... 88 2e-14
384emb|CR621493.1| full-length cDNA clone CS0DA011YN13 of Neuroblas... 88 2e-14
385emb|CR620403.1| full-length cDNA clone CS0DH004YK03 of T cells (... 88 2e-14
386emb|CR620946.1| full-length cDNA clone CS0DF004YC14 of Fetal bra... 88 2e-14
387emb|CR621356.1| full-length cDNA clone CS0DF012YO16 of Fetal bra... 88 2e-14
388emb|CR621201.1| full-length cDNA clone CS0DF032YL14 of Fetal bra... 88 2e-14
389emb|CR620764.1| full-length cDNA clone CS0DH003YL14 of T cells (... 88 2e-14
390emb|CR620727.1| full-length cDNA clone CS0DI001YL10 of Placenta ... 88 2e-14
391emb|CR620673.1| full-length cDNA clone CS0DF016YI07 of Fetal bra... 88 2e-14
392emb|CR620650.1| full-length cDNA clone CS0DF002YO01 of Fetal bra... 88 2e-14
393emb|CR620593.1| full-length cDNA clone CS0DF021YI19 of Fetal bra... 88 2e-14
394emb|CR620097.1| full-length cDNA clone CS0DG007YP14 of B cells (... 88 2e-14
395emb|CR619520.1| full-length cDNA clone CS0DF030YP24 of Fetal bra... 88 2e-14
396emb|CR619755.1| full-length cDNA clone CS0DG001YK16 of B cells (... 88 2e-14
397emb|CR619725.1| full-length cDNA clone CS0DF003YJ05 of Fetal bra... 88 2e-14
398emb|CR619635.1| full-length cDNA clone CS0DF020YI09 of Fetal bra... 88 2e-14
399emb|CR619202.1| full-length cDNA clone CS0DF038YJ09 of Fetal bra... 88 2e-14
400emb|CR618338.1| full-length cDNA clone CS0DF002YH19 of Fetal bra... 88 2e-14
401emb|CR618223.1| full-length cDNA clone CS0DF038YA18 of Fetal bra... 88 2e-14
402emb|CR618191.1| full-length cDNA clone CS0DF006YP13 of Fetal bra... 88 2e-14
403emb|CR618102.1| full-length cDNA clone CS0DA001YN02 of Neuroblas... 88 2e-14
404emb|CR617779.1| full-length cDNA clone CS0DF006YJ07 of Fetal bra... 88 2e-14
405emb|CR617680.1| full-length cDNA clone CS0DF015YL23 of Fetal bra... 88 2e-14
406emb|CR617649.1| full-length cDNA clone CS0CAP006YM16 of Thymus o... 88 2e-14
407emb|CR617269.1| full-length cDNA clone CS0DI041YL15 of Placenta ... 88 2e-14
408emb|CR617178.1| full-length cDNA clone CS0DF033YB22 of Fetal bra... 88 2e-14
409emb|CR617111.1| full-length cDNA clone CS0DE003YA20 of Placenta ... 88 2e-14
410emb|CR616894.1| full-length cDNA clone CS0DF001YA04 of Fetal bra... 88 2e-14
411emb|CR616650.1| full-length cDNA clone CS0DD003YH21 of Neuroblas... 88 2e-14
412emb|CR615486.1| full-length cDNA clone CS0DF019YG09 of Fetal bra... 88 2e-14
413emb|CR616207.1| full-length cDNA clone CS0DF033YF08 of Fetal bra... 88 2e-14
414emb|CR616066.1| full-length cDNA clone CS0DF027YE10 of Fetal bra... 88 2e-14
415emb|CR616054.1| full-length cDNA clone CS0DF026YF15 of Fetal bra... 88 2e-14
416emb|CR615318.1| full-length cDNA clone CS0DI039YO11 of Placenta ... 88 2e-14
417emb|CR615134.1| full-length cDNA clone CS0DF027YL08 of Fetal bra... 88 2e-14
418emb|CR615095.1| full-length cDNA clone CS0DF006YB15 of Fetal bra... 88 2e-14
419emb|CR614355.1| full-length cDNA clone CS0DF026YG10 of Fetal bra... 88 2e-14
420emb|CR614275.1| full-length cDNA clone CS0DA006YI13 of Neuroblas... 88 2e-14
421emb|CR613923.1| full-length cDNA clone CS0DG001YD03 of B cells (... 88 2e-14
422emb|CR613623.1| full-length cDNA clone CS0DF015YD21 of Fetal bra... 88 2e-14
423emb|CR613221.1| full-length cDNA clone CS0DF009YL15 of Fetal bra... 88 2e-14
424emb|CR613213.1| full-length cDNA clone CS0DF015YN08 of Fetal bra... 88 2e-14
425emb|CR613167.1| full-length cDNA clone CS0DA005YC20 of Neuroblas... 88 2e-14
426emb|CR612988.1| full-length cDNA clone CS0DF001YK04 of Fetal bra... 88 2e-14
427emb|CR612875.1| full-length cDNA clone CS0DF029YP12 of Fetal bra... 88 2e-14
428emb|CR612807.1| full-length cDNA clone CS0DF034YC14 of Fetal bra... 88 2e-14
429emb|CR612751.1| full-length cDNA clone CS0DF002YP03 of Fetal bra... 88 2e-14
430emb|CR612543.1| full-length cDNA clone CS0DA011YL01 of Neuroblas... 88 2e-14
431emb|CR612441.1| full-length cDNA clone CS0DA006YH15 of Neuroblas... 88 2e-14
432emb|CR612087.1| full-length cDNA clone CS0DF008YB21 of Fetal bra... 88 2e-14
433emb|CR611874.1| full-length cDNA clone CS0DF029YE04 of Fetal bra... 88 2e-14
434emb|CR611872.1| full-length cDNA clone CS0DA002YI12 of Neuroblas... 88 2e-14
435emb|CR610813.1| full-length cDNA clone CS0DF035YC20 of Fetal bra... 88 2e-14
436emb|CR610783.1| full-length cDNA clone CS0DF008YE16 of Fetal bra... 88 2e-14
437emb|CR611118.1| full-length cDNA clone CS0DF036YL05 of Fetal bra... 88 2e-14
438emb|CR611055.1| full-length cDNA clone CS0DF025YI02 of Fetal bra... 88 2e-14
439emb|CR611048.1| full-length cDNA clone CS0DF004YA24 of Fetal bra... 88 2e-14
440emb|CR610704.1| full-length cDNA clone CS0DF030YC20 of Fetal bra... 88 2e-14
441emb|CR610589.1| full-length cDNA clone CS0DM010YF19 of Fetal liv... 88 2e-14
442emb|CR609919.1| full-length cDNA clone CS0DK010YD12 of HeLa cell... 88 2e-14
443emb|CR609910.1| full-length cDNA clone CS0DF016YC05 of Fetal bra... 88 2e-14
444emb|CR609663.1| full-length cDNA clone CS0DF023YA06 of Fetal bra... 88 2e-14
445emb|CR609662.1| full-length cDNA clone CS0DF023YA07 of Fetal bra... 88 2e-14
446emb|CR608834.1| full-length cDNA clone CS0DF030YB09 of Fetal bra... 88 2e-14
447emb|CR607899.1| full-length cDNA clone CS0DF003YK18 of Fetal bra... 88 2e-14
448emb|CR608670.1| full-length cDNA clone CS0DF004YI03 of Fetal bra... 88 2e-14
449emb|CR608598.1| full-length cDNA clone CS0DF018YL09 of Fetal bra... 88 2e-14
450emb|CR608555.1| full-length cDNA clone CS0DG003YL10 of B cells (... 88 2e-14
451emb|CR607721.1| full-length cDNA clone CS0DF005YL07 of Fetal bra... 88 2e-14
452emb|CR607608.1| full-length cDNA clone CS0DF028YP18 of Fetal bra... 88 2e-14
453emb|CR607488.1| full-length cDNA clone CS0DF002YM23 of Fetal bra... 88 2e-14
454emb|CR607420.1| full-length cDNA clone CS0DF026YA21 of Fetal bra... 88 2e-14
455emb|CR607126.1| full-length cDNA clone CS0DG004YP18 of B cells (... 88 2e-14
456emb|CR607031.1| full-length cDNA clone CS0DG006YM15 of B cells (... 88 2e-14
457emb|CR604712.1| full-length cDNA clone CS0DF018YC02 of Fetal bra... 88 2e-14
458emb|CR606296.1| full-length cDNA clone CL0BB016ZH05 of Neuroblas... 88 2e-14
459emb|CR605898.1| full-length cDNA clone CS0DA003YN02 of Neuroblas... 88 2e-14
460emb|CR605815.1| full-length cDNA clone CL0BB018ZD09 of Neuroblas... 88 2e-14
461emb|CR605680.1| full-length cDNA clone CS0DF004YN02 of Fetal bra... 88 2e-14
462emb|CR605261.1| full-length cDNA clone CS0DI083YA23 of Placenta ... 88 2e-14
463emb|CR604912.1| full-length cDNA clone CS0DF032YE06 of Fetal bra... 88 2e-14
464emb|CR604797.1| full-length cDNA clone CS0DF008YJ17 of Fetal bra... 88 2e-14
465emb|CR604556.1| full-length cDNA clone CS0DF016YF23 of Fetal bra... 88 2e-14
466emb|CR604162.1| full-length cDNA clone CS0DG003YD06 of B cells (... 88 2e-14
467emb|CR603794.1| full-length cDNA clone CS0DF028YI20 of Fetal bra... 88 2e-14
468emb|CR603644.1| full-length cDNA clone CS0DF003YK20 of Fetal bra... 88 2e-14
469emb|CR603568.1| full-length cDNA clone CS0DF030YP07 of Fetal bra... 88 2e-14
470emb|CR603542.1| full-length cDNA clone CS0DF019YO01 of Fetal bra... 88 2e-14
471emb|CR603160.1| full-length cDNA clone CS0DG006YO22 of B cells (... 88 2e-14
472emb|CR603136.1| full-length cDNA clone CS0DF029YA05 of Fetal bra... 88 2e-14
473emb|CR602712.1| full-length cDNA clone CS0DA001YF12 of Neuroblas... 88 2e-14
474emb|CR602430.1| full-length cDNA clone CS0DF005YE10 of Fetal bra... 88 2e-14
475emb|CR602389.1| full-length cDNA clone CL0BB014ZC02 of Neuroblas... 88 2e-14
476emb|CR602045.1| full-length cDNA clone CS0DF033YA18 of Fetal bra... 88 2e-14
477emb|CR601668.1| full-length cDNA clone CS0DI039YO01 of Placenta ... 88 2e-14
478emb|CR601607.1| full-length cDNA clone CL0BB028ZC09 of Neuroblas... 88 2e-14
479emb|CR601589.1| full-length cDNA clone CS0DF036YD01 of Fetal bra... 88 2e-14
480emb|CR601344.1| full-length cDNA clone CS0DA008YC23 of Neuroblas... 88 2e-14
481emb|CR601013.1| full-length cDNA clone CL0BB014ZA01 of Neuroblas... 88 2e-14
482emb|CR600973.1| full-length cDNA clone CS0DF001YF22 of Fetal bra... 88 2e-14
483emb|CR600522.1| full-length cDNA clone CS0DF027YO20 of Fetal bra... 88 2e-14
484emb|CR600934.1| full-length cDNA clone CS0DA008YI01 of Neuroblas... 88 2e-14
485emb|CR600785.1| full-length cDNA clone CS0DF009YC16 of Fetal bra... 88 2e-14
486emb|CR599767.1| full-length cDNA clone CS0DF007YC07 of Fetal bra... 88 2e-14
487emb|CR599452.1| full-length cDNA clone CS0DF001YD20 of Fetal bra... 88 2e-14
488emb|CR599668.1| full-length cDNA clone CS0DF026YC03 of Fetal bra... 88 2e-14
489emb|CR599205.1| full-length cDNA clone CS0DF022YL12 of Fetal bra... 88 2e-14
490emb|CR599197.1| full-length cDNA clone CS0DG003YB13 of B cells (... 88 2e-14
491emb|CR599140.1| full-length cDNA clone CS0DF028YO21 of Fetal bra... 88 2e-14
492emb|CR598285.1| full-length cDNA clone CS0DG002YH21 of B cells (... 88 2e-14
493emb|CR598038.1| full-length cDNA clone CS0DF002YM07 of Fetal bra... 88 2e-14
494emb|CR597982.1| full-length cDNA clone CS0DF003YM12 of Fetal bra... 88 2e-14
495emb|CR597459.1| full-length cDNA clone CS0DF013YL15 of Fetal bra... 88 2e-14
496emb|CR597262.1| full-length cDNA clone CS0DF024YA20 of Fetal bra... 88 2e-14
497emb|CR596510.1| full-length cDNA clone CS0DF034YM13 of Fetal bra... 88 2e-14
498emb|CR596484.1| full-length cDNA clone CS0DF038YD09 of Fetal bra... 88 2e-14
499emb|CR596438.1| full-length cDNA clone CS0DF038YM11 of Fetal bra... 88 2e-14
500emb|CR596434.1| full-length cDNA clone CS0DF038YM18 of Fetal bra... 88 2e-14 
>gb|U76895.1|TAU76895 Triticum aestivum beta-tubulin 4 (Tubb4) mRNA, complete cds
          Length = 1866

 Score =  430 bits (217), Expect = e-117
 Identities = 226/229 (98%)
 Strand = Plus / Plus

                                                                       
Query: 51  acgatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaag 110
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 85  acgatgagggagatcctgcacatccagggcgggcagtgcgggaaccagatcggggccaag 144

                                                                       
Query: 111 ttctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggac 170
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 145 ttctgggaggtgatctgcgacgagcacgggatcgacgggacggggcgctacgcgggggac 204

                                                                       
Query: 171 tcggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttc 230
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 205 tcggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccggttc 264

                                                            
Query: 231 gtgccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 265 gtgccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 313



 Score = 46.1 bits (23), Expect = 0.059
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                 
Query: 9  ccccctcccccgcaaccaccacc 31
          |||||||||||||||||||||||
Sbjct: 20 ccccctcccccgcaaccaccacc 42
to top
>ref|NM_184995.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1695

 Score =  309 bits (156), Expect = 3e-81
 Identities = 207/224 (92%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 1   atgagggagatcctccacatccagggcgggcagtgcgggaaccagatcggggccaagttc 60

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||||||||||||||||| ||  | ||||  |||||||| |||||||||||||| 
Sbjct: 61  tgggaggtgatctgcgacgagcatggcgtggacgcgacggggcggtacgcgggggactcc 120

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||||||||||||||||||||||||||| ||||| ||  | | ||||
Sbjct: 121 gacctgcagctggagcggatcaacgtctactacaacgaggcgagcggcgggaggtacgtg 180

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 181 ccccgcgccgtgctcatggacctcgagcccgggaccatggactc 224
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  309 bits (156), Expect = 3e-81
 Identities = 207/224 (92%)
 Strand = Plus / Plus

                                                                            
Query: 54       atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
                |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 32067950 atgagggagatcctccacatccagggcgggcagtgcgggaaccagatcggggccaagttc 32068009

                                                                            
Query: 114      tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
                ||||||||||||||||||||||| ||  | ||||  |||||||| |||||||||||||| 
Sbjct: 32068010 tgggaggtgatctgcgacgagcatggcgtggacgcgacggggcggtacgcgggggactcc 32068069

                                                                            
Query: 174      gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
                ||||||||||||||||||||||||||||||||||||||||| ||||| ||  | | ||||
Sbjct: 32068070 gacctgcagctggagcggatcaacgtctactacaacgaggcgagcggcgggaggtacgtg 32068129

                                                            
Query: 234      ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
                |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 32068130 ccccgcgccgtgctcatggacctcgagcccgggaccatggactc 32068173



 Score =  224 bits (113), Expect = 1e-55
 Identities = 197/225 (87%)
 Strand = Plus / Plus

                                                                          
Query: 53     gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
              ||||||||||||||| ||||||||||| ||||| || |||||||||||||| ||||||||
Sbjct: 318433 gatgagggagatcctccacatccagggtgggcaatgcgggaaccagatcggcgccaagtt 318492

                                                                          
Query: 113    ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
              |||||||||| | ||||  |||||||||||||||| ||| ||||||||||  || |||||
Sbjct: 318493 ctgggaggtggtgtgcgcggagcacgggatcgacgccaccgggcgctacgacggcgactc 318552

                                                                          
Query: 173    ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
               |||||||||||||||||  ||||||| |||||||| ||||||  | | || ||||||||
Sbjct: 318553 cgacctgcagctggagcgcgtcaacgtgtactacaatgaggcctcctgcgggcgcttcgt 318612

                                                           
Query: 233    gccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
               || |||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 318613 cccgcgcgccgtgctcatggacctggagccgggcaccatggactc 318657



 Score =  141 bits (71), Expect = 1e-30
 Identities = 83/87 (95%)
 Strand = Plus / Plus

                                                                            
Query: 53       gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
                |||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||
Sbjct: 25656503 gatgagggagatcctgcacatccagggcgggcagtgcggcaaccagatcggcgccaagtt 25656562

                                           
Query: 113      ctgggaggtgatctgcgacgagcacgg 139
                ||||||||||||||||| |||||||||
Sbjct: 25656563 ctgggaggtgatctgcggcgagcacgg 25656589



 Score =  127 bits (64), Expect = 2e-26
 Identities = 91/100 (91%)
 Strand = Plus / Plus

                                                                            
Query: 179      gcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccg 238
                |||||| ||||||||||||||||||| ||||||||| ||||| ||||||  ||| || ||
Sbjct: 25656629 gcagctcgagcggatcaacgtctacttcaacgaggcgagcggcggccgccacgtcccgcg 25656688

