ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd26o24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT009199.1| Triticum aestivum clone wle1n.pk0005.d9:fis, full... 819 0.0
2ref|XM_507586.1| PREDICTED Oryza sativa (japonica cultivar-group... 165 2e-37
3ref|XM_482612.1| Oryza sativa (japonica cultivar-group), mRNA 165 2e-37
4ref|XM_507242.2| PREDICTED Oryza sativa (japonica cultivar-group... 165 2e-37
5dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 165 2e-37
6dbj|AP004703.3| Oryza sativa (japonica cultivar-group) genomic D... 165 2e-37
7dbj|AP004702.3| Oryza sativa (japonica cultivar-group) genomic D... 165 2e-37
8dbj|AK109485.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
9dbj|AK105990.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
10dbj|AK103781.1| Oryza sativa (japonica cultivar-group) cDNA clon... 165 2e-37
11ref|XM_468264.1| Oryza sativa (japonica cultivar-group), mRNA 129 1e-26
12ref|XM_507027.1| PREDICTED Oryza sativa (japonica cultivar-group... 129 1e-26
13dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
14dbj|AP004094.3| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
15dbj|AP003975.3| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
16dbj|AK119386.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-26
17dbj|AK073025.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-26
18dbj|AK061820.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-26
19dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 96 2e-16
20dbj|AP005636.2| Oryza sativa (japonica cultivar-group) genomic D... 96 2e-16
21dbj|AP005784.3| Oryza sativa (japonica cultivar-group) genomic D... 96 2e-16
22dbj|AK099984.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 2e-16
23dbj|AK065377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 2e-16
24gb|AY112022.1| Zea mays CL704_1 mRNA sequence 92 2e-15
25gb|BT009163.1| Triticum aestivum clone wl1n.pk0094.h5:fis, full ... 60 9e-06
26gb|BT017748.1| Zea mays clone EL01N0450A11.c mRNA sequence 54 5e-04
27gb|AY109688.1| Zea mays CL339_1 mRNA sequence 54 5e-04
28ref|XM_469696.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
29gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 52 0.002
30gb|AC092558.4| Oryza sativa chromosome 3 BAC OSJNBb0036F07 genom... 52 0.002
31dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
32dbj|AP006864.1| Lotus japonicus genomic DNA, chromosome 3, clone... 50 0.008
33gb|AC090885.1|AC090885 Homo sapiens chromosome 3 clone RP11-270I... 44 0.52
34gb|AC066589.3|AC066589 Homo sapiens chromosome 3 clone RP11-309M... 44 0.52
35gb|AC069246.6| Homo sapiens chromosome 3 clone RP11-221A8 map 3p... 44 0.52
36ref|XM_465099.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.1
37emb|AL035422.12|HS164F3 Human DNA sequence from clone RP1-164F3 ... 42 2.1
38gb|AE012493.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 2.1
39gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 42 2.1
40dbj|AK066972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.1
41gb|AC122315.5| Mus musculus BAC clone RP23-302P6 from 10, comple... 42 2.1
42gb|U78027.1|HSU78027 Homo sapiens Bruton's tyrosine kinase (BTK)... 42 2.1
43gb|DQ141111.1| Drosophila yakuba Dscam gene, partial sequence 40 8.1
44gb|DQ141109.1| Drosophila simulans Dscam gene, partial sequence 40 8.1
45gb|DQ141105.1| Drosophila erecta Dscam gene, partial sequence 40 8.1
46ref|NM_183930.1| Oryza sativa (japonica cultivar-group), predic... 40 8.1
47gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 8.1
48gb|AC009739.4| Drosophila melanogaster clone BACR26B18, complete... 40 8.1
49gb|AC146440.5| Pan troglodytes BAC clone RP43-11P11 from 7, comp... 40 8.1
50emb|AL591166.12| Human DNA sequence from clone RP11-315O13 on ch... 40 8.1
51emb|BX883045.1| Rattus norvegicus chromosome 20, major histocomp... 40 8.1
52emb|AL939122.1|SCO939122 Streptomyces coelicolor A3(2) complete ... 40 8.1
53gb|DQ317106.1| Drosophila yakuba Dscam gene, exons 3 through 24 40 8.1
54gb|AF385930.1|AF385930 Drosophila yakuba DSCAM splice variants g... 40 8.1
55gb|DQ357063.1| Phytophthora sojae cell 5A endo-1,4-betaglucanase... 40 8.1
56emb|AL117038.1|CNS01DNA Botrytis cinerea strain T4 cDNA library 40 8.1
57emb|AL117035.1|CNS01DN7 Botrytis cinerea strain T4 cDNA library 40 8.1
58emb|AL116748.1|CNS01DF8 Botrytis cinerea strain T4 cDNA library 40 8.1
59emb|AL116694.1|CNS01DDQ Botrytis cinerea strain T4 cDNA library 40 8.1
60emb|AL114101.1|CNS01BDP Botrytis cinerea strain T4 cDNA library 40 8.1
61emb|AL112985.1|CNS01AIP Botrytis cinerea strain T4 cDNA library 40 8.1
62emb|AL111926.1|CNS019PA Botrytis cinerea strain T4 cDNA library 40 8.1
63emb|AL111623.1|CNS019GV Botrytis cinerea strain T4 cDNA library 40 8.1
64emb|AL111776.1|CNS019L4 Botrytis cinerea strain T4 cDNA library 40 8.1
65dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
66dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
67gb|AY787762.1| Streptomyces filamentosus strain NRRL 11379 dapto... 40 8.1
68gb|AC006343.3| Homo sapiens PAC clone RP4-548K24 from 7q34-q36, ... 40 8.1
69gb|AF260530.1| Drosophila melanogaster Dscam gene, complete cds 40 8.1
70dbj|AP003331.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
71dbj|AP005246.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
72dbj|AK098873.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
73gb|AE003841.5| Drosophila melanogaster chromosome 2R, section 9 ... 40 8.1
74gb|AC005452.1|AC005452 Drosophila melanogaster, chromosome 2R, r... 40 8.1

