Clone Information

BLAST Search Result

Clone Name	basd27h09
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AY105317.1\| Zea mays PCO123556 mRNA sequence	246	6e-62
2	dbj\|AK062756.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	234	2e-58
3	gb\|AC097277.6\| Oryza sativa chromosome 3 BAC OSJNBa0022C08 genom...	143	6e-31
4	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	143	6e-31
5	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	143	6e-31
6	ref\|NM_119519.2\| Arabidopsis thaliana unknown protein AT4G33630 ...	48	0.026
7	ref\|NM_179157.1\| Arabidopsis thaliana unknown protein AT4G33630 ...	48	0.026
8	ref\|NM_119520.2\| Arabidopsis thaliana unknown protein AT4G33640 ...	48	0.026
9	gb\|BT025572.1\| Arabidopsis thaliana At4g33640 mRNA, complete cds	48	0.026
10	emb\|AL161583.2\|ATCHRIV79 Arabidopsis thaliana DNA chromosome 4, ...	48	0.026
11	emb\|AL031394.1\|ATT16L1 Arabidopsis thaliana DNA chromosome 4, BA...	48	0.026
12	gb\|AC148971.3\| Medicago truncatula chromosome 2 BAC clone mth2-7...	48	0.026
13	emb\|BX829162.1\|CNS0A3EX Arabidopsis thaliana Full-length cDNA Co...	48	0.026
14	emb\|BX828619.1\|CNS0A3FS Arabidopsis thaliana Full-length cDNA Co...	48	0.026
15	gb\|AY087101.1\| Arabidopsis thaliana clone 31672 mRNA, complete s...	48	0.026
16	dbj\|AP006357.1\| Lotus japonicus genomic DNA, chromosome 4, clone...	48	0.026
17	gb\|DQ144724.1\| Bifidobacterium breve Tkt (tkt), HrcA (hrcA), Dna...	44	0.41
18	gb\|AE014295.3\| Bifidobacterium longum NCC2705, complete genome	44	0.41
19	ref\|XM_748369.1\| Aspergillus fumigatus Af293 Rho guanyl nucleoti...	42	1.6
20	emb\|Z93059.1\|SLZ93059 S.latifolia mRNA, clone CCLS 86.1	42	1.6
21	gb\|CP000031.1\| Silicibacter pomeroyi DSS-3, complete genome	40	6.4
22	gb\|CP000143.1\| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl...	40	6.4
23	gb\|CP000010.1\| Burkholderia mallei ATCC 23344 chromosome 1, comp...	40	6.4
24	ref\|XM_594837.2\| PREDICTED: Bos taurus similar to two pore segme...	40	6.4
25	ref\|XM_421389.1\| PREDICTED: Gallus gallus similar to kinesin lig...	40	6.4
26	gb\|AC147837.2\| Xenopus tropicalis clone CH216-28I17, complete se...	40	6.4
27	gb\|CP000124.1\| Burkholderia pseudomallei 1710b chromosome I, com...	40	6.4
28	gb\|AC161228.7\| Mus musculus chromosome 3, clone RP24-77I5, compl...	40	6.4
29	gb\|AC122841.4\| Mus musculus BAC clone RP23-194E5 from 3, complet...	40	6.4
30	emb\|AJ971884.1\| Streptomyces sp. Bt 47 partial 16S rRNA gene, is...	40	6.4
31	ref\|XM_504456.1\| Yarrowia lipolytica CLIB122, YALI0E27181g predi...	40	6.4
32	emb\|BX571965.1\| Burkholderia pseudomallei strain K96243, chromos...	40	6.4
33	emb\|AL939123.1\|SCO939123 Streptomyces coelicolor A3(2) complete ...	40	6.4
34	emb\|AJ633046.1\| Ipomoea nil partial mRNA for putative CRC transc...	40	6.4
35	dbj\|AP006716.1\| Staphylococcus haemolyticus JCSC1435 DNA, comple...	40	6.4
36	emb\|CR406513.1\| Gallus gallus finished cDNA, clone ChEST731l14	40	6.4
37	emb\|CR390855.1\| Gallus gallus finished cDNA, clone ChEST378n2	40	6.4
38	gb\|AC133794.2\| Homo sapiens 12 BAC RP11-193M21 (Roswell Park Can...	40	6.4
39	gb\|CP000251.1\| Anaeromyxobacter dehalogenans 2CP-C, complete genome	40	6.4
40	dbj\|AB100016.1\| Leiognathus elongatus mitochondrial genes for NA...	40	6.4
41	gb\|AC154860.2\| Mus musculus BAC clone RP23-9N20 from 13, complet...	40	6.4
42	gb\|AC154321.2\| Mus musculus BAC clone RP23-316B9 from 13, comple...	40	6.4
43	emb\|Z71633.1\|SCYNR018W S.cerevisiae chromosome XIV reading frame...	40	6.4
44	emb\|AJ558236.1\|HSA558236 Homo sapiens partial CART1 gene for car...	40	6.4
45	gb\|CP000086.1\| Burkholderia thailandensis E264 chromosome I, com...	40	6.4
46	gb\|AE016958.1\| Mycobacterium avium subsp. paratuberculosis str. ...	40	6.4
47	emb\|CR382131.1\| Yarrowia lipolytica chromosome E of strain CLIB ...	40	6.4

