>emb|AL353637.21| Human DNA sequence from clone RP11-159H20 on chromosome 9q21.12-21.32
Contains a DnaJ (Hsp40) homolog subfamily B member 5
(DNAJB5) pseudogene, a lysophospholipase II (LYPLA2)
pseudogene, an eukaryotic translation initiation factor 3
subunit 1 35kDa (EIF3S1) pseudogene, the gene (possible
pseudogene) for a novel protein similar to forkhead box B1
(FOXB1), ATP synthase H+ transporting mitochondrial F0
complex subunit f isoform 2 (ATP5J2) pseudogene and three
CpG islands, complete sequence
Length = 146466
Score = 42.1 bits (21), Expect = 1.7
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 421 aactcagaggagcaggagcaaaaat 445
||||||||||||||| |||||||||
Sbjct: 78420 aactcagaggagcagaagcaaaaat 78444
>emb|AL591408.19| Human DNA sequence from clone RP11-792D24 on chromosome 10 Contains the
INA gene for internexin neuronal intermediate filament
protein alpha, the RNF134 gene for ring finger protein
134, the TAF5D gene for 100 kD TAF5 RNA polymerase II TATA
box binding protein (TBP)-associated factor, a novel gene,
the 5' end of the PDCD11 gene for programmed cell death 11
and four CpG islands, complete sequence
Length = 174474
Score = 40.1 bits (20), Expect = 6.5
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 219 tctcgtctctcctttaatgccatc 242
|||||| |||||||||||||||||
Sbjct: 50407 tctcgtttctcctttaatgccatc 50384
>emb|AL606724.17| Mouse DNA sequence from clone RP23-285D3 on chromosome 11 Contains part
of a novel gene, a heat shock protein (Hsp) pseudogene and
a CpG island, complete sequence
Length = 160470
Score = 40.1 bits (20), Expect = 6.5
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 268 agatatcttgatgagaaact 287
||||||||||||||||||||
Sbjct: 114879 agatatcttgatgagaaact 114898
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
Length = 3272609
Score = 40.1 bits (20), Expect = 6.5
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 ccccgacggcctcctcgtct 93
||||||||||||||||||||
Sbjct: 1928679 ccccgacggcctcctcgtct 1928660
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,744,817
Number of Sequences: 3902068
Number of extensions: 3744817
Number of successful extensions: 79831
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79647
Number of HSP's gapped (non-prelim): 184
length of query: 484
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 462
effective length of database: 17,147,199,772
effective search space: 7922006294664
effective search space used: 7922006294664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)