ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd26p05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BC071142.1| Xenopus laevis MGC82375 protein, mRNA (cDNA clone... 519 e-144
2ref|NM_001011475.1| Xenopus tropicalis hypothetical LOC496966 (L... 406 e-110
3gb|BC088766.1| Xenopus tropicalis hypothetical LOC496966, mRNA (... 406 e-110
4emb|CR387409.1| Gallus gallus finished cDNA, clone ChEST23b10 58 2e-05
5emb|AJ720974.1| Gallus gallus mRNA for hypothetical protein, clo... 56 7e-05
6ref|NM_001039332.1| Gallus gallus Williams Beuren syndrome chrom... 56 7e-05
7ref|NM_025375.1| Mus musculus Williams Beuren syndrome chromosom... 54 3e-04
8gb|AF412035.1| Mus musculus Williams-Beuren syndrome critical re... 54 3e-04
9dbj|AK151986.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 3e-04
10dbj|AK011005.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 54 3e-04
11dbj|AK003386.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 54 3e-04
12dbj|AK008966.1| Mus musculus adult male stomach cDNA, RIKEN full... 54 3e-04
13dbj|AK002497.1| Mus musculus adult male kidney cDNA, RIKEN full-... 54 3e-04
14gb|AC084109.2| Mus musculus strain C57BL6/J chromosome 5 clone R... 52 0.001
15dbj|AK178657.1| Mus musculus cDNA, clone:Y0G0107H19, strand:minu... 48 0.016
16gb|AC167362.2| Mus musculus BAC clone RP23-74P17 from chromosome... 40 3.9
17gb|AC122046.2| Mus musculus BAC clone RP24-449N4 from 7, complet... 40 3.9
18gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 3.9
19gb|AC068280.7| Homo sapiens BAC clone RP11-171H18 from 2, comple... 40 3.9
20gb|AC139500.2| Homo sapiens chromosome 5 clone RP11-864E4, compl... 40 3.9
21gb|AC114794.5| Homo sapiens BAC clone RP11-680G19 from 2, comple... 40 3.9
22gb|AC118459.2| Homo sapiens chromosome 5 clone RP11-124L9, compl... 40 3.9
23gb|AC138122.2| Homo sapiens 3 BAC RP11-336E3 (Roswell Park Cance... 40 3.9 
>gb|BC071142.1| Xenopus laevis MGC82375 protein, mRNA (cDNA clone MGC:82375
           IMAGE:4404918), complete cds
          Length = 1334

 Score =  519 bits (262), Expect = e-144
 Identities = 289/301 (96%)
 Strand = Plus / Plus

                                                                       
Query: 1   aaaatatacgcagaactcccgnatgattgaaattcanacacagatgtctgaacgtgcaga 60
           ||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| 
Sbjct: 81  aaaatatacgcagaactcccgtatgattgaaattcagacacagatgtctgaacgtgcagt 140

                                                                       
Query: 61  ggaactcctgagtttacctgaagatcagccttgctttcttctggatgngggatgtggatc 120
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 141 ggaactcctgagtttacctgaagatcagccttgctttcttctggatgtgggatgtggatc 200

                                                                       
Query: 121 tggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatnag 180
           ||| ||||||||| |||||||||||||| ||||||||||||||||||||||| |||| ||
Sbjct: 201 tggtctgagtggagattacatctctgaacagggacatcactgggttggaatcgatatcag 260

                                                                       
Query: 181 ctctgccatgttagatgtggcattagaacgtgaagcggaaggagatttaatttnngggga 240
           ||||||||||||||||||||||||||||||||||| |||||||||||||||||  |||||
Sbjct: 261 ctctgccatgttagatgtggcattagaacgtgaagtggaaggagatttaatttgtgggga 320

                                                                       
Query: 241 tatgggccagggaattcccttccgccctggaacttttgatggctgtatcagtatctcagc 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 tatgggccagggaattcccttccgccctggaacttttgatggctgtatcagtatctcagc 380

            
Query: 301 t 301
           |
Sbjct: 381 t 381
to top
>ref|NM_001011475.1| Xenopus tropicalis hypothetical LOC496966 (LOC496966), mRNA
          Length = 1340