>gb|BT009199.1| Triticum aestivum clone wle1n.pk0005.d9:fis, full insert mRNA
           sequence
          Length = 1182

 Score =  819 bits (413), Expect = 0.0
 Identities = 546/592 (92%), Gaps = 8/592 (1%)
 Strand = Plus / Plus

                                                                       
Query: 13  gcgctgacctgtggccccctgctcccgcctccctgtcctcctgttattactttccccacc 72
           |||||||||||||| |||||||| | |||||||  ||||| | |||||||||||| ||||
Sbjct: 45  gcgctgacctgtgggcccctgcttctgcctccccttcctcatcttattactttcctcacc 104

                                                                       
Query: 73  acgccgatctgccggactgtttcgcaaaccctaaccctagcaagcccgcttcactcctcc 132
           ||||||||| |||||  ||| |||||||||||||||||||  || ||||||| |||||||
Sbjct: 105 acgccgatccgccggtttgtctcgcaaaccctaaccctag--agtccgcttcgctcctcc 162

                                                                       
Query: 133 ------aacaagatctctctccgaatctatggatgcaccagctccgatgtctgccccacc 186
                 |||||||||||||||| ||||| |||||||||| ||||||||||||||||||||
Sbjct: 163 tcccccaacaagatctctctcctaatctttggatgcaccggctccgatgtctgccccacc 222

                                                                       
Query: 187 gccccccgcctcgtccgatgatgatgctaagcccgtcgacgaggagggcgtagagatccg 246
            ||||||||||| ||||| ||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 223 accccccgcctcctccgacgatgatggtaagcccgccgacgaggagggcgtagagatccg 282

                                                                       
Query: 247 cgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtcgtcggcga 306
           ||||||||||||||  |||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 283 cgaggtatgggcgaacaacctcgaggcggagttcgccgtgatccgtgacgtcgtcgacga 342

