ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | basd27e19 |
|---|---|
| Clone Library Name | barley_pub |
>gb|L32165.1|BLYHSPHAA Hordeum vulgare HSP70 mRNA, complete cds Length = 2028 Score = 979 bits (494), Expect = 0.0 Identities = 515/521 (98%), Gaps = 1/521 (0%) Strand = Plus / Plus Query: 2 gatcgacagaggcgaagccgccggnanaggaggaagaagaagctccagacgaggcgagga 61 |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| Sbjct: 10 gatcgacagaggcgaagccgccgg-agaggaggaagaagaagctccagacgaggcgagga 68 Query: 62 gaggagagggatcggcgtcgtggcgatggatcgggcccgcggctccgcgctgctgctcgg 121 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 69 gaggagagggatcggcgtcgtggcgatggatcgggcccgcggctccgcgctgctgctcgg 128 Query: 122 cgtcctgctcgcaggttcgctgtttgcactttgtgccgcgaaggaggaggccaagaagct 181 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 129 cgtcctgctcgcaggttcgctgtttgcactttgtgccgcgaaggaggaggccaagaagct 188 Query: 182 cggtactgtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaa 241 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 189 cggtaccgtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaa 248 Query: 242 cggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgg 301 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 249 cggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgg 308 Query: 302 gttcaccgatggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccc 361 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 309 gttcaccgatggggagaggctcatcggtgaggctgccaagaaccaggcggcggtcaaccc 368 Query: 362 cgagaggaccgtctttgacgtcaagcgtctcattggaagaaagtttgaggacaaggaggt 421 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 369 cgagaggaccgtttttgacgtcaagcgtctcattggaagaaagtttgaggacaaggaggt 428 Query: 422 gcagagggacatgaaacttgtcccctacaagattgtcaacaaggagggcaagccttacat 481 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 429 gcagagggacatgagacttgtcccctacaagattgtcaacaaggagggcaagccttacat 488 Query: 482 tcaggtcaagatcaaggatggggagaccaaggtcttcagcc 522 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 489 tcaggtcaagatcaaggatggggagaccaaggtcttcagcc 529
>ref|XM_463871.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2414 Score = 539 bits (272), Expect = e-150 Identities = 398/440 (90%) Strand = Plus / Plus Query: 83 ggcgatggatcgggcccgcggctccgcgctgctgctcggcgtcctgctcgcaggttcgct 142 |||||||||||||| ||||| | |||| | ||||||||||||||||||||||| || || Sbjct: 144 ggcgatggatcgggttcgcggatgcgcgttcctgctcggcgtcctgctcgcaggatccct 203 Query: 143 gtttgcactttgtgccgcgaaggaggaggccaagaagctcggtactgtgatcggtatcga 202 ||||||| ||| || |||||||||||| |||||||||||||||| ||||||||||| || Sbjct: 204 gtttgcattttctgttgcgaaggaggagaccaagaagctcggtaccgtgatcggtattga 263 Query: 203 tctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgc 262 ||| ||||| |||||||| |||||||||||||||||||| |||||||||||||||||||| Sbjct: 264 tcttggtacaacctactcgtgtgtcggtgtgtacaagaatggtcatgtcgagattatcgc 323 Query: 263 caatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggct 322 |||||||||||||||||||||||| ||||||||||||| ||||||||| | |||||||| Sbjct: 324 caatgaccagggtaaccgtatcacaccctcatgggttgcattcaccgatagcgagaggct 383 Query: 323 catcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgt 382 ||||||||||||||| ||||||||||| || || ||||| ||||||||| |||| || || Sbjct: 384 catcggtgaggctgccaagaaccaggcagctgtgaacccagagaggaccatcttcgatgt 443 Query: 383 caagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgt 442 ||| ||||||||||||||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 444 caaacgtctcattggaagaaagtttgaagacaaggaagttcagagggacatgaaacttgt 503 Query: 443 cccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatgg 502 ||||||||||||||| |||||||| || ||||| |||||||||||||||||||||||||| Sbjct: 504 cccctacaagattgtgaacaaggacggtaagccctacattcaggtcaagatcaaggatgg 563 Query: 503 ggagaccaaggtcttcagcc 522 |||| |||||||||||||| Sbjct: 564 agagaacaaggtcttcagcc 583
>ref|XM_506683.1| PREDICTED Oryza sativa (japonica cultivar-group), P0036E06.29 mRNA Length = 2417 Score = 539 bits (272), Expect = e-150 Identities = 398/440 (90%) Strand = Plus / Plus Query: 83 ggcgatggatcgggcccgcggctccgcgctgctgctcggcgtcctgctcgcaggttcgct 142 |||||||||||||| ||||| | |||| | ||||||||||||||||||||||| || || Sbjct: 111 ggcgatggatcgggttcgcggatgcgcgttcctgctcggcgtcctgctcgcaggatccct 170 Query: 143 gtttgcactttgtgccgcgaaggaggaggccaagaagctcggtactgtgatcggtatcga 202 ||||||| ||| || |||||||||||| |||||||||||||||| ||||||||||| || Sbjct: 171 gtttgcattttctgttgcgaaggaggagaccaagaagctcggtaccgtgatcggtattga 230 Query: 203 tctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgc 262 ||| ||||| |||||||| |||||||||||||||||||| |||||||||||||||||||| Sbjct: 231 tcttggtacaacctactcgtgtgtcggtgtgtacaagaatggtcatgtcgagattatcgc 290 Query: 263 caatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggct 322 |||||||||||||||||||||||| ||||||||||||| ||||||||| | |||||||| Sbjct: 291 caatgaccagggtaaccgtatcacaccctcatgggttgcattcaccgatagcgagaggct 350 Query: 323 catcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgt 382 ||||||||||||||| ||||||||||| || || ||||| ||||||||| |||| || || Sbjct: 351 catcggtgaggctgccaagaaccaggcagctgtgaacccagagaggaccatcttcgatgt 410 Query: 383 caagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgt 442 ||| ||||||||||||||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 411 caaacgtctcattggaagaaagtttgaagacaaggaagttcagagggacatgaaacttgt 470 Query: 443 cccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatgg 502 ||||||||||||||| |||||||| || ||||| |||||||||||||||||||||||||| Sbjct: 471 cccctacaagattgtgaacaaggacggtaagccctacattcaggtcaagatcaaggatgg 530 Query: 503 ggagaccaaggtcttcagcc 522 |||| |||||||||||||| Sbjct: 531 agagaacaaggtcttcagcc 550
>dbj|AK119653.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H01, full insert sequence Length = 2414 Score = 539 bits (272), Expect = e-150 Identities = 398/440 (90%) Strand = Plus / Plus Query: 83 ggcgatggatcgggcccgcggctccgcgctgctgctcggcgtcctgctcgcaggttcgct 142 |||||||||||||| ||||| | |||| | ||||||||||||||||||||||| || || Sbjct: 144 ggcgatggatcgggttcgcggatgcgcgttcctgctcggcgtcctgctcgcaggatccct 203 Query: 143 gtttgcactttgtgccgcgaaggaggaggccaagaagctcggtactgtgatcggtatcga 202 ||||||| ||| || |||||||||||| |||||||||||||||| ||||||||||| || Sbjct: 204 gtttgcattttctgttgcgaaggaggagaccaagaagctcggtaccgtgatcggtattga 263 Query: 203 tctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgc 262 ||| ||||| |||||||| |||||||||||||||||||| |||||||||||||||||||| Sbjct: 264 tcttggtacaacctactcgtgtgtcggtgtgtacaagaatggtcatgtcgagattatcgc 323 Query: 263 caatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggct 322 |||||||||||||||||||||||| ||||||||||||| ||||||||| | |||||||| Sbjct: 324 caatgaccagggtaaccgtatcacaccctcatgggttgcattcaccgatagcgagaggct 383 Query: 323 catcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgt 382 ||||||||||||||| ||||||||||| || || ||||| ||||||||| |||| || || Sbjct: 384 catcggtgaggctgccaagaaccaggcagctgtgaacccagagaggaccatcttcgatgt 443 Query: 383 caagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgt 442 ||| ||||||||||||||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 444 caaacgtctcattggaagaaagtttgaagacaaggaagttcagagggacatgaaacttgt 503 Query: 443 cccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatgg 502 ||||||||||||||| |||||||| || ||||| |||||||||||||||||||||||||| Sbjct: 504 cccctacaagattgtgaacaaggacggtaagccctacattcaggtcaagatcaaggatgg 563 Query: 503 ggagaccaaggtcttcagcc 522 |||| |||||||||||||| Sbjct: 564 agagaacaaggtcttcagcc 583
>dbj|AK065743.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013040G16, full insert sequence Length = 2416 Score = 539 bits (272), Expect = e-150 Identities = 398/440 (90%) Strand = Plus / Plus Query: 83 ggcgatggatcgggcccgcggctccgcgctgctgctcggcgtcctgctcgcaggttcgct 142 |||||||||||||| ||||| | |||| | ||||||||||||||||||||||| || || Sbjct: 111 ggcgatggatcgggttcgcggatgcgcgttcctgctcggcgtcctgctcgcaggatccct 170 Query: 143 gtttgcactttgtgccgcgaaggaggaggccaagaagctcggtactgtgatcggtatcga 202 ||||||| ||| || |||||||||||| |||||||||||||||| ||||||||||| || Sbjct: 171 gtttgcattttctgttgcgaaggaggagaccaagaagctcggtaccgtgatcggtattga 230 Query: 203 tctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgc 262 ||| ||||| |||||||| |||||||||||||||||||| |||||||||||||||||||| Sbjct: 231 tcttggtacaacctactcgtgtgtcggtgtgtacaagaatggtcatgtcgagattatcgc 290 Query: 263 caatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggct 322 |||||||||||||||||||||||| ||||||||||||| ||||||||| | |||||||| Sbjct: 291 caatgaccagggtaaccgtatcacaccctcatgggttgcattcaccgatagcgagaggct 350 Query: 323 catcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgt 382 ||||||||||||||| ||||||||||| || || ||||| ||||||||| |||| || || Sbjct: 351 catcggtgaggctgccaagaaccaggcagctgtgaacccagagaggaccatcttcgatgt 410 Query: 383 caagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgt 442 ||| ||||||||||||||||||||||| |||||||| || |||||||||||||||||||| Sbjct: 411 caaacgtctcattggaagaaagtttgaagacaaggaagttcagagggacatgaaacttgt 470 Query: 443 cccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatgg 502 ||||||||||||||| |||||||| || ||||| |||||||||||||||||||||||||| Sbjct: 471 cccctacaagattgtgaacaaggacggtaagccctacattcaggtcaagatcaaggatgg 530 Query: 503 ggagaccaaggtcttcagcc 522 |||| |||||||||||||| Sbjct: 531 agagaacaaggtcttcagcc 550
>gb|U58209.1|ZMU58209 Zea mays lumenal binding protein cBiPe3 mRNA, complete cds Length = 2365 Score = 523 bits (264), Expect = e-145 Identities = 393/436 (90%) Strand = Plus / Plus Query: 87 atggatcgggcccgcggctccgcgctgctgctcggcgtcctgctcgcaggttcgctgttt 146 |||||||||| || || |||||| | ||||||||||||||||||||||| || ||||| Sbjct: 110 atggatcgggttcgtggatccgcgttcctgctcggcgtcctgctcgcaggatccctgttc 169 Query: 147 gcactttgtgccgcgaaggaggaggccaagaagctcggtactgtgatcggtatcgatctc 206 || ||| | || ||||||||| ||||||||||||| |||||||| |||||||||||| Sbjct: 170 gcgttttcagttgctaaggaggagaccaagaagctcggcactgtgattggtatcgatctc 229 Query: 207 ggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaat 266 || ||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||| Sbjct: 230 ggaaccacctactcctgtgtgggtgtgtacaagaacggtcatgtcgagatcatcgccaat 289 Query: 267 gaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatc 326 |||||||||||||||||||| ||||||||||||| ||||||||| | |||||||||||| Sbjct: 290 gaccagggtaaccgtatcacaccctcatgggttgccttcaccgatagcgagaggctcatc 349 Query: 327 ggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaag 386 ||||||||||| ||||||||||| || |||||||| ||||||||| |||||||||||||| Sbjct: 350 ggtgaggctgccaagaaccaggcagctgtcaaccctgagaggaccatctttgacgtcaag 409 Query: 387 cgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgtcccc 446 |||||||| |||||||||||| |||| ||||| || |||||||||||||||||||||||| Sbjct: 410 cgtctcatcggaagaaagtttcaggataaggaagtccagagggacatgaaacttgtcccc 469 Query: 447 tacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatggggag 506 ||||||||| | |||||||| |||||||| |||||||||||||||||||||||||||||| Sbjct: 470 tacaagattattaacaaggatggcaagccatacattcaggtcaagatcaaggatggggag 529 Query: 507 accaaggtcttcagcc 522 | |||||||||||||| Sbjct: 530 aacaaggtcttcagcc 545
>gb|U58208.1|ZMU58208 Zea mays lumenal binding protein cBiPe2 mRNA, complete cds Length = 2338 Score = 515 bits (260), Expect = e-143 Identities = 392/436 (89%) Strand = Plus / Plus Query: 87 atggatcgggcccgcggctccgcgctgctgctcggcgtcctgctcgcaggttcgctgttt 146 ||||||||||| ||||| |||||| | ||||||||||||||||||||||| || |||| Sbjct: 127 atggatcgggctcgcggatccgcgttcctgctcggcgtcctgctcgcaggatccttgttc 186 Query: 147 gcactttgtgccgcgaaggaggaggccaagaagctcggtactgtgatcggtatcgatctc 206 || ||| | || || |||||| ||||||||||||| || ||||||||||||||||| Sbjct: 187 gcgttttcagttgctaaagaggagaccaagaagctcgggaccgtgatcggtatcgatctt 246 Query: 207 ggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaat 266 |||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||| Sbjct: 247 ggtaccacctactcctgtgtcggtgtctacaagaacggtcatgtcgagatcatcgccaat 306 Query: 267 gaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatc 326 |||||||||||||||||||| ||||||||||||| ||||||||| | |||||||||||| Sbjct: 307 gaccagggtaaccgtatcacaccctcatgggttgccttcaccgatagcgagaggctcatc 366 Query: 327 ggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaag 386 ||||||||||| ||||||||||| || |||||||| ||||||||| |||||||||||||| Sbjct: 367 ggtgaggctgccaagaaccaggcagccgtcaaccctgagaggaccatctttgacgtcaag 426 Query: 387 cgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgtcccc 446 |||||||| ||||||||||| | ||||||||| || |||||||||||||||||||| ||| Sbjct: 427 cgtctcatcggaagaaagttcgcggacaaggaagtccagagggacatgaaacttgttccc 486 Query: 447 tacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatggggag 506 ||||||||| | |||||||| |||||||| |||||||||||||||||||||||||||||| Sbjct: 487 tacaagattattaacaaggatggcaagccctacattcaggtcaagatcaaggatggggag 546 Query: 507 accaaggtcttcagcc 522 | |||||||||||||| Sbjct: 547 aacaaggtcttcagcc 562
>gb|AF006825.1|AF006825 Oryza sativa endosperm lumenal binding protein (BiP) mRNA, complete cds Length = 2417 Score = 492 bits (248), Expect = e-136 Identities = 389/436 (89%) Strand = Plus / Plus Query: 87 atggatcgggcccgcggctccgcgctgctgctcggcgtcctgctcgcaggttcgctgttt 146 |||||||||| ||||| || ||| | ||||||||||||||||||||||| || |||||| Sbjct: 121 atggatcgggttcgcggatctgcgttcctgctcggcgtcctgctcgcaggatccctgttt 180 Query: 147 gcactttgtgccgcgaaggaggaggccaagaagctcggtactgtgatcggtatcgatctc 206 ||| ||| || |||||||||||| |||||||||||||||| ||||||||||| ||||| Sbjct: 181 gcattttctgttgcgaaggaggagaccaagaagctcggtaccgtgatcggtattgatctt 240 Query: 207 ggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaat 266 ||||| |||||||| |||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 241 ggtacaacctactcgtgtgtcggtgtgtacaagaatggtcatgtcgagattatcgccaat 300 Query: 267 gaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatc 326 |||||||||||||||||||| ||||||||||||| ||||||||| | |||||||||||| Sbjct: 301 gaccagggtaaccgtatcacaccctcatgggttgcattcaccgatagcgagaggctcatc 360 Query: 327 ggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaag 386 ||||||||||| ||||||||||| || || ||||| ||||||||| |||| || ||||| Sbjct: 361 ggtgaggctgccaagaaccaggcagctgtgaacccagagaggaccatcttcgatgtcaaa 420 Query: 387 cgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgtcccc 446 ||| |||||||||||||||||| || ||||| || |||||||||||||||||||||||| Sbjct: 421 cgtgacattggaagaaagtttgaagagaaggaagttcagagggacatgaaacttgtcccc 480 Query: 447 tacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatggggag 506 ||||||||||| |||||| || ||||| |||||||||||||||||||||||||| ||| Sbjct: 481 tacaagattgtgaacaagatcggtaagccctacattcaggtcaagatcaaggatggagag 540 Query: 507 accaaggtcttcagcc 522 | |||||||||||||| Sbjct: 541 aacaaggtcttcagcc 556
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 329 bits (166), Expect = 5e-87 Identities = 247/274 (90%) Strand = Plus / Minus Query: 132 gcaggttcgctgtttgcactttgtgccgcgaaggaggaggccaagaagctcggtactgtg 191 ||||| || ||||||||| ||| || |||||||||||| |||||||||||||||| ||| Sbjct: 841760 gcaggatccctgtttgcattttctgttgcgaaggaggagaccaagaagctcggtaccgtg 841701 Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtc 251 |||||||| ||||| ||||| |||||||| |||||||||||||||||||| ||||||||| Sbjct: 841700 atcggtattgatcttggtacaacctactcgtgtgtcggtgtgtacaagaatggtcatgtc 841641 Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgat 311 ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| Sbjct: 841640 gagattatcgccaatgaccagggtaaccgtatcacaccctcatgggttgcattcaccgat 841581 Query: 312 ggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggacc 371 | ||||||||||||||||||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 841580 agcgagaggctcatcggtgaggctgccaagaaccaggcagctgtgaacccagagaggacc 841521 Query: 372 gtctttgacgtcaagcgtctcattggaagaaagt 405 |||| || ||||| ||||||||||||||||||| Sbjct: 841520 atcttcgatgtcaaacgtctcattggaagaaagt 841487 Score = 165 bits (83), Expect = 2e-37 Identities = 110/119 (92%) Strand = Plus / Minus Query: 404 gtttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaagattgtcaacaa 463 |||||| |||||||| || ||||||||||||||||||||||||||||||||||| ||||| Sbjct: 841403 gtttgaagacaaggaagttcagagggacatgaaacttgtcccctacaagattgtgaacaa 841344 Query: 464 ggagggcaagccttacattcaggtcaagatcaaggatggggagaccaaggtcttcagcc 522 ||| || ||||| |||||||||||||||||||||||||| |||| |||||||||||||| Sbjct: 841343 ggacggtaagccctacattcaggtcaagatcaaggatggagagaacaaggtcttcagcc 841285 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 83 ggcgatggatcgggcccgcggctccgcgctgctgctcggcgtcctgctcgcaggt 137 |||||||||||||| ||||| | |||| | |||||||||||||||||||||||| Sbjct: 842529 ggcgatggatcgggttcgcggatgcgcgttcctgctcggcgtcctgctcgcaggt 842475
>dbj|AP004121.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1442_E05 Length = 162407 Score = 329 bits (166), Expect = 5e-87 Identities = 247/274 (90%) Strand = Plus / Minus Query: 132 gcaggttcgctgtttgcactttgtgccgcgaaggaggaggccaagaagctcggtactgtg 191 ||||| || ||||||||| ||| || |||||||||||| |||||||||||||||| ||| Sbjct: 50968 gcaggatccctgtttgcattttctgttgcgaaggaggagaccaagaagctcggtaccgtg 50909 Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtc 251 |||||||| ||||| ||||| |||||||| |||||||||||||||||||| ||||||||| Sbjct: 50908 atcggtattgatcttggtacaacctactcgtgtgtcggtgtgtacaagaatggtcatgtc 50849 Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgat 311 ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| Sbjct: 50848 gagattatcgccaatgaccagggtaaccgtatcacaccctcatgggttgcattcaccgat 50789 Query: 312 ggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggacc 371 | ||||||||||||||||||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 50788 agcgagaggctcatcggtgaggctgccaagaaccaggcagctgtgaacccagagaggacc 50729 Query: 372 gtctttgacgtcaagcgtctcattggaagaaagt 405 |||| || ||||| ||||||||||||||||||| Sbjct: 50728 atcttcgatgtcaaacgtctcattggaagaaagt 50695 Score = 165 bits (83), Expect = 2e-37 Identities = 110/119 (92%) Strand = Plus / Minus Query: 404 gtttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaagattgtcaacaa 463 |||||| |||||||| || ||||||||||||||||||||||||||||||||||| ||||| Sbjct: 50611 gtttgaagacaaggaagttcagagggacatgaaacttgtcccctacaagattgtgaacaa 50552 Query: 464 ggagggcaagccttacattcaggtcaagatcaaggatggggagaccaaggtcttcagcc 522 ||| || ||||| |||||||||||||||||||||||||| |||| |||||||||||||| Sbjct: 50551 ggacggtaagccctacattcaggtcaagatcaaggatggagagaacaaggtcttcagcc 50493 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 83 ggcgatggatcgggcccgcggctccgcgctgctgctcggcgtcctgctcgcaggt 137 |||||||||||||| ||||| | |||| | |||||||||||||||||||||||| Sbjct: 51737 ggcgatggatcgggttcgcggatgcgcgttcctgctcggcgtcctgctcgcaggt 51683
>dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0036E06 Length = 137926 Score = 329 bits (166), Expect = 5e-87 Identities = 247/274 (90%) Strand = Plus / Minus Query: 132 gcaggttcgctgtttgcactttgtgccgcgaaggaggaggccaagaagctcggtactgtg 191 ||||| || ||||||||| ||| || |||||||||||| |||||||||||||||| ||| Sbjct: 119891 gcaggatccctgtttgcattttctgttgcgaaggaggagaccaagaagctcggtaccgtg 119832 Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtc 251 |||||||| ||||| ||||| |||||||| |||||||||||||||||||| ||||||||| Sbjct: 119831 atcggtattgatcttggtacaacctactcgtgtgtcggtgtgtacaagaatggtcatgtc 119772 Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgat 311 ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| Sbjct: 119771 gagattatcgccaatgaccagggtaaccgtatcacaccctcatgggttgcattcaccgat 119712 Query: 312 ggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggacc 371 | ||||||||||||||||||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 119711 agcgagaggctcatcggtgaggctgccaagaaccaggcagctgtgaacccagagaggacc 119652 Query: 372 gtctttgacgtcaagcgtctcattggaagaaagt 405 |||| || ||||| ||||||||||||||||||| Sbjct: 119651 atcttcgatgtcaaacgtctcattggaagaaagt 119618 Score = 165 bits (83), Expect = 2e-37 Identities = 110/119 (92%) Strand = Plus / Minus Query: 404 gtttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaagattgtcaacaa 463 |||||| |||||||| || ||||||||||||||||||||||||||||||||||| ||||| Sbjct: 119534 gtttgaagacaaggaagttcagagggacatgaaacttgtcccctacaagattgtgaacaa 119475 Query: 464 ggagggcaagccttacattcaggtcaagatcaaggatggggagaccaaggtcttcagcc 522 ||| || ||||| |||||||||||||||||||||||||| |||| |||||||||||||| Sbjct: 119474 ggacggtaagccctacattcaggtcaagatcaaggatggagagaacaaggtcttcagcc 119416 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 83 ggcgatggatcgggcccgcggctccgcgctgctgctcggcgtcctgctcgcaggt 137 |||||||||||||| ||||| | |||| | |||||||||||||||||||||||| Sbjct: 120660 ggcgatggatcgggttcgcggatgcgcgttcctgctcggcgtcctgctcgcaggt 120606
>emb|AJ295617.1|CAV295617 Corylus avellana mRNA for putative luminal binding protein Length = 2007 Score = 264 bits (133), Expect = 3e-67 Identities = 259/301 (86%) Strand = Plus / Plus Query: 222 tgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccagggtaaccgt 281 ||||| ||||| ||||||||||||||||| || || || ||||| ||||| || |||||| Sbjct: 145 tgtgttggtgtctacaagaacggtcatgttgaaatcatagccaacgaccaaggaaaccgt 204 Query: 282 atcacgccctcatgggttgggttcaccgatggggagaggctcatcggtgaggctgcaaag 341 ||||| || ||||||||||| ||||| || || ||||| | |||||||||||||| ||| Sbjct: 205 atcaccccatcatgggttggattcactgacggtgagagattgatcggtgaggctgctaag 264 Query: 342 aaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaagcgtctcattggaaga 401 |||||||| || |||||||| ||||||||| ||||||| ||||| | || ||||||||| Sbjct: 265 aaccaggcagctgtcaaccctgagaggaccatctttgatgtcaaaaggcttattggaaga 324 Query: 402 aagtttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaagattgtcaac 461 |||||||| ||||||||||| |||| ||||||||| ||||| || ||||||||||| || Sbjct: 325 aagtttgaagacaaggaggttcagaaggacatgaagcttgttccatacaagattgtgaat 384 Query: 462 aaggagggcaagccttacattcaggtcaagatcaaggatggggagaccaaggtcttcagc 521 ||||| || |||||||||||||| |||||||| |||||||| ||||||||||| |||||| Sbjct: 385 aaggatggaaagccttacattcaagtcaagattaaggatggtgagaccaaggttttcagc 444 Query: 522 c 522 | Sbjct: 445 c 445
>ref|NM_123567.3| Arabidopsis thaliana BIP; ATP binding AT5G42020 (BIP) transcript variant AT5G42020.2 mRNA, complete cds Length = 2163 Score = 198 bits (100), Expect = 1e-47 Identities = 265/320 (82%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| |||||||| ||||| ||||| ||||| |||||||| |||||||| || ||||| Sbjct: 228 gatcttggtaccacttactcttgtgttggtgtttacaagaatggtcatgttgaaattatt 287 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || ||| Sbjct: 288 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaagg 347 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| |||||||| || || || |||||||| ||||| ||| Sbjct: 348 ctcattggtgaggctgctaagaatcaggcggctgttaatcctgagaggactgtcttcgac 407 Query: 381 gtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaactt 440 || ||| | | || || |||| ||||||||||||||||| || | ||||| ||||||| Sbjct: 408 gttaagagattgatcgggcgaaaatttgaggacaaggaggttcaaaaggacaggaaactt 467 Query: 441 gtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggat 500 || || ||| ||||||| |||||||| || ||||| |||||||| ||||||||||||||| Sbjct: 468 gtaccttaccagattgtgaacaaggatggtaagccatacattcaagtcaagatcaaggat 527 Query: 501 ggggagaccaaggtcttcag 520 || ||||| ||||| ||||| Sbjct: 528 ggtgagactaaggttttcag 547
>ref|NM_180788.1| Arabidopsis thaliana BIP; ATP binding AT5G42020 (BIP) transcript variant AT5G42020.1 mRNA, complete cds Length = 2328 Score = 198 bits (100), Expect = 1e-47 Identities = 265/320 (82%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| |||||||| ||||| ||||| ||||| |||||||| |||||||| || ||||| Sbjct: 228 gatcttggtaccacttactcttgtgttggtgtttacaagaatggtcatgttgaaattatt 287 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || ||| Sbjct: 288 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaagg 347 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| |||||||| || || || |||||||| ||||| ||| Sbjct: 348 ctcattggtgaggctgctaagaatcaggcggctgttaatcctgagaggactgtcttcgac 407 Query: 381 gtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaactt 440 || ||| | | || || |||| ||||||||||||||||| || | ||||| ||||||| Sbjct: 408 gttaagagattgatcgggcgaaaatttgaggacaaggaggttcaaaaggacaggaaactt 467 Query: 441 gtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggat 500 || || ||| ||||||| |||||||| || ||||| |||||||| ||||||||||||||| Sbjct: 468 gtaccttaccagattgtgaacaaggatggtaagccatacattcaagtcaagatcaaggat 527 Query: 501 ggggagaccaaggtcttcag 520 || ||||| ||||| ||||| Sbjct: 528 ggtgagactaaggttttcag 547
>gb|BT008406.1| Arabidopsis thaliana At5g42020 gene, complete cds Length = 2007 Score = 198 bits (100), Expect = 1e-47 Identities = 265/320 (82%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| |||||||| ||||| ||||| ||||| |||||||| |||||||| || ||||| Sbjct: 121 gatcttggtaccacttactcttgtgttggtgtttacaagaatggtcatgttgaaattatt 180 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || ||| Sbjct: 181 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaagg 240 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| |||||||| || || || |||||||| ||||| ||| Sbjct: 241 ctcattggtgaggctgctaagaatcaggcggctgttaatcctgagaggactgtcttcgac 300 Query: 381 gtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaactt 440 || ||| | | || || |||| ||||||||||||||||| || | ||||| ||||||| Sbjct: 301 gttaagagattgatcgggcgaaaatttgaggacaaggaggttcaaaaggacaggaaactt 360 Query: 441 gtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggat 500 || || ||| ||||||| |||||||| || ||||| |||||||| ||||||||||||||| Sbjct: 361 gtaccttaccagattgtgaacaaggatggtaagccatacattcaagtcaagatcaaggat 420 Query: 501 ggggagaccaaggtcttcag 520 || ||||| ||||| ||||| Sbjct: 421 ggtgagactaaggttttcag 440
>gb|BT002392.1| Arabidopsis thaliana luminal binding protein (At5g42020) mRNA, complete cds Length = 2325 Score = 198 bits (100), Expect = 1e-47 Identities = 265/320 (82%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| |||||||| ||||| ||||| ||||| |||||||| |||||||| || ||||| Sbjct: 228 gatcttggtaccacttactcttgtgttggtgtttacaagaatggtcatgttgaaattatt 287 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || ||| Sbjct: 288 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaagg 347 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| |||||||| || || || |||||||| ||||| ||| Sbjct: 348 ctcattggtgaggctgctaagaatcaggcggctgttaatcctgagaggactgtcttcgac 407 Query: 381 gtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaactt 440 || ||| | | || || |||| ||||||||||||||||| || | ||||| ||||||| Sbjct: 408 gttaagagattgatcgggcgaaaatttgaggacaaggaggttcaaaaggacaggaaactt 467 Query: 441 gtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggat 500 || || ||| ||||||| |||||||| || ||||| |||||||| ||||||||||||||| Sbjct: 468 gtaccttaccagattgtgaacaaggatggtaagccatacattcaagtcaagatcaaggat 527 Query: 501 ggggagaccaaggtcttcag 520 || ||||| ||||| ||||| Sbjct: 528 ggtgagactaaggttttcag 547
>gb|U08382.1|GMU08382 Glycine max Century 84 BiP isoform C mRNA, partial cds Length = 1472 Score = 194 bits (98), Expect = 2e-46 Identities = 257/310 (82%) Strand = Plus / Plus Query: 213 acctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccag 272 ||||| |||||||||||||| |||||||| || ||||| || || || ||||| ||||| Sbjct: 240 acctattcatgtgtcggtgtttacaagaatggccatgttgaaatcatagccaacgaccaa 299 Query: 273 ggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatcggtgag 332 |||||||||||||| || || ||||||| |||||||| | ||||| ||||| || ||| Sbjct: 300 ggtaaccgtatcaccccatcgtgggttgctttcaccgacagtgagagactcattggggag 359 Query: 333 gctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaagcgtctc 392 ||||| ||||| ||||| || |||||||| || |||||| ||||||| |||||| | || Sbjct: 360 gctgccaagaatcaggcagctgtcaacccagaaaggaccatctttgatgtcaagagactt 419 Query: 393 attggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaag 452 || ||||||||||| || || ||||| || || | |||||||| ||||| || || ||| Sbjct: 420 atcggaagaaagttcgaagataaggaagttcaaaaagacatgaagcttgttccttataag 479 Query: 453 attgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatggggagaccaag 512 |||||||||||||| || || |||||||||||||| || || |||||||| ||||||||| Sbjct: 480 attgtcaacaaggatggaaaaccttacattcaggtgaaaattaaggatggtgagaccaag 539 Query: 513 gtcttcagcc 522 || ||||||| Sbjct: 540 gtgttcagcc 549
>emb|X60057.1|NTBLP4 Nicotiana tabacum blp4 mRNA for luminal binding protein (BiP) Length = 2345 Score = 192 bits (97), Expect = 8e-46 Identities = 253/305 (82%) Strand = Plus / Plus Query: 216 tactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccagggt 275 ||||||||||| ||||| |||||||| || ||||| || ||||| || |||||||| ||| Sbjct: 219 tactcatgtgttggtgtttacaagaatggacatgttgaaattatagcgaatgaccaaggt 278 Query: 276 aaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatcggtgaggct 335 || |||||||| || |||||||||| ||||| ||||| |||||||| || |||||||| Sbjct: 279 aatcgtatcaccccttcatgggttgccttcactgatggtgagaggctgattggtgaggca 338 Query: 336 gcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaagcgtctcatt 395 |||||||| || || || ||||| |||||||||||||| || ||||| | || ||| Sbjct: 339 gcaaagaatttagccgctgttaacccagagaggaccgtcttcgatgtcaaaagacttatt 398 Query: 396 ggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaagatt 455 |||||||||||||| ||||| || || || ||||||||||||||||| || ||||||||| Sbjct: 399 ggaagaaagtttgatgacaaagaagtacaaagggacatgaaacttgttccgtacaagatt 458 Query: 456 gtcaacaaggagggcaagccttacattcaggtcaagatcaaggatggggagaccaaggtc 515 || |||||||| || || || || || || || ||||| || ||||||||||||||| || Sbjct: 459 gttaacaaggatggtaaaccatatatccaagttaagattaaagatggggagaccaagatc 518 Query: 516 ttcag 520 ||||| Sbjct: 519 ttcag 523
>dbj|AB210900.1| Glycine max Gm bip mRNA for BiP, complete cds Length = 2299 Score = 186 bits (94), Expect = 5e-44 Identities = 256/310 (82%) Strand = Plus / Plus Query: 213 acctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccag 272 ||||| |||||||| ||||| ||||||||||| ||||| || || || ||||||||||| Sbjct: 188 acctattcatgtgttggtgtttacaagaacggccatgttgaaatcatagccaatgaccaa 247 Query: 273 ggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatcggtgag 332 |||||||||||||| || || ||||||| |||||||| | ||||| ||||| || ||| Sbjct: 248 ggtaaccgtatcaccccttcttgggttgctttcaccgacagtgagagactcattggggag 307 Query: 333 gctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaagcgtctc 392 ||||| ||||| | ||| || |||||||| || ||| | ||||||| |||||| | || Sbjct: 308 gctgccaagaatctggcagctgtcaacccagaaagggtcatctttgatgtcaagagactt 367 Query: 393 attggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaag 452 ||||||||||||||||| || ||||| || || | |||||||| ||||| || || ||| Sbjct: 368 attggaagaaagtttgaagataaggaagttcaacgagacatgaagcttgttccttataag 427 Query: 453 attgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatggggagaccaag 512 |||||||||||||| || || |||||||| ||||| || || |||||||| ||||||||| Sbjct: 428 attgtcaacaaggatggaaaaccttacatacaggtgaaaattaaggatggtgagaccaag 487 Query: 513 gtcttcagcc 522 || ||||||| Sbjct: 488 gtgttcagcc 497
>dbj|D84414.1|ATHBIPA Arabidopsis thaliana mRNA for luminal binding protein (BiP), complete cds Length = 2220 Score = 182 bits (92), Expect = 8e-43 Identities = 263/320 (82%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| |||||||| ||||| ||||| ||||| |||||||| |||||||| || ||||| Sbjct: 172 gatcttggtaccacttactcttgtgttggtgtttacaagaatggtcatgttgaaattatt 231 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || ||| Sbjct: 232 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaagg 291 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| || || || || || || |||||||| ||||| ||| Sbjct: 292 ctcattggtgaggctgctaagaatcaagcagctgttaatccagagaggactgtcttcgac 351 Query: 381 gtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaactt 440 || ||| | | || || |||| ||||||||||||||||| || | ||||| ||||||| Sbjct: 352 gttaagagattgatcgggcgaaaatttgaggacaaggaggttcaaaaggacaggaaactt 411 Query: 441 gtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggat 500 || || ||| ||||||| |||||||| || ||||| |||||||| ||||||||||||||| Sbjct: 412 gtaccttaccagattgtgaacaaggatggtaagccatacattcaagtcaagatcaaggat 471 Query: 501 ggggagaccaaggtcttcag 520 || ||||| ||||| ||||| Sbjct: 472 ggtgagactaaggttttcag 491
>gb|L23551.1|SPIHSC70A Spinacia oleracea ER-lumenal protein (HSC70) mRNA, complete cds Length = 2410 Score = 167 bits (84), Expect = 5e-38 Identities = 267/328 (81%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgag 254 ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| | || || Sbjct: 192 ggtattgatcttggtaccacctactcatgtgttggtgtgtacaaagatggtaaggttgaa 251 Query: 255 attatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggg 314 ||||| || |||||||| |||||||||||||| || |||||||| | |||||| | | Sbjct: 252 attatagcaaatgaccaaggtaaccgtatcaccccatcatgggtcgccttcaccaacgac 311 Query: 315 gagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtc 374 |||||| | ||||| |||||||| ||||| ||||| || | |||||||||||||| || Sbjct: 312 gagaggttgatcggggaggctgctaagaatcaggcagctgctaaccccgagaggactatc 371 Query: 375 tttgacgtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatg 434 || || |||||| | ||||| |||||||| || |||||||| ||||| || | ||||||| Sbjct: 372 ttcgatgtcaagaggctcatcggaagaaaattcgaggacaaagaggttcaaaaggacatg 431 Query: 435 aaacttgtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatc 494 || ||||| || ||||||||||| |||| ||| || ||||||||||| || || ||| | Sbjct: 432 aagcttgtaccttacaagattgtaaacagggatggaaagccttacatccaagttaaggtt 491 Query: 495 aaggatggggagaccaaggtcttcagcc 522 | || || ||||||||||| ||||||| Sbjct: 492 caagaaggtgagaccaaggttttcagcc 519
>gb|AF031241.1|AF031241 Glycine max endoplasmic reticulum HSC70-cognate binding protein precursor (BIP) mRNA, complete cds Length = 2180 Score = 165 bits (83), Expect = 2e-37 Identities = 269/331 (81%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtc 251 ||||| || ||||| || || ||||| |||||||| ||||| ||||||||||| ||||| Sbjct: 144 atcgggattgatcttggaacgacctattcatgtgttggtgtttacaagaacggccatgtt 203 Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgat 311 || || || |||||| | || |||||||||||||| || || ||||||| |||||||| Sbjct: 204 gaaatcatagccaataatcaaggtaaccgtatcaccccatcgtgggttgctttcaccgac 263 Query: 312 ggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggacc 371 | ||||| || || || |||||||| ||||| | ||| || |||||||| || |||||| Sbjct: 264 agtgagagactaattggagaggctgccaagaatctggcagctgtcaacccagaaaggacc 323 Query: 372 gtctttgacgtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggac 431 ||||||| |||||| | || |||||||||||||| || || ||||| || || || || Sbjct: 324 atctttgatgtcaagagacttattggaagaaagttcgaagataaggaagttcaaagagat 383 Query: 432 atgaaacttgtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaag 491 ||||| ||||| || || ||||||||||||||||| || || |||||||| || || || Sbjct: 384 atgaagcttgttccttataagattgtcaacaaggatggaaaaccttacatacaagtgaaa 443 Query: 492 atcaaggatggggagaccaaggtcttcagcc 522 || |||||||| ||||||||||| ||||||| Sbjct: 444 attaaggatggtgagaccaaggtgttcagcc 474
>ref|NM_122737.2| Arabidopsis thaliana ATP binding AT5G28540 mRNA, complete cds Length = 2280 Score = 159 bits (80), Expect = 1e-35 Identities = 260/320 (81%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| ||||| || ||||| ||||| ||||| |||||||| ||||||||||| ||||| Sbjct: 186 gatcttggtactacttactcttgtgttggtgtttacaagaatggtcatgtcgaaattatt 245 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || || Sbjct: 246 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaaga 305 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| || || || || || || |||||||| ||||| ||| Sbjct: 306 ctcattggtgaggctgctaagaatcaagcagctgttaatccagagaggactgtcttcgac 365 Query: 381 gtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaactt 440 || ||| | | || || |||| |||||||| |||||||| || | ||| | ||||||| Sbjct: 366 gttaagagattgatcgggcgaaaatttgaggataaggaggttcaaaaggataggaaactt 425 Query: 441 gtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggat 500 || || ||| ||||||| |||||||| || ||||| |||||||| ||||||||||||||| Sbjct: 426 gtaccttaccagattgtgaacaaggatggtaagccatacattcaagtcaagatcaaggat 485 Query: 501 ggggagaccaaggtcttcag 520 || ||||| ||||| ||||| Sbjct: 486 ggtgagactaaggttttcag 505
>gb|BT000453.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 2278 Score = 159 bits (80), Expect = 1e-35 Identities = 260/320 (81%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| ||||| || ||||| ||||| ||||| |||||||| ||||||||||| ||||| Sbjct: 188 gatcttggtactacttactcttgtgttggtgtttacaagaatggtcatgtcgaaattatt 247 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || || Sbjct: 248 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaaga 307 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| || || || || || || |||||||| ||||| ||| Sbjct: 308 ctcattggtgaggctgctaagaatcaagcagctgttaatccagagaggactgtcttcgac 367 Query: 381 gtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaactt 440 || ||| | | || || |||| |||||||| |||||||| || | ||| | ||||||| Sbjct: 368 gttaagagattgatcgggcgaaaatttgaggataaggaggttcaaaaggataggaaactt 427 Query: 441 gtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggat 500 || || ||| ||||||| |||||||| || ||||| |||||||| ||||||||||||||| Sbjct: 428 gtaccttaccagattgtgaacaaggatggtaagccatacattcaagtcaagatcaaggat 487 Query: 501 ggggagaccaaggtcttcag 520 || ||||| ||||| ||||| Sbjct: 488 ggtgagactaaggttttcag 507