 Score =  406 bits (205), Expect = e-110
 Identities = 274/300 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   aaaatatacgcagaactcccgnatgattgaaattcanacacagatgtctgaacgtgcaga 60
           ||||||||| ||||||||||| |||||||||||||| ||||||||||| || ||||||| 
Sbjct: 78  aaaatatacacagaactcccgtatgattgaaattcagacacagatgtccgagcgtgcagt 137

                                                                       
Query: 61  ggaactcctgagtttacctgaagatcagccttgctttcttctggatgngggatgtggatc 120
           ||||||||||||||| ||||| ||||||||||| || |||||||||| ||| ||||||||
Sbjct: 138 ggaactcctgagtttgcctgaggatcagccttgtttccttctggatgtgggctgtggatc 197

                                                                       
Query: 121 tggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatnag 180
           ||| ||||||||| ||||||||  |||| ||||||||||||||||||||||  |||| ||
Sbjct: 198 tggtctgagtggagattacatcagtgaacagggacatcactgggttggaattgatatcag 257

                                                                       
Query: 181 ctctgccatgttagatgtggcattagaacgtgaagcggaaggagatttaatttnngggga 240
           ||||||||||||||||||||||||||||||||||| ||||||||| |||||||  || ||
Sbjct: 258 ctctgccatgttagatgtggcattagaacgtgaagtggaaggagacttaatttgtggaga 317

                                                                       
Query: 241 tatgggccagggaattcccttccgccctggaacttttgatggctgtatcagtatctcagc 300
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318 tatgggccatggaattcccttccgccctggaacttttgatggctgtatcagtatctcagc 377
to top
>gb|BC088766.1| Xenopus tropicalis hypothetical LOC496966, mRNA (cDNA clone
           MGC:108067 IMAGE:7003803), complete cds
          Length = 1340

 Score =  406 bits (205), Expect = e-110
 Identities = 274/300 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   aaaatatacgcagaactcccgnatgattgaaattcanacacagatgtctgaacgtgcaga 60
           ||||||||| ||||||||||| |||||||||||||| ||||||||||| || ||||||| 
Sbjct: 78  aaaatatacacagaactcccgtatgattgaaattcagacacagatgtccgagcgtgcagt 137

                                                                       
Query: 61  ggaactcctgagtttacctgaagatcagccttgctttcttctggatgngggatgtggatc 120
           ||||||||||||||| ||||| ||||||||||| || |||||||||| ||| ||||||||
Sbjct: 138 ggaactcctgagtttgcctgaggatcagccttgtttccttctggatgtgggctgtggatc 197

                                                                       
Query: 121 tggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatnag 180
           ||| ||||||||| ||||||||  |||| ||||||||||||||||||||||  |||| ||
Sbjct: 198 tggtctgagtggagattacatcagtgaacagggacatcactgggttggaattgatatcag 257

                                                                       
Query: 181 ctctgccatgttagatgtggcattagaacgtgaagcggaaggagatttaatttnngggga 240
           ||||||||||||||||||||||||||||||||||| ||||||||| |||||||  || ||
Sbjct: 258 ctctgccatgttagatgtggcattagaacgtgaagtggaaggagacttaatttgtggaga 317

                                                                       
Query: 241 tatgggccagggaattcccttccgccctggaacttttgatggctgtatcagtatctcagc 300
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318 tatgggccatggaattcccttccgccctggaacttttgatggctgtatcagtatctcagc 377
to top
>emb|CR387409.1| Gallus gallus finished cDNA, clone ChEST23b10
          Length = 1106

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 238 ggatatgggccagggaattcccttccgccctggaacttttgatggctgtatcagtat 294
           |||||||||| | || ||||||||| | |||||||| ||||||||||| ||||||||
Sbjct: 261 ggatatgggcgatggcattcccttcaggcctggaacgtttgatggctgcatcagtat 317
to top
>emb|AJ720974.1| Gallus gallus mRNA for hypothetical protein, clone 31i18
          Length = 1214