>gb|AY105317.1| Zea mays PCO123556 mRNA sequence
          Length = 730

 Score =  246 bits (124), Expect = 6e-62
 Identities = 205/232 (88%)
 Strand = Plus / Plus

                                                                       
Query: 111 acgtcgaggaggaggtcgggaggctcaaggaggagatccagaggctcggccagcagcagc 170
           |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 191 acgtggaggaggaggtcgggaggctcaaggaggagatccataggctcggccagcagcagc 250

                                                                       
Query: 171 ccgacggctcctacaaggtcaaatttggtgtcatcttcaatgatgaccgatgtgcaaaca 230
           |||| ||||| ||||||||||| ||||| ||  ||||||| || || || |||||||| |
Sbjct: 251 ccgatggctcttacaaggtcaagtttggcgttctcttcaacgacgatcggtgtgcaaata 310

                                                                       
Query: 231 tatttgaagcattagttggcaccttgcgggccgccaagaagaggaaagttgtcacctacg 290
           | ||||||||| |||||||||||||| |||||||||||||||||||  |  | |||||||
Sbjct: 311 tctttgaagcactagttggcaccttgagggccgccaagaagaggaagatcttgacctacg 370

                                                               
Query: 291 acggtgaaatgcttctgcagggtgtccatgacaatgtggagataaccctgtt 342
           | || ||  |||||||||| |||||||||||||| |||||||||||||||||
Sbjct: 371 aaggcgagctgcttctgcaaggtgtccatgacaacgtggagataaccctgtt 422

to top

>dbj|AK062756.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-G08, full
           insert sequence
          Length = 543

 Score =  234 bits (118), Expect = 2e-58
 Identities = 226/262 (86%)
 Strand = Plus / Plus

                                                                       
Query: 111 acgtcgaggaggaggtcgggaggctcaaggaggagatccagaggctcggccagcagcagc 170
           |||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 85  acgtggaggaggaggtggggaagctcaaggaggagatccagaggctcggccagaagcagc 144

                                                                       
Query: 171 ccgacggctcctacaaggtcaaatttggtgtcatcttcaatgatgaccgatgtgcaaaca 230
           |||| || ||||||||||| |  || ||||| |||||||| |||||||| ||||||||||
Sbjct: 145 ccgatggatcctacaaggtaactttcggtgttatcttcaacgatgaccgttgtgcaaaca 204

                                                                       
Query: 231 tatttgaagcattagttggcaccttgcgggccgccaagaagaggaaagttgtcacctacg 290
           ||||||||||| |||| |||||||||||||| ||||||||||| ||| |||| |  || |
Sbjct: 205 tatttgaagcactagtcggcaccttgcgggctgccaagaagagaaaaattgttaagtatg 264

                                                                       
Query: 291 acggtgaaatgcttctgcagggtgtccatgacaatgtggagataaccctgttcgctcccc 350
           | |||||  ||||||| ||||| |  ||||||||||| ||||||||||||||  |||| |
Sbjct: 265 atggtgagctgcttctacagggggctcatgacaatgttgagataaccctgttgcctcctc 324

                                 
Query: 351 ccgcggtcgctgatgcttgaag 372
           | |||||||||| ||| |||||
Sbjct: 325 cagcggtcgctgctgcctgaag 346

to top

>gb|AC097277.6| Oryza sativa chromosome 3 BAC OSJNBa0022C08 genomic sequence, complete
             sequence
          Length = 150155

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Minus

                                                                         
Query: 197   ggtgtcatcttcaatgatgaccgatgtgcaaacatatttgaagcattagttggcaccttg 256
             ||||| |||||||| |||||||| ||||||||||||||||||||| |||| |||||||||
Sbjct: 41692 ggtgttatcttcaacgatgaccgttgtgcaaacatatttgaagcactagtcggcaccttg 41633