                                                        
Query: 239      cgccgtgctcatggacctcgagcccggcaccatggactcg 278
                |||||||||||||||||||||||| |||||||||||||||
Sbjct: 25656689 cgccgtgctcatggacctcgagccgggcaccatggactcg 25656728
to top
>gb|AC084320.10| Oryza sativa chromosome 3 BAC OSJNBa0091J19 genomic sequence, complete
             sequence
          Length = 178158

 Score =  309 bits (156), Expect = 3e-81
 Identities = 207/224 (92%)
 Strand = Plus / Plus

                                                                         
Query: 54    atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
             |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 69075 atgagggagatcctccacatccagggcgggcagtgcgggaaccagatcggggccaagttc 69134

                                                                         
Query: 114   tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
             ||||||||||||||||||||||| ||  | ||||  |||||||| |||||||||||||| 
Sbjct: 69135 tgggaggtgatctgcgacgagcatggcgtggacgcgacggggcggtacgcgggggactcc 69194

                                                                         
Query: 174   gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
             ||||||||||||||||||||||||||||||||||||||||| ||||| ||  | | ||||
Sbjct: 69195 gacctgcagctggagcggatcaacgtctactacaacgaggcgagcggcgggaggtacgtg 69254

                                                         
Query: 234   ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
             |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 69255 ccccgcgccgtgctcatggacctcgagcccgggaccatggactc 69298
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  309 bits (156), Expect = 3e-81
 Identities = 207/224 (92%)
 Strand = Plus / Plus

                                                                            
Query: 54       atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
                |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 32158462 atgagggagatcctccacatccagggcgggcagtgcgggaaccagatcggggccaagttc 32158521

                                                                            
Query: 114      tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
                ||||||||||||||||||||||| ||  | ||||  |||||||| |||||||||||||| 
Sbjct: 32158522 tgggaggtgatctgcgacgagcatggcgtggacgcgacggggcggtacgcgggggactcc 32158581

                                                                            
Query: 174      gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
                ||||||||||||||||||||||||||||||||||||||||| ||||| ||  | | ||||
Sbjct: 32158582 gacctgcagctggagcggatcaacgtctactacaacgaggcgagcggcgggaggtacgtg 32158641

                                                            
Query: 234      ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
                |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 32158642 ccccgcgccgtgctcatggacctcgagcccgggaccatggactc 32158685



 Score =  224 bits (113), Expect = 1e-55
 Identities = 197/225 (87%)
 Strand = Plus / Plus

                                                                          
Query: 53     gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
              ||||||||||||||| ||||||||||| ||||| || |||||||||||||| ||||||||
Sbjct: 318431 gatgagggagatcctccacatccagggtgggcaatgcgggaaccagatcggcgccaagtt 318490

                                                                          
Query: 113    ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
              |||||||||| | ||||  |||||||||||||||| ||| ||||||||||  || |||||
Sbjct: 318491 ctgggaggtggtgtgcgcggagcacgggatcgacgccaccgggcgctacgacggcgactc 318550

                                                                          
Query: 173    ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
               |||||||||||||||||  ||||||| |||||||| ||||||  | | || ||||||||
Sbjct: 318551 cgacctgcagctggagcgcgtcaacgtgtactacaatgaggcctcctgcgggcgcttcgt 318610

                                                           
Query: 233    gccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
               || |||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 318611 cccgcgcgccgtgctcatggacctggagccgggcaccatggactc 318655



 Score =  141 bits (71), Expect = 1e-30
 Identities = 83/87 (95%)
 Strand = Plus / Plus

                                                                            
Query: 53       gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
                |||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||
Sbjct: 25747812 gatgagggagatcctgcacatccagggcgggcagtgcggcaaccagatcggcgccaagtt 25747871

                                           
Query: 113      ctgggaggtgatctgcgacgagcacgg 139
                ||||||||||||||||| |||||||||
Sbjct: 25747872 ctgggaggtgatctgcggcgagcacgg 25747898



 Score =  127 bits (64), Expect = 2e-26
 Identities = 91/100 (91%)
 Strand = Plus / Plus

                                                                            
Query: 179      gcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccg 238
                |||||| ||||||||||||||||||| ||||||||| ||||| ||||||  ||| || ||
Sbjct: 25747938 gcagctcgagcggatcaacgtctacttcaacgaggcgagcggcggccgccacgtcccgcg 25747997

                                                        
Query: 239      cgccgtgctcatggacctcgagcccggcaccatggactcg 278
                |||||||||||||||||||||||| |||||||||||||||
Sbjct: 25747998 cgccgtgctcatggacctcgagccgggcaccatggactcg 25748037
to top
>dbj|AK120180.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013033M18, full
           insert sequence
          Length = 1741

 Score =  309 bits (156), Expect = 3e-81
 Identities = 207/224 (92%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 118 atgagggagatcctccacatccagggcgggcagtgcgggaaccagatcggggccaagttc 177

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||||||||||||||||| ||  | ||||  |||||||| |||||||||||||| 
Sbjct: 178 tgggaggtgatctgcgacgagcatggcgtggacgcgacggggcggtacgcgggggactcc 237

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||||||||||||||||||||||||||| ||||| ||  | | ||||
Sbjct: 238 gacctgcagctggagcggatcaacgtctactacaacgaggcgagcggcgggaggtacgtg 297

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 298 ccccgcgccgtgctcatggacctcgagcccgggaccatggactc 341
to top
>dbj|D13224.1|RICBETAT Oryza sativa (japonica cultivar-group) mRNA for beta-tubulin,
           complete cds
          Length = 1854

 Score =  301 bits (152), Expect = 6e-79
 Identities = 206/224 (91%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 121 atgagggagatcctccacatccagggcgggcagtgcgggaaccagatcggggccaagttc 180

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||||||||||||||||| ||  | ||||  |||||||| |||||||||||||| 
Sbjct: 181 tgggaggtgatctgcgacgagcatggcgtggacgcgacggggcggtacgcgggggactcc 240

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||||||||||||||||||||||||||| ||||| ||  | | ||||
Sbjct: 241 gacctgcagctggagcggatcaacgtctactacaacgaggcgagcggcgggaggtacgtg 300

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           |||||| ||||||||||||||||||||||||| |||||||||||
Sbjct: 301 ccccgcaccgtgctcatggacctcgagcccgggaccatggactc 344
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  293 bits (148), Expect = 2e-76
 Identities = 205/224 (91%)
 Strand = Plus / Minus

                                                                            
Query: 54       atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
                |||||||||||||||||||||||||| || || || ||||||||||||||||||||||||
Sbjct: 27496379 atgagggagatcctgcacatccaggggggccaatgcgggaaccagatcggggccaagttc 27496320

                                                                            
Query: 114      tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
                |||||||||||||||||||||||||||||||||  ||| ||    ||| | || ||||| 
Sbjct: 27496319 tgggaggtgatctgcgacgagcacgggatcgaccacaccggcaagtactccggcgactcc 27496260

                                                                            
Query: 174      gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
                ||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||
Sbjct: 27496259 gacctccagctcgagcggatcaacgtctactacaacgaggccagcggcggccgctacgtg 27496200

                                                            
Query: 234      ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
                ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 27496199 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 27496156
to top
>dbj|AP005610.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0032M14
          Length = 146636

 Score =  293 bits (148), Expect = 2e-76
 Identities = 205/224 (91%)
 Strand = Plus / Minus

                                                                         
Query: 54    atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
             |||||||||||||||||||||||||| || || || ||||||||||||||||||||||||
Sbjct: 65937 atgagggagatcctgcacatccaggggggccaatgcgggaaccagatcggggccaagttc 65878

                                                                         
Query: 114   tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
             |||||||||||||||||||||||||||||||||  ||| ||    ||| | || ||||| 
Sbjct: 65877 tgggaggtgatctgcgacgagcacgggatcgaccacaccggcaagtactccggcgactcc 65818

                                                                         
Query: 174   gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
             ||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||
Sbjct: 65817 gacctccagctcgagcggatcaacgtctactacaacgaggccagcggcggccgctacgtg 65758

                                                         
Query: 234   ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
             ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 65757 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 65714
to top
>dbj|AP005192.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0485A07
          Length = 166397

 Score =  293 bits (148), Expect = 2e-76
 Identities = 205/224 (91%)
 Strand = Plus / Minus

                                                                          
Query: 54     atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
              |||||||||||||||||||||||||| || || || ||||||||||||||||||||||||
Sbjct: 115448 atgagggagatcctgcacatccaggggggccaatgcgggaaccagatcggggccaagttc 115389

                                                                          
Query: 114    tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
              |||||||||||||||||||||||||||||||||  ||| ||    ||| | || ||||| 
Sbjct: 115388 tgggaggtgatctgcgacgagcacgggatcgaccacaccggcaagtactccggcgactcc 115329

                                                                          
Query: 174    gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
              ||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||
Sbjct: 115328 gacctccagctcgagcggatcaacgtctactacaacgaggccagcggcggccgctacgtg 115269

                                                          
Query: 234    ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
              ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 115268 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 115225
to top
>dbj|AK069237.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023010B07, full
           insert sequence
          Length = 1800

 Score =  293 bits (148), Expect = 2e-76
 Identities = 205/224 (91%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||||||||||||||| || || || ||||||||||||||||||||||||
Sbjct: 95  atgagggagatcctgcacatccaggggggccaatgcgggaaccagatcggggccaagttc 154

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||||||||||||||||||||||||  ||| ||    ||| | || ||||| 
Sbjct: 155 tgggaggtgatctgcgacgagcacgggatcgaccacaccggcaagtactccggcgactcc 214

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||
Sbjct: 215 gacctccagctcgagcggatcaacgtctactacaacgaggccagcggcggccgctacgtg 274

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 318
to top
>ref|XM_464246.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1809

 Score =  281 bits (142), Expect = 6e-73
 Identities = 205/226 (90%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||
Sbjct: 74  atgagggagatcctgcacatccagggggggcaatgcgggaaccagatcggggccaagttc 133

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||||||||||||||||||||||||  ||| ||    ||| |||| ||||| 
Sbjct: 134 tgggaggtgatctgcgacgagcacgggatcgaccacaccggcaagtactcgggcgactcc 193

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| ||||||||||||||||||||||||||||||||||| ||| | ||||| 
Sbjct: 194 gacctccagctcgagcggatcaacgtctactacaacgaggccagcggcggcaggttcgtt 253

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           || |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 254 ccgcgcgccgtgctcatggacctcgagccgggcaccatggactcgg 299
to top
>emb|X79367.1|OSBETATU O.sativa mRNA for beta-tubulin
          Length = 1674

 Score =  281 bits (142), Expect = 6e-73
 Identities = 205/226 (90%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||
Sbjct: 40  atgagggagatcctgcacatccagggggggcaatgcgggaaccagatcggggccaagttc 99

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||||||||||||||||||||||||  ||| ||    ||| |||| ||||| 
Sbjct: 100 tgggaggtgatctgcgacgagcacgggatcgaccacaccggcaagtactcgggcgactcc 159

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| ||||||||||||||||||||||||||||||||||| ||| | ||||| 
Sbjct: 160 gacctccagctcgagcggatcaacgtctactacaacgaggccagcggcggcaggttcgtt 219

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           || |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 220 ccgcgcgccgtgctcatggacctcgagccgggcaccatggactcgg 265
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  281 bits (142), Expect = 6e-73
 Identities = 205/226 (90%)
 Strand = Plus / Plus

                                                                           
Query: 54      atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
               |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||
Sbjct: 3619909 atgagggagatcctgcacatccagggggggcaatgcgggaaccagatcggggccaagttc 3619968

                                                                           
Query: 114     tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
               |||||||||||||||||||||||||||||||||  ||| ||    ||| |||| ||||| 
Sbjct: 3619969 tgggaggtgatctgcgacgagcacgggatcgaccacaccggcaagtactcgggcgactcc 3620028

                                                                           
Query: 174     gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
               ||||| ||||| ||||||||||||||||||||||||||||||||||| ||| | ||||| 
Sbjct: 3620029 gacctccagctcgagcggatcaacgtctactacaacgaggccagcggcggcaggttcgtt 3620088

                                                             
Query: 234     ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
               || |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 3620089 ccgcgcgccgtgctcatggacctcgagccgggcaccatggactcgg 3620134
to top
>dbj|AP005804.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0085K21
          Length = 180714

 Score =  281 bits (142), Expect = 6e-73
 Identities = 205/226 (90%)
 Strand = Plus / Plus

                                                                          
Query: 54     atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
              |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||
Sbjct: 101199 atgagggagatcctgcacatccagggggggcaatgcgggaaccagatcggggccaagttc 101258

                                                                          
Query: 114    tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
              |||||||||||||||||||||||||||||||||  ||| ||    ||| |||| ||||| 
Sbjct: 101259 tgggaggtgatctgcgacgagcacgggatcgaccacaccggcaagtactcgggcgactcc 101318

                                                                          
Query: 174    gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
              ||||| ||||| ||||||||||||||||||||||||||||||||||| ||| | ||||| 
Sbjct: 101319 gacctccagctcgagcggatcaacgtctactacaacgaggccagcggcggcaggttcgtt 101378

                                                            
Query: 234    ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
              || |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 101379 ccgcgcgccgtgctcatggacctcgagccgggcaccatggactcgg 101424
to top
>dbj|AK121574.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033036C16, full
           insert sequence
          Length = 1809

 Score =  281 bits (142), Expect = 6e-73
 Identities = 205/226 (90%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||
Sbjct: 74  atgagggagatcctgcacatccagggggggcaatgcgggaaccagatcggggccaagttc 133

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||||||||||||||||||||||||  ||| ||    ||| |||| ||||| 
Sbjct: 134 tgggaggtgatctgcgacgagcacgggatcgaccacaccggcaagtactcgggcgactcc 193

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| ||||||||||||||||||||||||||||||||||| ||| | ||||| 
Sbjct: 194 gacctccagctcgagcggatcaacgtctactacaacgaggccagcggcggcaggttcgtt 253

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           || |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 254 ccgcgcgccgtgctcatggacctcgagccgggcaccatggactcgg 299
to top
>dbj|D30717.1|RICBTB Oryza sativa (japonica cultivar-group) mRNA for beta-tubulin,
           complete cds
          Length = 1668

 Score =  281 bits (142), Expect = 6e-73
 Identities = 205/226 (90%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||
Sbjct: 59  atgagggagatcctgcacatccagggggggcaatgcgggaaccagatcggggccaagttc 118

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||||||||||||||||||||||||  ||| ||    ||| |||| ||||| 
Sbjct: 119 tgggaggtgatctgcgacgagcacgggatcgaccacaccggcaagtactcgggcgactcc 178

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| ||||||||||||||||||||||||||||||||||| ||| | ||||| 
Sbjct: 179 gacctccagctcgagcggatcaacgtctactacaacgaggccagcggcggcaggttcgtt 238

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           || |||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 239 ccgcgcgccgtgctcatggacctcgagccgggcaccatggactcgg 284
to top
>gb|AF059287.1|AF059287 Eleusine indica beta-tubulin 1 (TUB1) mRNA, complete cds
          Length = 1677

 Score =  274 bits (138), Expect = 1e-70
 Identities = 204/226 (90%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           ||||| |||||||| |||||||||||||| ||||| || |||||||||||||||||||||
Sbjct: 70  atgagagagatcctccacatccagggcggccagtgcggcaaccagatcggggccaagttc 129

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||||||||||||||||| ||||||  ||| ||    ||||| || ||||| 
Sbjct: 130 tgggaggtgatctgcgacgagcacggcatcgaccacaccggcaagtacgccggcgactcc 189

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 190 gacctccagctcgagcgcatcaacgtctactacaacgaggccagcggcggccgcttcgtc 249

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           || |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 ccgcgcgccgtgctcatggacctcgagcccggcaccatggactcgg 295
to top
>gb|BT016750.1| Zea mays clone Contig583 mRNA sequence
          Length = 920

 Score =  262 bits (132), Expect = 5e-67
 Identities = 201/224 (89%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           ||||| |||||||| |||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 107 atgagagagatcctccacatccagggcgggcagtgcggtaaccagatcggggccaagttc 166

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||||| |||||||||||||| |||||   ||| ||    ||||| || ||||| 
Sbjct: 167 tgggaggtgatatgcgacgagcacggcatcgatcacaccggaaagtacgccggcgactcc 226

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 227 gacctccagctggagcgcatcaacgtctactacaacgaggccagcggcggccgcttcgtc 286

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           || |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 287 ccgcgcgccgtcctcatggacctcgagcccggcaccatggactc 330
to top
>gb|U76744.1|TAU76744 Triticum aestivum beta-tubulin 1 (tubb1) mRNA, complete cds
          Length = 1485

 Score =  260 bits (131), Expect = 2e-66
 Identities = 206/231 (89%)
 Strand = Plus / Plus

                                                                       
Query: 47  ggcgacgatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggc 106
           ||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
Sbjct: 81  ggcgaagatgagggagatcctgcacatccagggcgggcagtgcgggaaccagatcgggtc 140

                                                                       
Query: 107 caagttctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcggg 166
           |||||||||||||||| | |||||||||||||| ||||||  ||||||| | ||||  ||
Sbjct: 141 caagttctgggaggtggtgtgcgacgagcacggcatcgaccccacggggaggtacgtcgg 200

                                                                       
Query: 167 ggactcggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccg 226
              ||| |||||||||||||||||  |||||||||||||||||||||||    | |||||
Sbjct: 201 cacctccgacctgcagctggagcgcgtcaacgtctactacaacgaggcctcgtgcggccg 260

                                                              
Query: 227 cttcgtgccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||| ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 261 cttcgtgccgcgcgccgtgctcatggatctcgagcccggcaccatggactc 311
to top
>gb|L10634.1|MZEBTUB7A Zea mays beta-7 tubulin (tub7) mRNA, complete cds
          Length = 1583