>gb|BT001212.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 2158 Score = 159 bits (80), Expect = 1e-35 Identities = 260/320 (81%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| ||||| || ||||| ||||| ||||| |||||||| ||||||||||| ||||| Sbjct: 121 gatcttggtactacttactcttgtgttggtgtttacaagaatggtcatgtcgaaattatt 180 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || || Sbjct: 181 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaaga 240 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| || || || || || || |||||||| ||||| ||| Sbjct: 241 ctcattggtgaggctgctaagaatcaagcagctgttaatccagagaggactgtcttcgac 300 Query: 381 gtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaactt 440 || ||| | | || || |||| |||||||| |||||||| || | ||| | ||||||| Sbjct: 301 gttaagagattgatcgggcgaaaatttgaggataaggaggttcaaaaggataggaaactt 360 Query: 441 gtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggat 500 || || ||| ||||||| |||||||| || ||||| |||||||| ||||||||||||||| Sbjct: 361 gtaccttaccagattgtgaacaaggatggtaagccatacattcaagtcaagatcaaggat 420 Query: 501 ggggagaccaaggtcttcag 520 || ||||| ||||| ||||| Sbjct: 421 ggtgagactaaggttttcag 440
>emb|AJ249329.1|CSA249329 Cucumis sativus mRNA for heat shock protein 70 (BiP-related) Length = 2322 Score = 153 bits (77), Expect = 7e-34 Identities = 236/289 (81%) Strand = Plus / Plus Query: 234 tacaagaacggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacgccctca 293 ||||||||||||||||| || ||||| || |||||||| || ||||||||||| || || Sbjct: 254 tacaagaacggtcatgtagaaattatagcgaatgaccaaggaaaccgtatcacaccttct 313 Query: 294 tgggttgggttcaccgatggggagaggctcatcggtgaggctgcaaagaaccaggcggcg 353 ||||| | ||||| ||| | ||||| | |||||||||||||| ||||| || || || Sbjct: 314 tgggtcgctttcactgatagtgagagattgatcggtgaggctgcgaagaatcaagcagct 373 Query: 354 gtcaaccccgagaggaccgtctttgacgtcaagcgtctcattggaagaaagtttgaggac 413 || ||||| || ||||| ||||| || |||||| | || || || ||||||||||| || Sbjct: 374 gttaaccctgaaaggacagtcttcgatgtcaagagacttatcggtagaaagtttgatgat 433 Query: 414 aaggaggtgcagagggacatgaaacttgtcccctacaagattgtcaacaaggagggcaag 473 || || || |||| |||||||| ||||| || |||||||| || || ||||| || ||| Sbjct: 434 aaagaagttcagaaagacatgaagcttgttccttacaagatcgtgaataaggatggaaag 493 Query: 474 ccttacattcaggtcaagatcaaggatggggagaccaaggtcttcagcc 522 ||||||||||| || |||||||||||||| ||||||||||| ||||||| Sbjct: 494 ccttacattcaagtgaagatcaaggatggtgagaccaaggttttcagcc 542
>gb|U08384.1|U08384 Glycine max Century 84 BiP isoform A mRNA, complete cds Length = 2449 Score = 151 bits (76), Expect = 3e-33 Identities = 252/310 (81%), Gaps = 3/310 (0%) Strand = Plus / Plus Query: 213 acctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccag 272 ||||| |||||||| ||||| ||||||||||| ||||| || || || ||||||||||| Sbjct: 201 acctattcatgtgttggtgtttacaagaacggccatgttgaaatcatagccaatgaccaa 260 Query: 273 ggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatcggtgag 332 |||||||||||||| || || ||| | |||||||| | ||||| ||||| || ||| Sbjct: 261 ggtaaccgtatcaccccttcttgga---gcttcaccgacagtgagagactcattggggag 317 Query: 333 gctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaagcgtctc 392 ||||| ||||| | ||| || |||||||| || ||| | ||||||| |||||| | || Sbjct: 318 gctgccaagaatctggcagctgtcaacccagaaagggtcatctttgatgtcaagagactt 377 Query: 393 attggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaag 452 ||||||||||||||||| || ||||| || || | |||||||| ||||| || || ||| Sbjct: 378 attggaagaaagtttgaagataaggaagttcaacgagacatgaagcttgttccttataag 437 Query: 453 attgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatggggagaccaag 512 |||||||||||||| || || |||||||| |||| || || |||||||| ||||||||| Sbjct: 438 attgtcaacaaggatggaaaaccttacatacaggagaaaattaaggatggcgagaccaag 497 Query: 513 gtcttcagcc 522 || ||||||| Sbjct: 498 gtgttcagcc 507
>emb|X60058.1|NTBLP5 Nicotiana tabacum blp5 mRNA for luminal binding protein (BiP) Length = 2273 Score = 147 bits (74), Expect = 4e-32 Identities = 263/326 (80%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgag 254 ||||| ||||| || || || ||||||||||| ||||| ||||||||||| ||||| || Sbjct: 204 ggtatagatcttggaacaacttactcatgtgttggtgtctacaagaacggacatgttgaa 263 Query: 255 attatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggg 314 || || || || ||||| |||||||||||||| || |||||||| | ||||| ||||| Sbjct: 264 atcatagcaaacgaccaaggtaaccgtatcaccccttcatgggtagccttcactgatggt 323 Query: 315 gagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtc 374 |||||||| || ||||| || || || || ||||| || || || || ||||||||| | Sbjct: 324 gagaggctgattggtgaagcagctaaaaatcaggctgctgttaatcctgagaggaccata 383 Query: 375 tttgacgtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatg 434 ||||||||||| | || || || ||||||||||| ||||| || || || ||||||| | Sbjct: 384 tttgacgtcaaaagacttatcgggagaaagtttgatgacaaagaagtacaaagggacaag 443 Query: 435 aaacttgtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatc 494 |||||||| || || ||||||| |||||||| || || || || || || || |||||| Sbjct: 444 aaacttgttccatatgagattgttaacaaggatgggaaaccatatatccaagttaagatc 503 Query: 495 aaggatggggagaccaaggtcttcag 520 || ||||||||||| ||||||||||| Sbjct: 504 aaagatggggagactaaggtcttcag 529
>gb|L08830.1|TOMBIPGRBC Tomato BiP (binding protein)/grp78 (glucose-regulated protein, 78 kD) (BiP/grp78) mRNA, complete cds Length = 2232 Score = 139 bits (70), Expect = 1e-29 Identities = 235/290 (81%) Strand = Plus / Plus Query: 213 acctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccag 272 ||||| || ||||| || ||||||||||| |||||||| |||||||| || |||||||| Sbjct: 255 acctattcctgtgttggggtgtacaagaatggtcatgtggagattatagctaatgaccaa 314 Query: 273 ggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatcggtgag 332 || ||| | || || || |||||||||| ||||| ||| ||||| | || |||||| Sbjct: 315 ggaaacaggattacaccatcatgggttgcattcactgataacgagagattgattggtgag 374 Query: 333 gctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaagcgtctc 392 ||||| ||||||| ||| ||||||||||| || || || ||||||| || ||| | || Sbjct: 375 gctgccaagaacctggctgcggtcaacccagaaagaacaatctttgatgttaagaggctg 434 Query: 393 attggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaag 452 ||||||||||| ||||| || ||||| || |||||||| ||||| || || || |||||| Sbjct: 435 attggaagaaaatttgaagataaggaagtacagagggatatgaagctggtaccgtacaag 494 Query: 453 attgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatgg 502 ||||||| |||||| || ||||| ||||| || ||||| ||||||||||| Sbjct: 495 attgtcagcaaggatggaaagccctacatacaagtcaaaatcaaggatgg 544
>gb|DQ226896.1| Boechera divaricarpa isolate SLW-D-E08 mRNA sequence Length = 233 Score = 137 bits (69), Expect = 4e-29 Identities = 192/233 (82%) Strand = Plus / Minus Query: 210 accacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgac 269 ||||||||||| ||||| ||||| ||||||||||| ||||| || || || ||||||||| Sbjct: 233 accacctactcttgtgttggtgtttacaagaacggccatgttgaaatcattgccaatgac 174 Query: 270 cagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatcggt 329 || || |||||||| || || || ||||| || ||||| || |||||| | || ||| Sbjct: 173 caaggaaaccgtattacaccttcctgggtgggtttcactgactccgagaggttgattggt 114 Query: 330 gaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaagcgt 389 || ||||| |||||||||||||| || || || |||||||| |||||||| |||||||| Sbjct: 113 gaagctgctaagaaccaggcggctgttaatccagagaggactgtctttgatgtcaagcga 54 Query: 390 ctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaacttgt 442 | || || |||||||| |||||||| |||||||| | ||||||||||||||| Sbjct: 53 ttgatcggcagaaagttcgaggacaaagaggtgcaaaaggacatgaaacttgt 1
>emb|Z49764.2|PM5LBIPRT Pseudotsuga menziesii mRNA for luminal binding protein (BiP gene) Length = 2626 Score = 127 bits (64), Expect = 4e-26 Identities = 247/308 (80%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgag 254 ||||| |||||||| ||||| || || ||||| ||||| ||||| || |||||||| || Sbjct: 461 ggtatagatctcggaaccacgtattcttgtgttggtgtttacaaaaatggtcatgttgaa 520 Query: 255 attatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggg 314 || || || |||||||| || || | || || || || ||||||| ||||| ||| Sbjct: 521 atcatagcaaatgaccaaggaaataggattacaccttcttgggttgccttcactgatacc 580 Query: 315 gagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtc 374 || || |||||||| |||||||| || ||||||||||| | || || || |||||||| Sbjct: 581 gaaagactcatcggagaggctgccaaaaaccaggcggcaatgaatcctgaaaggaccgtt 640 Query: 375 tttgacgtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatg 434 ||||| || || || | ||||||||||||| |||||||||||||||||| | ||||| Sbjct: 641 tttgatgtgaaacggttgattggaagaaagtatgaggacaaggaggtgcaaaaagacatc 700 Query: 435 aaacttgtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatc 494 |||||| | |||||||| ||||| ||||| || || ||||||||||||||||| |||||| Sbjct: 701 aaacttttgccctacaaaattgtaaacaaagatgggaagccttacattcaggtgaagatc 760 Query: 495 aaggatgg 502 | |||||| Sbjct: 761 agggatgg 768
>ref|XM_480535.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2031 Score = 125 bits (63), Expect = 2e-25 Identities = 173/209 (82%), Gaps = 3/209 (1%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || || ||||| || ||||| || ||| |||||| ||| Sbjct: 136 gtgatcgggatcgacctcggcacgacgtactcgtgcgtcggagtctaccggaacggccat 195 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 |||||||| |||||||| |||||||| ||||| ||||||||||| ||||| | |||||| Sbjct: 196 gtcgagatcatcgccaacgaccaggggaaccggatcacgccctcgtgggtcgccttcacc 255 Query: 309 ga---tggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgag 365 || || ||| |||||||||||||||| || |||||||||||||||| |||||| ||| Sbjct: 256 gacggcggcgagcggctcatcggtgaggccgccaagaaccaggcggcggccaacccggag 315 Query: 366 aggaccgtctttgacgtcaagcgtctcat 394 ||||| ||| |||| |||||| ||||| Sbjct: 316 cggaccatctacgacgccaagcggctcat 344
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 125 bits (63), Expect = 2e-25 Identities = 173/209 (82%), Gaps = 3/209 (1%) Strand = Plus / Minus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || || ||||| || ||||| || ||| |||||| ||| Sbjct: 5641314 gtgatcgggatcgacctcggcacgacgtactcgtgcgtcggagtctaccggaacggccat 5641255 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 |||||||| |||||||| |||||||| ||||| ||||||||||| ||||| | |||||| Sbjct: 5641254 gtcgagatcatcgccaacgaccaggggaaccggatcacgccctcgtgggtcgccttcacc 5641195 Query: 309 ga---tggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgag 365 || || ||| |||||||||||||||| || |||||||||||||||| |||||| ||| Sbjct: 5641194 gacggcggcgagcggctcatcggtgaggccgccaagaaccaggcggcggccaacccggag 5641135 Query: 366 aggaccgtctttgacgtcaagcgtctcat 394 ||||| ||| |||| |||||| ||||| Sbjct: 5641134 cggaccatctacgacgccaagcggctcat 5641106
>dbj|AP005499.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0412D08 Length = 150188 Score = 125 bits (63), Expect = 2e-25 Identities = 173/209 (82%), Gaps = 3/209 (1%) Strand = Plus / Minus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || || ||||| || ||||| || ||| |||||| ||| Sbjct: 96690 gtgatcgggatcgacctcggcacgacgtactcgtgcgtcggagtctaccggaacggccat 96631 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 |||||||| |||||||| |||||||| ||||| ||||||||||| ||||| | |||||| Sbjct: 96630 gtcgagatcatcgccaacgaccaggggaaccggatcacgccctcgtgggtcgccttcacc 96571 Query: 309 ga---tggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgag 365 || || ||| |||||||||||||||| || |||||||||||||||| |||||| ||| Sbjct: 96570 gacggcggcgagcggctcatcggtgaggccgccaagaaccaggcggcggccaacccggag 96511 Query: 366 aggaccgtctttgacgtcaagcgtctcat 394 ||||| ||| |||| |||||| ||||| Sbjct: 96510 cggaccatctacgacgccaagcggctcat 96482
>gb|AF338252.1|AF338252 Glycine max BiP-isoform D (BiPD) gene, partial cds Length = 5146 Score = 123 bits (62), Expect = 6e-25 Identities = 176/214 (82%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtc 251 ||||| || ||||| || || ||||| |||||||||||||| |||||||| || ||||| Sbjct: 3269 atcggcattgatcttggaacaacctattcatgtgtcggtgtttacaagaatggccatgtt 3328 Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgat 311 || || || ||||| ||||| |||||||||||||| || || ||||||| |||||||| Sbjct: 3329 gaaatcatagccaacgaccaaggtaaccgtatcaccccatcgtgggttgctttcaccgac 3388 Query: 312 ggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggacc 371 | ||||| ||||| || |||||||| ||||| ||||| || |||||||| || |||||| Sbjct: 3389 agtgagagactcattggggaggctgccaagaatcaggcagctgtcaacccagaaaggacc 3448 Query: 372 gtctttgacgtcaagcgtctcattggaagaaagt 405 ||||||| |||||| | || || |||||||||| Sbjct: 3449 atctttgatgtcaagagacttatcggaagaaagt 3482 Score = 91.7 bits (46), Expect = 2e-15 Identities = 82/94 (87%) Strand = Plus / Plus Query: 429 gacatgaaacttgtcccctacaagattgtcaacaaggagggcaagccttacattcaggtc 488 |||||||| ||||| || || ||||||||||||||||| || || |||||||||||||| Sbjct: 3585 gacatgaagcttgttccttataagattgtcaacaaggatggaaaaccttacattcaggtg 3644 Query: 489 aagatcaaggatggggagaccaaggtcttcagcc 522 || || |||||||| ||||||||||| ||||||| Sbjct: 3645 aaaattaaggatggtgagaccaaggtgttcagcc 3678
>gb|U08383.1|GMU08383 Glycine max Century 84 BiP isoform B mRNA, complete cds Length = 2239 Score = 123 bits (62), Expect = 6e-25 Identities = 212/262 (80%) Strand = Plus / Plus Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 |||||||| || |||||||||||||| || || ||||||| |||||||| | ||||| Sbjct: 261 gccaatgatcaaggtaaccgtatcaccccatcgtgggttgctttcaccgacagtgagaga 320 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 || || || |||||||| |||| | ||| || |||||||| | |||||| ||||||| Sbjct: 321 ctaattggagaggctgccaagatcgtggcagctgtcaacccagtaaggaccatctttgat 380 Query: 381 gtcaagcgtctcattggaagaaagtttgaggacaaggaggtgcagagggacatgaaactt 440 |||||| | || |||||||||||||| || || ||||| || || || || ||||| ||| Sbjct: 381 gtcaagagacttattggaagaaagttcgaagataaggaagttcaaagagatatgaagctt 440 Query: 441 gtcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggat 500 || || || ||||||||||||||||| || || |||||||| || || || || |||||| Sbjct: 441 gttccttataagattgtcaacaaggatggaaaaccttacatacaagtgaaaattaaggat 500 Query: 501 ggggagaccaaggtcttcagcc 522 || ||||||||||| ||||||| Sbjct: 501 ggtgagaccaaggtgttcagcc 522
>gb|AY137471.1| Panagrellus redivivus heat shock protein 70-C mRNA, complete cds Length = 2202 Score = 121 bits (61), Expect = 2e-24 Identities = 91/101 (90%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtc 251 ||||||||||||||||| ||||| ||||| ||||||||||| ||||||||||||| ||| Sbjct: 199 atcggtatcgatctcggaaccacttactcgtgtgtcggtgtctacaagaacggtcgtgtt 258 Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgccctc 292 || || || |||||||||||||||||||||||||| ||||| Sbjct: 259 gaaatcattgccaatgaccagggtaaccgtatcactccctc 299
>gb|L23552.1|SPIHSC70G Spinacia oleracea ER-lumenal protein (HSC70) gene, complete cds Length = 5138 Score = 117 bits (59), Expect = 4e-23 Identities = 173/211 (81%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgag 254 ||||| ||||| |||||||||||||||||||| ||||||||||| | ||| | || || Sbjct: 2092 ggtattgatcttggtaccacctactcatgtgttggtgtgtacaaagatggtaaggttgaa 2151 Query: 255 attatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggg 314 ||||| || |||||||| |||||||||||||| || |||||||| | |||||| | | Sbjct: 2152 attatagcaaatgaccaaggtaaccgtatcaccccatcatgggtcgccttcaccaacgac 2211 Query: 315 gagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtc 374 |||||| | ||||| |||||||| ||||| ||||| || | |||||||||||||| || Sbjct: 2212 gagaggttgatcggggaggctgctaagaatcaggcagctgctaaccccgagaggactatc 2271 Query: 375 tttgacgtcaagcgtctcattggaagaaagt 405 || || |||||| | ||||| |||||||||| Sbjct: 2272 ttcgatgtcaagaggctcatcggaagaaagt 2302 Score = 61.9 bits (31), Expect = 2e-06 Identities = 94/115 (81%) Strand = Plus / Plus Query: 408 gaggacaaggaggtgcagagggacatgaaacttgtcccctacaagattgtcaacaaggag 467 |||||||| ||||| || | ||||||||| ||||| || ||||||||||| |||| ||| Sbjct: 2408 gaggacaaagaggttcaaaaggacatgaagcttgtaccttacaagattgtaaacagggat 2467 Query: 468 ggcaagccttacattcaggtcaagatcaaggatggggagaccaaggtcttcagcc 522 || ||||||||||| || || ||| | | || || ||||||||||| ||||||| Sbjct: 2468 ggaaagccttacatccaagttaaggttcaagaaggtgagaccaaggttttcagcc 2522
>dbj|D89342.1| Arabidopsis thaliana DNA for luminal binding protein, complete cds Length = 4631 Score = 115 bits (58), Expect = 1e-22 Identities = 151/182 (82%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| |||||||| ||||| ||||| ||||| |||||||| |||||||| || ||||| Sbjct: 1943 gatcttggtaccacttactcttgtgttggtgtttacaagaatggtcatgttgaaattatt 2002 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || ||| Sbjct: 2003 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaagg 2062 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| |||||||| || || || |||||||| ||||| ||| Sbjct: 2063 ctcattggtgaggctgctaagaatcaggcggctgttaatcctgagaggactgtcttcgac 2122 Query: 381 gt 382 || Sbjct: 2123 gt 2124 Score = 111 bits (56), Expect = 2e-21 Identities = 101/116 (87%) Strand = Plus / Plus Query: 405 tttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaagattgtcaacaag 464 ||||||||||||||||| || | ||||| ||||||||| || ||| ||||||| |||||| Sbjct: 2228 tttgaggacaaggaggttcaaaaggacaggaaacttgtaccttaccagattgtgaacaag 2287 Query: 465 gagggcaagccttacattcaggtcaagatcaaggatggggagaccaaggtcttcag 520 || || ||||| |||||||| ||||||||||||||||| ||||| ||||| ||||| Sbjct: 2288 gatggtaagccatacattcaagtcaagatcaaggatggtgagactaaggttttcag 2343
>dbj|AB017067.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJC20 Length = 83689 Score = 115 bits (58), Expect = 1e-22 Identities = 151/182 (82%) Strand = Plus / Minus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| |||||||| ||||| ||||| ||||| |||||||| |||||||| || ||||| Sbjct: 32301 gatcttggtaccacttactcttgtgttggtgtttacaagaatggtcatgttgaaattatt 32242 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || ||| Sbjct: 32241 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaagg 32182 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| |||||||| || || || |||||||| ||||| ||| Sbjct: 32181 ctcattggtgaggctgctaagaatcaggcggctgttaatcctgagaggactgtcttcgac 32122 Query: 381 gt 382 || Sbjct: 32121 gt 32120 Score = 111 bits (56), Expect = 2e-21 Identities = 101/116 (87%) Strand = Plus / Minus Query: 405 tttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaagattgtcaacaag 464 ||||||||||||||||| || | ||||| ||||||||| || ||| ||||||| |||||| Sbjct: 32016 tttgaggacaaggaggttcaaaaggacaggaaacttgtaccttaccagattgtgaacaag 31957 Query: 465 gagggcaagccttacattcaggtcaagatcaaggatggggagaccaaggtcttcag 520 || || ||||| |||||||| ||||||||||||||||| ||||| ||||| ||||| Sbjct: 31956 gatggtaagccatacattcaagtcaagatcaaggatggtgagactaaggttttcag 31901
>dbj|AB024993.1| Cicer arietinum mRNA for dnaK-type molecular chaperone, partial cds Length = 414 Score = 113 bits (57), Expect = 6e-22 Identities = 162/197 (82%) Strand = Plus / Plus Query: 213 acctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccag 272 |||||||| ||||| ||||| |||||||| || ||||| || || || ||||| ||||| Sbjct: 218 acctactcgtgtgttggtgtttacaagaatggccatgttgaaatcatagccaacgaccaa 277 Query: 273 ggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatcggtgag 332 |||||||||||||| || |||||||||| |||||||| | ||||| || ||||| ||| Sbjct: 278 ggtaaccgtatcaccccatcatgggttgctttcaccgacagtgagagactgatcggggag 337 Query: 333 gctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaagcgtctc 392 ||||||||||| | || || ||||| || ||||||||| ||||||| |||||| | || Sbjct: 338 gctgcaaagaatcttgcagctgtcaatcctgagaggaccatctttgatgtcaagagactt 397 Query: 393 attggaagaaagtttga 409 || |||||||| ||||| Sbjct: 398 atcggaagaaaatttga 414