                                                                         
Query: 257   cgggccgccaagaagaggaaagttgtcacctacgacggtgaaatgcttctgcagggtgtc 316
             ||||| ||||||||||| ||| |||| |  || || |||||  ||||||| ||||| |  
Sbjct: 41632 cgggctgccaagaagagaaaaattgttaagtatgatggtgagctgcttctacagggggct 41573

                                                                     
Query: 317   catgacaatgtggagataaccctgttcgctccccccgcggtcgctgatgcttgaag 372
             ||||||||||| ||||||||||||||  |||| || |||||||||| ||| |||||
Sbjct: 41572 catgacaatgttgagataaccctgttgcctcctccagcggtcgctgctgcctgaag 41517



 Score =  109 bits (55), Expect = 8e-21
 Identities = 73/79 (92%)
 Strand = Plus / Minus

                                                                         
Query: 111   acgtcgaggaggaggtcgggaggctcaaggaggagatccagaggctcggccagcagcagc 170
             |||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 43594 acgtggaggaggaggtggggaagctcaaggaggagatccagaggctcggccagaagcagc 43535

                                
Query: 171   ccgacggctcctacaaggt 189
             |||| || |||||||||||
Sbjct: 43534 ccgatggatcctacaaggt 43516

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Plus

                                                                            
Query: 197      ggtgtcatcttcaatgatgaccgatgtgcaaacatatttgaagcattagttggcaccttg 256
                ||||| |||||||| |||||||| ||||||||||||||||||||| |||| |||||||||
Sbjct: 27262703 ggtgttatcttcaacgatgaccgttgtgcaaacatatttgaagcactagtcggcaccttg 27262762

                                                                            
Query: 257      cgggccgccaagaagaggaaagttgtcacctacgacggtgaaatgcttctgcagggtgtc 316
                ||||| ||||||||||| ||| |||| |  || || |||||  ||||||| ||||| |  
Sbjct: 27262763 cgggctgccaagaagagaaaaattgttaagtatgatggtgagctgcttctacagggggct 27262822

                                                                        
Query: 317      catgacaatgtggagataaccctgttcgctccccccgcggtcgctgatgcttgaag 372
                ||||||||||| ||||||||||||||  |||| || |||||||||| ||| |||||
Sbjct: 27262823 catgacaatgttgagataaccctgttgcctcctccagcggtcgctgctgcctgaag 27262878



 Score =  109 bits (55), Expect = 8e-21
 Identities = 73/79 (92%)
 Strand = Plus / Plus

                                                                            
Query: 111      acgtcgaggaggaggtcgggaggctcaaggaggagatccagaggctcggccagcagcagc 170
                |||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 27260801 acgtggaggaggaggtggggaagctcaaggaggagatccagaggctcggccagaagcagc 27260860

                                   
Query: 171      ccgacggctcctacaaggt 189
                |||| || |||||||||||
Sbjct: 27260861 ccgatggatcctacaaggt 27260879

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  143 bits (72), Expect = 6e-31
 Identities = 150/176 (85%)
 Strand = Plus / Plus

                                                                            
Query: 197      ggtgtcatcttcaatgatgaccgatgtgcaaacatatttgaagcattagttggcaccttg 256
                ||||| |||||||| |||||||| ||||||||||||||||||||| |||| |||||||||
Sbjct: 27354026 ggtgttatcttcaacgatgaccgttgtgcaaacatatttgaagcactagtcggcaccttg 27354085

                                                                            
Query: 257      cgggccgccaagaagaggaaagttgtcacctacgacggtgaaatgcttctgcagggtgtc 316
                ||||| ||||||||||| ||| |||| |  || || |||||  ||||||| ||||| |  
Sbjct: 27354086 cgggctgccaagaagagaaaaattgttaagtatgatggtgagctgcttctacagggggct 27354145

                                                                        
Query: 317      catgacaatgtggagataaccctgttcgctccccccgcggtcgctgatgcttgaag 372
                ||||||||||| ||||||||||||||  |||| || |||||||||| ||| |||||
Sbjct: 27354146 catgacaatgttgagataaccctgttgcctcctccagcggtcgctgctgcctgaag 27354201



 Score =  109 bits (55), Expect = 8e-21
 Identities = 73/79 (92%)
 Strand = Plus / Plus