 Score =  254 bits (128), Expect = 1e-64
 Identities = 200/224 (89%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           ||||| |||||||| |||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 10  atgagagagatcctccacatccagggcgggcagtgcggtaaccagatcggggccaagttc 69

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||||| |||||||||||||| ||||||  ||| ||    ||||| || ||||| 
Sbjct: 70  tgggaggtgatatgcgacgagcacggcatcgaccacaccggcaagtacgccggcgactcc 129

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 130 gacctccagctcgagcgcatcaacgtctactacaacgaggccagcggcggccgcttcgtc 189

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           || |||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 190 ccgcgcgccgtcctcatggacctcgagccaggcaccatggactc 233
to top
>emb|AJ586807.1| Setaria viridis tub2 gene for beta tubulin, exons 1-3
          Length = 1763

 Score =  252 bits (127), Expect = 5e-64
 Identities = 202/227 (88%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           ||||||||||||||| |||||||||||||||||||| || ||||||||||| ||||||||
Sbjct: 111 gatgagggagatccttcacatccagggcgggcagtgcggcaaccagatcggcgccaagtt 170

                                                                       
Query: 113 ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
           |||||||||| |||||| ||||||||| ||||||| ||| || |||||||  || |||||
Sbjct: 171 ctgggaggtggtctgcgccgagcacggcatcgacgccaccggccgctacggcggcgactc 230

                                                                       
Query: 173 ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
            ||||| ||||| |||||  |||||||||||||||||||||||  | | |||||||||||
Sbjct: 231 cgacctccagctcgagcgcgtcaacgtctactacaacgaggcctcctgcggccgcttcgt 290

                                                          
Query: 233 gccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           |||||||||||| ||||||||||||||||| || |||||||||||||
Sbjct: 291 gccccgcgccgtcctcatggacctcgagccggggaccatggactcgg 337
to top
>gb|AF059289.1|AF059289 Eleusine indica beta-tubulin 3 (TUB3) mRNA, complete cds
          Length = 1690

 Score =  246 bits (124), Expect = 3e-62
 Identities = 199/224 (88%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||| |||||||||||||| ||||| || ||||||||||| |||||||||
Sbjct: 93  atgagggagatcctccacatccagggcggccagtgcggcaaccagatcggagccaagttc 152

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||||||||||||||||| ||||||  ||| ||    ||||| || ||||| 
Sbjct: 153 tgggaggtgatctgcgacgagcacggcatcgaccacaccggcaagtacgcaggcgactcc 212

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| ||||| ||||| |||||||||||||||||| |||| |||||||| || 
Sbjct: 213 gacctccagctcgagcgcatcaatgtctactacaacgaggccggcggtggccgctttgtc 272

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 273 ccgcgcgccgtgctcatggacctcgagcccggcaccatggactc 316
to top
>gb|U76746.1|TAU76746 Triticum aestivum beta-tubulin 3 (tubb3) mRNA, complete cds
          Length = 1688

 Score =  246 bits (124), Expect = 3e-62
 Identities = 199/224 (88%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||||| |||||||||||||| ||||| || |||||||||||||||||||||
Sbjct: 69  atgagggaaatcctccacatccagggcggccagtgcggcaaccagatcggggccaagttc 128

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||||||||||||||||| ||||||   || ||    ||||| || ||||| 
Sbjct: 129 tgggaggtgatctgcgacgagcacggcatcgaccagaccggcaagtacgccggcgactcc 188

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| ||||| ||||||||||||||||||||||||||||| || |||||||||
Sbjct: 189 gacctccagctcgagcgcatcaacgtctactacaacgaggccagcggcggtcgcttcgtg 248

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||| ||||||||||||||||| || |||||||||||
Sbjct: 249 ccccgcgccgtcctcatggacctcgagccggggaccatggactc 292
to top
>emb|X52878.1|ZMB1TUB Maize gene for beta 1 tubulin
          Length = 2461

 Score =  238 bits (120), Expect = 8e-60
 Identities = 198/224 (88%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||| |||||||||||||| |||||||| ||||||||||| |||||||||
Sbjct: 551 atgagggagatcctccacatccagggcggccagtgtggcaaccagatcggtgccaagttc 610

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| ||| | ||||  |||||||| ||||||| ||| || |||||||  || ||||| 
Sbjct: 611 tgggaagtggtgtgcgcggagcacggcatcgacgccaccggccgctacggcggcgactcc 670

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||| |||||  |||||||||||||||||||||||    | ||||||||||||
Sbjct: 671 gacctgcagctcgagcgcgtcaacgtctactacaacgaggcctcgtgcggccgcttcgtg 730

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 731 ccccgcgccgtgctcatggacctagagcccggcaccatggactc 774
to top
>ref|NM_187707.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1344

 Score =  234 bits (118), Expect = 1e-58
 Identities = 196/222 (88%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
Sbjct: 1   atgagggagatcctgcacatccagggcgggcagtgtggcaaccagatcggctccaagttc 60

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||| |||||||||||||||| ||||||  ||| || |||||||  ||   ||| 
Sbjct: 61  tgggaggtggtctgcgacgagcacggcatcgaccccaccggccgctacgtcggcacctcc 120

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| |||||  |||||||||||||||| ||||||  | | ||||||||||||
Sbjct: 121 gacctccagctcgagcgcgtcaacgtctactacaatgaggcctcctgcggccgcttcgtg 180

                                                     
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           ||||||||||||||||||||||||||||| || |||||||||
Sbjct: 181 ccccgcgccgtgctcatggacctcgagccgggtaccatggac 222
to top
>emb|X74654.1|ZMB3TUB Z.mays mRNA for beta 3 tubulin
          Length = 1686

 Score =  234 bits (118), Expect = 1e-58
 Identities = 196/222 (88%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           |||||||||||||||||||||||||||||| ||||| || ||||||||||| ||||||||
Sbjct: 109 gatgagggagatcctgcacatccagggcggccagtgcggcaaccagatcggcgccaagtt 168

                                                                       
Query: 113 ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
           ||||||||| ||||||| |||||||||  |||||  ||||||  ||||| |||| | |||
Sbjct: 169 ctgggaggtcatctgcggcgagcacggcgtcgactccacgggatgctactcgggtgtctc 228

                                                                       
Query: 173 ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
               | |||||| |||||||||||||||||||||||||||||| | || ||||||| |||
Sbjct: 229 cccgcagcagctcgagcggatcaacgtctactacaacgaggccgggggcggccgctacgt 288

                                                     
Query: 233 gccccgcgccgtgctcatggacctcgagcccggcaccatgga 274
           |||||||||||||||||||||||| |||||||||||||||||
Sbjct: 289 gccccgcgccgtgctcatggacctggagcccggcaccatgga 330
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  234 bits (118), Expect = 1e-58
 Identities = 196/222 (88%)
 Strand = Plus / Minus

                                                                            
Query: 54       atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
                |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
Sbjct: 10100349 atgagggagatcctgcacatccagggcgggcagtgtggcaaccagatcggctccaagttc 10100290

                                                                            
Query: 114      tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
                ||||||||| |||||||||||||||| ||||||  ||| || |||||||  ||   ||| 
Sbjct: 10100289 tgggaggtggtctgcgacgagcacggcatcgaccccaccggccgctacgtcggcacctcc 10100230

                                                                            
Query: 174      gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
                ||||| ||||| |||||  |||||||||||||||| ||||||  | | ||||||||||||
Sbjct: 10100229 gacctccagctcgagcgcgtcaacgtctactacaatgaggcctcctgcggccgcttcgtg 10100170

                                                          
Query: 234      ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
                ||||||||||||||||||||||||||||| || |||||||||
Sbjct: 10100169 ccccgcgccgtgctcatggacctcgagccgggtaccatggac 10100128



 Score = 93.7 bits (47), Expect = 3e-16
 Identities = 179/223 (80%)
 Strand = Plus / Plus

                                                                            
Query: 53       gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
                |||||| ||||||||||||||||| |||||||| ||||| ||||||||||| ||||| ||
Sbjct: 34162160 gatgagagagatcctgcacatccaaggcgggcaatgtggcaaccagatcggtgccaaatt 34162219

                                                                            
Query: 113      ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
                |||||||||| | || || ||||| || || |||   || ||||| ||| | ||  ||||
Sbjct: 34162220 ctgggaggtggtgtgtgatgagcatggcattgaccctaccgggcggtacacaggcaactc 34162279

                                                                            
Query: 173      ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
                 || |||||| |||||||  |||| || |||||||| ||||||  | | || ||||| ||
Sbjct: 34162280 agatctgcagttggagcgtgtcaatgtgtactacaatgaggcctcctgcggtcgctttgt 34162339

                                                           
Query: 233      gccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
                ||| || || || ||||||||||| ||||| || || ||||||
Sbjct: 34162340 gcctcgtgctgttctcatggaccttgagcctggtactatggac 34162382
to top
>dbj|AP003631.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0581F09
          Length = 154248

 Score =  234 bits (118), Expect = 1e-58
 Identities = 196/222 (88%)
 Strand = Plus / Minus

                                                                         
Query: 54    atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
             |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
Sbjct: 47818 atgagggagatcctgcacatccagggcgggcagtgtggcaaccagatcggctccaagttc 47759

                                                                         
Query: 114   tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
             ||||||||| |||||||||||||||| ||||||  ||| || |||||||  ||   ||| 
Sbjct: 47758 tgggaggtggtctgcgacgagcacggcatcgaccccaccggccgctacgtcggcacctcc 47699

                                                                         
Query: 174   gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
             ||||| ||||| |||||  |||||||||||||||| ||||||  | | ||||||||||||
Sbjct: 47698 gacctccagctcgagcgcgtcaacgtctactacaatgaggcctcctgcggccgcttcgtg 47639

                                                       
Query: 234   ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
             ||||||||||||||||||||||||||||| || |||||||||
Sbjct: 47638 ccccgcgccgtgctcatggacctcgagccgggtaccatggac 47597
to top
>dbj|AK122127.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033132F08, full
           insert sequence
          Length = 1771

 Score =  234 bits (118), Expect = 1e-58
 Identities = 196/222 (88%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
Sbjct: 97  atgagggagatcctgcacatccagggcgggcagtgtggcaaccagatcggctccaagttc 156

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||| |||||||||||||||| ||||||  ||| || |||||||  ||   ||| 
Sbjct: 157 tgggaggtggtctgcgacgagcacggcatcgaccccaccggccgctacgtcggcacctcc 216

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| |||||  |||||||||||||||| ||||||  | | ||||||||||||
Sbjct: 217 gacctccagctcgagcgcgtcaacgtctactacaatgaggcctcctgcggccgcttcgtg 276

                                                     
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           ||||||||||||||||||||||||||||| || |||||||||
Sbjct: 277 ccccgcgccgtgctcatggacctcgagccgggtaccatggac 318
to top
>dbj|AK065323.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002P20, full
           insert sequence
          Length = 1712

 Score =  234 bits (118), Expect = 1e-58
 Identities = 196/222 (88%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
Sbjct: 97  atgagggagatcctgcacatccagggcgggcagtgtggcaaccagatcggctccaagttc 156

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||| |||||||||||||||| ||||||  ||| || |||||||  ||   ||| 
Sbjct: 157 tgggaggtggtctgcgacgagcacggcatcgaccccaccggccgctacgtcggcacctcc 216

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| |||||  |||||||||||||||| ||||||  | | ||||||||||||
Sbjct: 217 gacctccagctcgagcgcgtcaacgtctactacaatgaggcctcctgcggccgcttcgtg 276

                                                     
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           ||||||||||||||||||||||||||||| || |||||||||
Sbjct: 277 ccccgcgccgtgctcatggacctcgagccgggtaccatggac 318
to top
>gb|L33263.1|RICBTUBULI Oryza sativa beta-tubulin mRNA
          Length = 1652

 Score =  234 bits (118), Expect = 1e-58
 Identities = 195/220 (88%), Gaps = 3/220 (1%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||||||||||||||| || || || |||||| |||||||||||||||||
Sbjct: 155 atgagggagatcctgcacatccaggggggccaatgcgggaacaagatcggggccaagttc 214

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||||||||||||||||||||||||  ||| ||    ||| | || ||||| 
Sbjct: 215 tgggaggtgatctgcgacgagcacgggatcgaccacaccggcaagtactccggcgactcc 274

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctact---acaacgaggccagcgggggccgcttc 230
           ||||| ||||| | |||||||||||||||||   |||||||||||||||| || |||| |
Sbjct: 275 gacctccagctcgtgcggatcaacgtctactacaacaacgaggccagcggcggtcgctac 334

                                                   
Query: 231 gtgccccgcgccgtgctcatggacctcgagcccggcacca 270
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 335 gtgccccgcgccgtgctcatggacctcgagcccggcacca 374
to top
>dbj|AP003018.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0004B13
          Length = 142268

 Score =  234 bits (118), Expect = 1e-58
 Identities = 196/222 (88%)
 Strand = Plus / Minus

                                                                         
Query: 54    atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
             |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
Sbjct: 24948 atgagggagatcctgcacatccagggcgggcagtgtggcaaccagatcggctccaagttc 24889

                                                                         
Query: 114   tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
             ||||||||| |||||||||||||||| ||||||  ||| || |||||||  ||   ||| 
Sbjct: 24888 tgggaggtggtctgcgacgagcacggcatcgaccccaccggccgctacgtcggcacctcc 24829

                                                                         
Query: 174   gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
             ||||| ||||| |||||  |||||||||||||||| ||||||  | | ||||||||||||
Sbjct: 24828 gacctccagctcgagcgcgtcaacgtctactacaatgaggcctcctgcggccgcttcgtg 24769

                                                       
Query: 234   ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
             ||||||||||||||||||||||||||||| || |||||||||
Sbjct: 24768 ccccgcgccgtgctcatggacctcgagccgggtaccatggac 24727
to top
>gb|AC107224.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0009C08, complete sequence
          Length = 137033

 Score =  224 bits (113), Expect = 1e-55
 Identities = 197/225 (87%)
 Strand = Plus / Plus

                                                                         
Query: 53    gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
             ||||||||||||||| ||||||||||| ||||| || |||||||||||||| ||||||||
Sbjct: 45961 gatgagggagatcctccacatccagggtgggcaatgcgggaaccagatcggcgccaagtt 46020

                                                                         
Query: 113   ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
             |||||||||| | ||||  |||||||||||||||| ||| ||||||||||  || |||||
Sbjct: 46021 ctgggaggtggtgtgcgcggagcacgggatcgacgccaccgggcgctacgacggcgactc 46080

                                                                         
Query: 173   ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
              |||||||||||||||||  ||||||| |||||||| ||||||  | | || ||||||||
Sbjct: 46081 cgacctgcagctggagcgcgtcaacgtgtactacaatgaggcctcctgcgggcgcttcgt 46140

                                                          
Query: 233   gccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
              || |||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 46141 cccgcgcgccgtgctcatggacctggagccgggcaccatggactc 46185
to top
>ref|NM_187634.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1344

 Score =  222 bits (112), Expect = 5e-55
 Identities = 196/224 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||| ||||||||||| ||||| || |||||||||||||| |||||||||
Sbjct: 1   atgagggagatcctccacatccagggtgggcaatgcgggaaccagatcggcgccaagttc 60

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||| | ||||  |||||||||||||||| ||| ||||||||||  || ||||| 
Sbjct: 61  tgggaggtggtgtgcgcggagcacgggatcgacgccaccgggcgctacgacggcgactcc 120

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||||||  ||||||| |||||||| ||||||  | | || |||||||| 
Sbjct: 121 gacctgcagctggagcgcgtcaacgtgtactacaatgaggcctcctgcgggcgcttcgtc 180

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           || |||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 181 ccgcgcgccgtgctcatggacctggagccgggcaccatggactc 224
to top
>gb|AC130607.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0017D10,
             complete sequence
          Length = 149870

 Score =  208 bits (105), Expect = 7e-51
 Identities = 195/225 (86%)
 Strand = Plus / Plus

                                                                         
Query: 53    gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
             ||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||
Sbjct: 58750 gatgagggagatcttgcacatccagggcgggcagtgcgggaaccagatcgggtccaagtt 58809

                                                                         
Query: 113   ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
             |||||||||| | ||||||||||| || ||||||   |||||| | ||||| ||    ||
Sbjct: 58810 ctgggaggtggtgtgcgacgagcatggcatcgacccgacggggaggtacgccggcacgtc 58869

                                                                         
Query: 173   ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
             ||||||||||||||||||  | ||||||||||||||||||||     | ||||| |||||
Sbjct: 58870 ggacctgcagctggagcgcgtgaacgtctactacaacgaggcgtcgtgcggccggttcgt 58929

                                                          
Query: 233   gccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
             ||| |||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 58930 gccgcgcgccgtgctcatggacctggagccgggcaccatggactc 58974
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  208 bits (105), Expect = 7e-51
 Identities = 195/225 (86%)
 Strand = Plus / Plus

                                                                            
Query: 53       gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
                ||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||
Sbjct: 20060425 gatgagggagatcttgcacatccagggcgggcagtgcgggaaccagatcgggtccaagtt 20060484

                                                                            
Query: 113      ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
                |||||||||| | ||||||||||| || ||||||   |||||| | ||||| ||    ||
Sbjct: 20060485 ctgggaggtggtgtgcgacgagcatggcatcgacccgacggggaggtacgccggcacgtc 20060544

                                                                            
Query: 173      ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
                ||||||||||||||||||  | ||||||||||||||||||||     | ||||| |||||
Sbjct: 20060545 ggacctgcagctggagcgcgtgaacgtctactacaacgaggcgtcgtgcggccggttcgt 20060604

                                                             
Query: 233      gccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
                ||| |||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 20060605 gccgcgcgccgtgctcatggacctggagccgggcaccatggactc 20060649
to top
>dbj|AB104732.1| Oryza sativa (japonica cultivar-group) OsTUB6 mRNA for
           beta-tubulin, complete cds
          Length = 1479