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 239 gatatgggccagggaattcccttccgccctggaacttttgatggctgtatcagtat 294
           ||||||||| | || ||||||||| | |||||||| ||||||||||| ||||||||
Sbjct: 323 gatatgggcgatggcattcccttcaggcctggaacgtttgatggctgcatcagtat 378
to top
>ref|NM_001039332.1| Gallus gallus Williams Beuren syndrome chromosome region 22
           (WBSCR22), mRNA
          Length = 1214

 Score = 56.0 bits (28), Expect = 7e-05
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 239 gatatgggccagggaattcccttccgccctggaacttttgatggctgtatcagtat 294
           ||||||||| | || ||||||||| | |||||||| ||||||||||| ||||||||
Sbjct: 323 gatatgggcgatggcattcccttcaggcctggaacgtttgatggctgcatcagtat 378
to top
>ref|NM_025375.1| Mus musculus Williams Beuren syndrome chromosome region 22
           (Wbscr22), mRNA
          Length = 1608

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 119 tctggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatn 178
           ||||| ||||||||| |||| ||||| |||||||||||  ||||||| || ||  | || 
Sbjct: 541 tctgggctgagtggagattatatctcagaagagggacactactgggtgggcattgacatc 600

                              
Query: 179 agctctgccatgttagatg 197
           ||| |||||||||| ||||
Sbjct: 601 agccctgccatgttggatg 619
to top
>gb|AF412035.1| Mus musculus Williams-Beuren syndrome critical region protein 22
           (Wbscr22) mRNA, complete cds
          Length = 1286

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 119 tctggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatn 178
           ||||| ||||||||| |||| ||||| |||||||||||  ||||||| || ||  | || 
Sbjct: 219 tctgggctgagtggagattatatctcagaagagggacactactgggtgggcattgacatc 278

                              
Query: 179 agctctgccatgttagatg 197
           ||| |||||||||| ||||
Sbjct: 279 agccctgccatgttggatg 297
to top
>dbj|AK151986.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830044I24 product:Williams
           Beuren syndrome chromosome region 22, full insert
           sequence
          Length = 1295

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 119 tctggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatn 178
           ||||| ||||||||| |||| ||||| |||||||||||  ||||||| || ||  | || 
Sbjct: 228 tctgggctgagtggagattatatctcagaagagggacactactgggtgggcattgacatc 287

                              
Query: 179 agctctgccatgttagatg 197
           ||| |||||||||| ||||
Sbjct: 288 agccctgccatgttggatg 306
to top
>dbj|AK011005.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2510027G19 product:similar to PUTATIVE
           METHYLTRANSFERASE WBMT [Homo sapiens], full insert
           sequence
          Length = 1222

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 119 tctggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatn 178
           ||||| ||||||||| |||| ||||| |||||||||||  ||||||| || ||  | || 
Sbjct: 227 tctgggctgagtggagattatatctcagaagagggacactactgggtgggcattgacatc 286

                              
Query: 179 agctctgccatgttagatg 197
           ||| |||||||||| ||||
Sbjct: 287 agccctgccatgttggatg 305
to top
>dbj|AK003386.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110003N24 product:similar to
           PUTATIVE METHYLTRANSFERASE WBMT [Homo sapiens], full
           insert sequence
          Length = 1286

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 119 tctggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatn 178
           ||||| ||||||||| |||| ||||| |||||||||||  ||||||| || ||  | || 
Sbjct: 220 tctgggctgagtggagattatatctcagaagagggacactactgggtgggcattgacatc 279

                              
Query: 179 agctctgccatgttagatg 197
           ||| |||||||||| ||||
Sbjct: 280 agccctgccatgttggatg 298
to top
>dbj|AK008966.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched
           library, clone:2210417I18 product:similar to PUTATIVE
           METHYLTRANSFERASE WBMT [Homo sapiens], full insert
           sequence
          Length = 1119

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 119 tctggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatn 178
           ||||| ||||||||| |||| ||||| |||||||||||  ||||||| || ||  | || 
Sbjct: 52  tctgggctgagtggagattatatctcagaagagggacactactgggtgggcattgacatc 111

                              
Query: 179 agctctgccatgttagatg 197
           ||| |||||||||| ||||
Sbjct: 112 agccctgccatgttggatg 130
to top
>dbj|AK002497.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610010L07 product:similar to PUTATIVE
           METHYLTRANSFERASE WBMT [Homo sapiens], full insert
           sequence
          Length = 1608