>emb|AJ312020.1|SDU312020 Scherffelia dubia partial mRNA for luminal binding protein (bip gene), strain SAG 40.89 Length = 2040 Score = 111 bits (56), Expect = 2e-21 Identities = 110/128 (85%) Strand = Plus / Plus Query: 163 aggaggaggccaagaagctcggtactgtgatcggtatcgatctcggtaccacctactcat 222 |||||||||| |||||| |||| ||||||||||| |||||||| || ||||| ||||| | Sbjct: 94 aggaggaggcgaagaagatcggcactgtgatcggcatcgatctgggcaccacgtactcgt 153 Query: 223 gtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccagggtaaccgta 282 | || || |||||||||||||| | ||| ||||| |||||||| |||||||| ||||| | Sbjct: 154 gcgtgggcgtgtacaagaacgggcgtgtggagatcatcgccaacgaccagggcaaccgca 213 Query: 283 tcacgccc 290 |||||||| Sbjct: 214 tcacgccc 221
>gb|AC130600.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0048I21, complete sequence Length = 137650 Score = 101 bits (51), Expect = 2e-18 Identities = 170/209 (81%), Gaps = 3/209 (1%) Strand = Plus / Minus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || || ||||| || ||||| || ||| ||||| | | Sbjct: 18369 gtgatcgggatcgacctcggcacgacgtactcgtgcgtcggcgtctaccggaacgaccgt 18310 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 |||||||| |||||||| |||||||| ||||| ||||||||||| ||||| | |||||| Sbjct: 18309 gtcgagatcatcgccaacgaccaggggaaccggatcacgccctcgtgggtcgccttcacc 18250 Query: 309 ga---tggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgag 365 || || ||| |||||||||| ||||| || |||||||||||||||| |||||| ||| Sbjct: 18249 gacggcggcgagcggctcatcggcgaggcagccaagaaccaggcggcggccaacccggag 18190 Query: 366 aggaccgtctttgacgtcaagcgtctcat 394 ||||| ||| |||| |||||| ||||| Sbjct: 18189 cggaccatctacgacgccaagcggctcat 18161
>ref|XM_475261.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2064 Score = 101 bits (51), Expect = 2e-18 Identities = 170/209 (81%), Gaps = 3/209 (1%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || || ||||| || ||||| || ||| ||||| | | Sbjct: 172 gtgatcgggatcgacctcggcacgacgtactcgtgcgtcggcgtctaccggaacgaccgt 231 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 |||||||| |||||||| |||||||| ||||| ||||||||||| ||||| | |||||| Sbjct: 232 gtcgagatcatcgccaacgaccaggggaaccggatcacgccctcgtgggtcgccttcacc 291 Query: 309 ga---tggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgag 365 || || ||| |||||||||| ||||| || |||||||||||||||| |||||| ||| Sbjct: 292 gacggcggcgagcggctcatcggcgaggcagccaagaaccaggcggcggccaacccggag 351 Query: 366 aggaccgtctttgacgtcaagcgtctcat 394 ||||| ||| |||| |||||| ||||| Sbjct: 352 cggaccatctacgacgccaagcggctcat 380
>gb|AC135429.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0636F09, complete sequence Length = 177374 Score = 101 bits (51), Expect = 2e-18 Identities = 170/209 (81%), Gaps = 3/209 (1%) Strand = Plus / Minus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || || ||||| || ||||| || ||| ||||| | | Sbjct: 147392 gtgatcgggatcgacctcggcacgacgtactcgtgcgtcggcgtctaccggaacgaccgt 147333 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 |||||||| |||||||| |||||||| ||||| ||||||||||| ||||| | |||||| Sbjct: 147332 gtcgagatcatcgccaacgaccaggggaaccggatcacgccctcgtgggtcgccttcacc 147273 Query: 309 ga---tggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgag 365 || || ||| |||||||||| ||||| || |||||||||||||||| |||||| ||| Sbjct: 147272 gacggcggcgagcggctcatcggcgaggcagccaagaaccaggcggcggccaacccggag 147213 Query: 366 aggaccgtctttgacgtcaagcgtctcat 394 ||||| ||| |||| |||||| ||||| Sbjct: 147212 cggaccatctacgacgccaagcggctcat 147184
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 101 bits (51), Expect = 2e-18 Identities = 170/209 (81%), Gaps = 3/209 (1%) Strand = Plus / Minus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || || ||||| || ||||| || ||| ||||| | | Sbjct: 20891591 gtgatcgggatcgacctcggcacgacgtactcgtgcgtcggcgtctaccggaacgaccgt 20891532 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 |||||||| |||||||| |||||||| ||||| ||||||||||| ||||| | |||||| Sbjct: 20891531 gtcgagatcatcgccaacgaccaggggaaccggatcacgccctcgtgggtcgccttcacc 20891472 Query: 309 ga---tggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgag 365 || || ||| |||||||||| ||||| || |||||||||||||||| |||||| ||| Sbjct: 20891471 gacggcggcgagcggctcatcggcgaggcagccaagaaccaggcggcggccaacccggag 20891412 Query: 366 aggaccgtctttgacgtcaagcgtctcat 394 ||||| ||| |||| |||||| ||||| Sbjct: 20891411 cggaccatctacgacgccaagcggctcat 20891383 Score = 85.7 bits (43), Expect = 1e-13 Identities = 138/169 (81%), Gaps = 3/169 (1%) Strand = Plus / Minus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| ||||||||||| || || ||||| ||| ||| || || Sbjct: 17517233 gtgatcgggatcgacctcggcaccacctactcgtgcgttggtgtctaccggaatggccac 17517174 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcac- 307 |||||||| |||||||| |||||||| ||||| ||||| ||||| ||||| | ||||| Sbjct: 17517173 gtcgagatcatcgccaacgaccaggggaaccggatcacaccctcgtgggtcgccttcacc 17517114 Query: 308 --cgatggggagaggctcatcggtgaggctgcaaagaaccaggcggcgg 354 || || ||| |||||||||| ||||| || |||||||||||||||| Sbjct: 17517113 ggcggcggcgagcggctcatcggcgaggccgccaagaaccaggcggcgg 17517065 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 cgaggcgaggagaggagagg 70 |||||||||||||||||||| Sbjct: 3641896 cgaggcgaggagaggagagg 3641915
>dbj|AK106696.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-114-D06, full insert sequence Length = 2273 Score = 101 bits (51), Expect = 2e-18 Identities = 170/209 (81%), Gaps = 3/209 (1%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || || ||||| || ||||| || ||| ||||| | | Sbjct: 205 gtgatcgggatcgacctcggcacgacgtactcgtgcgtcggcgtctaccggaacgaccgt 264 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 |||||||| |||||||| |||||||| ||||| ||||||||||| ||||| | |||||| Sbjct: 265 gtcgagatcatcgccaacgaccaggggaaccggatcacgccctcgtgggtcgccttcacc 324 Query: 309 ga---tggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgag 365 || || ||| |||||||||| ||||| || |||||||||||||||| |||||| ||| Sbjct: 325 gacggcggcgagcggctcatcggcgaggcagccaagaaccaggcggcggccaacccggag 384 Query: 366 aggaccgtctttgacgtcaagcgtctcat 394 ||||| ||| |||| |||||| ||||| Sbjct: 385 cggaccatctacgacgccaagcggctcat 413
>gb|AY161271.1| Spodoptera frugiperda heat shock cognate 70 protein mRNA, complete cds Length = 2723 Score = 99.6 bits (50), Expect = 9e-18 Identities = 92/106 (86%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||||||||| | || ||||||||||| ||||| |||||||||||||| || | | Sbjct: 251 gtgatcggtatcgacttggggaccacctactcttgtgttggtgtgtacaagaatggccgt 310 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcat 294 || || ||||| || ||||||||||||||||||||||| ||||||| Sbjct: 311 gtggaaattattgctaatgaccagggtaaccgtatcactccctcat 356
>emb|BX069833.1|CNS09Q1P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6CF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 859 Score = 97.6 bits (49), Expect = 3e-17 Identities = 85/97 (87%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||||||||||||||| ||||||||||| || |||||||||||||||||||| | || | Sbjct: 38 tcggtatcgatctcggcaccacctactcctgcgtcggtgtgtacaagaacgggcgcgtgg 97 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 | || || ||||| |||||||||||||| |||||||| Sbjct: 98 aaatcattgccaacgaccagggtaaccgcatcacgcc 134
>emb|BX019691.1|CNS08NCV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA3AC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 970 Score = 97.6 bits (49), Expect = 3e-17 Identities = 85/97 (87%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||||||||||||||| ||||||||||| || |||||||||||||||||||| | || | Sbjct: 34 tcggtatcgatctcggcaccacctactcctgcgtcggtgtgtacaagaacgggcgcgtgg 93 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 | || || ||||| |||||||||||||| |||||||| Sbjct: 94 aaatcattgccaacgaccagggtaaccgcatcacgcc 130
>ref|XM_313085.2| Anopheles gambiae str. PEST ENSANGP00000012893 (ENSANGG00000010404), partial mRNA Length = 1971 Score = 97.6 bits (49), Expect = 3e-17 Identities = 85/97 (87%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||||||||||||||| ||||||||||| || |||||||||||||||||||| | || | Sbjct: 92 tcggtatcgatctcggcaccacctactcctgcgtcggtgtgtacaagaacgggcgcgtgg 151 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 | || || ||||| |||||||||||||| |||||||| Sbjct: 152 aaatcattgccaacgaccagggtaaccgcatcacgcc 188
>gb|AF262043.1|T26D3 Arabidopsis thaliana BAC T26D3 Length = 81223 Score = 95.6 bits (48), Expect = 1e-16 Identities = 99/116 (85%) Strand = Plus / Minus Query: 405 tttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaagattgtcaacaag 464 |||||||| |||||||| || | ||| | ||||||||| || ||| ||||||| |||||| Sbjct: 73474 tttgaggataaggaggttcaaaaggataggaaacttgtaccttaccagattgtgaacaag 73415 Query: 465 gagggcaagccttacattcaggtcaagatcaaggatggggagaccaaggtcttcag 520 || || ||||| |||||||| ||||||||||||||||| ||||| ||||| ||||| Sbjct: 73414 gatggtaagccatacattcaagtcaagatcaaggatggtgagactaaggttttcag 73359 Score = 91.7 bits (46), Expect = 2e-15 Identities = 148/182 (81%) Strand = Plus / Minus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| ||||| || ||||| ||||| ||||| |||||||| ||||||||||| ||||| Sbjct: 73756 gatcttggtactacttactcttgtgttggtgtttacaagaatggtcatgtcgaaattatt 73697 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || || Sbjct: 73696 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaaga 73637 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| || || || || || || |||||||| ||||| ||| Sbjct: 73636 ctcattggtgaggctgctaagaatcaagcagctgttaatccagagaggactgtcttcgac 73577 Query: 381 gt 382 || Sbjct: 73576 gt 73575
>dbj|D89341.1| Arabidopsis thaliana DNA for luminal binding protein, complete cds Length = 4484 Score = 95.6 bits (48), Expect = 1e-16 Identities = 99/116 (85%) Strand = Plus / Plus Query: 405 tttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaagattgtcaacaag 464 |||||||| |||||||| || | ||| | ||||||||| || ||| ||||||| |||||| Sbjct: 2151 tttgaggataaggaggttcaaaaggataggaaacttgtaccttaccagattgtgaacaag 2210 Query: 465 gagggcaagccttacattcaggtcaagatcaaggatggggagaccaaggtcttcag 520 || || ||||| |||||||| ||||||||||||||||| ||||| ||||| ||||| Sbjct: 2211 gatggtaagccatacattcaagtcaagatcaaggatggtgagactaaggttttcag 2266 Score = 91.7 bits (46), Expect = 2e-15 Identities = 148/182 (81%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| ||||| || ||||| ||||| ||||| |||||||| ||||||||||| ||||| Sbjct: 1869 gatcttggtactacttactcttgtgttggtgtttacaagaatggtcatgtcgaaattatt 1928 Query: 261 gccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgatggggagagg 320 ||||||||||| || |||||||| || || ||||||||||| || || || || || Sbjct: 1929 gccaatgaccaaggaaaccgtattacaccttcatgggttggttttactgactctgaaaga 1988 Query: 321 ctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgac 380 ||||| ||||||||||| ||||| || || || || || || |||||||| ||||| ||| Sbjct: 1989 ctcattggtgaggctgctaagaatcaagcagctgttaatccagagaggactgtcttcgac 2048 Query: 381 gt 382 || Sbjct: 2049 gt 2050
>ref|XM_475128.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2010 Score = 85.7 bits (43), Expect = 1e-13 Identities = 138/169 (81%), Gaps = 3/169 (1%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| ||||||||||| || || ||||| ||| ||| || || Sbjct: 121 gtgatcgggatcgacctcggcaccacctactcgtgcgttggtgtctaccggaatggccac 180 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcac- 307 |||||||| |||||||| |||||||| ||||| ||||| ||||| ||||| | ||||| Sbjct: 181 gtcgagatcatcgccaacgaccaggggaaccggatcacaccctcgtgggtcgccttcacc 240 Query: 308 --cgatggggagaggctcatcggtgaggctgcaaagaaccaggcggcgg 354 || || ||| |||||||||| ||||| || |||||||||||||||| Sbjct: 241 ggcggcggcgagcggctcatcggcgaggccgccaagaaccaggcggcgg 289
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07, complete sequence Length = 159932 Score = 85.7 bits (43), Expect = 1e-13 Identities = 138/169 (81%), Gaps = 3/169 (1%) Strand = Plus / Minus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| ||||||||||| || || ||||| ||| ||| || || Sbjct: 47038 gtgatcgggatcgacctcggcaccacctactcgtgcgttggtgtctaccggaatggccac 46979 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcac- 307 |||||||| |||||||| |||||||| ||||| ||||| ||||| ||||| | ||||| Sbjct: 46978 gtcgagatcatcgccaacgaccaggggaaccggatcacaccctcgtgggtcgccttcacc 46919 Query: 308 --cgatggggagaggctcatcggtgaggctgcaaagaaccaggcggcgg 354 || || ||| |||||||||| ||||| || |||||||||||||||| Sbjct: 46918 ggcggcggcgagcggctcatcggcgaggccgccaagaaccaggcggcgg 46870
>ref|XM_469504.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2010 Score = 83.8 bits (42), Expect = 5e-13 Identities = 165/206 (80%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || |||||||| || || || |||||| |||||| || Sbjct: 115 gtgatcggcatcgacctcgggacgacctactcgtgcgtgggggtgtaccggaacggccac 174 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 || || || ||||||| |||||||| ||||| |||||||| || ||||| | ||||||| Sbjct: 175 gtggacatcgtcgccaacgaccagggcaaccggatcacgccgtcgtgggtggcgttcacc 234 Query: 309 gatggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagagg 368 || | ||| | ||| |||| ||||| || ||||||||||||||| ||||||| || | Sbjct: 235 gacgacgagcgcctcgtcggcgaggccgccaagaaccaggcggcgctcaacccggaccgc 294 Query: 369 accgtctttgacgtcaagcgtctcat 394 ||| |||| ||| ||||||| ||||| Sbjct: 295 accatcttcgacatcaagcgcctcat 320
>gb|AC087181.9| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0018H01 map R1538, complete sequence Length = 142712 Score = 83.8 bits (42), Expect = 5e-13 Identities = 165/206 (80%) Strand = Plus / Minus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || |||||||| || || || |||||| |||||| || Sbjct: 60669 gtgatcggcatcgacctcgggacgacctactcgtgcgtgggggtgtaccggaacggccac 60610 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 || || || ||||||| |||||||| ||||| |||||||| || ||||| | ||||||| Sbjct: 60609 gtggacatcgtcgccaacgaccagggcaaccggatcacgccgtcgtgggtggcgttcacc 60550 Query: 309 gatggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagagg 368 || | ||| | ||| |||| ||||| || ||||||||||||||| ||||||| || | Sbjct: 60549 gacgacgagcgcctcgtcggcgaggccgccaagaaccaggcggcgctcaacccggaccgc 60490 Query: 369 accgtctttgacgtcaagcgtctcat 394 ||| |||| ||| ||||||| ||||| Sbjct: 60489 accatcttcgacatcaagcgcctcat 60464
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 83.8 bits (42), Expect = 5e-13 Identities = 165/206 (80%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || |||||||| || || || |||||| |||||| || Sbjct: 28352373 gtgatcggcatcgacctcgggacgacctactcgtgcgtgggggtgtaccggaacggccac 28352432 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 || || || ||||||| |||||||| ||||| |||||||| || ||||| | ||||||| Sbjct: 28352433 gtggacatcgtcgccaacgaccagggcaaccggatcacgccgtcgtgggtggcgttcacc 28352492 Query: 309 gatggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagagg 368 || | ||| | ||| |||| ||||| || ||||||||||||||| ||||||| || | Sbjct: 28352493 gacgacgagcgcctcgtcggcgaggccgccaagaaccaggcggcgctcaacccggaccgc 28352552 Query: 369 accgtctttgacgtcaagcgtctcat 394 ||| |||| ||| ||||||| ||||| Sbjct: 28352553 accatcttcgacatcaagcgcctcat 28352578 Score = 48.1 bits (24), Expect = 0.029 Identities = 81/100 (81%) Strand = Plus / Plus Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 |||||||| |||||||| |||||||| ||||| | |||||| || | || | ||||||| Sbjct: 9342342 gtcgagatcatcgccaacgaccaggggaaccgcaccacgccgtcgtatgtcgcgttcacc 9342401 Query: 309 gatggggagaggctcatcggtgaggctgcaaagaaccagg 348 || |||||||||||||| || || || |||||||||| Sbjct: 9342402 gactccgagaggctcatcggcgacgccgccaagaaccagg 9342441 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 cgaggcgaggagaggagagg 70 |||||||||||||||||||| Sbjct: 12941063 cgaggcgaggagaggagagg 12941082
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 83.8 bits (42), Expect = 5e-13 Identities = 165/206 (80%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||||| ||||| || |||||||| || || || |||||| |||||| || Sbjct: 28443697 gtgatcggcatcgacctcgggacgacctactcgtgcgtgggggtgtaccggaacggccac 28443756 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 || || || ||||||| |||||||| ||||| |||||||| || ||||| | ||||||| Sbjct: 28443757 gtggacatcgtcgccaacgaccagggcaaccggatcacgccgtcgtgggtggcgttcacc 28443816 Query: 309 gatggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagagg 368 || | ||| | ||| |||| ||||| || ||||||||||||||| ||||||| || | Sbjct: 28443817 gacgacgagcgcctcgtcggcgaggccgccaagaaccaggcggcgctcaacccggaccgc 28443876 Query: 369 accgtctttgacgtcaagcgtctcat 394 ||| |||| ||| ||||||| ||||| Sbjct: 28443877 accatcttcgacatcaagcgcctcat 28443902 Score = 48.1 bits (24), Expect = 0.029 Identities = 81/100 (81%) Strand = Plus / Plus Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 |||||||| |||||||| |||||||| ||||| | |||||| || | || | ||||||| Sbjct: 9340463 gtcgagatcatcgccaacgaccaggggaaccgcaccacgccgtcgtatgtcgcgttcacc 9340522 Query: 309 gatggggagaggctcatcggtgaggctgcaaagaaccagg 348 || |||||||||||||| || || || |||||||||| Sbjct: 9340523 gactccgagaggctcatcggcgacgccgccaagaaccagg 9340562 Score = 40.1 bits (20), Expect = 7.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 cgaggcgaggagaggagagg 70 |||||||||||||||||||| Sbjct: 12937838 cgaggcgaggagaggagagg 12937857
>gb|DQ440225.1| Aedes aegypti clone AET-2544 heat shock cognate 70 mRNA, complete cds Length = 1968 Score = 81.8 bits (41), Expect = 2e-12 Identities = 83/97 (85%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 ||||||||||||| || || |||||||| ||||| || |||||||||||||| | || | Sbjct: 95 tcggtatcgatctgggaacgacctactcgtgtgtgggagtgtacaagaacggccgagtgg 154 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| |||||||||||||| || ||||| Sbjct: 155 agatcatcgccaacgaccagggtaaccgaattacgcc 191
>emb|Z11983.1|STBIPLBP S.tuberosum BiP gene for luminal binding protein, partial Length = 390 Score = 81.8 bits (41), Expect = 2e-12 Identities = 155/193 (80%) Strand = Plus / Plus Query: 213 acctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccag 272 ||||| || ||||| || ||||| ||||| |||||||| |||||||| || |||||||| Sbjct: 184 acctattcctgtgttggggtgtataagaatggtcatgtggagattatagctaatgaccaa 243 Query: 273 ggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatcggtgag 332 || ||| | || || || |||||||||| ||||| ||| ||||| | || |||||| Sbjct: 244 ggaaacaggattacaccatcatgggttgcattcactgataacgagagattgattggtgag 303 Query: 333 gctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaagcgtctc 392 ||||| ||||||| ||| ||||||||||| || ||||| ||||||| || ||| | || Sbjct: 304 gctgccaagaacctggctgcggtcaacccagaaaggacaatctttgatgttaagaggctg 363 Query: 393 attggaagaaagt 405 ||||||||||||| Sbjct: 364 attggaagaaagt 376