 Score =  208 bits (105), Expect = 7e-51
 Identities = 195/225 (86%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           ||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||
Sbjct: 97  gatgagggagatcttgcacatccagggcgggcagtgcgggaaccagatcgggtccaagtt 156

                                                                       
Query: 113 ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
           |||||||||| | ||||||||||| || ||||||   |||||| | ||||| ||    ||
Sbjct: 157 ctgggaggtggtgtgcgacgagcatggcatcgacccgacggggaggtacgccggcacgtc 216

                                                                       
Query: 173 ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
           ||||||||||||||||||  | ||||||||||||||||||||     | ||||| |||||
Sbjct: 217 ggacctgcagctggagcgcgtgaacgtctactacaacgaggcgtcgtgcggccggttcgt 276

                                                        
Query: 233 gccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||| |||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 277 gccgcgcgccgtgctcatggacctggagccgggcaccatggactc 321
to top
>dbj|AK122099.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033125G10, full
           insert sequence
          Length = 1614

 Score =  208 bits (105), Expect = 7e-51
 Identities = 195/225 (86%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           ||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||||||
Sbjct: 90  gatgagggagatcttgcacatccagggcgggcagtgcgggaaccagatcgggtccaagtt 149

                                                                       
Query: 113 ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
           |||||||||| | ||||||||||| || ||||||   |||||| | ||||| ||    ||
Sbjct: 150 ctgggaggtggtgtgcgacgagcatggcatcgacccgacggggaggtacgccggcacgtc 209

                                                                       
Query: 173 ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
           ||||||||||||||||||  | ||||||||||||||||||||     | ||||| |||||
Sbjct: 210 ggacctgcagctggagcgcgtgaacgtctactacaacgaggcgtcgtgcggccggttcgt 269

                                                        
Query: 233 gccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||| |||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 270 gccgcgcgccgtgctcatggacctggagccgggcaccatggactc 314
to top
>gb|U22050.1|PCU22050 Phytophthora cinnamomi beta-tubulin gene, complete cds
          Length = 2220

 Score =  188 bits (95), Expect = 6e-45
 Identities = 182/211 (86%)
 Strand = Plus / Plus

                                                                       
Query: 69  cacatccagggcgggcagtgtgggaaccagatcggggccaagttctgggaggtgatctgc 128
           ||||||||||| || ||||| || ||||||||||| ||||||||||||||||| |||| |
Sbjct: 295 cacatccagggtggccagtgcggtaaccagatcggcgccaagttctgggaggtcatctcc 354

                                                                       
Query: 129 gacgagcacgggatcgacggcacggggcgctacgcgggggactcggacctgcagctggag 188
           |||||||||||  | |||   |||||   ||||   || |||||||||||||||||||||
Sbjct: 355 gacgagcacggcgtggacccgacgggatcctaccacggcgactcggacctgcagctggag 414

                                                                       
Query: 189 cggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccgcgccgtgctc 248
           || |||||||| ||||||||||||||||  || ||||||| ||||||||||||| | |||
Sbjct: 415 cgcatcaacgtgtactacaacgaggccacgggcggccgctacgtgccccgcgccatcctc 474

                                          
Query: 249 atggacctcgagcccggcaccatggactcgg 279
           |||||||| ||||||||||||||||||||||
Sbjct: 475 atggacctggagcccggcaccatggactcgg 505
to top
>emb|X52879.1|ZMB2TUBR Maize mRNA for beta 2 tubulin
          Length = 1579

 Score =  180 bits (91), Expect = 2e-42
 Identities = 190/223 (85%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           |||||||||||||||||| |||||||| |||||||| ||||||||||||||  |||||||
Sbjct: 89  gatgagggagatcctgcatatccagggagggcagtgcgggaaccagatcggctccaagtt 148

                                                                       
Query: 113 ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
           |||||||||| | ||||| |||||||| ||||||   |||||||| |||  ||||   ||
Sbjct: 149 ctgggaggtggtgtgcgatgagcacggcatcgacccgacggggcggtacatggggacgtc 208

                                                                       
Query: 173 ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
           |||| |||||||||||||  ||||||||||||||||||||||     | ||  | |||||
Sbjct: 209 ggacgtgcagctggagcgcgtcaacgtctactacaacgaggcttcatgtggtaggttcgt 268

                                                      
Query: 233 gccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           ||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 269 gccgcgcgcggtgctcatggaccttgagcccggcaccatggac 311
to top
>gb|AY110929.1| Zea mays CL2242_8 mRNA sequence
          Length = 1684

 Score =  180 bits (91), Expect = 2e-42
 Identities = 190/223 (85%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           |||||||||||||||||| |||||||| |||||||| ||||||||||||||  |||||||
Sbjct: 89  gatgagggagatcctgcatatccagggagggcagtgcgggaaccagatcggctccaagtt 148

                                                                       
Query: 113 ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
           |||||||||| | ||||| |||||||| ||||||   |||||||| |||  ||||   ||
Sbjct: 149 ctgggaggtggtgtgcgatgagcacggcatcgacccgacggggcggtacatggggacgtc 208

                                                                       
Query: 173 ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
           |||| |||||||||||||  ||||||||||||||||||||||     | ||  | |||||
Sbjct: 209 ggacgtgcagctggagcgcgtcaacgtctactacaacgaggcttcatgtggtaggttcgt 268

                                                      
Query: 233 gccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           ||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 269 gccgcgcgcggtgctcatggaccttgagcccggcaccatggac 311
to top
>gb|AF059290.1|AF059290 Eleusine indica beta-tubulin 4 (TUB4) mRNA, complete cds
          Length = 1741

 Score =  178 bits (90), Expect = 6e-42
 Identities = 189/222 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||||| ||||||||||| |||||||| || |||||||||||| ||||||||
Sbjct: 96  atgagggagatccttcacatccagggtgggcagtgcggtaaccagatcgggtccaagttc 155

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||  |||||||||||||||| ||||||   || || |||||||  ||   ||| 
Sbjct: 156 tgggaggttgtctgcgacgagcacggcatcgacccaaccggccgctacgtcggcacctcc 215

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| |||||  |||||||||||||||| ||||||    | || |||||||| 
Sbjct: 216 gaccttcagcttgagcgcgtcaacgtctactacaatgaggcctcatgcggtcgcttcgtc 275

                                                     
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           ||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 276 ccccgtgccgtgctcatggaccttgagcccggcaccatggac 317
to top
>gb|DQ217196.1| Taeniopygia guttata clone 0058P0025C05 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1259

 Score =  170 bits (86), Expect = 1e-39
 Identities = 191/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 42  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 101

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 102 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 161

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 162 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 221

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 222 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 267
to top
>gb|DQ217195.1| Taeniopygia guttata clone 0058P0057H05 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1255

 Score =  170 bits (86), Expect = 1e-39
 Identities = 191/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 176

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 236

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 237 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 282
to top
>gb|DQ217194.1| Taeniopygia guttata clone 0063P0007D06 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1467

 Score =  170 bits (86), Expect = 1e-39
 Identities = 191/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 176

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 236

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 237 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 282
to top
>gb|DQ217192.1| Taeniopygia guttata clone 0058P0058E06 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1255

 Score =  170 bits (86), Expect = 1e-39
 Identities = 191/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 176

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 236

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 237 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 282
to top
>gb|DQ217191.1| Taeniopygia guttata clone 0058P0048B01 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1255

 Score =  170 bits (86), Expect = 1e-39
 Identities = 191/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 176

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 236

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 237 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 282
to top
>gb|DQ217187.1| Taeniopygia guttata clone 0058P0053E12 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1257

 Score =  170 bits (86), Expect = 1e-39
 Identities = 191/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 44  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 103

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 104 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 163

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 164 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 223

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 224 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 269
to top
>gb|DQ217186.1| Taeniopygia guttata clone 0058P0032D04 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1520

 Score =  170 bits (86), Expect = 1e-39
 Identities = 191/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 176

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 236

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 237 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 282
to top
>gb|DQ217184.1| Taeniopygia guttata clone 0058P0057D03 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1257

 Score =  170 bits (86), Expect = 1e-39
 Identities = 191/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 58  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 117

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 118 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 177

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 178 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 237

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 238 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 283
to top
>gb|DQ217183.1| Taeniopygia guttata clone 0058P0030E11 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1256

 Score =  170 bits (86), Expect = 1e-39
 Identities = 191/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 176

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 236

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 237 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 282
to top
>gb|DQ217181.1| Taeniopygia guttata clone 0058P0029E09 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1256

 Score =  170 bits (86), Expect = 1e-39
 Identities = 191/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 176

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 236

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 237 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 282
to top
>gb|DQ217193.1| Taeniopygia guttata clone 0058P0055C09 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1260

 Score =  163 bits (82), Expect = 4e-37
 Identities = 190/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| || || |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaattggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 176

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 236

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 237 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 282
to top
>gb|DQ217190.1| Taeniopygia guttata clone 0058P0005H01 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1259

 Score =  163 bits (82), Expect = 4e-37
 Identities = 190/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| || || |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaattggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 176

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 236

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 237 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 282
to top
>gb|DQ217188.1| Taeniopygia guttata clone 0058P0005C05 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1259

 Score =  163 bits (82), Expect = 4e-37
 Identities = 190/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| || || |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaattggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 176

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 236

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 237 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 282
to top
>gb|DQ217185.1| Taeniopygia guttata clone 0058P0031E02 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1257

 Score =  163 bits (82), Expect = 4e-37
 Identities = 190/226 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   || |||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggcgacagc 176

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||||||||||||||| ||||| |||||||||||||||||||  || |||   | ||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggccacaggcggcaagtacgtg 236

                                                         
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactcgg 279
           ||||||||||||||  ||||||| ||||||||||||||||||||||
Sbjct: 237 ccccgcgccgtgctggtggacctggagcccggcaccatggactcgg 282
to top
>gb|BT016769.1| Zea mays clone Contig602 mRNA sequence
          Length = 906

 Score =  163 bits (82), Expect = 4e-37
 Identities = 187/222 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           ||||||||||| || ||||||||||| || ||||| || |||||||||||  ||||||||
Sbjct: 81  atgagggagattctccacatccagggtggacagtgcggcaaccagatcggttccaagttc 140

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||  ||||||||||||| || ||||||  ||| || ||||| |  ||   ||| 
Sbjct: 141 tgggaggtcgtctgcgacgagcatggtatcgaccccaccggacgctatgtcggcacctcc 200

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| |||||  |||| ||||||||||||||||||    | ||||||||||||
Sbjct: 201 gacctccagctcgagcgcgtcaatgtctactacaacgaggcctcatgcggccgcttcgtg 260

                                                     
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           || ||||| |||||||||||||||||||||||||||||||||
Sbjct: 261 ccgcgcgctgtgctcatggacctcgagcccggcaccatggac 302
to top
>gb|AY103690.1| Zea mays PCO144028 mRNA sequence
          Length = 1855

 Score =  155 bits (78), Expect = 9e-35
 Identities = 186/222 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           ||||||||||| || ||||||||||| || ||||| || |||||||||||  ||||||||
Sbjct: 227 atgagggagattctccacatccagggtggacagtgcggcaaccagatcggttccaagttc 286

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||  ||||||||||||| || ||||||  ||| || ||||| |  ||   ||| 
Sbjct: 287 tgggaggtcgtctgcgacgagcatggtatcgaccccaccggacgctatgtcggcacctcc 346

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| |||||  |||| ||||||||||||||||||    | ||||||||||||
Sbjct: 347 gacctccagctcgagcgcgtcaatgtctactacaacgaggcctcatgcggccgcttcgtg 406

                                                     
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           || ||||| |||||||||||||||||||| ||||||||||||
Sbjct: 407 ccgcgcgctgtgctcatggacctcgagcctggcaccatggac 448
to top
>gb|L10636.1|MZEBTUB8A Zea mays beta-8 tubulin (tub8) mRNA, complete cds
          Length = 1625

 Score =  155 bits (78), Expect = 9e-35
 Identities = 186/222 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           ||||||||||| || |||||||||||||| ||||| || |||||||||||  ||||||||
Sbjct: 76  atgagggagattctccacatccagggcggccagtgcggtaaccagatcggttccaagttc 135

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||  ||||||||||||| || |||||   ||| || ||||| |  ||   ||| 
Sbjct: 136 tgggaggtcgtctgcgacgagcatggtatcgatcccaccggacgctatgtcggcacctcc 195

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| |||||  |||| ||||||||||||||||||    | ||||||||||||
Sbjct: 196 gacctccagctcgagcgcgtcaatgtctactacaacgaggcctcatgcggccgcttcgtg 255

                                                     
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           ||| |||| |||||||||||||||||||| ||||||||||||
Sbjct: 256 cccggcgctgtgctcatggacctcgagcctggcaccatggac 297
to top
>gb|AF064849.1| Homo sapiens map 4q35 repeat region, complete sequence
          Length = 570

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 48  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 107

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 108 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 167

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 168 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 227

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 228 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 271
to top
>gb|BC071888.1| Homo sapiens cDNA clone IMAGE:3958193, **** WARNING: chimeric clone
           ****
          Length = 1933

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 425 atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 484

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 485 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 544

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 545 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 604

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 605 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 648
to top
>gb|AY167990.1| Homo sapiens class IVb beta tubulin mRNA, complete cds
          Length = 1338

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 1   atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 60

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 61  tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 120

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 121 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 180

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 181 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 224
to top
>emb|BX648521.1|HSM808669 Homo sapiens mRNA; cDNA DKFZp686F0685 (from clone DKFZp686F0685)
          Length = 2057

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 75  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 134

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 135 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 194

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 195 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 254

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 255 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 298
to top
>dbj|AK026167.1| Homo sapiens cDNA: FLJ22514 fis, clone HRC12119, highly similar to
           HSBT278 Homo sapiens mRNA for beta tubulin
          Length = 1579

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 74  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 133

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 134 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 193

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 194 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 253

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 254 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 297
to top
>dbj|AK000560.1| Homo sapiens cDNA FLJ20553 fis, clone KAT11806, highly similar to
           X79535 H
          Length = 1586

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 75  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 134

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 135 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 194

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 195 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 254

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 255 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 298
to top
>dbj|AK098686.1| Homo sapiens cDNA FLJ25820 fis, clone TST07642, highly similar to
           TUBULIN BETA-2 CHAIN
          Length = 1492

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 70  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 129

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 130 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 189

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 190 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 249

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 250 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 293
to top
>dbj|AK026609.1| Homo sapiens cDNA: FLJ22956 fis, clone KAT09938, highly similar to
           HSBT278 Homo sapiens mRNA for beta tubulin
          Length = 1579

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 75  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 134

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 135 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 194

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 195 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 254

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 255 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 298
to top
>dbj|AK026594.1| Homo sapiens cDNA: FLJ22941 fis, clone KAT08078, highly similar to
           HSBT278 Homo sapiens mRNA for beta tubulin
          Length = 1587

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 75  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 134

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 135 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 194

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 195 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 254

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 255 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 298
to top
>gb|BC029529.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:33915
           IMAGE:5274343), complete cds
          Length = 1579

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 75  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 134

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 135 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 194

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 195 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 254

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 255 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 298
to top
>gb|BC071889.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:88568
           IMAGE:4905049), complete cds
          Length = 1590

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 39  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 98

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 99  tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 158

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 159 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 218

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 219 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 262
to top
>gb|BC002783.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:4028
           IMAGE:3614023), complete cds
          Length = 1552

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 48  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 107

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 108 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 167

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 168 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 227

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 228 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 271
to top
>gb|BC039175.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:21910
           IMAGE:4385885), complete cds
          Length = 1551

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 48  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 107

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 108 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 167

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 168 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 227

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 228 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 271
to top
>gb|BC019829.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:29954
           IMAGE:5110038), complete cds
          Length = 1577

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 64  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 123

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 124 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 183

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 184 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 243

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 244 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 287
to top
>gb|BC002885.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:11278
           IMAGE:3944735), complete cds
          Length = 1560

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 45  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 104

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 105 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 164

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 165 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 224

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 225 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 268
to top
>gb|BC001911.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:2666
           IMAGE:3544236), complete cds
          Length = 1557

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 38  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 97

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 98  tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 157

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 158 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 217

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 218 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 261
to top
>gb|BC007889.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:14233
           IMAGE:4127195), complete cds
          Length = 1550

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 39  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 98

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 99  tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 158

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 159 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 218

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 219 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 262
to top
>gb|BC019359.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:13231
           IMAGE:4024979), complete cds
          Length = 1548

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 41  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 100

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 101 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 160

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 161 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 220

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 221 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 264
to top
>gb|BC024038.1| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:10845
           IMAGE:3616531), complete cds
          Length = 1544

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 39  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 98

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 99  tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 158

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 159 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 218

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 219 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 262
to top
>gb|BC012835.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:4826
           IMAGE:3603755), complete cds
          Length = 1568

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 50  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 110 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 169

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 170 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 229

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 230 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 273
to top
>gb|BC004188.2| Homo sapiens tubulin, beta 2C, mRNA (cDNA clone MGC:2826
           IMAGE:2964559), complete cds
          Length = 1568

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 50  atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 110 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 169

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 170 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 229

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 230 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 273
to top
>ref|NM_006088.5| Homo sapiens tubulin, beta 2C (TUBB2C), mRNA
          Length = 1591

 Score =  151 bits (76), Expect = 1e-33
 Identities = 187/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 103 atgagggaaatcgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 162

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 163 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 222

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 223 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 282

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 283 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 326
to top
>gb|AF095840.1|AF095840 Entosiphon sulcatum b-tubulin (tub-b) gene, complete cds
          Length = 1495

 Score =  147 bits (74), Expect = 2e-32
 Identities = 182/218 (83%)
 Strand = Plus / Plus