                                                                       
Query: 307 ttactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccgctcgggag 366
           |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 343 ttacccgtacatcgccatggacaccgagttcccgggcatcgtgtgccgcccgctcgggag 402

                                                                       
Query: 367 ctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgacatgctgag 426
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 403 ctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgacatgctgag 462

                                                                       
Query: 427 cctcatccagcttggtctcactctctccgacgagaacggcgcactccctgccaggggcac 486
           ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 463 cctcatccagcttggtctcaccctctccgacgagaacggcgcactcccggccaggggcac 522

                                                                       
Query: 487 nnnnnnncgcccctgcgcctggcagttcaactttcggggcttcgatccgcgctcagaccc 546
                  |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 523 gggggggcgcccctgcgcctggcagttcaactttcggggcttcgatccgcgctcagaccc 582

                                                               
Query: 547 cgccaacgccgactccatcgacctgctacgcaacagtgggatcgacttcgac 598
           ||||||||| |||||||||||||||||||||||||| |||||||||||||||
Sbjct: 583 cgccaacgctgactccatcgacctgctacgcaacagcgggatcgacttcgac 634



to top

>ref|XM_507586.1| PREDICTED Oryza sativa (japonica cultivar-group), P0524F03.33 mRNA
          Length = 1259

 Score =  165 bits (83), Expect = 2e-37
 Identities = 194/231 (83%)
 Strand = Plus / Plus

                                                                       
Query: 230 gagggcgtagagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatc 289
           |||||||| |||||||| ||||||||||||  |||||| ||||||||| |||| | ||||
Sbjct: 221 gagggcgtggagatccgggaggtatgggcggggaacctggaggcggagatcgcggcgatc 280

                                                                       
Query: 290 cgtgacgtcgtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtg 349
           || ||||  |||| |   ||| ||||| |||| |||||||| ||||||||||||||||||
Sbjct: 281 cgcgacgaggtcgaccggtacccgtacgtcgccatggacacggagttcccgggcatcgtg 340

                                                                       
Query: 350 tgccgcccgctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggcc 409
           ||||||||  |||| | ||| ||| |||  ||||||| ||||||||||| |||| |||||
Sbjct: 341 tgccgccccgtcggcaacttccgcaccaccgacgagttcaactacgccaacctcgaggcc 400

                                                              
Query: 410 aacgtcgacatgctgagcctcatccagcttggtctcactctctccgacgag 460
           |||||| ||||||| |  ||||||||||| || ||||| ||||||||||||
Sbjct: 401 aacgtcaacatgctcaagctcatccagctcggcctcaccctctccgacgag 451



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 75/93 (80%)
 Strand = Plus / Plus

                                                                       
Query: 505 ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
           ||||||||||||||| || || ||||| || ||  | |||||  ||||||||||||||||
Sbjct: 496 ctggcagttcaacttccgcgggttcgacccccggaccgacccgtccaacgccgactccat 555

                                            
Query: 565 cgacctgctacgcaacagtgggatcgacttcga 597
           | |  |||| |||| | | || |||||||||||
Sbjct: 556 ccagatgctccgcacctgcggcatcgacttcga 588



to top

>ref|XM_482612.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1199

 Score =  165 bits (83), Expect = 2e-37
 Identities = 194/231 (83%)
 Strand = Plus / Plus

                                                                       
Query: 230 gagggcgtagagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatc 289
           |||||||| |||||||| ||||||||||||  |||||| ||||||||| |||| | ||||
Sbjct: 312 gagggcgtggagatccgggaggtatgggcggggaacctggaggcggagatcgcggcgatc 371

                                                                       
Query: 290 cgtgacgtcgtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtg 349
           || ||||  |||| |   ||| ||||| |||| |||||||| ||||||||||||||||||
Sbjct: 372 cgcgacgaggtcgaccggtacccgtacgtcgccatggacacggagttcccgggcatcgtg 431