>gb|L08829.1|TOMBIPGRP Tomato BiP (binding protein)/grp78 (glucose-regulated protein, 78 kD) (BiP/grp78) gene, 5'end Length = 2966 Score = 81.8 bits (41), Expect = 2e-12 Identities = 155/193 (80%) Strand = Plus / Plus Query: 213 acctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccag 272 ||||| || ||||| || ||||||||||| |||||||| |||||||| || |||||||| Sbjct: 1519 acctattcctgtgttggggtgtacaagaatggtcatgtggagattatagctaatgaccaa 1578 Query: 273 ggtaaccgtatcacgccctcatgggttgggttcaccgatggggagaggctcatcggtgag 332 || ||| | || || || |||||||||| ||||| ||| ||||| | || |||||| Sbjct: 1579 ggaaacaggattacaccatcatgggttgcattcactgataacgagagattgattggtgag 1638 Query: 333 gctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttgacgtcaagcgtctc 392 ||||| ||||||| ||| ||||||||||| || || || ||||||| || ||| | || Sbjct: 1639 gctgccaagaacctggctgcggtcaacccagaaagaacaatctttgatgttaagaggctg 1698 Query: 393 attggaagaaagt 405 ||||||||||||| Sbjct: 1699 attggaagaaagt 1711 Score = 67.9 bits (34), Expect = 3e-08 Identities = 82/98 (83%) Strand = Plus / Plus Query: 405 tttgaggacaaggaggtgcagagggacatgaaacttgtcccctacaagattgtcaacaag 464 ||||| || ||||| || |||||||| ||||| || || || ||||||||||||| |||| Sbjct: 1801 tttgaagataaggaagtacagagggatatgaagctggtaccgtacaagattgtcagcaag 1860 Query: 465 gagggcaagccttacattcaggtcaagatcaaggatgg 502 || || ||||| ||||| || ||||| ||||||||||| Sbjct: 1861 gatggaaagccctacatacaagtcaaaatcaaggatgg 1898
>ref|NM_076618.2| Caenorhabditis elegans Heat Shock Protein family member (hsp-3) (hsp-3) mRNA, complete cds Length = 2649 Score = 79.8 bits (40), Expect = 8e-12 Identities = 79/92 (85%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgag 254 |||||||||||||| ||||||||||| |||||||| || ||||||||||| | ||| || Sbjct: 426 ggtatcgatctcggaaccacctactcgtgtgtcggagtttacaagaacggacgtgttgaa 485 Query: 255 attatcgccaatgaccagggtaaccgtatcac 286 || || ||||| ||||| || ||||||||||| Sbjct: 486 atcattgccaacgaccaaggaaaccgtatcac 517
>ref|XM_784444.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock 70kDa protein 5 (LOC584585), mRNA Length = 2693 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Plus Query: 213 acctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccag 272 |||||||| ||||| ||||||| |||||| |||| || ||||| |||||||||||||| Sbjct: 124 acctactcttgtgtgggtgtgttcaagaatggtcgcgtagagatcatcgccaatgaccaa 183 Query: 273 ggtaaccgtatcacgccctc 292 || ||||| ||||||||||| Sbjct: 184 ggaaaccgaatcacgccctc 203
>dbj|AP004746.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0035F08 Length = 167446 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Minus Query: 319 ggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggaccgtctttg 378 |||||||||||||||| || |||||||||||||||| |||||| ||| ||||| ||| | Sbjct: 167409 ggctcatcggtgaggccgccaagaaccaggcggcggccaacccggagcggaccatctacg 167350 Query: 379 acgtcaagcgtctcat 394 ||| |||||| ||||| Sbjct: 167349 acgccaagcggctcat 167334
>dbj|AB016836.1| Bombyx mori mRNA for heat shock 70 kD protein cognate, complete cds Length = 2643 Score = 69.9 bits (35), Expect = 8e-09 Identities = 80/95 (84%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtc 251 |||||||||||| | |||||||| ||||||||||||||||| ||||| || || | ||| Sbjct: 258 atcggtatcgatttgggtaccacttactcatgtgtcggtgtctacaaaaatggacgtgta 317 Query: 252 gagattatcgccaatgaccagggtaaccgtatcac 286 || || || |||||||| ||||| ||||| ||||| Sbjct: 318 gaaatcattgccaatgatcagggaaaccgcatcac 352
>gb|BC052971.1| Danio rerio heat shock 70kDa protein 5 (glucose-regulated protein), mRNA (cDNA clone MGC:55994 IMAGE:3819692), complete cds Length = 2356 Score = 67.9 bits (34), Expect = 3e-08 Identities = 82/98 (83%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 ||||| || ||||| ||||| ||||| ||||| ||||| || || |||||||| || | | Sbjct: 220 gtgattgggatcgacctcgggaccacatactcctgtgttggagtctacaagaatggccgt 279 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcac 286 || |||||||| |||||||||||||| ||||| ||||| Sbjct: 280 gttgagattattgccaatgaccagggaaaccgcatcac 317
>ref|NM_213058.1| Danio rerio heat shock 70kDa protein 5 (glucose-regulated protein) (hspa5), mRNA Length = 2356 Score = 67.9 bits (34), Expect = 3e-08 Identities = 82/98 (83%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 ||||| || ||||| ||||| ||||| ||||| ||||| || || |||||||| || | | Sbjct: 220 gtgattgggatcgacctcgggaccacatactcctgtgttggagtctacaagaatggccgt 279 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcac 286 || |||||||| |||||||||||||| ||||| ||||| Sbjct: 280 gttgagattattgccaatgaccagggaaaccgcatcac 317
>ref|XM_502562.1| Yarrowia lipolytica CLIB122, YALI0D08184g predicted mRNA Length = 1947 Score = 67.9 bits (34), Expect = 3e-08 Identities = 127/158 (80%) Strand = Plus / Plus Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 ||||||||||||||||| |||||||||||||| | ||| ||||| | |||| ||||| Sbjct: 70 gtcgagattatcgccaacgaccagggtaaccgaaccaccccctctttcgttgccttcact 129 Query: 309 gatggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagagg 368 || ||| | ||||| ||||| ||||| ||||||||||| || | ||||||| | Sbjct: 130 gacactgagcgactcattggtgatgctgccaagaaccaggctgccatgaaccccgtcaac 189 Query: 369 accgtctttgacgtcaagcgtctcattggaagaaagtt 406 |||||||| |||| |||||| ||||||||| ||||||| Sbjct: 190 accgtcttcgacgccaagcgactcattggacgaaagtt 227 Score = 48.1 bits (24), Expect = 0.029 Identities = 65/78 (83%), Gaps = 3/78 (3%) Strand = Plus / Plus Query: 442 tcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatg 501 |||||| |||||||||| |||||| |||||||| ||||| ||||| || |||||| || Sbjct: 263 tccccttcaagattgtcgacaaggccggcaagcccaacattgaggtcgagttcaagggtg 322 Query: 502 gggagaccaaggtcttca 519 ||||||||||||||| Sbjct: 323 ---agaccaaggtcttca 337
>gb|U56965.1| Caenorhabditis elegans cosmid C15H9, complete sequence Length = 41752 Score = 67.9 bits (34), Expect = 3e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacgg 244 |||||||||||||| ||||||||||| |||||||| || ||||||||||| Sbjct: 2738 ggtatcgatctcggaaccacctactcgtgtgtcggagtttacaagaacgg 2689
>emb|CT033531.1| Platynereis dumerilii EST IB0AAA18DC08EM1 Length = 781 Score = 67.9 bits (34), Expect = 3e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| || ||||| || |||||||| || || | ||||||||| | ||| || ||||| Sbjct: 236 gatctgggaaccacttattcatgtgttggagttttcaagaacggacgtgtagaaattatt 295 Query: 261 gccaatgaccagggtaaccgtatcac 286 |||||||||||||||||||||||||| Sbjct: 296 gccaatgaccagggtaaccgtatcac 321
>emb|CT032422.1| Platynereis dumerilii EST IB0AAA38CD04EM1 Length = 890 Score = 67.9 bits (34), Expect = 3e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| || ||||| || |||||||| || || | ||||||||| | ||| || ||||| Sbjct: 293 gatctgggaaccacttattcatgtgttggagttttcaagaacggacgtgtagaaattatt 352 Query: 261 gccaatgaccagggtaaccgtatcac 286 |||||||||||||||||||||||||| Sbjct: 353 gccaatgaccagggtaaccgtatcac 378
>emb|CT032351.1| Platynereis dumerilii EST IB0AAA39DE12EM1 Length = 922 Score = 67.9 bits (34), Expect = 3e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 ||||| || ||||| || |||||||| || || | ||||||||| | ||| || ||||| Sbjct: 240 gatctgggaaccacttattcatgtgttggagttttcaagaacggacgtgtagaaattatt 299 Query: 261 gccaatgaccagggtaaccgtatcac 286 |||||||||||||||||||||||||| Sbjct: 300 gccaatgaccagggtaaccgtatcac 325
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 67.9 bits (34), Expect = 3e-08 Identities = 127/158 (80%) Strand = Plus / Minus Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcacc 308 ||||||||||||||||| |||||||||||||| | ||| ||||| | |||| ||||| Sbjct: 1045481 gtcgagattatcgccaacgaccagggtaaccgaaccaccccctctttcgttgccttcact 1045422 Query: 309 gatggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagagg 368 || ||| | ||||| ||||| ||||| ||||||||||| || | ||||||| | Sbjct: 1045421 gacactgagcgactcattggtgatgctgccaagaaccaggctgccatgaaccccgtcaac 1045362 Query: 369 accgtctttgacgtcaagcgtctcattggaagaaagtt 406 |||||||| |||| |||||| ||||||||| ||||||| Sbjct: 1045361 accgtcttcgacgccaagcgactcattggacgaaagtt 1045324 Score = 48.1 bits (24), Expect = 0.029 Identities = 65/78 (83%), Gaps = 3/78 (3%) Strand = Plus / Minus Query: 442 tcccctacaagattgtcaacaaggagggcaagccttacattcaggtcaagatcaaggatg 501 |||||| |||||||||| |||||| |||||||| ||||| ||||| || |||||| || Sbjct: 1045288 tccccttcaagattgtcgacaaggccggcaagcccaacattgaggtcgagttcaagggtg 1045229 Query: 502 gggagaccaaggtcttca 519 ||||||||||||||| Sbjct: 1045228 ---agaccaaggtcttca 1045214
>gb|U29675.1|PTU29675 Phaeodactylum tricornutum ER lumenal chaperone BiP mRNA, complete cds Length = 2194 Score = 67.9 bits (34), Expect = 3e-08 Identities = 55/62 (88%) Strand = Plus / Plus Query: 183 ggtactgtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaac 242 ||||| |||||||||||||||||||| ||||| || || |||||||| |||| ||||||| Sbjct: 230 ggtaccgtgatcggtatcgatctcggcaccacgtattcgtgtgtcggcgtgttcaagaac 289 Query: 243 gg 244 || Sbjct: 290 gg 291 Score = 48.1 bits (24), Expect = 0.029 Identities = 36/40 (90%) Strand = Plus / Plus Query: 355 tcaaccccgagaggaccgtctttgacgtcaagcgtctcat 394 |||||||||| | ||||| |||||||||||||||||||| Sbjct: 405 tcaaccccgaaaacaccgtttttgacgtcaagcgtctcat 444
>gb|M26604.1|CELHSP3 C. elegans BiP (hsp3) gene, complete cds Length = 3569 Score = 67.9 bits (34), Expect = 3e-08 Identities = 46/50 (92%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacgg 244 |||||||||||||| ||||||||||| |||||||| || ||||||||||| Sbjct: 550 ggtatcgatctcggaaccacctactcgtgtgtcggagtttacaagaacgg 599
>gb|AY432037.1| Aedes aegypti ASAP ID: 36759 heat shock protein mRNA sequence Length = 694 Score = 65.9 bits (33), Expect = 1e-07 Identities = 66/77 (85%) Strand = Plus / Plus Query: 213 acctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccag 272 |||||||| ||||| || |||||||||||||| | || ||||| |||||||| |||||| Sbjct: 12 acctactcgtgtgtgggagtgtacaagaacggccgagtggagatcatcgccaacgaccag 71 Query: 273 ggtaaccgtatcacgcc 289 |||||||| || ||||| Sbjct: 72 ggtaaccgaattacgcc 88
>ref|XM_323300.1| Neurospora crassa OR74A 78 KDA GLUCOSE-REGULATED PROTEIN HOMOLOG PRECURSOR (GRP 78) (IMMUNOGLOBULIN HEAVY CHAIN BINDING PROTEIN HOMOLOG) (BIP) (NCU03982.1) partial mRNA Length = 1986 Score = 65.9 bits (33), Expect = 1e-07 Identities = 165/209 (78%) Strand = Plus / Plus Query: 186 actgtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggt 245 ||||| |||||||| |||||||| ||||||||||| || || |||||| |||| || Sbjct: 118 actgttatcggtattgatctcggaaccacctactcttgcgttggtgtgatgcagaagggc 177 Query: 246 catgtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttc 305 | ||||||||| ||| ||| ||||| || |||||||| || || || | || | ||| Sbjct: 178 aaggtcgagattctcgtcaacgaccaaggaaaccgtattaccccgtcttatgtcgccttc 237 Query: 306 accgatggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgag 365 ||||||| |||||| || | ||||| || || ||||||||||| |||| ||||||| | Sbjct: 238 accgatgaggagagacttgttggtgacgccgccaagaaccaggctgcggccaacccccac 297 Query: 366 aggaccgtctttgacgtcaagcgtctcat 394 || ||| |||| ||| ||||||||||||| Sbjct: 298 agaaccatcttcgacatcaagcgtctcat 326
>ref|XM_951474.1| Neurospora crassa OR74A 78 KDA GLUCOSE-REGULATED PROTEIN HOMOLOG PRECURSOR (GRP 78) (IMMUNOGLOBULIN HEAVY CHAIN BINDING PROTEIN HOMOLOG) (BIP) (NCU03982.1) partial mRNA Length = 1986 Score = 65.9 bits (33), Expect = 1e-07 Identities = 165/209 (78%) Strand = Plus / Plus Query: 186 actgtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggt 245 ||||| |||||||| |||||||| ||||||||||| || || |||||| |||| || Sbjct: 118 actgttatcggtattgatctcggaaccacctactcttgcgttggtgtgatgcagaagggc 177 Query: 246 catgtcgagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttc 305 | ||||||||| ||| ||| ||||| || |||||||| || || || | || | ||| Sbjct: 178 aaggtcgagattctcgtcaacgaccaaggaaaccgtattaccccgtcttatgtcgccttc 237 Query: 306 accgatggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgag 365 ||||||| |||||| || | ||||| || || ||||||||||| |||| ||||||| | Sbjct: 238 accgatgaggagagacttgttggtgacgccgccaagaaccaggctgcggccaacccccac 297 Query: 366 aggaccgtctttgacgtcaagcgtctcat 394 || ||| |||| ||| ||||||||||||| Sbjct: 298 agaaccatcttcgacatcaagcgtctcat 326
>gb|DQ062087.1| Oxytricha sp. LPJ-2005 heat shock protein 70 mRNA, partial cds; macronuclear Length = 1090 Score = 65.9 bits (33), Expect = 1e-07 Identities = 66/77 (85%) Strand = Plus / Plus Query: 210 accacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgac 269 ||||| ||||||||||| || || ||||||||| | ||| || || |||||||||||| Sbjct: 21 accacgtactcatgtgttggcgttgtcaagaacggacgtgttgaaatcatcgccaatgac 80 Query: 270 cagggtaaccgtatcac 286 ||||||||||||||||| Sbjct: 81 cagggtaaccgtatcac 97
>gb|AF295960.1| Drosophila melanogaster strain QD18 (JPN) heat shock protein Hsp70Bc gene, complete cds Length = 2217 Score = 63.9 bits (32), Expect = 5e-07 Identities = 77/92 (83%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| ||||| ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgtgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350491.1| Drosophila melanogaster strain 3CPA2 heat shock protein Hsp70Bc gene, complete cds Length = 2201 Score = 63.9 bits (32), Expect = 5e-07 Identities = 77/92 (83%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| ||||| ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgtgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350485.1| Drosophila melanogaster strain 3CPA126 heat shock protein Hsp70Bc gene, complete cds Length = 2201 Score = 63.9 bits (32), Expect = 5e-07 Identities = 77/92 (83%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| ||||| ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgtgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>ref|NM_205491.1| Gallus gallus heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5), mRNA Length = 2389 Score = 63.9 bits (32), Expect = 5e-07 Identities = 77/92 (83%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 ||||| |||||||||||||| || ||||| ||||| | ||||||||| | || || || Sbjct: 134 atcgacctcggtaccacctattcttgtgtgggtgtattcaagaacggccgcgtggaaatc 193 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 || |||||||||||||| ||||| |||||||| Sbjct: 194 attgccaatgaccaggggaaccgcatcacgcc 225
>gb|M27260.1|CHKGR78 Chicken 78-kD glucose-regulated protein, complete cds Length = 2389 Score = 63.9 bits (32), Expect = 5e-07 Identities = 77/92 (83%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 ||||| |||||||||||||| || ||||| ||||| | ||||||||| | || || || Sbjct: 134 atcgacctcggtaccacctattcttgtgtgggtgtattcaagaacggccgcgtggaaatc 193 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 || |||||||||||||| ||||| |||||||| Sbjct: 194 attgccaatgaccaggggaaccgcatcacgcc 225
>emb|AJ249331.1|CSA249331 Cucumis sativus mRNA for heat shock protein 70 isoform-2 Length = 2617 Score = 61.9 bits (31), Expect = 2e-06 Identities = 73/87 (83%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtc 251 ||||||||||||||||||||||| ||||| ||||| ||||| | | ||| || ||| Sbjct: 392 atcggtatcgatctcggtaccacttactcttgtgtgggtgtttggcaacacgatcgtgtt 451 Query: 252 gagattatcgccaatgaccagggtaac 278 ||||| || |||||||||||||||||| Sbjct: 452 gagatcattgccaatgaccagggtaac 478
>gb|AY123131.1| Griffithsia japonica heat shock protein 70 mRNA, partial cds Length = 654 Score = 61.9 bits (31), Expect = 2e-06 Identities = 85/103 (82%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtc 251 ||||||||||| ||||||||||||||||| || ||||| || | | || | || ||| Sbjct: 43 atcggtatcgacctcggtaccacctactcctgcgtcggcgtctggcaaaatgatcgcgtc 102 Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgccctcat 294 ||||| |||||||| |||||||||||||| | |||||||||| Sbjct: 103 gagatcatcgccaacgaccagggtaaccgcactacgccctcat 145
>emb|CR861205.1| Pongo pygmaeus mRNA; cDNA DKFZp459C013 (from clone DKFZp459C013) Length = 2558 Score = 61.9 bits (31), Expect = 2e-06 Identities = 88/107 (82%) Strand = Plus / Plus Query: 183 ggtactgtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaac 242 ||||| ||| |||| ||||| || || ||||||||||| || ||||| |||| ||||||| Sbjct: 312 ggtaccgtggtcggcatcgacctggggaccacctactcctgcgtcggcgtgttcaagaac 371 Query: 243 ggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacgcc 289 || | || ||||| |||||||| || ||||| ||||| |||||||| Sbjct: 372 ggccgcgtggagatcatcgccaacgatcagggcaaccgcatcacgcc 418
>gb|AY648749.1| Danio rerio immunoglobulin binding protein mRNA, complete cds Length = 2354 Score = 60.0 bits (30), Expect = 8e-06 Identities = 81/98 (82%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 ||||| || ||||| || || ||||| ||||| ||||| || || |||||||| || | | Sbjct: 223 gtgattgggatcgaccttgggaccacatactcctgtgttggagtctacaagaatggccgt 282 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcac 286 || |||||||| |||||||||||||| ||||| ||||| Sbjct: 283 gttgagattattgccaatgaccagggaaaccgcatcac 320
>gb|BC077757.1| Xenopus laevis heavy-chain binding protein BiP, mRNA (cDNA clone MGC:79065 IMAGE:4957353), complete cds Length = 2463 Score = 60.0 bits (30), Expect = 8e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 255 attatcgccaatgaccagggtaaccgtatcacgccctc 292 ||||| |||||||||||||||||||||||||| ||||| Sbjct: 270 attattgccaatgaccagggtaaccgtatcacaccctc 307
>gb|BC041200.1| Xenopus laevis heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa), mRNA (cDNA clone MGC:52648 IMAGE:4681479), complete cds Length = 2448 Score = 60.0 bits (30), Expect = 8e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 255 attatcgccaatgaccagggtaaccgtatcacgccctc 292 ||||| |||||||||||||||||||||||||| ||||| Sbjct: 267 attattgccaatgaccagggtaaccgtatcacaccctc 304
>gb|BC063946.1| Danio rerio heat shock 70kDa protein 5 (glucose-regulated protein), mRNA (cDNA clone MGC:77606 IMAGE:6996474), complete cds Length = 2345 Score = 60.0 bits (30), Expect = 8e-06 Identities = 81/98 (82%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 ||||| || ||||| || || ||||| ||||| ||||| || || |||||||| || | | Sbjct: 201 gtgattgggatcgaccttgggaccacatactcctgtgttggagtctacaagaatggccgt 260 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcac 286 || |||||||| |||||||||||||| ||||| ||||| Sbjct: 261 gttgagattattgccaatgaccagggaaaccgcatcac 298
>dbj|AB240548.1| Paralichthys olivaceus mRNA for hypothetical protein, partial cds Length = 734 Score = 60.0 bits (30), Expect = 8e-06 Identities = 63/74 (85%) Strand = Plus / Plus Query: 213 acctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccag 272 ||||||||||||||||| |||| |||||| |||| || ||||| || |||| |||||| Sbjct: 106 acctactcatgtgtcggagtgttcaagaatggtcgcgtggagatcattaccaacgaccag 165 Query: 273 ggtaaccgtatcac 286 |||||||| ||||| Sbjct: 166 ggtaaccgcatcac 179
