| Clone Name | basd27k18 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_480438.1| Oryza sativa (japonica cultivar-group), mRNA Length = 867 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 312 cggcgccggcgggcgggaggg 332 ||||||||||||||||||||| Sbjct: 469 cggcgccggcgggcgggaggg 449
>ref|NM_176831.4| Mus musculus phosphopantothenoylcysteine decarboxylase (Ppcdc), mRNA Length = 2767 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 392 tccagcccaggaacgtccaac 412 ||||||||||||||||||||| Sbjct: 299 tccagcccaggaacgtccaac 279
>gb|BC052928.1| Mus musculus phosphopantothenoylcysteine decarboxylase, mRNA (cDNA clone MGC:62920 IMAGE:5255304), complete cds Length = 1423 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 392 tccagcccaggaacgtccaac 412 ||||||||||||||||||||| Sbjct: 248 tccagcccaggaacgtccaac 228
>gb|BC089351.1| Mus musculus phosphopantothenoylcysteine decarboxylase, mRNA (cDNA clone MGC:102190 IMAGE:30603115), complete cds Length = 2730 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 392 tccagcccaggaacgtccaac 412 ||||||||||||||||||||| Sbjct: 263 tccagcccaggaacgtccaac 243
>gb|BC004779.1| Mus musculus phosphopantothenoylcysteine decarboxylase, mRNA (cDNA clone IMAGE:3257493), complete cds Length = 1678 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 392 tccagcccaggaacgtccaac 412 ||||||||||||||||||||| Sbjct: 292 tccagcccaggaacgtccaac 272
>dbj|AK036042.1| Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:9630029K22 product:CDNA FLJ14585 FIS, CLONE NT2RM4001611, WEAKLY SIMILAR TO SIS2 PROTEIN homolog [Homo sapiens], full insert sequence Length = 1928 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 392 tccagcccaggaacgtccaac 412 ||||||||||||||||||||| Sbjct: 282 tccagcccaggaacgtccaac 262
>dbj|AK038628.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched library, clone:A230051J07 product:hypothetical Flavoprotein containing protein, full insert sequence Length = 725 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 392 tccagcccaggaacgtccaac 412 ||||||||||||||||||||| Sbjct: 277 tccagcccaggaacgtccaac 257
>dbj|AK078825.1| Mus musculus 16 days embryo lung cDNA, RIKEN full-length enriched library, clone:8430432M10 product:weakly similar to CDNA FLJ14585 FIS, CLONE NT2RM4001611, WEAKLY SIMILAR TO SIS2 PROTEIN [Homo sapiens], full insert sequence Length = 1654 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 392 tccagcccaggaacgtccaac 412 ||||||||||||||||||||| Sbjct: 282 tccagcccaggaacgtccaac 262
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 312 cggcgccggcgggcgggaggg 332 ||||||||||||||||||||| Sbjct: 5139792 cggcgccggcgggcgggaggg 5139772
>dbj|AP005531.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1099H05 Length = 186036 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 312 cggcgccggcgggcgggaggg 332 ||||||||||||||||||||| Sbjct: 8148 cggcgccggcgggcgggaggg 8128
>dbj|AP004656.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0020B10 Length = 136175 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 312 cggcgccggcgggcgggaggg 332 ||||||||||||||||||||| Sbjct: 89556 cggcgccggcgggcgggaggg 89536
>emb|AL974309.17| Zebrafish DNA sequence from clone DKEY-29D5 in linkage group 1, complete sequence Length = 214332 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 41 acggagatggaggaacaaacaaag 64 |||||||| ||||||||||||||| Sbjct: 147101 acggagatagaggaacaaacaaag 147124
>ref|XM_701060.1| PREDICTED: Danio rerio hypothetical protein LOC562737 (LOC562737), mRNA Length = 811 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 41 acggagatggaggaacaaacaaag 64 |||||||| ||||||||||||||| Sbjct: 563 acggagatagaggaacaaacaaag 586
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 312 cggcgccggcgggcgggagg 331 |||||||||||||||||||| Sbjct: 3044648 cggcgccggcgggcgggagg 3044629 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,839,353 Number of Sequences: 3902068 Number of extensions: 1839353 Number of successful extensions: 43312 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 43166 Number of HSP's gapped (non-prelim): 146 length of query: 425 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 403 effective length of database: 17,147,199,772 effective search space: 6910321508116 effective search space used: 6910321508116 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)