                                                                       
Query: 350 tgccgcccgctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggcc 409
           ||||||||  |||| | ||| ||| |||  ||||||| ||||||||||| |||| |||||
Sbjct: 432 tgccgccccgtcggcaacttccgcaccaccgacgagttcaactacgccaacctcgaggcc 491

                                                              
Query: 410 aacgtcgacatgctgagcctcatccagcttggtctcactctctccgacgag 460
           |||||| ||||||| |  ||||||||||| || ||||| ||||||||||||
Sbjct: 492 aacgtcaacatgctcaagctcatccagctcggcctcaccctctccgacgag 542



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 505 ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
           ||||||||||||||| || || ||||| || ||  | |||||  ||||||||||||||||
Sbjct: 587 ctggcagttcaacttccgcgggttcgacccccggaccgacccgtccaacgccgactccat 646

            
Query: 565 c 565
           |
Sbjct: 647 c 647



to top

>ref|XM_507242.2| PREDICTED Oryza sativa (japonica cultivar-group), P0524F03.33 mRNA
          Length = 1222

 Score =  165 bits (83), Expect = 2e-37
 Identities = 194/231 (83%)
 Strand = Plus / Plus

                                                                       
Query: 230 gagggcgtagagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatc 289
           |||||||| |||||||| ||||||||||||  |||||| ||||||||| |||| | ||||
Sbjct: 332 gagggcgtggagatccgggaggtatgggcggggaacctggaggcggagatcgcggcgatc 391

                                                                       
Query: 290 cgtgacgtcgtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtg 349
           || ||||  |||| |   ||| ||||| |||| |||||||| ||||||||||||||||||
Sbjct: 392 cgcgacgaggtcgaccggtacccgtacgtcgccatggacacggagttcccgggcatcgtg 451

                                                                       
Query: 350 tgccgcccgctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggcc 409
           ||||||||  |||| | ||| ||| |||  ||||||| ||||||||||| |||| |||||
Sbjct: 452 tgccgccccgtcggcaacttccgcaccaccgacgagttcaactacgccaacctcgaggcc 511

                                                              
Query: 410 aacgtcgacatgctgagcctcatccagcttggtctcactctctccgacgag 460
           |||||| ||||||| |  ||||||||||| || ||||| ||||||||||||
Sbjct: 512 aacgtcaacatgctcaagctcatccagctcggcctcaccctctccgacgag 562



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 505 ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
           ||||||||||||||| || || ||||| || ||  | |||||  ||||||||||||||||
Sbjct: 607 ctggcagttcaacttccgcgggttcgacccccggaccgacccgtccaacgccgactccat 666

            
Query: 565 c 565
           |
Sbjct: 667 c 667



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  165 bits (83), Expect = 2e-37
 Identities = 194/231 (83%)
 Strand = Plus / Plus

                                                                            
Query: 230      gagggcgtagagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatc 289
                |||||||| |||||||| ||||||||||||  |||||| ||||||||| |||| | ||||
Sbjct: 21411838 gagggcgtggagatccgggaggtatgggcggggaacctggaggcggagatcgcggcgatc 21411897

                                                                            
Query: 290      cgtgacgtcgtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtg 349
                || ||||  |||| |   ||| ||||| |||| |||||||| ||||||||||||||||||
Sbjct: 21411898 cgcgacgaggtcgaccggtacccgtacgtcgccatggacacggagttcccgggcatcgtg 21411957

                                                                            
Query: 350      tgccgcccgctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggcc 409
                ||||||||  |||| | ||| ||| |||  ||||||| ||||||||||| |||| |||||
Sbjct: 21411958 tgccgccccgtcggcaacttccgcaccaccgacgagttcaactacgccaacctcgaggcc 21412017

                                                                   
Query: 410      aacgtcgacatgctgagcctcatccagcttggtctcactctctccgacgag 460
                |||||| ||||||| |  ||||||||||| || ||||| ||||||||||||
Sbjct: 21412018 aacgtcaacatgctcaagctcatccagctcggcctcaccctctccgacgag 21412068