                                                                       
Query: 60  gagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttctgggag 119
           |||||| |||||||||||| ||| ||||| || |||||||||||  ||||||||||||||
Sbjct: 7   gagatcgtgcacatccaggccggccagtgcggcaaccagatcggctccaagttctgggag 66

                                                                       
Query: 120 gtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcggacctg 179
           ||||| | ||||||||| ||  |||||  ||| |||   |||  |||||| || ||||| 
Sbjct: 67  gtgatttccgacgagcatggcgtcgaccccaccgggacgtaccagggggattccgacctc 126

                                                                       
Query: 180 cagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccgc 239
           ||||| ||||| |||||||| |||||||||||||||| ||| |||||||  || ||||||
Sbjct: 127 cagctcgagcgcatcaacgtgtactacaacgaggccaccggcggccgctatgtcccccgc 186

                                                 
Query: 240 gccgtgctcatggacctcgagcccggcaccatggactc 277
           ||| | || |||||||| |||||||| |||||||||||
Sbjct: 187 gccatcctgatggacctggagcccggaaccatggactc 224
to top
>gb|AY729820.1| Pavlova lutheri beta-tubulin gene, partial cds
          Length = 1218

 Score =  145 bits (73), Expect = 9e-32
 Identities = 172/205 (83%)
 Strand = Plus / Plus

                                                                       
Query: 75  cagggcgggcagtgtgggaaccagatcggggccaagttctgggaggtgatctgcgacgag 134
           |||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||
Sbjct: 1   cagggcgggcagtgcgggaaccagatcggcgccaagttctgggaggtgatctccgacgag 60

                                                                       
Query: 135 cacgggatcgacggcacggggcgctacgcgggggactcggacctgcagctggagcggatc 194
           |||||  |||||   |||||   ||||   || || || ||||| ||||| ||||| |||
Sbjct: 61  cacggtgtcgacccgacgggcacctaccacggcgattccgacctccagctcgagcgcatc 120

                                                                       
Query: 195 aacgtctactacaacgaggccagcgggggccgcttcgtgccccgcgccgtgctcatggac 254
           |||||||||| ||||||||| |  || ||||||| |||||| |||||  | || ||||||
Sbjct: 121 aacgtctacttcaacgaggcgacgggcggccgctacgtgccgcgcgcgatcctgatggac 180

                                    
Query: 255 ctcgagcccggcaccatggactcgg 279
           |||||||| ||||| ||||||||||
Sbjct: 181 ctcgagccgggcacgatggactcgg 205
to top
>gb|M79341.1|ECRBTUBB Ectocarpus variabilis beta-tubulin mRNA, complete cds
          Length = 2379

 Score =  145 bits (73), Expect = 9e-32
 Identities = 157/185 (84%)
 Strand = Plus / Plus

                                                                       
Query: 93  aaccagatcggggccaagttctgggaggtgatctgcgacgagcacgggatcgacggcacg 152
           |||||||||||| |||||||||||||||| |||| ||| |||||||| ||||||  ||||
Sbjct: 75  aaccagatcgggtccaagttctgggaggtcatctccgatgagcacggcatcgaccccacg 134

                                                                       
Query: 153 gggcgctacgcgggggactcggacctgcagctggagcggatcaacgtctactacaacgag 212
           |||||||||   || ||||| ||||| ||||| ||||| ||||||  ||||| |||||||
Sbjct: 135 gggcgctaccacggcgactccgacctccagctcgagcgcatcaactgctacttcaacgag 194

                                                                       
Query: 213 gccagcgggggccgcttcgtgccccgcgccgtgctcatggacctcgagcccggcaccatg 272
           |||| || |||||| | ||| || |||||| | || ||||||||||||||||| ||||||
Sbjct: 195 gccaccgcgggccgatacgtcccgcgcgccatccttatggacctcgagcccggaaccatg 254

                
Query: 273 gactc 277
           |||||
Sbjct: 255 gactc 259
to top
>dbj|AK021414.1| Homo sapiens cDNA FLJ11352 fis, clone HEMBA1000020, highly similar
           to Homo sapiens beta 2 gene
          Length = 1424

 Score =  143 bits (72), Expect = 3e-31
 Identities = 186/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| | | ||||| | |||| ||||||||| || ||||| ||||| |||||||| 
Sbjct: 75  atgagggaaaacgtgcacttgcaggccgggcagtgcggcaaccaaatcggcgccaagttt 134

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||| |||||||| ||||||  ||||||   ||||   ||||||   
Sbjct: 135 tgggaggtgatcagcgatgagcacggcatcgaccccacgggcacctaccacggggacagc 194

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 195 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 254

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 255 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 298
to top
>emb|AL832497.1|HSM803805 Homo sapiens mRNA; cDNA DKFZp686J1451 (from clone DKFZp686J1451)
          Length = 1641

 Score =  143 bits (72), Expect = 3e-31
 Identities = 186/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||||||||||  || |||||||| ||||||||||| |||||||||
Sbjct: 136 atgagggaaatcgtgcacatccaggctggtcagtgtggcaaccagatcggtgccaagttc 195

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| | || || || || ||||||  ||| ||   ||||   ||||||   
Sbjct: 196 tgggaggtgatcagtgatgaacatggcatcgaccccaccggcacctaccacggggacagc 255

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           |||||||||||||| || |||||||| |||||||| ||||||| ||| |||   | ||||
Sbjct: 256 gacctgcagctggaacgcatcaacgtgtactacaatgaggccaccggcggcaagtacgtg 315

                                                       
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||||||||||| |||| || ||||||||||||||||||||
Sbjct: 316 ccccgcgccgtgctcgtggatctggagcccggcaccatggactc 359
to top
>gb|M21297.1|SOYSB2TUB Soybean (G.max L.) beta-tubulin (S-beta-2) gene, complete cds
          Length = 3070

 Score =  143 bits (72), Expect = 3e-31
 Identities = 180/216 (83%)
 Strand = Plus / Plus

                                                                       
Query: 60  gagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttctgggag 119
           |||| ||| |||||||| || || || || || ||||||||||| |||||||||||||||
Sbjct: 463 gagagccttcacatccaaggtggccaatgcggcaaccagatcggcgccaagttctgggag 522

                                                                       
Query: 120 gtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcggacctg 179
           ||| | ||||  |||||||||||||||  ||| ||  | ||||  |||||||| || || 
Sbjct: 523 gtggtttgcgcggagcacgggatcgaccccactggaaggtacggtggggactcagagctt 582

                                                                       
Query: 180 cagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccgc 239
           ||||| ||| ||||||| |||||||||||||| |||||| | ||||| ||||||| ||||
Sbjct: 583 cagctcgagaggatcaatgtctactacaacgaagccagctgcggccggttcgtgcgccgc 642

                                               
Query: 240 gccgtgctcatggacctcgagcccggcaccatggac 275
           || || |||||||||||||| || ||||||||||||
Sbjct: 643 gcggttctcatggacctcgaaccgggcaccatggac 678
to top
>ref|XM_469133.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1572

 Score =  141 bits (71), Expect = 1e-30
 Identities = 83/87 (95%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           |||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||
Sbjct: 120 gatgagggagatcctgcacatccagggcgggcagtgcggcaaccagatcggcgccaagtt 179

                                      
Query: 113 ctgggaggtgatctgcgacgagcacgg 139
           ||||||||||||||||| |||||||||
Sbjct: 180 ctgggaggtgatctgcggcgagcacgg 206



 Score =  127 bits (64), Expect = 2e-26
 Identities = 91/100 (91%)
 Strand = Plus / Plus

                                                                       
Query: 179 gcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccg 238
           |||||| ||||||||||||||||||| ||||||||| ||||| ||||||  ||| || ||
Sbjct: 246 gcagctcgagcggatcaacgtctacttcaacgaggcgagcggcggccgccacgtcccgcg 305

                                                   
Query: 239 cgccgtgctcatggacctcgagcccggcaccatggactcg 278
           |||||||||||||||||||||||| |||||||||||||||
Sbjct: 306 cgccgtgctcatggacctcgagccgggcaccatggactcg 345
to top
>gb|AC137991.3| Oryza sativa chromosome 3 BAC OSJNBa0034D21 genomic sequence, complete
              sequence
          Length = 190834

 Score =  141 bits (71), Expect = 1e-30
 Identities = 83/87 (95%)
 Strand = Plus / Minus

                                                                          
Query: 53     gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
              |||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||
Sbjct: 188389 gatgagggagatcctgcacatccagggcgggcagtgcggcaaccagatcggcgccaagtt 188330

                                         
Query: 113    ctgggaggtgatctgcgacgagcacgg 139
              ||||||||||||||||| |||||||||
Sbjct: 188329 ctgggaggtgatctgcggcgagcacgg 188303



 Score =  127 bits (64), Expect = 2e-26
 Identities = 91/100 (91%)
 Strand = Plus / Minus

                                                                          
Query: 179    gcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccg 238
              |||||| ||||||||||||||||||| ||||||||| ||||| ||||||  ||| || ||
Sbjct: 188263 gcagctcgagcggatcaacgtctacttcaacgaggcgagcggcggccgccacgtcccgcg 188204

                                                      
Query: 239    cgccgtgctcatggacctcgagcccggcaccatggactcg 278
              |||||||||||||||||||||||| |||||||||||||||
Sbjct: 188203 cgccgtgctcatggacctcgagccgggcaccatggactcg 188164
to top
>gb|AC139174.3| Oryza sativa chromosome 3 BAC OSJNBb0065L20 genomic sequence, complete
             sequence
          Length = 167427

 Score =  141 bits (71), Expect = 1e-30
 Identities = 83/87 (95%)
 Strand = Plus / Minus

                                                                         
Query: 53    gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
             |||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||
Sbjct: 45848 gatgagggagatcctgcacatccagggcgggcagtgcggcaaccagatcggcgccaagtt 45789

                                        
Query: 113   ctgggaggtgatctgcgacgagcacgg 139
             ||||||||||||||||| |||||||||
Sbjct: 45788 ctgggaggtgatctgcggcgagcacgg 45762



 Score =  127 bits (64), Expect = 2e-26
 Identities = 91/100 (91%)
 Strand = Plus / Minus

                                                                         
Query: 179   gcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccg 238
             |||||| ||||||||||||||||||| ||||||||| ||||| ||||||  ||| || ||
Sbjct: 45722 gcagctcgagcggatcaacgtctacttcaacgaggcgagcggcggccgccacgtcccgcg 45663

                                                     
Query: 239   cgccgtgctcatggacctcgagcccggcaccatggactcg 278
             |||||||||||||||||||||||| |||||||||||||||
Sbjct: 45662 cgccgtgctcatggacctcgagccgggcaccatggactcg 45623
to top
>gb|AY382291.2| Physcomitrella patens beta-tubulin 5 (Tub5) gene, complete cds
          Length = 3529

 Score =  141 bits (71), Expect = 1e-30
 Identities = 185/223 (82%)
 Strand = Plus / Plus

                                                                        
Query: 53   gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
            |||||| |||||||||||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 1834 gatgagagagatcctgcacattcaaggcgggcagtgcggaaaccagatcggagccaagtt 1893

                                                                        
Query: 113  ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
            |||||||||| | ||||| |||||||| ||||||  ||| ||   ||||  |||   |||
Sbjct: 1894 ctgggaggtggtgtgcgaggagcacggcatcgaccccaccggtacctacaagggcctctc 1953

                                                                        
Query: 173  ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
            |||  ||||||| ||||| ||||| || |||||||||||||||||||| ||||| | |||
Sbjct: 1954 ggatttgcagctcgagcgcatcaatgtgtactacaacgaggccagcggtggccgatacgt 2013

                                                       
Query: 233  gccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
            ||||||||| ||  | ||||| || ||||| || |||||||||
Sbjct: 2014 gccccgcgcggttttgatggatctggagcctggaaccatggac 2056
to top
>dbj|AB104733.1| Oryza sativa (japonica cultivar-group) OsTUB8 mRNA for
           beta-tubulin, complete cds
          Length = 1572

 Score =  141 bits (71), Expect = 1e-30
 Identities = 83/87 (95%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           |||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||
Sbjct: 120 gatgagggagatcctgcacatccagggcgggcagtgcggcaaccagatcggcgccaagtt 179

                                      
Query: 113 ctgggaggtgatctgcgacgagcacgg 139
           ||||||||||||||||| |||||||||
Sbjct: 180 ctgggaggtgatctgcggcgagcacgg 206



 Score =  127 bits (64), Expect = 2e-26
 Identities = 91/100 (91%)
 Strand = Plus / Plus

                                                                       
Query: 179 gcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccg 238
           |||||| ||||||||||||||||||| ||||||||| ||||| ||||||  ||| || ||
Sbjct: 246 gcagctcgagcggatcaacgtctacttcaacgaggcgagcggcggccgccacgtcccgcg 305

                                                   
Query: 239 cgccgtgctcatggacctcgagcccggcaccatggactcg 278
           |||||||||||||||||||||||| |||||||||||||||
Sbjct: 306 cgccgtgctcatggacctcgagccgggcaccatggactcg 345
to top
>dbj|AK121321.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023114E06, full
           insert sequence
          Length = 1740

 Score =  141 bits (71), Expect = 1e-30
 Identities = 83/87 (95%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           |||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||
Sbjct: 121 gatgagggagatcctgcacatccagggcgggcagtgcggcaaccagatcggcgccaagtt 180

                                      
Query: 113 ctgggaggtgatctgcgacgagcacgg 139
           ||||||||||||||||| |||||||||
Sbjct: 181 ctgggaggtgatctgcggcgagcacgg 207



 Score =  127 bits (64), Expect = 2e-26
 Identities = 91/100 (91%)
 Strand = Plus / Plus

                                                                       
Query: 179 gcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccg 238
           |||||| ||||||||||||||||||| ||||||||| ||||| ||||||  ||| || ||
Sbjct: 247 gcagctcgagcggatcaacgtctacttcaacgaggcgagcggcggccgccacgtcccgcg 306

                                                   
Query: 239 cgccgtgctcatggacctcgagcccggcaccatggactcg 278
           |||||||||||||||||||||||| |||||||||||||||
Sbjct: 307 cgccgtgctcatggacctcgagccgggcaccatggactcg 346
to top
>gb|BC000748.2| Homo sapiens tubulin, beta 3, mRNA (cDNA clone MGC:2411
           IMAGE:2823044), complete cds
          Length = 1720

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>gb|BC003021.1| Homo sapiens tubulin, beta 3, mRNA (cDNA clone MGC:4055
           IMAGE:2823044), complete cds
          Length = 1720

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>ref|NM_006086.2| Homo sapiens tubulin, beta 3 (TUBB3), mRNA
          Length = 1736

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 66  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 125

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 126 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 185

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 186 gacttgcagctggagcggatcagcgtctactacaacgaggcc 227
to top
>gb|BC064975.1| Homo sapiens tubulin, beta 3, mRNA (cDNA clone IMAGE:6152050), with
           apparent retained intron
          Length = 951

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 27  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 86

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 87  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 146

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 147 gacttgcagctggagcggatcagcgtctactacaacgaggcc 188
to top
>emb|X74656.1|ZMB5TUB Z.mays mRNA for beta 5 tubulin
          Length = 1671

 Score =  139 bits (70), Expect = 5e-30
 Identities = 184/222 (82%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           ||||||||||| || |||||||||||||| ||||| || |||||||||||  | || |||
Sbjct: 64  atgagggagattctccacatccagggcggccagtgcggcaaccagatcggttcaaaattc 123

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||  ||||||||||||| || |||||   ||| || ||||| |  ||   ||| 
Sbjct: 124 tgggaggtcgtctgcgacgagcatggtatcgatcccaccggacgctatgtcggcacctcc 183

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||||| ||||| |||||  |||| ||||||||||||||||||    | ||||||||||||
Sbjct: 184 gacctccagctcgagcgcgtcaatgtctactacaacgaggcctcatgcggccgcttcgtg 243

                                                     
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           || ||||| |||||||||||||||||||| ||||||||||||
Sbjct: 244 ccgcgcgctgtgctcatggacctcgagcctggcaccatggac 285
to top
>emb|CR615967.1| full-length cDNA clone CS0DF038YF01 of Fetal brain of Homo sapiens
           (human)
          Length = 1652

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR615850.1| full-length cDNA clone CS0DJ007YO19 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1657

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR615754.1| full-length cDNA clone CS0DF010YP09 of Fetal brain of Homo sapiens
           (human)
          Length = 1677

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 39  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 98

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 99  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 158

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 159 gacttgcagctggagcggatcagcgtctactacaacgaggcc 200
to top
>emb|CR625914.1| full-length cDNA clone CS0DN002YB01 of Adult brain of Homo sapiens
           (human)
          Length = 1060

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR625315.1| full-length cDNA clone CS0DF005YP01 of Fetal brain of Homo sapiens
           (human)
          Length = 1673

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR625137.1| full-length cDNA clone CS0DF011YI10 of Fetal brain of Homo sapiens
           (human)
          Length = 1685

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR624879.1| full-length cDNA clone CS0DF012YA22 of Fetal brain of Homo sapiens
           (human)
          Length = 1657

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR624252.1| full-length cDNA clone CS0DF009YA20 of Fetal brain of Homo sapiens
           (human)
          Length = 1572

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR624149.1| full-length cDNA clone CS0DF009YJ19 of Fetal brain of Homo sapiens
           (human)
          Length = 1629

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 24  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 83

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 84  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 143

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 144 gacttgcagctggagcggatcagcgtctactacaacgaggcc 185
to top
>emb|CR623719.1| full-length cDNA clone CS0DG005YH11 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1675

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 48  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 107

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 108 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 167

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 168 gacttgcagctggagcggatcagcgtctactacaacgaggcc 209
to top
>emb|CR623384.1| full-length cDNA clone CS0DF036YB17 of Fetal brain of Homo sapiens
           (human)
          Length = 1664