>ref|XM_697518.1| PREDICTED: Danio rerio hypothetical protein LOC555098 (LOC555098), mRNA Length = 2350 Score = 60.0 bits (30), Expect = 8e-06 Identities = 81/98 (82%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 ||||| || ||||| || || ||||| ||||| ||||| || || |||||||| || | | Sbjct: 220 gtgattgggatcgaccttgggaccacatactcctgtgttggagtctacaagaatggccgt 279 Query: 249 gtcgagattatcgccaatgaccagggtaaccgtatcac 286 || |||||||| |||||||||||||| ||||| ||||| Sbjct: 280 gttgagattattgccaatgaccagggaaaccgcatcac 317
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 60.0 bits (30), Expect = 8e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||| | ||||| |||||||||||||| ||||| || ||| |||||| | Sbjct: 16168243 gtgatcgggatcaacctcggcaccacctactcatgggtcggcgtctaccggaacggcatt 16168302 Query: 249 gtcgagattatcgccaatgaccaggg 274 |||||||| |||||||| |||||||| Sbjct: 16168303 gtcgagatcatcgccaacgaccaggg 16168328
>dbj|AP004681.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0040M10 Length = 162790 Score = 60.0 bits (30), Expect = 8e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcat 248 |||||||| ||| | ||||| |||||||||||||| ||||| || ||| |||||| | Sbjct: 73036 gtgatcgggatcaacctcggcaccacctactcatgggtcggcgtctaccggaacggcatt 73095 Query: 249 gtcgagattatcgccaatgaccaggg 274 |||||||| |||||||| |||||||| Sbjct: 73096 gtcgagatcatcgccaacgaccaggg 73121
>gb|U55069.1|XLU55069 Xenopus laevis immunoglobulin binding protein (BiP/Grp78) mRNA, complete cds Length = 2379 Score = 60.0 bits (30), Expect = 8e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 255 attatcgccaatgaccagggtaaccgtatcacgccctc 292 ||||| |||||||||||||||||||||||||| ||||| Sbjct: 202 attattgccaatgaccagggtaaccgtatcacaccctc 239
>gb|U62807.1|XLU62807 Xenopus laevis heavy-chain binding protein BiP mRNA, complete cds Length = 2470 Score = 60.0 bits (30), Expect = 8e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 255 attatcgccaatgaccagggtaaccgtatcacgccctc 292 ||||| |||||||||||||||||||||||||| ||||| Sbjct: 242 attattgccaatgaccagggtaaccgtatcacaccctc 279
>gb|M27825.1|BRMHSP70 B.lactucae heat shock protein 70 (hsp70) gene, complete cds Length = 2869 Score = 60.0 bits (30), Expect = 8e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgt 234 ||||||||||||| || || |||||||||||||||||||||| Sbjct: 619 tcggtatcgatcttggcacgacctactcatgtgtcggtgtgt 660
>gb|M26906.1|CELHSP3B C.briggsae heat shock protein 3 gene, complete cds Length = 2305 Score = 60.0 bits (30), Expect = 8e-06 Identities = 72/86 (83%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtc 251 ||||||||||||||||| |||||||| || ||||| || || ||||||||||| | ||| Sbjct: 771 atcggtatcgatctcggaaccacctattcctgtgttggagtatacaagaacggacgtgtt 830 Query: 252 gagattatcgccaatgaccagggtaa 277 || || ||||| || ||||| ||||| Sbjct: 831 gaaatcatcgctaacgaccaaggtaa 856
>gb|AC154042.1| Drosophila melanogaster clone BACR46E23, complete sequence Length = 181148 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 228 ggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacg 287 ||||||||||||||||| | || ||||| |||||||| || ||||||||||| ||||| Sbjct: 95865 ggtgtgtacaagaacggacgcgttgagatcatcgccaacgatcagggtaaccgcatcact 95806 Query: 288 ccctc 292 ||||| Sbjct: 95805 ccctc 95801
>ref|NM_112093.1| Arabidopsis thaliana HSP70; ATP binding AT3G12580 (HSP70) mRNA, complete cds Length = 2281 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgt 232 |||||||||||||||||||| |||||||| || |||||||| Sbjct: 130 atcggtatcgatctcggtacaacctactcttgcgtcggtgt 170
>ref|XM_520257.1| PREDICTED: Pan troglodytes heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (LOC464733), mRNA Length = 2580 Score = 58.0 bits (29), Expect = 3e-05 Identities = 80/97 (82%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 311 tcggcatcgacctggggaccacctactcctgcgtcggcgtgttcaagaacggccgcgtgg 370 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| ||||| |||||||| Sbjct: 371 agatcatcgccaacgatcagggcaaccgcatcacgcc 407
>gb|AE017356.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 14, complete sequence Length = 762694 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 258 atcgccaatgaccagggtaaccgtatcacgccctcatgggt 298 |||||||| |||||||||||||||||||| || |||||||| Sbjct: 491184 atcgccaacgaccagggtaaccgtatcactccatcatgggt 491144
>ref|XM_370461.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein (MG06958.4) partial mRNA Length = 1956 Score = 58.0 bits (29), Expect = 3e-05 Identities = 29/29 (100%) Strand = Plus / Plus Query: 252 gagattatcgccaatgaccagggtaaccg 280 ||||||||||||||||||||||||||||| Sbjct: 73 gagattatcgccaatgaccagggtaaccg 101
>ref|XM_585062.2| PREDICTED: Bos taurus similar to 78 kDa glucose-regulated protein precursor (GRP 78) (Immunoglobulin heavy chain binding protein) (BiP) (LOC508302), mRNA Length = 612 Score = 58.0 bits (29), Expect = 3e-05 Identities = 80/97 (82%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || |||||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 95 tcggcatcgacctgggtaccacctactcctgcgtcggggtgttcaagaacggccgcgtgg 154 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || || || ||||| |||||||| Sbjct: 155 agatcatcgccaacgatcaaggcaaccgcatcacgcc 191
>ref|NM_005347.2| Homo sapiens heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5), mRNA Length = 3925 Score = 58.0 bits (29), Expect = 3e-05 Identities = 80/97 (82%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 296 tcggcatcgacctggggaccacctactcctgcgtcggcgtgttcaagaacggccgcgtgg 355 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| ||||| |||||||| Sbjct: 356 agatcatcgccaacgatcagggcaaccgcatcacgcc 392
>ref|XM_568651.1| Cryptococcus neoformans var. neoformans JEC21 heat shock protein (CNN01680) partial mRNA Length = 2319 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 258 atcgccaatgaccagggtaaccgtatcacgccctcatgggt 298 |||||||| |||||||||||||||||||| || |||||||| Sbjct: 427 atcgccaacgaccagggtaaccgtatcactccatcatgggt 467
>ref|XM_568652.1| Cryptococcus neoformans var. neoformans JEC21 heat shock protein (CNN01680) partial mRNA Length = 2397 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 258 atcgccaatgaccagggtaaccgtatcacgccctcatgggt 298 |||||||| |||||||||||||||||||| || |||||||| Sbjct: 427 atcgccaacgaccagggtaaccgtatcactccatcatgggt 467
>emb|X75673.1|PCGRP78G P.cinnamomi GRP78/BiP gene Length = 3859 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgccctc 292 ||||| |||||||| |||||||| ||||||||||||||||| Sbjct: 1798 gagatcatcgccaacgaccagggcaaccgtatcacgccctc 1838
>emb|AJ002551.1|ATAJ2551 Arabidopsis thaliana mRNA for heat shock protein 70 Length = 2171 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgt 232 |||||||||||||||||||| |||||||| || |||||||| Sbjct: 112 atcggtatcgatctcggtacaacctactcttgcgtcggtgt 152
>emb|AJ271729.1|HSA271729 Homo sapiens mRNA for glucose-regulated protein (HSPA5 gene) Length = 2007 Score = 58.0 bits (29), Expect = 3e-05 Identities = 80/97 (82%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 105 tcggcatcgacctggggaccacctactcctgcgtcggcgtgttcaagaacggccgcgtgg 164 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| ||||| |||||||| Sbjct: 165 agatcatcgccaacgatcagggcaaccgcatcacgcc 201
>ref|NM_167308.1| Drosophila melanogaster Heat shock protein cognate 3 CG4147-RD, transcript variant D (Hsc70-3), mRNA Length = 3193 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 228 ggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacg 287 ||||||||||||||||| | || ||||| |||||||| || ||||||||||| ||||| Sbjct: 435 ggtgtgtacaagaacggacgcgttgagatcatcgccaacgatcagggtaaccgcatcact 494 Query: 288 ccctc 292 ||||| Sbjct: 495 ccctc 499
>ref|NM_167307.1| Drosophila melanogaster Heat shock protein cognate 3 CG4147-RC, transcript variant C (Hsc70-3), mRNA Length = 2981 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 228 ggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacg 287 ||||||||||||||||| | || ||||| |||||||| || ||||||||||| ||||| Sbjct: 223 ggtgtgtacaagaacggacgcgttgagatcatcgccaacgatcagggtaaccgcatcact 282 Query: 288 ccctc 292 ||||| Sbjct: 283 ccctc 287
>ref|NM_167306.1| Drosophila melanogaster Heat shock protein cognate 3 CG4147-RA, transcript variant A (Hsc70-3), mRNA Length = 3027 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 228 ggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacg 287 ||||||||||||||||| | || ||||| |||||||| || ||||||||||| ||||| Sbjct: 269 ggtgtgtacaagaacggacgcgttgagatcatcgccaacgatcagggtaaccgcatcact 328 Query: 288 ccctc 292 ||||| Sbjct: 329 ccctc 333
>dbj|AB167743.1| Numida meleagris hspa5 mRNA for heat shock protein, complete cds Length = 2465 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 ||||| ||||| |||||||| || || || ||||| | ||||||||| | ||| ||||| Sbjct: 200 atcgacctcggcaccacctattcttgcgtgggtgtcttcaagaacggccgtgtggagata 259 Query: 258 atcgccaatgaccagggtaaccgtatcac 286 || |||||||||||||| ||||| ||||| Sbjct: 260 attgccaatgaccaggggaaccgcatcac 288
>ref|NM_078577.2| Drosophila melanogaster Heat shock protein cognate 3 CG4147-RB, transcript variant B (Hsc70-3), mRNA Length = 3220 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 228 ggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacg 287 ||||||||||||||||| | || ||||| |||||||| || ||||||||||| ||||| Sbjct: 462 ggtgtgtacaagaacggacgcgttgagatcatcgccaacgatcagggtaaccgcatcact 521 Query: 288 ccctc 292 ||||| Sbjct: 522 ccctc 526
>gb|AY059885.1| Arabidopsis thaliana 70 kDa heat shock protein (T16H11.7) mRNA, complete cds Length = 2185 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgt 232 |||||||||||||||||||| |||||||| || |||||||| Sbjct: 129 atcggtatcgatctcggtacaacctactcttgcgtcggtgt 169
>gb|AY054190.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, complete cds Length = 2185 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgt 232 |||||||||||||||||||| |||||||| || |||||||| Sbjct: 129 atcggtatcgatctcggtacaacctactcttgcgtcggtgt 169
>gb|AY054183.1| Arabidopsis thaliana AT3g12580/T2E22_110 mRNA, complete cds Length = 2284 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgt 232 |||||||||||||||||||| |||||||| || |||||||| Sbjct: 130 atcggtatcgatctcggtacaacctactcttgcgtcggtgt 170
>gb|BC020235.1| Homo sapiens heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa), mRNA (cDNA clone MGC:31939 IMAGE:5020098), complete cds Length = 3925 Score = 58.0 bits (29), Expect = 3e-05 Identities = 80/97 (82%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 296 tcggcatcgacctggggaccacctactcctgcgtcggcgtgttcaagaacggccgcgtgg 355 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| ||||| |||||||| Sbjct: 356 agatcatcgccaacgatcagggcaaccgcatcacgcc 392
>gb|AC069474.4|AC069474 Arabidopsis thaliana chromosome 3 BAC T2E22 genomic sequence, complete sequence Length = 105768 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgt 232 |||||||||||||||||||| |||||||| || |||||||| Sbjct: 34132 atcggtatcgatctcggtacaacctactcttgcgtcggtgt 34172
>gb|BT004838.1| Drosophila melanogaster RH21402 full insert cDNA Length = 3259 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 228 ggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacg 287 ||||||||||||||||| | || ||||| |||||||| || ||||||||||| ||||| Sbjct: 463 ggtgtgtacaagaacggacgcgttgagatcatcgccaacgatcagggtaaccgcatcact 522 Query: 288 ccctc 292 ||||| Sbjct: 523 ccctc 527
>gb|AY163897.1| Panagrellus redivivus heat shock protein 70 A2 mRNA, partial cds Length = 1106 Score = 58.0 bits (29), Expect = 3e-05 Identities = 65/77 (84%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgag 254 ||||| || |||||||| |||||||| || ||||| || ||| ||||||| | |||||| Sbjct: 85 ggtattgacctcggtacgacctactcctgcgtcggcgtctaccagaacggcaaagtcgag 144 Query: 255 attatcgccaatgacca 271 ||||||||||| ||||| Sbjct: 145 attatcgccaacgacca 161
>dbj|AP002055.2| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T16H11 Length = 21024 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgt 232 |||||||||||||||||||| |||||||| || |||||||| Sbjct: 20797 atcggtatcgatctcggtacaacctactcttgcgtcggtgt 20757
>gb|AF216292.1|AF216292 Homo sapiens endoplasmic reticulum lumenal Ca2+ binding protein grp78 mRNA, complete cds Length = 1965 Score = 58.0 bits (29), Expect = 3e-05 Identities = 80/97 (82%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 92 tcggcatcgacctggggaccacctactcctgcgtcggcgtgttcaagaacggccgcgtgg 151 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| ||||| |||||||| Sbjct: 152 agatcatcgccaacgatcagggcaaccgcatcacgcc 188
>gb|AF188611.1|AF188611 Homo sapiens BiP protein (HSPA5) mRNA, partial cds Length = 1917 Score = 58.0 bits (29), Expect = 3e-05 Identities = 80/97 (82%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 38 tcggcatcgacctggggaccacctactcctgcgtcggcgtgttcaagaacggccgcgtgg 97 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| ||||| |||||||| Sbjct: 98 agatcatcgccaacgatcagggcaaccgcatcacgcc 134
>gb|AE003487.2| Drosophila melanogaster chromosome X, section 39 of 74 of the complete sequence Length = 308317 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 228 ggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacg 287 ||||||||||||||||| | || ||||| |||||||| || ||||||||||| ||||| Sbjct: 95568 ggtgtgtacaagaacggacgcgttgagatcatcgccaacgatcagggtaaccgcatcact 95509 Query: 288 ccctc 292 ||||| Sbjct: 95508 ccctc 95504
>gb|AF101421.1|AF101421 Cichorium intybus heat shock protein mRNA, partial cds Length = 461 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcggtgt 232 ||||||||||||||||||||||| ||||| || |||||||| Sbjct: 28 atcggtatcgatctcggtaccacatactcctgcgtcggtgt 68
>gb|U41652.1|SBU41652 Sorghum bicolor heat shock protein 70 cognate (hsc70) mRNA, partial cds Length = 675 Score = 58.0 bits (29), Expect = 3e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 248 tgtcgagattatcgccaatgaccagggtaaccgtatcacgccctc 292 ||||||||| |||||||| |||||||||||||| | ||||||||| Sbjct: 133 tgtcgagatcatcgccaacgaccagggtaaccgcaccacgccctc 177
>gb|L01498.1|DROHSC3A Drosophila melanogaster heat shock protein cognate 72 (Hsc3) mRNA, complete cds Length = 3066 Score = 58.0 bits (29), Expect = 3e-05 Identities = 56/65 (86%) Strand = Plus / Plus Query: 228 ggtgtgtacaagaacggtcatgtcgagattatcgccaatgaccagggtaaccgtatcacg 287 ||||||||||||||||| | || ||||| |||||||| || ||||||||||| ||||| Sbjct: 320 ggtgtgtacaagaacggacgcgttgagatcatcgccaacgatcagggtaaccgcatcact 379 Query: 288 ccctc 292 ||||| Sbjct: 380 ccctc 384
>gb|AY846865.1| Drosophila melanogaster strain Z(S)49 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3385 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1574 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1633 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1634 atcgccaatgaccagggcaaccgcaccacgcc 1665
>gb|AY846864.1| Drosophila melanogaster strain Z(S)24 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3385 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1574 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1633 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1634 atcgccaatgaccagggcaaccgcaccacgcc 1665
>gb|AY846863.1| Drosophila melanogaster strain Z(S)2 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3381 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1570 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1629 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1630 atcgccaatgaccagggcaaccgcaccacgcc 1661
>gb|AY846862.1| Drosophila melanogaster strain Z(S)53 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3377 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1566 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1625 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1626 atcgccaatgaccagggcaaccgcaccacgcc 1657
>gb|AY846861.1| Drosophila melanogaster strain Z(S)29 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3381 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1570 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1629 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1630 atcgccaatgaccagggcaaccgcaccacgcc 1661
>gb|AY846860.1| Drosophila melanogaster strain Z(S)15 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3491 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1680 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1739 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1740 atcgccaatgaccagggcaaccgcaccacgcc 1771
>gb|AY846859.1| Drosophila melanogaster strain Z(S)30A transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3491 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1680 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1739 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1740 atcgccaatgaccagggcaaccgcaccacgcc 1771
>gb|AY846858.1| Drosophila melanogaster strain Z(S)11 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3491 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1680 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1739 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1740 atcgccaatgaccagggcaaccgcaccacgcc 1771
>gb|AY846857.1| Drosophila melanogaster strain Z(S)10 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3491 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1680 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1739 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1740 atcgccaatgaccagggcaaccgcaccacgcc 1771
>gb|AY846856.1| Drosophila melanogaster strain Z(S)6 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3491 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1680 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1739 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1740 atcgccaatgaccagggcaaccgcaccacgcc 1771
>gb|AY846855.1| Drosophila melanogaster strain Z(S)30 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3478 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1667 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1726 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1727 atcgccaatgaccagggcaaccgcaccacgcc 1758
>gb|AY846854.1| Drosophila melanogaster strain Z(S)56 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3491 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1680 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1739 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1740 atcgccaatgaccagggcaaccgcaccacgcc 1771
>gb|AY846853.1| Drosophila melanogaster strain IS9 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3491 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1680 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1739 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1740 atcgccaatgaccagggcaaccgcaccacgcc 1771