                                                                            
Query: 111      acgtcgaggaggaggtcgggaggctcaaggaggagatccagaggctcggccagcagcagc 170
                |||| ||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 27352124 acgtggaggaggaggtggggaagctcaaggaggagatccagaggctcggccagaagcagc 27352183

                                   
Query: 171      ccgacggctcctacaaggt 189
                |||| || |||||||||||
Sbjct: 27352184 ccgatggatcctacaaggt 27352202

to top

>ref|NM_119519.2| Arabidopsis thaliana unknown protein AT4G33630 transcript variant
            AT4G33630.1 mRNA, complete cds
          Length = 2873

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 206  ttcaatgatgaccgatgtgcaaacatatttgaagcattagttgg 249
            |||||||| || |||||||| ||||| ||||||||||| |||||
Sbjct: 2853 ttcaatgacgatcgatgtgccaacatctttgaagcattggttgg 2810

to top

>ref|NM_179157.1| Arabidopsis thaliana unknown protein AT4G33630 transcript variant
            AT4G33630.2 mRNA, complete cds
          Length = 2877

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 206  ttcaatgatgaccgatgtgcaaacatatttgaagcattagttgg 249
            |||||||| || |||||||| ||||| ||||||||||| |||||
Sbjct: 2857 ttcaatgacgatcgatgtgccaacatctttgaagcattggttgg 2814

to top

>ref|NM_119520.2| Arabidopsis thaliana unknown protein AT4G33640 mRNA, complete cds
          Length = 559

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 206 ttcaatgatgaccgatgtgcaaacatatttgaagcattagttgg 249
           |||||||| || |||||||| ||||| ||||||||||| |||||
Sbjct: 192 ttcaatgacgatcgatgtgccaacatctttgaagcattggttgg 235

to top

>gb|BT025572.1| Arabidopsis thaliana At4g33640 mRNA, complete cds
          Length = 288

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 206 ttcaatgatgaccgatgtgcaaacatatttgaagcattagttgg 249
           |||||||| || |||||||| ||||| ||||||||||| |||||
Sbjct: 100 ttcaatgacgatcgatgtgccaacatctttgaagcattggttgg 143

to top

>emb|AL161583.2|ATCHRIV79 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 79
          Length = 199536

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 206    ttcaatgatgaccgatgtgcaaacatatttgaagcattagttgg 249
              |||||||| || |||||||| ||||| ||||||||||| |||||
Sbjct: 188005 ttcaatgacgatcgatgtgccaacatctttgaagcattggttgg 187962

to top

>emb|AL031394.1|ATT16L1 Arabidopsis thaliana DNA chromosome 4, BAC clone T16L1 (ESSAII project)
          Length = 98124

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 206   ttcaatgatgaccgatgtgcaaacatatttgaagcattagttgg 249
             |||||||| || |||||||| ||||| ||||||||||| |||||
Sbjct: 40687 ttcaatgacgatcgatgtgccaacatctttgaagcattggttgg 40644

to top

>gb|AC148971.3| Medicago truncatula chromosome 2 BAC clone mth2-79e23, complete
             sequence
          Length = 108394

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 210   atgatgaccgatgtgcaaacatatttgaagca 241
             ||||||||| ||||||||| ||||||||||||
Sbjct: 38995 atgatgaccaatgtgcaaatatatttgaagca 38964



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 293   ggtgaaatgcttctgcagggtgtccatgacaatgtgga 330
             |||||| |||| ||||| || |||||||||||||||||
Sbjct: 38912 ggtgaattgctgctgcaaggagtccatgacaatgtgga 38875

to top

>emb|BX829162.1|CNS0A3EX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL77ZB03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 468

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 206 ttcaatgatgaccgatgtgcaaacatatttgaagcattagttgg 249
           |||||||| || |||||||| ||||| ||||||||||| |||||
Sbjct: 112 ttcaatgacgatcgatgtgccaacatctttgaagcattggttgg 155

to top

>emb|BX828619.1|CNS0A3FS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL22ZE03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 502

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 206 ttcaatgatgaccgatgtgcaaacatatttgaagcattagttgg 249
           |||||||| || |||||||| ||||| ||||||||||| |||||
Sbjct: 144 ttcaatgacgatcgatgtgccaacatctttgaagcattggttgg 187

to top

>gb|AY087101.1| Arabidopsis thaliana clone 31672 mRNA, complete sequence
          Length = 516

