>gb|AC124128.11| Mus musculus chromosome 6, clone RP23-158O11, complete sequence
          Length = 208907

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 245    ctgcttttcttcctcaagctc 265
              |||||||||||||||||||||
Sbjct: 101672 ctgcttttcttcctcaagctc 101692

>gb|AC148664.1| Macaca mulatta Major Histocompatibility Complex BAC MMU021E24, complete
              sequence
          Length = 189424

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 238    ccatatcctgcttttcttcctcaag 262
              |||| ||||||||||||||||||||
Sbjct: 122434 ccatctcctgcttttcttcctcaag 122410

>gb|AC147377.4| Mus musculus BAC clone RP23-156K23 from chromosome 5, complete sequence
          Length = 236084

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 404   agctagagccacagatgaat 423
             ||||||||||||||||||||
Sbjct: 95610 agctagagccacagatgaat 95591

>emb|AL391382.10| Human DNA sequence from clone RP11-38M15 on chromosome 13 Contains a
             chromosome 21 open reading frame 70 (C21orf70) pseudogene,
             two novel genes, a calponin 3 acidic (CNN3) pseudogene, a
             zinc finger protein 267 (ZNF267) pseudogene, two novel
             pseudogenes, a novel gene similar to chromosome 21 open
             reading frame 15 (C21orf15), a pseudogene similar to
             cytochrome P450 subfamily IVF polypeptide 8 (CYP4F8)
             (CPF8, CYPIVF8), a pseudogene similar to sorting nexin 18
             (SNX18), a melanoma antigen pseudogene and a CpG island,
             complete sequence
          Length = 186458

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   gtggttgccactggggcagt 296
             ||||||||||||||||||||
Sbjct: 46893 gtggttgccactggggcagt 46874

>gb|AC158232.2| Mus musculus BAC clone RP24-200M15 from chromosome 12, complete
             sequence
          Length = 187225

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 52    tcagaggaagcaactcagct 71
             ||||||||||||||||||||
Sbjct: 27106 tcagaggaagcaactcagct 27125

>emb|BX819869.1|CNS0AA6Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS40ZB05 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1312

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 187  gcttgttcaccagagatagt 206
            ||||||||||||||||||||
Sbjct: 1273 gcttgttcaccagagatagt 1254

>emb|BX842556.1|CNS0AEKA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB67ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1313

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 ccccagatgtggttgccact 288
           ||||||||||||||||||||
Sbjct: 214 ccccagatgtggttgccact 233

>dbj|AP006391.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT09E08, TM0265,
             complete sequence
          Length = 100864

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   ttcctcaagctcagacccca 273
             ||||||||||||||||||||
Sbjct: 96773 ttcctcaagctcagacccca 96754


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,708,285
Number of Sequences: 3902068
Number of extensions: 3708285
Number of successful extensions: 67612
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67601
Number of HSP's gapped (non-prelim): 11
length of query: 466
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 444
effective length of database: 17,147,199,772
effective search space: 7613356698768
effective search space used: 7613356698768
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)