>gb|AY846852.1| Drosophila melanogaster strain IS25 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3490 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1679 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1738 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1739 atcgccaatgaccagggcaaccgcaccacgcc 1770
>gb|AY846851.1| Drosophila melanogaster strain IS2 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3488 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1677 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1736 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1737 atcgccaatgaccagggcaaccgcaccacgcc 1768
>gb|AY846850.1| Drosophila melanogaster strain IS3 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3490 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1679 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1738 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1739 atcgccaatgaccagggcaaccgcaccacgcc 1770
>gb|AY846849.1| Drosophila melanogaster strain IS5 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3490 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1679 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1738 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1739 atcgccaatgaccagggcaaccgcaccacgcc 1770
>gb|AY846848.1| Drosophila melanogaster strain IS4 transposon S-element, complete sequence; and hsp70Bb gene, partial cds Length = 3490 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1679 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1738 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1739 atcgccaatgaccagggcaaccgcaccacgcc 1770
>gb|AY650293.1| Macaca fascicularis heat-shock 70-kDa protein 5 mRNA, partial cds Length = 1806 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 210 accacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgac 269 ||||||||||| || ||||| |||| ||||||||| | || ||||| |||||||| || Sbjct: 13 accacctactcctgcgtcggcgtgttcaagaacggccgcgtggagatcatcgccaacgat 72 Query: 270 cagggtaaccgtatcacgcc 289 ||||| ||||| |||||||| Sbjct: 73 cagggcaaccgcatcacgcc 92
>gb|BT011541.1| Drosophila melanogaster LP08776 full insert cDNA Length = 3081 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 935 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 994 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 995 atcgccaatgaccagggcaaccgcaccacgcc 1026
>gb|BT011379.1| Drosophila melanogaster LP05233 full insert cDNA Length = 5543 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 249 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 308 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 309 atcgccaatgaccagggcaaccgcaccacgcc 340
>gb|BT011058.1| Drosophila melanogaster LP05203 full insert cDNA Length = 2350 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 242 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 301 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 302 atcgccaatgaccagggcaaccgcaccacgcc 333
>emb|Y09011.1|HCHSP70GR N.crassa DNA for glucose-regulated gene of hsp70 family Length = 4422 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 303 ttcaccgatggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaacccc 362 |||||||||| |||||| || | ||||| || || ||||||||||| |||| ||||||| Sbjct: 2128 ttcaccgatgaggagagacttgttggtgacgccgccaagaaccaggctgcggccaacccc 2187 Query: 363 gagaggaccgtctttgacgtcaagcgtctcat 394 | || ||| |||| ||| ||||||||||||| Sbjct: 2188 cacagaaccatcttcgacatcaagcgtctcat 2219
>emb|X87949.1|HSRNABIP H.sapiens mRNA for BiP protein Length = 2554 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 210 accacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaatgac 269 ||||||||||| || ||||| |||| ||||||||| | || ||||| |||||||| || Sbjct: 331 accacctactcctgcgtcggcgtgttcaagaacggccgcgtggagatcatcgccaacgat 390 Query: 270 cagggtaaccgtatcacgcc 289 ||||| ||||| |||||||| Sbjct: 391 cagggcaaccgcatcacgcc 410
>ref|NM_176486.1| Drosophila melanogaster Hsp70Bbb CG5834-RA (Hsp70Bbb), mRNA Length = 2591 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 258 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 317 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 318 atcgccaatgaccagggcaaccgcaccacgcc 349
>ref|NM_169469.1| Drosophila melanogaster Heat-shock-protein-70Ba CG31449-RA (Hsp70Ba), mRNA Length = 2475 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 237 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 296 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 297 atcgccaatgaccagggcaaccgcaccacgcc 328
>gb|AF295962.1| Drosophila melanogaster strain FrV3-1 heat shock protein Hsp70Bc gene, complete cds Length = 2217 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF295961.1| Drosophila melanogaster strain Z(H)1 heat shock protein Hsp70Bc gene, complete cds Length = 2206 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF295959.1| Drosophila melanogaster strain B28 heat shock protein Hsp70Bc gene, complete cds Length = 2217 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF295958.1| Drosophila melanogaster strain AUS heat shock protein Hsp70Bc gene, complete cds Length = 2217 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF295957.1| Drosophila melanogaster strain ZZ30 heat shock protein Hsp70Bb gene, complete cds Length = 2548 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF295956.1| Drosophila melanogaster strain FrV3-1 heat shock protein Hsp70Bb gene, complete cds Length = 2550 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 223 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 282 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 283 atcgccaatgaccagggcaaccgcaccacgcc 314
>gb|AF295955.1| Drosophila melanogaster strain QD18 (JPN) heat shock protein Hsp70Bb gene, complete cds Length = 2393 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF295954.1| Drosophila melanogaster strain AUS heat shock protein Hsp70Bb gene, complete cds Length = 2548 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF295953.1| Drosophila melanogaster strain B28 heat shock protein Hsp70Bb gene, complete cds Length = 2386 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 223 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 282 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 283 atcgccaatgaccagggcaaccgcaccacgcc 314
>gb|AF295952.1| Drosophila melanogaster strain B25 heat shock protein Hsp70Bb gene, complete cds Length = 2548 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF295951.1| Drosophila melanogaster strain Z(H)1 heat shock protein Hsp70Bb gene, complete cds Length = 2541 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 223 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 282 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 283 atcgccaatgaccagggcaaccgcaccacgcc 314
>gb|AF295950.1| Drosophila melanogaster strain QD18 (JPN) heat shock protein Hsp70Ba gene, complete cds Length = 2563 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF295949.1| Drosophila melanogaster strain AUS heat shock protein Hsp70Ba gene, complete cds Length = 2550 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 223 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 282 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 283 atcgccaatgaccagggcaaccgcaccacgcc 314
>gb|AF295948.1| Drosophila melanogaster strain FrV3-1 heat shock protein Hsp70Ba gene, complete cds Length = 2563 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF295947.1| Drosophila melanogaster strain Z(H)1 heat shock protein Hsp70Ba gene, complete cds Length = 2563 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF295946.1| Drosophila melanogaster strain A28 heat shock protein Hsp70Ba gene, complete cds Length = 2556 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 223 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 282 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 283 atcgccaatgaccagggcaaccgcaccacgcc 314
>gb|AF350490.1| Drosophila melanogaster strain 3CPA43 heat shock protein Hsp70Bc gene, complete cds Length = 2201 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350489.1| Drosophila melanogaster strain 3CPA81 heat shock protein Hsp70Bc gene, complete cds Length = 2201 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350488.1| Drosophila melanogaster strain 3CPA86 heat shock protein Hsp70Bc gene, complete cds Length = 2201 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350487.1| Drosophila melanogaster strain 3CPA61 heat shock protein Hsp70Bc gene, complete cds Length = 2201 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350486.1| Drosophila melanogaster strain 3CPA47 heat shock protein Hsp70Bc gene, complete cds Length = 2201 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350484.1| Drosophila melanogaster strain 3CPA35 heat shock protein Hsp70Bc gene, complete cds Length = 2201 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350483.1| Drosophila melanogaster strain 3CPA2 heat shock protein Hsp70Bb gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350482.1| Drosophila melanogaster strain 3CPA43 heat shock protein Hsp70Bb gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350481.1| Drosophila melanogaster strain 3CPA81 heat shock protein Hsp70Bb gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350480.1| Drosophila melanogaster strain 3CPA86 heat shock protein Hsp70Bb gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350479.1| Drosophila melanogaster strain 3CPA61 heat shock protein Hsp70Bb gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350478.1| Drosophila melanogaster strain 3CPA47 heat shock protein Hsp70Bb gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350477.1| Drosophila melanogaster strain 3CPA126 heat shock protein Hsp70Bb gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350476.1| Drosophila melanogaster strain 3CPA35 heat shock protein Hsp70Bb gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350475.1| Drosophila melanogaster strain 3CPA2 heat shock protein Hsp70Ba gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350474.1| Drosophila melanogaster strain 3CPA43 heat shock protein Hsp70Ba gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350473.1| Drosophila melanogaster strain 3CPA81 heat shock protein Hsp70Ba gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350472.1| Drosophila melanogaster strain 3CPA86 heat shock protein Hsp70Ba gene, complete cds Length = 2516 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 223 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 282 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 283 atcgccaatgaccagggcaaccgcaccacgcc 314
>gb|AF350471.1| Drosophila melanogaster strain 3CPA61 heat shock protein Hsp70Ba gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350470.1| Drosophila melanogaster strain 3CPA47 heat shock protein Hsp70Ba gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350469.1| Drosophila melanogaster strain 3CPA126 heat shock protein Hsp70Ba gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF350468.1| Drosophila melanogaster strain 3CPA35 heat shock protein Hsp70Ba gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>ref|NM_141952.1| Drosophila melanogaster Heat-shock-protein-70Bc CG6489-RA (Hsp70Bc), mRNA Length = 2211 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 258 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 317 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 318 atcgccaatgaccagggcaaccgcaccacgcc 349
>ref|NM_080188.2| Drosophila melanogaster Heat-shock-protein-70Bb CG31359-RA (Hsp70Bb), mRNA Length = 2591 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 258 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 317 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 318 atcgccaatgaccagggcaaccgcaccacgcc 349
>gb|AF377341.1|AF377341 Drosophila melanogaster transposon P-element, heat shock protein Hsp70Ba gene, partial cds Length = 2099 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1924 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1983 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1984 atcgccaatgaccagggcaaccgcaccacgcc 2015
>gb|AF385408.1|AF385408 Drosophila melanogaster strain SFS97 heat shock protein Hsp70Ba gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF385407.1|AF385407 Drosophila melanogaster strain NFS97 isolate 3 heat shock protein Hsp70Ba gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF385406.1|AF385406 Drosophila melanogaster strain NFS97 isolate 2 heat shock protein Hsp70Ba gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AF385405.1|AF385405 Drosophila melanogaster strain NFS97 isolate 1 heat shock protein Hsp70Ba gene, complete cds Length = 2523 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 230 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 289 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 290 atcgccaatgaccagggcaaccgcaccacgcc 321
>gb|AC007668.7| Drosophila melanogaster, chromosome 3R, region 87C-87C, BAC clone BACR02G11, complete sequence Length = 167239 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 44298 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 44357 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 44358 atcgccaatgaccagggcaaccgcaccacgcc 44389 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 41015 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 41074 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 41075 atcgccaatgaccagggcaaccgcaccacgcc 41106 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 37732 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 37791 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 37792 atcgccaatgaccagggcaaccgcaccacgcc 37823 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 2507 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 2448 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 2447 atcgccaatgaccagggcaaccgcaccacgcc 2416
>gb|AC007594.5| Drosophila melanogaster, chromosome 3R, region 87B-87C, BAC clone BACR28I14, complete sequence Length = 161601 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 151235 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 151294 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 151295 atcgccaatgaccagggcaaccgcaccacgcc 151326 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 147952 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 148011 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 148012 atcgccaatgaccagggcaaccgcaccacgcc 148043 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 144669 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 144728 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 144729 atcgccaatgaccagggcaaccgcaccacgcc 144760 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 109444 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 109385 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 109384 atcgccaatgaccagggcaaccgcaccacgcc 109353
>gb|AF377953.1|AF377953 Drosophila melanogaster strain Arvin/Zimbabwe heat shock protein Hsp70Ba gene, promoter region and partial cds Length = 2290 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 2115 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 2174 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 2175 atcgccaatgaccagggcaaccgcaccacgcc 2206
>gb|AY032740.1| Drosophila melanogaster truncated Jockey element transposon, and heat shock protein Hsp70Ba gene, promoter and complete cds Length = 4464 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 2178 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 2237 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 2238 atcgccaatgaccagggcaaccgcaccacgcc 2269
>gb|AY370940.1| Drosophila melanogaster strain Evolution Canyon 2000 heat shock protein hsp70Bb (hsp70Bb) gene, promoter region and partial cds Length = 1772 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 1622 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 1681 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 1682 atcgccaatgaccagggcaaccgcaccacgcc 1713
>gb|AE003696.3| Drosophila melanogaster chromosome 3R, section 34 of 118 of the complete sequence Length = 265467 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 79898 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 79957 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 79958 atcgccaatgaccagggcaaccgcaccacgcc 79989 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 76615 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 76674 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 76675 atcgccaatgaccagggcaaccgcaccacgcc 76706 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 73332 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 73391 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 73392 atcgccaatgaccagggcaaccgcaccacgcc 73423 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 198 atcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagatt 257 |||||||| || ||||||||||| || || ||||| ||| || | || | || |||||| Sbjct: 38107 atcgatctgggcaccacctactcctgcgtgggtgtctaccagcatggcaaggttgagatt 38048 Query: 258 atcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||| ||||| | |||||| Sbjct: 38047 atcgccaatgaccagggcaaccgcaccacgcc 38016
>ref|XM_744501.1| Aspergillus fumigatus Af293 ER Hsp70 chaperone BiP (Afu2g04620) partial mRNA Length = 2019 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 442 tcccctacaagattgtcaacaaggagggcaagcct 476 ||||||||||| ||||||||||||| ||||||||| Sbjct: 404 tcccctacaaggttgtcaacaaggatggcaagcct 438 Score = 50.1 bits (25), Expect = 0.007 Identities = 82/101 (81%) Strand = Plus / Plus Query: 186 actgtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggt 245 ||||| |||||||||||||| || || || ||||| |||||||||||| ||||||| Sbjct: 148 actgtcatcggtatcgatcttggaacaacatactcttgtgtcggtgtgatgcagaacgga 207 Query: 246 catgtcgagattatcgccaatgaccagggtaaccgtatcac 286 | || || || |||||||| ||||| || ||||||||||| Sbjct: 208 aaggttgaaatcatcgccaacgaccaaggaaaccgtatcac 248
>ref|XM_445544.1| Candida glabrata CBS138, CAGL0D02948g partial mRNA Length = 2004 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 186 actgtgatcggtatcgatctcggtaccacctactcatgtgtcg 228 |||||||||||||||||||| ||||| || ||||| ||||||| Sbjct: 109 actgtgatcggtatcgatctgggtactacgtactcgtgtgtcg 151