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 206 ttcaatgatgaccgatgtgcaaacatatttgaagcattagttgg 249
           |||||||| || |||||||| ||||| ||||||||||| |||||
Sbjct: 157 ttcaatgacgatcgatgtgccaacatctttgaagcattggttgg 200

to top

>dbj|AP006357.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT36C13, TM0100a,
             complete sequence
          Length = 79575

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 210   atgatgaccgatgtgcaaacatatttgaagca 241
             ||||||| ||||| ||||||||||||||||||
Sbjct: 74935 atgatgatcgatgcgcaaacatatttgaagca 74904

to top

>gb|DQ144724.1| Bifidobacterium breve Tkt (tkt), HrcA (hrcA), DnaJ2 (dnaJ2),
            hypothetical protein, and Bac (bac) genes, complete cds
          Length = 6640

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 167  cagcccgacggctcctacaagg 188
            ||||||||||||||||||||||
Sbjct: 1426 cagcccgacggctcctacaagg 1405

to top

>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome
          Length = 2256640

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 167    cagcccgacggctcctacaagg 188
              ||||||||||||||||||||||
Sbjct: 497155 cagcccgacggctcctacaagg 497134

to top

>ref|XM_748369.1| Aspergillus fumigatus Af293 Rho guanyl nucleotide exchange factor
            (Afu5g11890) partial mRNA
          Length = 4656

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 118  ggaggaggtcgggaggctcaaggaggaga 146
            ||||||| |||||||||||||| ||||||
Sbjct: 4551 ggaggagatcgggaggctcaagaaggaga 4579

to top

>emb|Z93059.1|SLZ93059 S.latifolia mRNA, clone CCLS 86.1
          Length = 464

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 212 gatgaccgatgtgcaaacatatttgaagc 240
           |||||||| |||||||| |||||||||||
Sbjct: 54  gatgaccgctgtgcaaatatatttgaagc 82

to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 161     cagcagcagcccgacggctc 180
               ||||||||||||||||||||
Sbjct: 3991504 cagcagcagcccgacggctc 3991523

to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 155     ctcggccagcagcagcccga 174
               ||||||||||||||||||||
Sbjct: 1856016 ctcggccagcagcagcccga 1856035

to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 166    gcagcccgacggctcctacaaggt 189
              ||||||||||||||| ||||||||
Sbjct: 433179 gcagcccgacggctcgtacaaggt 433156

to top

>ref|XM_594837.2| PREDICTED: Bos taurus similar to two pore segment channel 2
           (LOC516679), mRNA
          Length = 1731

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 157 cggccagcagcagcccgacg 176
           ||||||||||||||||||||
Sbjct: 151 cggccagcagcagcccgacg 132

to top

>ref|XM_421389.1| PREDICTED: Gallus gallus similar to kinesin light chain 1J; KLC1J
            (LOC423484), mRNA
          Length = 3682

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 223  tgcaaacatatttgaagcat 242
            ||||||||||||||||||||
Sbjct: 2752 tgcaaacatatttgaagcat 2771

to top

>gb|AC147837.2| Xenopus tropicalis clone CH216-28I17, complete sequence
          Length = 181178

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 225  caaacatatttgaagcatta 244
            ||||||||||||||||||||
Sbjct: 9449 caaacatatttgaagcatta 9430

to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 166     gcagcccgacggctcctacaaggt 189
               ||||||||||||||| ||||||||
Sbjct: 3280746 gcagcccgacggctcgtacaaggt 3280723

to top

>gb|AC161228.7| Mus musculus chromosome 3, clone RP24-77I5, complete sequence
          Length = 222551

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 309  agggtgtccatgacaatgtggaga 332
            |||||||||||||| |||||||||
Sbjct: 9545 agggtgtccatgaccatgtggaga 9522

to top

>gb|AC122841.4| Mus musculus BAC clone RP23-194E5 from 3, complete sequence
          Length = 200088

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 309   agggtgtccatgacaatgtggaga 332
             |||||||||||||| |||||||||
Sbjct: 64183 agggtgtccatgaccatgtggaga 64206

to top

>emb|AJ971884.1| Streptomyces sp. Bt 47 partial 16S rRNA gene, isolate Bt 47
          Length = 1395

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 333 taaccctgttcgctcccccc 352
           ||||||||||||||||||||
Sbjct: 714 taaccctgttcgctcccccc 695

to top

>ref|XM_504456.1| Yarrowia lipolytica CLIB122, YALI0E27181g predicted mRNA
          Length = 2067