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 119 tctggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatn 178
           ||||| ||||||||| |||| ||||| |||||||||||  ||||||| || ||  | || 
Sbjct: 541 tctgggctgagtggagattatatctcagaagagggacactactgggtgggcattgacatc 600

                              
Query: 179 agctctgccatgttagatg 197
           ||| |||||||||| ||||
Sbjct: 601 agccctgccatgttggatg 619
to top
>gb|AC084109.2| Mus musculus strain C57BL6/J chromosome 5 clone RP23-38B15, complete
              sequence
          Length = 149453

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                          
Query: 119    tctggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatn 178
              ||||| ||||||||| |||| ||||| |||||||||||  ||||||| || ||  | || 
Sbjct: 108150 tctgggctgagtggagattatatctcagaagagggacactactgggtgggcattgacatc 108091

                            
Query: 179    agctctgccatgtt 192
              ||| ||||||||||
Sbjct: 108090 agccctgccatgtt 108077
to top
>dbj|AK178657.1| Mus musculus cDNA, clone:Y0G0107H19, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000005512, based on BLAT search
          Length = 195

 Score = 48.1 bits (24), Expect = 0.016
 Identities = 64/79 (81%)
 Strand = Plus / Plus

                                                                       
Query: 119 tctggnctgagtgganattacatctctgaagagggacatcactgggttggaatcnatatn 178
           ||||| |||| |||| |||| ||||| |||||||||||  ||||||| || ||  | || 
Sbjct: 114 tctgggctgantggagattatatctcagaagagggacactactgggtgggcattgacatc 173

                              
Query: 179 agctctgccatgttagatg 197
           ||| |||||||||| ||||
Sbjct: 174 agccctgccatgttggatg 192
to top
>gb|AC167362.2| Mus musculus BAC clone RP23-74P17 from chromosome 7, complete sequence
          Length = 215537

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 152    ggacatcactgggttggaat 171
              ||||||||||||||||||||
Sbjct: 196955 ggacatcactgggttggaat 196936
to top
>gb|AC122046.2| Mus musculus BAC clone RP24-449N4 from 7, complete sequence
          Length = 150101

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 152   ggacatcactgggttggaat 171
             ||||||||||||||||||||
Sbjct: 50469 ggacatcactgggttggaat 50488
to top
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 247     ccagggaattcccttccgcc 266
               ||||||||||||||||||||
Sbjct: 4167108 ccagggaattcccttccgcc 4167127
to top
>gb|AC068280.7| Homo sapiens BAC clone RP11-171H18 from 2, complete sequence
          Length = 92487

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 147   aagagggacatcactgggtt 166
             ||||||||||||||||||||
Sbjct: 79415 aagagggacatcactgggtt 79434
to top
>gb|AC139500.2| Homo sapiens chromosome 5 clone RP11-864E4, complete sequence
          Length = 194350

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 278   gatggctgtatcagtatctc 297
             ||||||||||||||||||||
Sbjct: 46470 gatggctgtatcagtatctc 46489
to top
>gb|AC114794.5| Homo sapiens BAC clone RP11-680G19 from 2, complete sequence
          Length = 168875

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 147    aagagggacatcactgggtt 166
              ||||||||||||||||||||
Sbjct: 148554 aagagggacatcactgggtt 148535
to top
>gb|AC118459.2| Homo sapiens chromosome 5 clone RP11-124L9, complete sequence
          Length = 146061

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 278   gatggctgtatcagtatctc 297
             ||||||||||||||||||||
Sbjct: 41443 gatggctgtatcagtatctc 41424
to top
>gb|AC138122.2| Homo sapiens 3 BAC RP11-336E3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 31001

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    tttacctgaagatcagcctt 92
             ||||||||||||||||||||
Sbjct: 28596 tttacctgaagatcagcctt 28615


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,966,257
Number of Sequences: 3902068
Number of extensions: 1966257
Number of successful extensions: 51428
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51383
Number of HSP's gapped (non-prelim): 45
length of query: 301
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 279
effective length of database: 17,147,199,772
effective search space: 4784068736388
effective search space used: 4784068736388
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top