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 39  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 98

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 99  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 158

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 159 gacttgcagctggagcggatcagcgtctactacaacgaggcc 200
to top
>emb|CR623379.1| full-length cDNA clone CS0DF036YB10 of Fetal brain of Homo sapiens
           (human)
          Length = 1674

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 36  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 95

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 96  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 155

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 156 gacttgcagctggagcggatcagcgtctactacaacgaggcc 197
to top
>emb|CR623445.1| full-length cDNA clone CS0DF005YB15 of Fetal brain of Homo sapiens
           (human)
          Length = 1676

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 38  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 97

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 98  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 157

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 158 gacttgcagctggagcggatcagcgtctactacaacgaggcc 199
to top
>emb|CR621602.1| full-length cDNA clone CS0DF001YC21 of Fetal brain of Homo sapiens
           (human)
          Length = 1678

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR622839.1| full-length cDNA clone CS0DF026YC19 of Fetal brain of Homo sapiens
           (human)
          Length = 1621

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR622759.1| full-length cDNA clone CS0DF014YK24 of Fetal brain of Homo sapiens
           (human)
          Length = 1637

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 28  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 87

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 88  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 147

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 148 gacttgcagctggagcggatcagcgtctactacaacgaggcc 189
to top
>emb|CR622595.1| full-length cDNA clone CS0DN001YL23 of Adult brain of Homo sapiens
           (human)
          Length = 1628

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR620404.1| full-length cDNA clone CS0DF031YK19 of Fetal brain of Homo sapiens
           (human)
          Length = 1673

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR619439.1| full-length cDNA clone CS0DG003YA16 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1634

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR619366.1| full-length cDNA clone CS0DF014YG24 of Fetal brain of Homo sapiens
           (human)
          Length = 1688

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR618719.1| full-length cDNA clone CS0DF021YA06 of Fetal brain of Homo sapiens
           (human)
          Length = 1662

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR618148.1| full-length cDNA clone CS0DF037YN17 of Fetal brain of Homo sapiens
           (human)
          Length = 1652

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR617704.1| full-length cDNA clone CS0DF038YG23 of Fetal brain of Homo sapiens
           (human)
          Length = 1670

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR617597.1| full-length cDNA clone CS0DF010YP23 of Fetal brain of Homo sapiens
           (human)
          Length = 1693

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR616697.1| full-length cDNA clone CS0DA002YC18 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1684

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR615487.1| full-length cDNA clone CS0DF013YI09 of Fetal brain of Homo sapiens
           (human)
          Length = 1668

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR615484.1| full-length cDNA clone CS0DF019YG07 of Fetal brain of Homo sapiens
           (human)
          Length = 1611

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR614854.1| full-length cDNA clone CS0DF007YO04 of Fetal brain of Homo sapiens
           (human)
          Length = 1596

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 39  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 98

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 99  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 158

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 159 gacttgcagctggagcggatcagcgtctactacaacgaggcc 200
to top
>emb|CR614638.1| full-length cDNA clone CS0DA003YC13 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1557

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR614385.1| full-length cDNA clone CS0DF007YJ03 of Fetal brain of Homo sapiens
           (human)
          Length = 1673

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 53  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 112

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 113 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 172

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 173 gacttgcagctggagcggatcagcgtctactacaacgaggcc 214
to top
>emb|CR614150.1| full-length cDNA clone CS0DF015YJ10 of Fetal brain of Homo sapiens
           (human)
          Length = 1661

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 38  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 97

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 98  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 157

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 158 gacttgcagctggagcggatcagcgtctactacaacgaggcc 199
to top
>emb|CR613956.1| full-length cDNA clone CS0DG004YH19 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1687

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR609561.1| full-length cDNA clone CS0DG006YC09 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1673

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 45  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 104

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 105 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 164

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 165 gacttgcagctggagcggatcagcgtctactacaacgaggcc 206
to top
>emb|CR613333.1| full-length cDNA clone CS0DF011YA14 of Fetal brain of Homo sapiens
           (human)
          Length = 1676

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR613212.1| full-length cDNA clone CS0DF015YN09 of Fetal brain of Homo sapiens
           (human)
          Length = 1654

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR612703.1| full-length cDNA clone CS0DF037YH20 of Fetal brain of Homo sapiens
           (human)
          Length = 1640

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 17  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 76

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 77  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 136

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 137 gacttgcagctggagcggatcagcgtctactacaacgaggcc 178
to top
>emb|CR612113.1| full-length cDNA clone CS0DF036YH23 of Fetal brain of Homo sapiens
           (human)
          Length = 1671

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR611692.1| full-length cDNA clone CS0DF009YI18 of Fetal brain of Homo sapiens
           (human)
          Length = 1553

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR611346.1| full-length cDNA clone CS0DF008YG23 of Fetal brain of Homo sapiens
           (human)
          Length = 1661

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 39  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 98

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 99  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 158

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 159 gacttgcagctggagcggatcagcgtctactacaacgaggcc 200
to top
>emb|CR610945.1| full-length cDNA clone CS0DA008YC09 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1658

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 36  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 95

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 96  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 155

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 156 gacttgcagctggagcggatcagcgtctactacaacgaggcc 197
to top
>emb|CR610920.1| full-length cDNA clone CS0DF013YA15 of Fetal brain of Homo sapiens
           (human)
          Length = 1685

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR610428.1| full-length cDNA clone CS0DF001YP17 of Fetal brain of Homo sapiens
           (human)
          Length = 1651

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR609931.1| full-length cDNA clone CS0DF014YG03 of Fetal brain of Homo sapiens
           (human)
          Length = 1691

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR609873.1| full-length cDNA clone CS0DF009YH14 of Fetal brain of Homo sapiens
           (human)
          Length = 1657

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR609372.1| full-length cDNA clone CS0DF002YL02 of Fetal brain of Homo sapiens
           (human)
          Length = 1654

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 30  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 89

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 90  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 149

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 150 gacttgcagctggagcggatcagcgtctactacaacgaggcc 191
to top
>emb|CR609285.1| full-length cDNA clone CS0DF030YE09 of Fetal brain of Homo sapiens
           (human)
          Length = 1660

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 48  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 107

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 108 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 167

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 168 gacttgcagctggagcggatcagcgtctactacaacgaggcc 209
to top
>emb|CR609278.1| full-length cDNA clone CS0DF007YC21 of Fetal brain of Homo sapiens
           (human)
          Length = 1658

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 36  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 95

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 96  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 155

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 156 gacttgcagctggagcggatcagcgtctactacaacgaggcc 197
to top
>emb|CR607915.1| full-length cDNA clone CS0DF038YE04 of Fetal brain of Homo sapiens
           (human)
          Length = 1657

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR607807.1| full-length cDNA clone CS0DF030YI19 of Fetal brain of Homo sapiens
           (human)
          Length = 1661

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR608519.1| full-length cDNA clone CS0DF026YL16 of Fetal brain of Homo sapiens
           (human)
          Length = 1680

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR604723.1| full-length cDNA clone CS0DF026YA06 of Fetal brain of Homo sapiens
           (human)
          Length = 1654

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR604583.1| full-length cDNA clone CS0DF003YG20 of Fetal brain of Homo sapiens
           (human)
          Length = 1635

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR605022.1| full-length cDNA clone CS0DF016YA20 of Fetal brain of Homo sapiens
           (human)
          Length = 1644

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR605928.1| full-length cDNA clone CS0DF006YM22 of Fetal brain of Homo sapiens
           (human)
          Length = 1689

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 45  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 104

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 105 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 164

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 165 gacttgcagctggagcggatcagcgtctactacaacgaggcc 206
to top
>emb|CR605372.1| full-length cDNA clone CS0DF021YG18 of Fetal brain of Homo sapiens
           (human)
          Length = 1672

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR605687.1| full-length cDNA clone CS0DF017YL06 of Fetal brain of Homo sapiens
           (human)
          Length = 1676

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 43  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 102

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 103 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 162

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 163 gacttgcagctggagcggatcagcgtctactacaacgaggcc 204
to top
>emb|CR605618.1| full-length cDNA clone CS0DF004YP17 of Fetal brain of Homo sapiens
           (human)
          Length = 1671

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR605315.1| full-length cDNA clone CS0DF008YL08 of Fetal brain of Homo sapiens
           (human)
          Length = 1512

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR604865.1| full-length cDNA clone CS0DF006YI05 of Fetal brain of Homo sapiens
           (human)
          Length = 1676

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR604211.1| full-length cDNA clone CS0DF001YA09 of Fetal brain of Homo sapiens
           (human)
          Length = 1668

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR604086.1| full-length cDNA clone CS0DN003YP17 of Adult brain of Homo sapiens
           (human)
          Length = 1657

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 43  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 102

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 103 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 162

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 163 gacttgcagctggagcggatcagcgtctactacaacgaggcc 204
to top
>emb|CR604020.1| full-length cDNA clone CS0DF034YG16 of Fetal brain of Homo sapiens
           (human)
          Length = 1606

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR603943.1| full-length cDNA clone CS0DF038YG17 of Fetal brain of Homo sapiens
           (human)
          Length = 1656

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR603741.1| full-length cDNA clone CS0DN003YK16 of Adult brain of Homo sapiens
           (human)
          Length = 1661

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 38  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 97

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 98  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 157

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 158 gacttgcagctggagcggatcagcgtctactacaacgaggcc 199
to top
>emb|CR603509.1| full-length cDNA clone CS0DF015YF07 of Fetal brain of Homo sapiens
           (human)
          Length = 1661

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 38  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 97

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 98  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 157

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 158 gacttgcagctggagcggatcagcgtctactacaacgaggcc 199
to top
>emb|CR603504.1| full-length cDNA clone CS0DF019YF15 of Fetal brain of Homo sapiens
           (human)
          Length = 1644

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 38  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 97

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 98  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 157

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 158 gacttgcagctggagcggatcagcgtctactacaacgaggcc 199
to top
>emb|CR601978.1| full-length cDNA clone CS0DF031YB04 of Fetal brain of Homo sapiens
           (human)
          Length = 1677

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 73  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 132

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 133 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 192

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 193 gacttgcagctggagcggatcagcgtctactacaacgaggcc 234
to top
>emb|CR601914.1| full-length cDNA clone CS0DF029YG22 of Fetal brain of Homo sapiens
           (human)
          Length = 1662

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 45  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 104

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 105 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 164

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 165 gacttgcagctggagcggatcagcgtctactacaacgaggcc 206
to top
>emb|CR601754.1| full-length cDNA clone CS0DF015YO08 of Fetal brain of Homo sapiens
           (human)
          Length = 1606

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR601082.1| full-length cDNA clone CS0DF004YG09 of Fetal brain of Homo sapiens
           (human)
          Length = 1606

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR600381.1| full-length cDNA clone CS0DF002YJ17 of Fetal brain of Homo sapiens
           (human)
          Length = 1672

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 45  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 104

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 105 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 164

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 165 gacttgcagctggagcggatcagcgtctactacaacgaggcc 206
to top
>emb|CR600906.1| full-length cDNA clone CS0DF011YB14 of Fetal brain of Homo sapiens
           (human)
          Length = 1664

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 53  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 112

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 113 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 172

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 173 gacttgcagctggagcggatcagcgtctactacaacgaggcc 214
to top
>emb|CR600096.1| full-length cDNA clone CL0BB012ZA10 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1688

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 43  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 102

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 103 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 162

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 163 gacttgcagctggagcggatcagcgtctactacaacgaggcc 204
to top
>emb|CR600094.1| full-length cDNA clone CS0DI080YH19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1632

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 21  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 80

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 81  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 140

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 141 gacttgcagctggagcggatcagcgtctactacaacgaggcc 182
to top
>emb|CR599992.1| full-length cDNA clone CS0DA010YF14 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1658

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 38  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 97

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 98  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 157

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 158 gacttgcagctggagcggatcagcgtctactacaacgaggcc 199
to top
>emb|CR599272.1| full-length cDNA clone CS0DF025YB17 of Fetal brain of Homo sapiens
           (human)
          Length = 1668

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR598551.1| full-length cDNA clone CS0DF013YG06 of Fetal brain of Homo sapiens
           (human)
          Length = 1502

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 43  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 102

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 103 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 162

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 163 gacttgcagctggagcggatcagcgtctactacaacgaggcc 204
to top
>emb|CR598043.1| full-length cDNA clone CS0DF001YN08 of Fetal brain of Homo sapiens
           (human)
          Length = 1659

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 53  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 112

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 113 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 172

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 173 gacttgcagctggagcggatcagcgtctactacaacgaggcc 214
to top
>emb|CR598025.1| full-length cDNA clone CS0DF032YL01 of Fetal brain of Homo sapiens
           (human)
          Length = 1703

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 88  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 147

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 148 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 207

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 208 gacttgcagctggagcggatcagcgtctactacaacgaggcc 249
to top
>emb|CR597505.1| full-length cDNA clone CS0DF014YA10 of Fetal brain of Homo sapiens
           (human)
          Length = 1662

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR596786.1| full-length cDNA clone CS0DF005YF08 of Fetal brain of Homo sapiens
           (human)
          Length = 1651

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 38  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 97

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 98  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 157

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 158 gacttgcagctggagcggatcagcgtctactacaacgaggcc 199
to top
>emb|CR596505.1| full-length cDNA clone CS0DF034YM19 of Fetal brain of Homo sapiens
           (human)
          Length = 1855

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 44  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 103

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 104 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 163

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 164 gacttgcagctggagcggatcagcgtctactacaacgaggcc 205
to top
>emb|CR596446.1| full-length cDNA clone CS0DF002YK07 of Fetal brain of Homo sapiens
           (human)
          Length = 1658

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR596211.1| full-length cDNA clone CS0DF004YN22 of Fetal brain of Homo sapiens
           (human)
          Length = 1660

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 38  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 97

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 98  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 157

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 158 gacttgcagctggagcggatcagcgtctactacaacgaggcc 199
to top
>emb|CR595964.1| full-length cDNA clone CL0BB005ZB01 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1675

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 53  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 112

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 113 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 172

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 173 gacttgcagctggagcggatcagcgtctactacaacgaggcc 214
to top
>emb|CR595448.1| full-length cDNA clone CS0DF003YE06 of Fetal brain of Homo sapiens
           (human)
          Length = 1670

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 48  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 107

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 108 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 167

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 168 gacttgcagctggagcggatcagcgtctactacaacgaggcc 209
to top
>emb|CR594063.1| full-length cDNA clone CS0DF001YC03 of Fetal brain of Homo sapiens
           (human)
          Length = 1654

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 38  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 97

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 98  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 157

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 158 gacttgcagctggagcggatcagcgtctactacaacgaggcc 199
to top
>emb|CR594636.1| full-length cDNA clone CS0DF028YG23 of Fetal brain of Homo sapiens
           (human)
          Length = 1685

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 47  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 106

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 107 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 166

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 167 gacttgcagctggagcggatcagcgtctactacaacgaggcc 208
to top
>emb|CR594431.1| full-length cDNA clone CS0DF005YN20 of Fetal brain of Homo sapiens
           (human)
          Length = 1661

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR593464.1| full-length cDNA clone CS0DF018YM13 of Fetal brain of Homo sapiens
           (human)
          Length = 1683

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 45  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 104

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 105 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 164

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 165 gacttgcagctggagcggatcagcgtctactacaacgaggcc 206
to top
>emb|CR593269.1| full-length cDNA clone CS0DF017YJ19 of Fetal brain of Homo sapiens
           (human)
          Length = 1660

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 23  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 82

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 83  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 142

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 143 gacttgcagctggagcggatcagcgtctactacaacgaggcc 184
to top
>emb|CR592535.1| full-length cDNA clone CS0DF020YG13 of Fetal brain of Homo sapiens
           (human)
          Length = 1635

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 36  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 95

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 96  tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 155

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 156 gacttgcagctggagcggatcagcgtctactacaacgaggcc 197
to top
>emb|CR592791.1| full-length cDNA clone CS0DF033YO08 of Fetal brain of Homo sapiens
           (human)
          Length = 1688

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR592610.1| full-length cDNA clone CS0DG007YG24 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1675

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 53  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 112

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 113 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 172

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 173 gacttgcagctggagcggatcagcgtctactacaacgaggcc 214
to top
>emb|CR592245.1| full-length cDNA clone CS0DF025YG13 of Fetal brain of Homo sapiens
           (human)
          Length = 1687

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 49  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 108

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 109 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 168

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 169 gacttgcagctggagcggatcagcgtctactacaacgaggcc 210
to top
>emb|CR591503.1| full-length cDNA clone CS0DF031YG23 of Fetal brain of Homo sapiens
           (human)
          Length = 1665

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 55  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 114

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 115 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 174

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 175 gacttgcagctggagcggatcagcgtctactacaacgaggcc 216
to top
>emb|CR590783.1| full-length cDNA clone CS0DF011YL22 of Fetal brain of Homo sapiens
           (human)
          Length = 1668

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 46  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 105

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 106 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 165

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 166 gacttgcagctggagcggatcagcgtctactacaacgaggcc 207
to top
>emb|CR590708.1| full-length cDNA clone CS0DF008YA03 of Fetal brain of Homo sapiens
           (human)
          Length = 1687

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 44  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 103

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 104 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 163

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 164 gacttgcagctggagcggatcagcgtctactacaacgaggcc 205
to top
>emb|CR590351.1| full-length cDNA clone CS0DF015YL09 of Fetal brain of Homo sapiens
           (human)
          Length = 1660

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 50  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 109

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 110 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 169

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 170 gacttgcagctggagcggatcagcgtctactacaacgaggcc 211
to top
>emb|CR590075.1| full-length cDNA clone CS0DF024YN18 of Fetal brain of Homo sapiens
           (human)
          Length = 1659

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 54  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 113

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 114 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 173