>gb|AY226079.1| Monosiga brevicollis type Mb_ER 70-kDa heat-shock protein-like (hsp70) mRNA, partial sequence Length = 2026 Score = 54.0 bits (27), Expect = 5e-04 Identities = 75/91 (82%) Strand = Plus / Plus Query: 183 ggtactgtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaac 242 |||||||| || ||||| || || |||||||||||||| || || ||||||| |||||| Sbjct: 77 ggtactgttattggtattgaccttggtaccacctactcttgcgtgggtgtgttcaagaat 136 Query: 243 ggtcatgtcgagattatcgccaatgaccagg 273 || | ||||||||| || |||| ||||||| Sbjct: 137 ggccgtgtcgagatcattcccaacgaccagg 167
>emb|CR380950.1| Candida glabrata strain CBS138 chromosome D complete sequence Length = 651701 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 186 actgtgatcggtatcgatctcggtaccacctactcatgtgtcg 228 |||||||||||||||||||| ||||| || ||||| ||||||| Sbjct: 308299 actgtgatcggtatcgatctgggtactacgtactcgtgtgtcg 308341
>gb|AF034618.1|AF034618 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-1) gene, complete cds Length = 4349 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgt 226 |||||||| |||||||||||||||||||| ||||| Sbjct: 1193 atcggtattgatctcggtaccacctactcttgtgt 1227
>gb|L26243.1|SPIC70A Spinacia oleracea heat shock C70 protein mRNA, complete cds Length = 2194 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgt 226 |||||||| |||||||||||||||||||| ||||| Sbjct: 72 atcggtattgatctcggtaccacctactcttgtgt 106
>emb|AJ865158.1| Cocos nucifera microsatellite DNA, clone CnCir 48 Length = 272 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 324 atcggtgaggctgcaaagaaccaggc 349 |||||||||||||||||||||||||| Sbjct: 24 atcggtgaggctgcaaagaaccaggc 49
>ref|XM_566757.1| Cryptococcus neoformans var. neoformans JEC21 heat shock protein sks2 (heat shock cognate protein hsc1) (CNA03160) partial mRNA Length = 2116 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgag 254 |||||||| || ||||| |||||||| ||||||||||| | | |||| | |||||| Sbjct: 98 ggtatcgaccttggtactacctactcttgtgtcggtgtctggcaaaacgaccgagtcgag 157 Query: 255 attatcgccaatgaccagggtaaccg 280 || |||||||| |||||||||||||| Sbjct: 158 atcatcgccaacgaccagggtaaccg 183
>ref|XM_503913.1| Yarrowia lipolytica CLIB122, YALI0E13706g predicted mRNA Length = 2013 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgt 232 ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 121 ggtatcgatctgggtaccacctactcctgtgttggtgt 158
>dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012 Length = 2668010 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgt 234 ||||||||||| | |||||||||||||| ||||| ||||||| Sbjct: 2578994 tcggtatcgatttgggtaccacctactcctgtgtgggtgtgt 2579035
>dbj|AB168812.1| Macaca fascicularis testis cDNA, clone: QtsA-15024, similar to human heat shock 70kDa protein 1-like (HSPA1L), mRNA, RefSeq: NM_005527.2 Length = 2449 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgag 254 |||||||| || || ||||||||||| ||||| || |||| | || |||| | || ||| Sbjct: 181 ggtatcgacctgggcaccacctactcctgtgtgggggtgttccagcacggcaaggtggag 240 Query: 255 attatcgccaatgaccagggtaaccg 280 || ||||||||||||||||| ||||| Sbjct: 241 atcatcgccaatgaccagggcaaccg 266
>dbj|AB168570.1| Macaca fascicularis testis cDNA clone: QtsA-13086, similar to human heat shock 70kDa protein 1-like (HSPA1L), mRNA, RefSeq: NM_005527.2 Length = 2422 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgag 254 |||||||| || || ||||||||||| ||||| || |||| | || |||| | || ||| Sbjct: 194 ggtatcgacctgggcaccacctactcctgtgtgggggtgttccagcacggcaaggtggag 253 Query: 255 attatcgccaatgaccagggtaaccg 280 || ||||||||||||||||| ||||| Sbjct: 254 atcatcgccaatgaccagggcaaccg 279
>gb|AF302413.1|AF302413 Drosophila orena heat shock protein Hsp70Bb gene, complete cds Length = 1932 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||||||||| ||||| | |||||| Sbjct: 70 gagattatcgccaatgaccagggcaaccgcaccacgcc 107
>gb|AF302412.1|AF302412 Drosophila orena heat shock protein Hsp70Ba gene, complete cds Length = 1932 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgcc 289 ||||||||||||||||||||||| ||||| | |||||| Sbjct: 70 gagattatcgccaatgaccagggcaaccgcaccacgcc 107
>gb|AC148662.1| Macaca mulatta Major Histocompatibility Complex BAC MMU009PO6, complete sequence Length = 191271 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Minus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgag 254 |||||||| || || ||||||||||| ||||| || |||| | || |||| | || ||| Sbjct: 64017 ggtatcgacctgggcaccacctactcctgtgtgggggtgttccagcacggcaaggtggag 63958 Query: 255 attatcgccaatgaccagggtaaccg 280 || ||||||||||||||||| ||||| Sbjct: 63957 atcatcgccaatgaccagggcaaccg 63932 Score = 44.1 bits (22), Expect = 0.45 Identities = 73/90 (81%) Strand = Plus / Plus Query: 191 gatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgt 250 |||||| ||||| || || ||||||||||| ||||| || |||| | || |||| | || Sbjct: 79872 gatcggcatcgacctgggcaccacctactcctgtgtgggggtgttccagcacggcaaggt 79931 Query: 251 cgagattatcgccaatgaccagggtaaccg 280 ||||| |||||||| |||||||| ||||| Sbjct: 79932 ggagatcatcgccaacgaccagggcaaccg 79961 Score = 44.1 bits (22), Expect = 0.45 Identities = 73/90 (81%) Strand = Plus / Plus Query: 191 gatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgt 250 |||||| ||||| || || ||||||||||| ||||| || |||| | || |||| | || Sbjct: 67911 gatcggcatcgacctgggcaccacctactcctgtgtgggggtgttccagcacggcaaggt 67970 Query: 251 cgagattatcgccaatgaccagggtaaccg 280 ||||| |||||||| |||||||| ||||| Sbjct: 67971 ggagatcatcgccaacgaccagggcaaccg 68000
>dbj|AK182640.1| Mus musculus cDNA, clone:Y0G0123E11, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000015800, based on BLAT search Length = 174 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 255 attatcgccaatgaccagggtaaccg 280 |||||||||||||||||||||||||| Sbjct: 149 attatcgccaatgaccagggtaaccg 174
>dbj|AK119255.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-H02, full insert sequence Length = 2311 Score = 52.0 bits (26), Expect = 0.002 Identities = 116/146 (79%) Strand = Plus / Plus Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgat 311 ||||| |||||||| |||||||| ||||| | ||| ||||| | || || |||||||| Sbjct: 264 gagatcatcgccaacgaccagggcaaccgcaccaccccctcctacgtcggcttcaccgac 323 Query: 312 ggggagaggctcatcggtgaggctgcaaagaaccaggcggcggtcaaccccgagaggacc 371 |||||||||||||| || ||||| |||||||||| || | |||||| | ||| Sbjct: 324 tccgagaggctcatcggagatgctgccaagaaccaggtcgccatgaaccccatcaacacc 383 Query: 372 gtctttgacgtcaagcgtctcattgg 397 |||||||| | ||||||||||||||| Sbjct: 384 gtctttgatgccaagcgtctcattgg 409
>gb|AF161180.1|AF161180 Malus domestica high molecular weight heat shock protein (Hsp2) mRNA, complete cds Length = 2212 Score = 52.0 bits (26), Expect = 0.002 Identities = 74/90 (82%) Strand = Plus / Plus Query: 191 gatcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgt 250 |||||| ||||||||||| ||||| ||||| || |||||||| | | ||| || ||| Sbjct: 60 gatcgggatcgatctcggaaccacttactcgtgcgtcggtgtttggcaacacgatcgtgt 119 Query: 251 cgagattatcgccaatgaccagggtaaccg 280 |||||| ||||||||||| ||||| ||||| Sbjct: 120 cgagatcatcgccaatgatcagggcaaccg 149
>dbj|AK107338.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-F12, full insert sequence Length = 2330 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcgg 229 ||||||||||| || |||||||||||||| |||||||| Sbjct: 85 atcggtatcgaccttggtaccacctactcgtgtgtcgg 122 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 248 tgtcgagattatcgccaatgaccagggtaaccg 280 ||||||||| |||||||| |||||||||||||| Sbjct: 141 tgtcgagatcatcgccaacgaccagggtaaccg 173
>gb|U63136.1|YLU63136 Yarrowia lipolytica heat shock 70 protein Kar2p/BiP homolog (KAR2) gene, complete cds Length = 2569 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgt 232 ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 501 ggtatcgatctgggtaccacctactcctgtgttggtgt 538
>gb|U49932.1|PAU49932 Pichia angusta heat shock protein 70 homolog (HSA2) gene, complete cds Length = 2267 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 249 gtcgagattatcgccaatgaccagggtaac 278 ||||||||||||||||||||||| |||||| Sbjct: 365 gtcgagattatcgccaatgaccaaggtaac 394
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 195 ggtatcgatctcggtaccacctactcatgtgtcggtgt 232 ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 1657996 ggtatcgatctgggtaccacctactcctgtgttggtgt 1657959 Score = 40.1 bits (20), Expect = 7.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 447 tacaagattgtcaacaaggagggcaagc 474 |||||||| |||||||||||||||||| Sbjct: 4073223 tacaagatgatcaacaaggagggcaagc 4073196
>emb|X92446.1|SSGRP78 S.scrofa mRNA for grp78 protein Length = 2453 Score = 52.0 bits (26), Expect = 0.002 Identities = 83/102 (81%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || || || |||| |||||| || | ||| | Sbjct: 230 tcggcatcgacctgggcaccacctactcgtgcgttggggtgttcaagaatggccgtgtgg 289 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgccctcat 294 |||| |||||||| || ||||| ||||| |||||||| |||| Sbjct: 290 agatcatcgccaacgatcagggcaaccgcatcacgccgtcat 331
>gb|AY651257.1| Bodo saltans heat shock protein 70-B cytosolic isoform gene, partial cds Length = 1912 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 252 gagattatcgccaatgaccagggtaaccg 280 |||||||| |||||||||||||||||||| Sbjct: 23 gagattattgccaatgaccagggtaaccg 51
>gb|BC106193.1| Mus musculus heat shock protein 8, mRNA (cDNA clone MGC:118485 IMAGE:6329283), complete cds Length = 2129 Score = 50.1 bits (25), Expect = 0.007 Identities = 73/89 (82%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 |||||||| ||||||||||| ||||| ||||| | | || | || | || || ||||| Sbjct: 91 gatctcggcaccacctactcctgtgtgggtgtcttccagcatggaaaggtggaaattatt 150 Query: 261 gccaatgaccagggtaaccgtatcacgcc 289 |||||||||||||||||||| | |||||| Sbjct: 151 gccaatgaccagggtaaccgcaccacgcc 179
>gb|BC085486.1| Mus musculus heat shock protein 8, mRNA (cDNA clone MGC:102008 IMAGE:30540914), complete cds Length = 2129 Score = 50.1 bits (25), Expect = 0.007 Identities = 73/89 (82%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 |||||||| ||||||||||| ||||| ||||| | | || | || | || || ||||| Sbjct: 95 gatctcggcaccacctactcctgtgtgggtgtcttccagcatggaaaggtggaaattatt 154 Query: 261 gccaatgaccagggtaaccgtatcacgcc 289 |||||||||||||||||||| | |||||| Sbjct: 155 gccaatgaccagggtaaccgcaccacgcc 183
>gb|AC134045.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0022E16 map C481S, complete sequence Length = 179668 Score = 50.1 bits (25), Expect = 0.007 Identities = 79/97 (81%) Strand = Plus / Plus Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgat 311 ||||| |||||||| |||||||| ||||| | ||| ||||| | || || |||||||| Sbjct: 131862 gagatcatcgccaacgaccagggcaaccgcaccaccccctcctacgtcggcttcaccgac 131921 Query: 312 ggggagaggctcatcggtgaggctgcaaagaaccagg 348 |||||||||||||| || ||||| |||||||||| Sbjct: 131922 tccgagaggctcatcggagatgctgccaagaaccagg 131958
>gb|AY965684.1| Pichia pastoris Kar2p (KAR2) gene, complete cds Length = 2040 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Plus Query: 189 gtgatcggtatcgatctcggtaccacctactcatgtgtcggtgtg 233 ||||| ||||||||| | |||||||| ||||| |||||||||||| Sbjct: 118 gtgattggtatcgatttgggtaccacgtactcttgtgtcggtgtg 162
>ref|XM_989582.1| PREDICTED: Mus musculus similar to heat shock protein 8 (LOC621284), mRNA Length = 2179 Score = 50.1 bits (25), Expect = 0.007 Identities = 73/89 (82%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 |||||||| ||||||||||| ||||| ||||| | | || | || | || || ||||| Sbjct: 217 gatctcggcaccacctactcctgtgtgggtgtcttccagcatggaaaggtggaaattatt 276 Query: 261 gccaatgaccagggtaaccgtatcacgcc 289 |||||||||||||||||||| | |||||| Sbjct: 277 gccaatgaccagggtaaccgcaccacgcc 305
>ref|XM_754845.1| Ustilago maydis 521 hypothetical protein (UM03791.1) partial mRNA Length = 1938 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactcatgtgtcg 228 |||||||||||||| ||||| |||||||| ||||||| Sbjct: 13 atcggtatcgatcttggtactacctactcctgtgtcg 49
>ref|XM_537847.2| PREDICTED: Canis familiaris similar to 78 kDa glucose-regulated protein precursor (GRP 78) (Immunoglobulin heavy chain binding protein) (BiP) (Endoplasmic reticulum lumenal Ca(2+) binding protein grp78), transcript variant 1 (LOC480726), mRNA Length = 2555 Score = 50.1 bits (25), Expect = 0.007 Identities = 79/97 (81%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 275 tcggcatcgacctgggcaccacctactcctgcgtcggggtgttcaagaacggccgcgtgg 334 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| || || |||||||| Sbjct: 335 agatcatcgccaacgatcagggcaatcgcatcacgcc 371
>ref|XM_858292.1| PREDICTED: Canis familiaris similar to 78 kDa glucose-regulated protein precursor (GRP 78) (Immunoglobulin heavy chain binding protein) (BiP) (Endoplasmic reticulum lumenal Ca(2+) binding protein grp78), transcript variant 5 (LOC480726), mRNA Length = 2516 Score = 50.1 bits (25), Expect = 0.007 Identities = 79/97 (81%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 275 tcggcatcgacctgggcaccacctactcctgcgtcggggtgttcaagaacggccgcgtgg 334 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| || || |||||||| Sbjct: 335 agatcatcgccaacgatcagggcaatcgcatcacgcc 371
>ref|XM_858266.1| PREDICTED: Canis familiaris similar to 78 kDa glucose-regulated protein precursor (GRP 78) (Immunoglobulin heavy chain binding protein) (BiP) (Endoplasmic reticulum lumenal Ca(2+) binding protein grp78), transcript variant 4 (LOC480726), mRNA Length = 2360 Score = 50.1 bits (25), Expect = 0.007 Identities = 79/97 (81%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 275 tcggcatcgacctgggcaccacctactcctgcgtcggggtgttcaagaacggccgcgtgg 334 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| || || |||||||| Sbjct: 335 agatcatcgccaacgatcagggcaatcgcatcacgcc 371
>ref|XM_858246.1| PREDICTED: Canis familiaris similar to 78 kDa glucose-regulated protein precursor (GRP 78) (Immunoglobulin heavy chain binding protein) (BiP) (Endoplasmic reticulum lumenal Ca(2+) binding protein grp78), transcript variant 3 (LOC480726), mRNA Length = 2317 Score = 50.1 bits (25), Expect = 0.007 Identities = 79/97 (81%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 275 tcggcatcgacctgggcaccacctactcctgcgtcggggtgttcaagaacggccgcgtgg 334 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| || || |||||||| Sbjct: 335 agatcatcgccaacgatcagggcaatcgcatcacgcc 371
>ref|XM_858226.1| PREDICTED: Canis familiaris similar to 78 kDa glucose-regulated protein precursor (GRP 78) (Immunoglobulin heavy chain binding protein) (BiP) (Endoplasmic reticulum lumenal Ca(2+) binding protein grp78), transcript variant 2 (LOC480726), mRNA Length = 2218 Score = 50.1 bits (25), Expect = 0.007 Identities = 79/97 (81%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | || | Sbjct: 275 tcggcatcgacctgggcaccacctactcctgcgtcggggtgttcaagaacggccgcgtgg 334 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| || || |||||||| Sbjct: 335 agatcatcgccaacgatcagggcaatcgcatcacgcc 371
>ref|XM_501940.1| Yarrowia lipolytica CLIB122, YALI0C17347g predicted mRNA Length = 1905 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactc 220 |||||||||||||||||||||||| |||| Sbjct: 58 atcggtatcgatctcggtaccaccaactc 86
>gb|AY131206.1| Spironucleus barkhanus cytosolic heat shock protein 70 (hsp70) mRNA, partial cds Length = 1974 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 321 ctcatcggtgaggctgcaaagaaccaggc 349 ||||||||||||||||| ||||||||||| Sbjct: 130 ctcatcggtgaggctgccaagaaccaggc 158 Score = 46.1 bits (23), Expect = 0.11 Identities = 53/63 (84%) Strand = Plus / Plus Query: 207 ggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatcgccaat 266 ||||| |||||||| ||||| ||||| | | |||| | | ||||||||||||||||||| Sbjct: 16 ggtactacctactcttgtgttggtgtcttccagaatgaacgtgtcgagattatcgccaat 75 Query: 267 gac 269 ||| Sbjct: 76 gac 78
>emb|X81860.1|CHHSP70 C.herbarum mRNA for heat shock protein 70 Length = 2203 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 252 gagattatcgccaatgaccagggtaaccg 280 |||||||||||||| |||||||||||||| Sbjct: 121 gagattatcgccaacgaccagggtaaccg 149 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactc 220 |||||||||||||| ||||| |||||||| Sbjct: 61 atcggtatcgatcttggtactacctactc 89
>emb|X67711.2|OSHSC70A O.sativa hsp70 gene for heat shock protein 70 Length = 4791 Score = 50.1 bits (25), Expect = 0.007 Identities = 79/97 (81%) Strand = Plus / Plus Query: 252 gagattatcgccaatgaccagggtaaccgtatcacgccctcatgggttgggttcaccgat 311 ||||| |||||||| |||||||| ||||| | ||| ||||| | || || |||||||| Sbjct: 776 gagatcatcgccaacgaccagggcaaccgcaccaccccctcctacgtcggcttcaccgac 835 Query: 312 ggggagaggctcatcggtgaggctgcaaagaaccagg 348 |||||||||||||| || ||||| |||||||||| Sbjct: 836 tccgagaggctcatcggagatgctgccaagaaccagg 872
>emb|X61491.1|SOSCE70 S.oleracea sce70 mRNA for 70 kDa heat shock protein of the chloroplast envelope membrane Length = 2535 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 192 atcggtatcgatctcggtaccacctactc 220 |||||||| |||||||||||||||||||| Sbjct: 405 atcggtattgatctcggtaccacctactc 433
>gb|AC158355.2| Mus musculus BAC clone RP24-374N16 from chromosome 9, complete sequence Length = 172612 Score = 50.1 bits (25), Expect = 0.007 Identities = 73/89 (82%) Strand = Plus / Plus Query: 201 gatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcgagattatc 260 |||||||| ||||||||||| ||||| ||||| | | || | || | || || ||||| Sbjct: 91372 gatctcggcaccacctactcctgtgtgggtgtcttccagcatggaaaggtggaaattatt 91431 Query: 261 gccaatgaccagggtaaccgtatcacgcc 289 |||||||||||||||||||| | |||||| Sbjct: 91432 gccaatgaccagggtaaccgcaccacgcc 91460
>dbj|AB232154.1| Macaca fuscata Bip mRNA for immunoglobulin heavy-chain binding protein, complete cds Length = 1965 Score = 50.1 bits (25), Expect = 0.007 Identities = 79/97 (81%) Strand = Plus / Plus Query: 193 tcggtatcgatctcggtaccacctactcatgtgtcggtgtgtacaagaacggtcatgtcg 252 |||| ||||| || || ||||||||||| || ||||| |||| ||||||||| | | | Sbjct: 92 tcggcatcgacctggggaccacctactcctgcgtcggcgtgttcaagaacggccgcgcgg 151 Query: 253 agattatcgccaatgaccagggtaaccgtatcacgcc 289 |||| |||||||| || ||||| ||||| |||||||| Sbjct: 152 agatcatcgccaacgatcagggcaaccgcatcacgcc 188 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,057,795 Number of Sequences: 3902068 Number of extensions: 4057795 Number of successful extensions: 204013 Number of sequences better than 10.0: 772 Number of HSP's better than 10.0 without gapping: 739 Number of HSP's successfully gapped in prelim test: 40 Number of HSP's that attempted gapping in prelim test: 199525 Number of HSP's gapped (non-prelim): 4339 length of query: 522 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 499 effective length of database: 17,143,297,704 effective search space: 8554505554296 effective search space used: 8554505554296 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