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 132 ggctcaaggaggagatccag 151
           ||||||||||||||||||||
Sbjct: 593 ggctcaaggaggagatccag 612

to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 166     gcagcccgacggctcctacaaggt 189
               ||||||||||||||| ||||||||
Sbjct: 3011921 gcagcccgacggctcgtacaaggt 3011898

to top

>emb|AL939123.1|SCO939123 Streptomyces coelicolor A3(2) complete genome; segment 20/29
          Length = 300100

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 159   gccagcagcagcccgacggc 178
             ||||||||||||||||||||
Sbjct: 94232 gccagcagcagcccgacggc 94251

to top

>emb|AJ633046.1| Ipomoea nil partial mRNA for putative CRC transcription factor 2
           (crc2 gene)
          Length = 350

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 135 tcaaggaggagatccagagg 154
           ||||||||||||||||||||
Sbjct: 266 tcaaggaggagatccagagg 285

to top

>dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, complete genome
          Length = 2685015

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 225    caaacatatttgaagcatta 244
              ||||||||||||||||||||
Sbjct: 686832 caaacatatttgaagcatta 686851

to top

>emb|CR406513.1| Gallus gallus finished cDNA, clone ChEST731l14
          Length = 1201

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 223 tgcaaacatatttgaagcat 242
           ||||||||||||||||||||
Sbjct: 269 tgcaaacatatttgaagcat 288

to top

>emb|CR390855.1| Gallus gallus finished cDNA, clone ChEST378n2
          Length = 1108

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 223 tgcaaacatatttgaagcat 242
           ||||||||||||||||||||
Sbjct: 722 tgcaaacatatttgaagcat 741

to top

>gb|AC133794.2| Homo sapiens 12 BAC RP11-193M21 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 89995

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 315  tccatgacaatgtggagata 334
            ||||||||||||||||||||
Sbjct: 6835 tccatgacaatgtggagata 6816

to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 110    cacgtcgaggaggaggtcgg 129
              ||||||||||||||||||||
Sbjct: 875454 cacgtcgaggaggaggtcgg 875435

to top

>dbj|AB100016.1| Leiognathus elongatus mitochondrial genes for NADH dehydrogenase
            subunits 4, tRNA-His, tRNA-Ser, tRNA-Leu, NADH
            dehydrogenase subunits 5
          Length = 3419

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 58   agcatcatcggagaagaaaccggcgagg 85
            |||||| | |||||||||||||||||||
Sbjct: 2784 agcatctttggagaagaaaccggcgagg 2757

to top

>gb|AC154860.2| Mus musculus BAC clone RP23-9N20 from 13, complete sequence
          Length = 192309

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 308    cagggtgtccatgacaatgt 327
              ||||||||||||||||||||
Sbjct: 191794 cagggtgtccatgacaatgt 191813

to top

>gb|AC154321.2| Mus musculus BAC clone RP23-316B9 from 13, complete sequence
          Length = 177816

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 308   cagggtgtccatgacaatgt 327
             ||||||||||||||||||||
Sbjct: 63656 cagggtgtccatgacaatgt 63637

to top

>emb|Z71633.1|SCYNR018W S.cerevisiae chromosome XIV reading frame ORF YNR018w
          Length = 1757

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 158  ggccagcagcagcccgacgg 177
            ||||||||||||||||||||
Sbjct: 1180 ggccagcagcagcccgacgg 1161

to top

>emb|AJ558236.1|HSA558236 Homo sapiens partial CART1 gene for cartilage paired-class
            homeoprotein 1, exons 1-3 and joined CDS
          Length = 6836

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 315  tccatgacaatgtggagata 334
            ||||||||||||||||||||
Sbjct: 6369 tccatgacaatgtggagata 6388

to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 166     gcagcccgacggctcctacaaggt 189
               ||||||||||||||| ||||||||
Sbjct: 1865026 gcagcccgacggctcgtacaaggt 1865049

to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 157     cggccagcagcagcccgacg 176
               ||||||||||||||||||||
Sbjct: 1125158 cggccagcagcagcccgacg 1125177

to top

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 132     ggctcaaggaggagatccag 151
               ||||||||||||||||||||
Sbjct: 3221629 ggctcaaggaggagatccag 3221648


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,009,475
Number of Sequences: 3902068
Number of extensions: 4009475
Number of successful extensions: 90986
Number of sequences better than 10.0: 47
Number of HSP's better than 10.0 without gapping: 47
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 90344
Number of HSP's gapped (non-prelim): 641
length of query: 474
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 452
effective length of database: 17,147,199,772
effective search space: 7750534296944
effective search space used: 7750534296944
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result