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 174 gacttgcagctggagcggatcagcgtctactacaacgaggcc 215
to top
>dbj|AK223039.1| Homo sapiens mRNA for tubulin, beta, 4 variant, clone: JTH08432
          Length = 1735

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 58  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 117

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 118 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 177

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 178 gacttgcagctggagcggatcagcgtctactacaacgaggcc 219
to top
>dbj|AK058140.1| Homo sapiens cDNA FLJ25411 fis, clone TST03333, highly similar to
           TUBULIN BETA-3 CHAIN
          Length = 1603

 Score =  139 bits (70), Expect = 5e-30
 Identities = 139/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 58  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 117

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 118 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 177

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||||||||||
Sbjct: 178 gacttgcagctggagcggatcagcgtctactacaacgaggcc 219
to top
>emb|Y09741.1|HVBTUBI Hordeum vulgare mRNA for beta-tubulin 1
          Length = 1646

 Score =  139 bits (70), Expect = 5e-30
 Identities = 190/230 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  cggcgacgatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcgggg 105
           |||||| ||||||||||||||||||||||||||| ||||| ||||| ||||||||||| |
Sbjct: 76  cggcgaagatgagggagatcctgcacatccagggtgggcaatgtggcaaccagatcggtg 135

                                                                       
Query: 106 ccaagttctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgg 165
           ||||||||||||||||| | || || ||||| || || |||   || ||||||||| | |
Sbjct: 136 ccaagttctgggaggtggtgtgtgatgagcatggcattgacccaactgggcgctacaccg 195

                                                                       
Query: 166 gggactcggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggcc 225
           |   ||| ||||||||| |||||||  |||| ||||||||||| ||||||  | | || |
Sbjct: 196 gtacctctgacctgcagttggagcgtgtcaatgtctactacaatgaggcctcctgtggtc 255

                                                             
Query: 226 gcttcgtgccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           |||| |||||||| || || || |||||||| ||||| || |||||||||
Sbjct: 256 gctttgtgccccgtgcagttcttatggaccttgagccgggtaccatggac 305
to top
>emb|AJ586806.1| Setaria viridis tub1 gene for beta tubulin, exons 1-3
          Length = 1971

 Score =  137 bits (69), Expect = 2e-29
 Identities = 189/229 (82%)
 Strand = Plus / Plus

                                                                       
Query: 47  ggcgacgatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggc 106
           ||||| |||||| |||||| ||||||||||||| ||||| ||||| ||||||||||| ||
Sbjct: 1   ggcgaagatgagagagatcttgcacatccagggtgggcaatgtggcaaccagatcggtgc 60

                                                                       
Query: 107 caagttctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcggg 166
           |||||||||||||||| | || || ||||| || || |||   || ||||| ||| | ||
Sbjct: 61  caagttctgggaggtggtgtgtgatgagcatggcattgacccaactgggcggtacacagg 120

                                                                       
Query: 167 ggactcggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccg 226
             |||| ||||||||| |||||||  |||| ||||||||||||||||||  | | |||||
Sbjct: 121 caactctgacctgcagttggagcgtgtcaatgtctactacaacgaggcctcctgtggccg 180

                                                            
Query: 227 cttcgtgccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           ||| |||||||| || || ||||||||||| ||||| || || ||||||
Sbjct: 181 ctttgtgccccgtgctgtcctcatggaccttgagcctgggacaatggac 229
to top
>emb|X74655.1|ZMB4TUB Z.mays mRNA for beta 4 tubulin
          Length = 1715

 Score =  133 bits (67), Expect = 3e-28
 Identities = 103/115 (89%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           |||||||||||||||||||||||||||||| ||||| || ||||||||||| ||||||||
Sbjct: 104 gatgagggagatcctgcacatccagggcggccagtgcggcaaccagatcggcgccaagtt 163

                                                                  
Query: 113 ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggg 167
           ||||||||||||||||| ||||||| |  |||||  |||||| |||||| |||||
Sbjct: 164 ctgggaggtgatctgcggcgagcactgcgtcgactccacgggccgctactcgggg 218



 Score =  131 bits (66), Expect = 1e-27
 Identities = 87/94 (92%)
 Strand = Plus / Plus

                                                                       
Query: 181 agctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccgcg 240
           |||| |||||||||||||||||||||||||||||  | || ||||||| |||||||||||
Sbjct: 238 agctcgagcggatcaacgtctactacaacgaggctgggggtggccgctacgtgccccgcg 297

                                             
Query: 241 ccgtgctcatggacctcgagcccggcaccatgga 274
           |||||||||||||||| |||||||||||||||||
Sbjct: 298 ccgtgctcatggacctggagcccggcaccatgga 331
to top
>gb|U76896.1|TAU76896 Triticum aestivum beta-tubulin 5 (Tubb5) mRNA, complete cds
          Length = 1692

 Score =  133 bits (67), Expect = 3e-28
 Identities = 184/223 (82%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           ||||||||||||||||||||||||||| ||||||||||| |||||||| ||  |||||||
Sbjct: 87  gatgagggagatcctgcacatccagggtgggcagtgtggaaaccagattggttccaagtt 146

                                                                       
Query: 113 ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
           |||||||||| | || || ||||| || ||||||  ||| ||||| || |  ||   |||
Sbjct: 147 ctgggaggtggtgtgtgatgagcatggcatcgaccccaccgggcggtatgtcggcacctc 206

                                                                       
Query: 173 ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
            |||||||||||||||||  |||||||||||||||| ||||||    | || ||||| ||
Sbjct: 207 tgacctgcagctggagcgtgtcaacgtctactacaatgaggcctcatgtggtcgctttgt 266

                                                      
Query: 233 gccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           |||||| || || || ||||| || ||||| ||||||||||||
Sbjct: 267 gccccgtgctgtccttatggatcttgagccgggcaccatggac 309
to top
>gb|L10635.1|MZEBTUB4A Zea mays beta-4 tubulin (tub4) mRNA, complete cds
          Length = 1651

 Score =  133 bits (67), Expect = 3e-28
 Identities = 103/115 (89%)
 Strand = Plus / Plus

                                                                       
Query: 53  gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
           |||||||||||||||||||||||||||||| ||||| || ||||||||||| ||||||||
Sbjct: 44  gatgagggagatcctgcacatccagggcggccagtgcggcaaccagatcggcgccaagtt 103

                                                                  
Query: 113 ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggg 167
           ||||||||||||||||| ||||||| |  |||||  |||||| |||||| |||||
Sbjct: 104 ctgggaggtgatctgcggcgagcactgcgtcgactccacgggccgctactcgggg 158



 Score =  123 bits (62), Expect = 3e-25
 Identities = 86/94 (91%)
 Strand = Plus / Plus

                                                                       
Query: 181 agctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccccgcg 240
           |||| |||||||||||||||||||||||||||||  | || |||||||  ||||||||||
Sbjct: 178 agctcgagcggatcaacgtctactacaacgaggctgggggtggccgctatgtgccccgcg 237

                                             
Query: 241 ccgtgctcatggacctcgagcccggcaccatgga 274
           |||||||||||||||| |||||||||||||||||
Sbjct: 238 ccgtgctcatggacctggagcccggcaccatgga 271
to top
>dbj|AB169662.1| Macaca fascicularis brain cDNA, clone: QccE-15186, similar to human
           tubulin, beta, 4 (TUBB4), mRNA, RefSeq: NM_006086.1
          Length = 1779

 Score =  131 bits (66), Expect = 1e-27
 Identities = 138/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 114 atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 173

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 174 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 233

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||| ||||||
Sbjct: 234 gacttgcagctggagcggatcagcgtctactacaatgaggcc 275
to top
>dbj|AB125205.1| Macaca fascicularis TUBB4 mRNA for tubulin, beta, 4, complete cds
          Length = 1717

 Score =  131 bits (66), Expect = 1e-27
 Identities = 138/162 (85%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 58  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 117

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||| || ||| | || ||||| || ||||||  ||  ||   ||||| ||| ||||||
Sbjct: 118 tgggaagtcatcagtgatgagcatggcatcgaccccagcggcaactacgtgggcgactcg 177

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||| |||||||||||||||||| |||||||||||| ||||||
Sbjct: 178 gacttgcagctggagcggatcagcgtctactacaatgaggcc 219
to top
>gb|U76745.1|TAU76745 Triticum aestivum beta-tubulin 2 (tubb2) mRNA, complete cds
          Length = 1646

 Score =  131 bits (66), Expect = 1e-27
 Identities = 189/230 (82%)
 Strand = Plus / Plus

                                                                       
Query: 46  cggcgacgatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcgggg 105
           |||||| ||||||||| ||||||||||||||||| ||||| ||||| ||||||||||| |
Sbjct: 57  cggcgaagatgagggaaatcctgcacatccagggtgggcaatgtggcaaccagatcggtg 116

                                                                       
Query: 106 ccaagttctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgg 165
           ||||||||||||||||| | || || ||||| || || |||   || ||||||||| | |
Sbjct: 117 ccaagttctgggaggtggtgtgtgatgagcatggcattgacccaactgggcgctacaccg 176

                                                                       
Query: 166 gggactcggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggcc 225
           |   ||| ||||||||| |||||||  |||| ||||||||||| ||||||    | || |
Sbjct: 177 gtacctctgacctgcagttggagcgtgtcaatgtctactacaatgaggcctcgtgtggtc 236

                                                             
Query: 226 gcttcgtgccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           |||| |||||||| || || || |||||||| |||||||| |||||||||
Sbjct: 237 gctttgtgccccgtgctgttcttatggaccttgagcccggtaccatggac 286
to top
>gb|AY382286.2| Physcomitrella patens beta-tubulin 6 (Tub6) gene, complete cds
          Length = 3437

 Score =  129 bits (65), Expect = 5e-27
 Identities = 167/201 (83%)
 Strand = Plus / Plus

                                                                        
Query: 53   gatgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagtt 112
            |||||| |||||||||||||| ||||| || ||||| |||||||||||||| ||||||||
Sbjct: 1812 gatgagagagatcctgcacattcagggaggacagtgcgggaaccagatcggagccaagtt 1871

                                                                        
Query: 113  ctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactc 172
            |||||||||| | ||||| ||||| || ||||||   ||||||   |||  ||| |  ||
Sbjct: 1872 ctgggaggtggtgtgcgaggagcatggcatcgacccgacggggacgtaccagggcgtgtc 1931

                                                                        
Query: 173  ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
            |||  ||||||||||||||||||| || |||||||||||||| ||||| || || | |||
Sbjct: 1932 ggatttgcagctggagcggatcaatgtgtactacaacgaggcgagcggaggtcggtacgt 1991

                                 
Query: 233  gccccgcgccgtgctcatgga 253
            ||||||||  ||||| |||||
Sbjct: 1992 gccccgcggagtgctgatgga 2012
to top
>dbj|AB239681.1| Pyrus pyrifolia var. culta PsTUB-b2 mRNA for beta tubulin like
           protein, partial cds
          Length = 1194

 Score =  127 bits (64), Expect = 2e-26
 Identities = 163/196 (83%)
 Strand = Plus / Plus

                                                                       
Query: 80  cgggcagtgtgggaaccagatcggggccaagttctgggaggtgatctgcgacgagcacgg 139
           ||||||||||||||| || ||||||||||||| |||||||||| | |||| |||||||||
Sbjct: 2   cgggcagtgtgggaatcaaatcggggccaagtgctgggaggtggtgtgcgccgagcacgg 61

                                                                       
Query: 140 gatcgacggcacggggcgctacgcgggggactcggacctgcagctggagcggatcaacgt 199
            ||||||  ||| || ||||||   || ||||| || || ||||| ||| || | || ||
Sbjct: 62  catcgactccaccggacgctaccacggtgactccgagctccagcttgagagggttaatgt 121

                                                                       
Query: 200 ctactacaacgaggccagcgggggccgcttcgtgccccgcgccgtgctcatggacctcga 259
           ||||||||| ||||||||||| |||||||  || || ||||||||||||||||| || ||
Sbjct: 122 ctactacaatgaggccagcggtggccgctatgttcctcgcgccgtgctcatggatctgga 181

                           
Query: 260 gcccggcaccatggac 275
           ||| || |||||||||
Sbjct: 182 gcctggtaccatggac 197
to top
>gb|DQ217182.1| Taeniopygia guttata clone 0058P0009G11 tubulin beta 2-like mRNA,
           complete sequence
          Length = 1179

 Score =  123 bits (62), Expect = 3e-25
 Identities = 137/162 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||  ||||| | |||| ||||||||| |||||||| ||||| |||||||||
Sbjct: 57  atgagggagattgtgcacctgcaggccgggcagtgcgggaaccaaatcggagccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||||||| |||||||||| || ||||||  ||| ||   ||||   ||||||   
Sbjct: 117 tgggaggtgatcagcgacgagcatggcatcgaccccaccggcacctaccacggggacagc 176

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 177 gacctgcagctggagcgcatcaatgtctactacaacgaggcc 218
to top
>gb|AY382287.1| Physcomitrella patens beta-tubulin 1 (Tub1) gene, complete cds
          Length = 1684

 Score =  123 bits (62), Expect = 3e-25
 Identities = 182/222 (81%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           ||||| |||||||||||||| || ||||| ||||| || ||||||||||| |||||||||
Sbjct: 1   atgagagagatcctgcacattcaaggcggccagtgcggaaaccagatcggagccaagttc 60

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           ||||||||| | ||||| |||||||| || |||  ||| ||   ||||  |||   ||||
Sbjct: 61  tgggaggtggtgtgcgaggagcacggcattgaccccaccggtacctacaagggcctctcg 120

                                                                       
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtg 233
           ||  ||||||| ||||| ||||| ||||||||||||||||||||||| ||||| | ||||
Sbjct: 121 gatttgcagctcgagcgcatcaatgtctactacaacgaggccagcggtggccggtacgtg 180

                                                     
Query: 234 ccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           ||||| || ||  | ||||| || ||||| || |||||||||
Sbjct: 181 ccccgtgcggttttgatggatctggagcctggaaccatggac 222
to top
>gb|AY729818.1| Isochrysis galbana beta-tubulin gene, partial cds
          Length = 1203

 Score =  123 bits (62), Expect = 3e-25
 Identities = 153/190 (80%)
 Strand = Plus / Plus

                                                                       
Query: 90  gggaaccagatcggggccaagttctgggaggtgatctgcgacgagcacgggatcgacggc 149
           ||||||||||| || || || |||||||||||  |||  || ||||| || ||||||   
Sbjct: 1   gggaaccagatyggcgcyaarttctgggaggtygtctcsgaygagcayggcatcgacccs 60

                                                                       
Query: 150 acggggcgctacgcgggggactcggacctgcagctggagcggatcaacgtctactacaac 209
           || ||   ||||   || || |||||||| ||||||||||| |||||||| |||||||| 
Sbjct: 61  accggcacctaccacggcgaytcggacctccagctggagcgcatcaacgtgtactacaay 120

                                                                       
Query: 210 gaggccagcgggggccgcttcgtgccccgcgccgtgctcatggacctcgagcccggcacc 269
           ||||| |  || ||||||| ||| ||||||||| | || |||||||||||||| ||||||
Sbjct: 121 gaggcgacgggcggccgctacgtrccccgcgccatcctgatggacctcgagccgggcacc 180

                     
Query: 270 atggactcgg 279
           ||||||||||
Sbjct: 181 atggactcgg 190
to top
>gb|AY944863.1| Dissophora decumbens strain FSU801 clone 3 beta-tubulin (btub1)
           gene, partial cds
          Length = 1162

 Score =  121 bits (61), Expect = 1e-24
 Identities = 139/165 (84%)
 Strand = Plus / Plus

                                                                       
Query: 107 caagttctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcggg 166
           ||||||||||||||| ||| ||||||||||||| ||||||  ||| ||   |||||  ||
Sbjct: 10  caagttctgggaggtcatcagcgacgagcacggtatcgacaacaccggtgtctacggcgg 69

                                                                       
Query: 167 ggactcggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccg 226
            ||||||||||| ||||| ||||| |||||||||||||| |||||||||| ||| |||  
Sbjct: 70  tgactcggaccttcagcttgagcgcatcaacgtctactataacgaggccaccggaggcaa 129

                                                        
Query: 227 cttcgtgccccgcgccgtgctcatggacctcgagcccggcaccat 271
            | ||| ||||||||||| ||| | ||||||||||||||||||||
Sbjct: 130 gtacgttccccgcgccgtcctcgtcgacctcgagcccggcaccat 174
to top
>gb|BC111295.1| Bos taurus cDNA clone MGC:134115 IMAGE:8062346, complete cds
          Length = 1897

 Score =  121 bits (61), Expect = 1e-24
 Identities = 136/161 (84%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||||||||||||||||
Sbjct: 66  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagatcggggccaagttc 125

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| |||| || || ||||| |||  ||  ||    || | ||| ||||||
Sbjct: 126 tgggaggtcatcagcgatgaacatgggatagaccccagtggcaattatgtgggtgactcg 185

                                                    
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggc 214
           ||||||||||||||||| ||||  |||||||||||||||||
Sbjct: 186 gacctgcagctggagcgcatcagtgtctactacaacgaggc 226
to top
>gb|AF030547.1|AF030547 Manduca sexta beta-1 tubulin mRNA, complete cds
          Length = 1937

 Score =  121 bits (61), Expect = 1e-24
 Identities = 186/225 (82%), Gaps = 2/225 (0%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||| ||| ||||||||||||  || || || || ||||||||||| || ||||||
Sbjct: 72  atgagggaaatcgtgcacatccaggctggccaatgcggcaaccagatcggagctaagttc 131

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgct-acgcgggggactc 172
           |||||| | ||||  |||||||| || ||||||  ||| || |||| ||   || |||||
Sbjct: 132 tgggagatcatctctgacgagcatggcatcgaccccaccgg-cgcttaccatggcgactc 190

                                                                       
Query: 173 ggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgt 232
           |||||||||||||||||| |||||||| |||||||| ||||||  ||| |||   | |||
Sbjct: 191 ggacctgcagctggagcgcatcaacgtgtactacaatgaggcctccggcggcaagtacgt 250

                                                        
Query: 233 gccccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||| |||||| | ||| ||||||||||||||||||||||||||||
Sbjct: 251 gccgcgcgccatcctcgtggacctcgagcccggcaccatggactc 295
to top
>gb|BC101270.2| Homo sapiens tubulin, beta 8, mRNA (cDNA clone IMAGE:40024141),
           partial cds
          Length = 1324

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 115 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 174

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 175 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 217



 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 80  cgggcagtgtgggaaccagatcggggccaagttctgggaggtgatct 126
           ||||||||| ||||| |||||||| ||||||||||||||||||||||
Sbjct: 20  cgggcagtgcgggaatcagatcggcgccaagttctgggaggtgatct 66
to top
>ref|NM_177987.1| Homo sapiens tubulin, beta 8 (TUBB8), mRNA
          Length = 1335

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 122 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 181

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 182 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 224



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 1   atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 60

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 61  tgggaggtgatct 73
to top
>emb|CR626121.1| full-length cDNA clone CS0DG001YJ06 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1428

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 169 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 228

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 229 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 271



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 48  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 107

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 108 tgggaggtgatct 120
to top
>emb|CR621858.1| full-length cDNA clone CS0DK003YK14 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1382

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 169 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 228

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 229 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 271



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 48  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 107

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 108 tgggaggtgatct 120
to top
>emb|CR614889.1| full-length cDNA clone CS0DA005YB05 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1390

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 177 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 236

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 237 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 279



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 56  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 115

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 116 tgggaggtgatct 128
to top
>emb|CR612709.1| full-length cDNA clone CS0DG007YM03 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1431

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 172 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 231

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 232 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 274



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 51  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 110

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 111 tgggaggtgatct 123
to top
>emb|CR606225.1| full-length cDNA clone CS0DE004YD15 of Placenta of Homo sapiens
           (human)
          Length = 1436

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 191 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 250

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 251 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 293



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 70  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 129

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 130 tgggaggtgatct 142
to top
>emb|CR605516.1| full-length cDNA clone CS0DM002YL01 of Fetal liver of Homo sapiens
           (human)
          Length = 1397

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 185 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 244

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 245 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 287



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 64  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 123

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 124 tgggaggtgatct 136
to top
>emb|CR603378.1| full-length cDNA clone CS0DF031YO21 of Fetal brain of Homo sapiens
           (human)
          Length = 1382

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 123 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 182

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 183 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 225



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 2   atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 61

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 62  tgggaggtgatct 74
to top
>emb|CR603249.1| full-length cDNA clone CS0DE002YA12 of Placenta of Homo sapiens
           (human)
          Length = 1416

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 99  acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 158

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 159 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 201



 Score = 69.9 bits (35), Expect = 4e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 80  cgggcagtgtgggaaccagatcggggccaagttctgggaggtgatct 126
           ||||||||| ||||| |||||||| ||||||||||||||||||||||
Sbjct: 4   cgggcagtgcgggaatcagatcggcgccaagttctgggaggtgatct 50
to top
>emb|CR601851.1| full-length cDNA clone CS0DN002YJ23 of Adult brain of Homo sapiens
           (human)
          Length = 1373

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 160 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 219

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 220 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 262



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 39  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 98

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 99  tgggaggtgatct 111
to top
>emb|CR599052.1| full-length cDNA clone CS0DI014YN15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1390

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 177 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 236

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 237 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 279



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 56  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 115

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 116 tgggaggtgatct 128
to top
>emb|CR592383.1| full-length cDNA clone CS0DF003YG14 of Fetal brain of Homo sapiens
           (human)
          Length = 1413

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 177 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 236

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 237 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 279



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 56  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 115

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 116 tgggaggtgatct 128
to top
>emb|CR592639.1| full-length cDNA clone CS0DF037YA21 of Fetal brain of Homo sapiens
           (human)
          Length = 1390

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 177 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 236

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 237 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 279



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 56  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 115

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 116 tgggaggtgatct 128
to top
>emb|CR592105.1| full-length cDNA clone CS0DI014YF15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1398

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 185 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 244

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 245 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 287



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 64  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 123

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 124 tgggaggtgatct 136
to top
>emb|CR591556.1| full-length cDNA clone CS0DK009YJ04 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1374

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 161 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 220

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 221 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 263



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 40  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 99

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 100 tgggaggtgatct 112
to top
>emb|CR590375.1| full-length cDNA clone CS0DF038YG05 of Fetal brain of Homo sapiens
           (human)
          Length = 1398

 Score =  117 bits (59), Expect = 2e-23
 Identities = 92/103 (89%)
 Strand = Plus / Plus

                                                                       
Query: 175 acctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgc 234
           |||||||||||||||| |||||||| |||||||||||||||||||| ||| | | |||||
Sbjct: 185 acctgcagctggagcgcatcaacgtgtactacaacgaggccagcggtggcaggtacgtgc 244

                                                      
Query: 235 cccgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||||| |||||| |||| || ||||| ||||||||||||||
Sbjct: 245 cccgcgctgtgctcgtggatctggagccgggcaccatggactc 287



 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||| ||  |||  ||||||||| ||||| |||||||| |||||||||
Sbjct: 64  atgagggagatcgtgctcacgcagatcgggcagtgcgggaatcagatcggcgccaagttc 123

                        
Query: 114 tgggaggtgatct 126
           |||||||||||||
Sbjct: 124 tgggaggtgatct 136
to top
>gb|AF482414.1| Heterocapsa triquetra beta-tubulin (btub2) mRNA, partial cds
          Length = 1161

 Score =  117 bits (59), Expect = 2e-23
 Identities = 143/171 (83%)
 Strand = Plus / Plus

                                                                       
Query: 105 gccaagttctgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcg 164
           |||||||||||||||||||||| |||||||||||| ||||||  ||||||    |||   
Sbjct: 7   gccaagttctgggaggtgatctccgacgagcacggcatcgaccccacgggcacgtaccat 66

                                                                       
Query: 165 ggggactcggacctgcagctggagcggatcaacgtctactacaacgaggccagcgggggc 224
           || ||||| ||||||||||||||||| || ||||| |||||||||||||||| ||| |||
Sbjct: 67  ggagactctgacctgcagctggagcgcattaacgtgtactacaacgaggccaccggtggc 126

                                                              
Query: 225 cgcttcgtgccccgcgccgtgctcatggacctcgagcccggcaccatggac 275
           ||||  ||||| |||||| |  | |||||||| ||||| ||||| ||||||
Sbjct: 127 cgctatgtgccgcgcgccatcttgatggacctggagccgggcacgatggac 177
to top
>gb|BC088749.1| Mus musculus tubulin, beta 3, mRNA (cDNA clone MGC:103107
           IMAGE:6307387), complete cds
          Length = 1756

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 45  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 104

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| |||| |||||||| || |||  ||  ||   ||| |  |||||||| 
Sbjct: 105 tgggaggtcatcagcgatgagcacggcatagaccccagcggcaactatgtaggggactca 164

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||||||||||||||||| |||| ||| |||||||| ||||||
Sbjct: 165 gacctgcagctggagcgcatcagcgtatactacaatgaggcc 206
to top
>gb|AF459021.1| Rattus norvegicus neuron-specific class III beta-tubulin mRNA,
           complete cds
          Length = 2141

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 58  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 117

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| | |||||||| || || |||  ||  ||   ||| | ||||||||||
Sbjct: 118 tgggaggtcatcagtgacgagcatggcatagaccccagcggcaactatgtgggggactcg 177

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           |||||||||||||| || ||||  ||||||||||| ||||||
Sbjct: 178 gacctgcagctggaacgcatcagtgtctactacaatgaggcc 219
to top
>ref|NM_023279.2| Mus musculus tubulin, beta 3 (Tubb3), mRNA
          Length = 1758

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 43  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 102

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| |||| |||||||| || |||  ||  ||   ||| |  |||||||| 
Sbjct: 103 tgggaggtcatcagcgatgagcacggcatagaccccagcggcaactatgtaggggactca 162

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||||||||||||||||| |||| ||| |||||||| ||||||
Sbjct: 163 gacctgcagctggagcgcatcagcgtatactacaatgaggcc 204
to top
>gb|BC031357.1| Mus musculus tubulin, beta 3, mRNA (cDNA clone MGC:35812
           IMAGE:5363050), complete cds
          Length = 1758

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 43  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 102

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| |||| |||||||| || |||  ||  ||   ||| |  |||||||| 
Sbjct: 103 tgggaggtcatcagcgatgagcacggcatagaccccagcggcaactatgtaggggactca 162

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||||||||||||||||| |||| ||| |||||||| ||||||
Sbjct: 163 gacctgcagctggagcgcatcagcgtatactacaatgaggcc 204
to top
>ref|NM_139254.1| Rattus norvegicus tubulin, beta 3 (Tubb3), mRNA
          Length = 2141

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 58  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 117

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| | |||||||| || || |||  ||  ||   ||| | ||||||||||
Sbjct: 118 tgggaggtcatcagtgacgagcatggcatagaccccagcggcaactatgtgggggactcg 177

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           |||||||||||||| || ||||  ||||||||||| ||||||
Sbjct: 178 gacctgcagctggaacgcatcagtgtctactacaatgaggcc 219
to top
>gb|BC097281.1| Rattus norvegicus tubulin, beta 3, mRNA (cDNA clone MGC:114260
           IMAGE:7461390), complete cds
          Length = 1776

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 30  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 89

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| | |||||||| || || |||  ||  ||   ||| | ||||||||||
Sbjct: 90  tgggaggtcatcagtgacgagcatggcatagaccccagcggcaactatgtgggggactcg 149

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           |||||||||||||| || ||||  ||||||||||| ||||||
Sbjct: 150 gacctgcagctggaacgcatcagtgtctactacaatgaggcc 191
to top
>dbj|AK149014.1| Mus musculus 2 days neonate sympathetic ganglion cDNA, RIKEN
           full-length enriched library, clone:7120476D15
           product:tubulin, beta 3, full insert sequence
          Length = 1733

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 55  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 114

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| |||| |||||||| || |||  ||  ||   ||| |  |||||||| 
Sbjct: 115 tgggaggtcatcagcgatgagcacggcatagaccccagcggcaactatgtaggggactca 174

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||||||||||||||||| |||| ||| |||||||| ||||||
Sbjct: 175 gacctgcagctggagcgcatcagcgtatactacaatgaggcc 216
to top
>dbj|AK051298.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
           enriched library, clone:D130031O03 product:tubulin, beta
           3, full insert sequence
          Length = 1732

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 55  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 114

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| |||| |||||||| || |||  ||  ||   ||| |  |||||||| 
Sbjct: 115 tgggaggtcatcagcgatgagcacggcatagaccccagcggcaactatgtaggggactca 174

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||||||||||||||||| |||| ||| |||||||| ||||||
Sbjct: 175 gacctgcagctggagcgcatcagcgtatactacaatgaggcc 216
to top
>dbj|AK012528.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700078D11 product:tubulin, beta
           3, full insert sequence
          Length = 1734

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 58  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 117

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| |||| |||||||| || |||  ||  ||   ||| |  |||||||| 
Sbjct: 118 tgggaggtcatcagcgatgagcacggcatagaccccagcggcaactatgtaggggactca 177

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||||||||||||||||| |||| ||| |||||||| ||||||
Sbjct: 178 gacctgcagctggagcgcatcagcgtatactacaatgaggcc 219
to top
>dbj|AK082942.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:C530009K02 product:tubulin, beta
           3, full insert sequence
          Length = 1729

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 55  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 114

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| |||| |||||||| || |||  ||  ||   ||| |  |||||||| 
Sbjct: 115 tgggaggtcatcagcgatgagcacggcatagaccccagcggcaactatgtaggggactca 174

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||||||||||||||||| |||| ||| |||||||| ||||||
Sbjct: 175 gacctgcagctggagcgcatcagcgtatactacaatgaggcc 216
to top
>gb|AF312873.1|AF312873 Mus musculus tubulin beta-3 mRNA, complete cds
          Length = 1705

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 26  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 85

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| |||| |||||||| || |||  ||  ||   ||| |  |||||||| 
Sbjct: 86  tgggaggtcatcagcgatgagcacggcatagaccccagcggcaactatgtaggggactca 145

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           ||||||||||||||||| |||| ||| |||||||| ||||||
Sbjct: 146 gacctgcagctggagcgcatcagcgtatactacaatgaggcc 187
to top
>ref|XM_579666.1| PREDICTED: Rattus norvegicus tubulin, beta 3 (Tubb3), mRNA
          Length = 1785

 Score =  115 bits (58), Expect = 8e-23
 Identities = 136/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| |||||||||||| ||| ||||| || |||||||| ||||||||||||
Sbjct: 57  atgagggagatcgtgcacatccaggccggccagtgcggcaaccagataggggccaagttc 116

                                                                       
Query: 114 tgggaggtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcg 173
           |||||||| ||| | |||||||| || || |||  ||  ||   ||| | ||||||||||
Sbjct: 117 tgggaggtcatcagtgacgagcatggcatagaccccagcggcaactatgtgggggactcg 176

                                                     
Query: 174 gacctgcagctggagcggatcaacgtctactacaacgaggcc 215
           |||||||||||||| || ||||  ||||||||||| ||||||
Sbjct: 177 gacctgcagctggaacgcatcagtgtctactacaatgaggcc 218
to top
>ref|XM_418971.1| PREDICTED: Gallus gallus similar to tubulin beta chain - human
           (LOC420884), mRNA
          Length = 1580

 Score =  113 bits (57), Expect = 3e-22
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                       
Query: 60  gagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttctgggag 119
           |||||| |||||||||||| ||||||||| || ||||||||||| |||||||||||||||
Sbjct: 88  gagatcgtgcacatccaggccgggcagtgcggcaaccagatcggcgccaagttctgggag 147

                                                                       
Query: 120 gtgatctgcgacgagcacgggatcgacggcacggggcgctacgcgggggactcggacctg 179
           || ||| |||| |||||||| ||||||  ||| ||  |||||   || |||   ||||||
Sbjct: 148 gtcatcagcgatgagcacggcatcgaccccaccggcagctaccacggcgacagcgacctg 207

                                        
Query: 180 cagctggagcggatcaacgtctactacaa 208
           ||||||||| |||||||||| ||||||||
Sbjct: 208 cagctggagaggatcaacgtgtactacaa 236



 Score = 40.1 bits (20), Expect = 3.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 252 gacctcgagcccggcaccatggactcgg 279
           ||||| ||||||||||| ||||||||||
Sbjct: 280 gacctggagcccggcacgatggactcgg 307
to top
>ref|XM_851157.1| PREDICTED: Canis familiaris similar to tubulin, beta, 2, transcript
           variant 3 (LOC491231), mRNA
          Length = 1453

 Score =  113 bits (57), Expect = 3e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 177 ctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccc 236
           ||||||||||||||||||||||| |||||||||||||||| ||| |||   |  ||||||
Sbjct: 177 ctgcagctggagcggatcaacgtgtactacaacgaggccaccggtggcaagtatgtgccc 236

                                                    
Query: 237 cgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||| |||||| ||||||| ||||||||||||||||||||
Sbjct: 237 cgcgctgtgctcgtggacctagagcccggcaccatggactc 277



 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||||| | |||| ||| ||||| || ||||||||||| |||||||||
Sbjct: 54  atgagggagatcgtgcacctgcaggccggccagtgcggcaaccagatcggcgccaagttc 113

                                           
Query: 114 tgggaggtgatctgcgacgagcacgggatcga 145
           |||||||||||| |||||||||| || |||||
Sbjct: 114 tgggaggtgatcagcgacgagcatggcatcga 145
to top
>ref|XM_843368.1| PREDICTED: Canis familiaris similar to tubulin, beta, 2, transcript
           variant 1 (LOC491231), mRNA
          Length = 1542

 Score =  113 bits (57), Expect = 3e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 177 ctgcagctggagcggatcaacgtctactacaacgaggccagcgggggccgcttcgtgccc 236
           ||||||||||||||||||||||| |||||||||||||||| ||| |||   |  ||||||
Sbjct: 177 ctgcagctggagcggatcaacgtgtactacaacgaggccaccggtggcaagtatgtgccc 236

                                                    
Query: 237 cgcgccgtgctcatggacctcgagcccggcaccatggactc 277
           ||||| |||||| ||||||| ||||||||||||||||||||
Sbjct: 237 cgcgctgtgctcgtggacctagagcccggcaccatggactc 277



 Score = 95.6 bits (48), Expect = 7e-17
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                       
Query: 54  atgagggagatcctgcacatccagggcgggcagtgtgggaaccagatcggggccaagttc 113
           |||||||||||| ||||| | |||| ||| ||||| || ||||||||||| |||||||||
Sbjct: 54  atgagggagatcgtgcacctgcaggccggccagtgcggcaaccagatcggcgccaagttc 113

                                           
Query: 114 tgggaggtgatctgcgacgagcacgggatcga 145
           |||||||||||| |||||||||| || |||||
Sbjct: 114 tgggaggtgatcagcgacgagcatggcatcga 145


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,788,746
Number of Sequences: 3902068
Number of extensions: 1788746
Number of successful extensions: 40188
Number of sequences better than 10.0: 2617
Number of HSP's better than 10.0 without gapping: 2620
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 34920
Number of HSP's gapped (non-prelim): 5179
length of query: 279
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 257
effective length of database: 17,147,199,772
effective search space: 4406830341404
effective search space used: 4406830341404
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top