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                            
Query: 505      ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
                ||||||||||||||| || || ||||| || ||  | |||||  ||||||||||||||||
Sbjct: 21412113 ctggcagttcaacttccgcgggttcgacccccggaccgacccgtccaacgccgactccat 21412172

                 
Query: 565      c 565
                |
Sbjct: 21412173 c 21412173



to top

>dbj|AP004703.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0528B09
          Length = 156897

 Score =  165 bits (83), Expect = 2e-37
 Identities = 194/231 (83%)
 Strand = Plus / Plus

                                                                         
Query: 230   gagggcgtagagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatc 289
             |||||||| |||||||| ||||||||||||  |||||| ||||||||| |||| | ||||
Sbjct: 15833 gagggcgtggagatccgggaggtatgggcggggaacctggaggcggagatcgcggcgatc 15892

                                                                         
Query: 290   cgtgacgtcgtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtg 349
             || ||||  |||| |   ||| ||||| |||| |||||||| ||||||||||||||||||
Sbjct: 15893 cgcgacgaggtcgaccggtacccgtacgtcgccatggacacggagttcccgggcatcgtg 15952

                                                                         
Query: 350   tgccgcccgctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggcc 409
             ||||||||  |||| | ||| ||| |||  ||||||| ||||||||||| |||| |||||
Sbjct: 15953 tgccgccccgtcggcaacttccgcaccaccgacgagttcaactacgccaacctcgaggcc 16012

                                                                
Query: 410   aacgtcgacatgctgagcctcatccagcttggtctcactctctccgacgag 460
             |||||| ||||||| |  ||||||||||| || ||||| ||||||||||||
Sbjct: 16013 aacgtcaacatgctcaagctcatccagctcggcctcaccctctccgacgag 16063



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 75/93 (80%)
 Strand = Plus / Plus

                                                                         
Query: 505   ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
             ||||||||||||||| || || ||||| || ||  | |||||  ||||||||||||||||
Sbjct: 16108 ctggcagttcaacttccgcgggttcgacccccggaccgacccgtccaacgccgactccat 16167

                                              
Query: 565   cgacctgctacgcaacagtgggatcgacttcga 597
             | |  |||| |||| | | || |||||||||||
Sbjct: 16168 ccagatgctccgcacctgcggcatcgacttcga 16200



to top

>dbj|AP004702.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0524F03
          Length = 167696

 Score =  165 bits (83), Expect = 2e-37
 Identities = 194/231 (83%)
 Strand = Plus / Plus

                                                                          
Query: 230    gagggcgtagagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatc 289
              |||||||| |||||||| ||||||||||||  |||||| ||||||||| |||| | ||||
Sbjct: 111763 gagggcgtggagatccgggaggtatgggcggggaacctggaggcggagatcgcggcgatc 111822

                                                                          
Query: 290    cgtgacgtcgtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtg 349
              || ||||  |||| |   ||| ||||| |||| |||||||| ||||||||||||||||||
Sbjct: 111823 cgcgacgaggtcgaccggtacccgtacgtcgccatggacacggagttcccgggcatcgtg 111882

                                                                          
Query: 350    tgccgcccgctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggcc 409
              ||||||||  |||| | ||| ||| |||  ||||||| ||||||||||| |||| |||||
Sbjct: 111883 tgccgccccgtcggcaacttccgcaccaccgacgagttcaactacgccaacctcgaggcc 111942

                                                                 
Query: 410    aacgtcgacatgctgagcctcatccagcttggtctcactctctccgacgag 460
              |||||| ||||||| |  ||||||||||| || ||||| ||||||||||||
Sbjct: 111943 aacgtcaacatgctcaagctcatccagctcggcctcaccctctccgacgag 111993



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                          
Query: 505    ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
              ||||||||||||||| || || ||||| || ||  | |||||  ||||||||||||||||
Sbjct: 112038 ctggcagttcaacttccgcgggttcgacccccggaccgacccgtccaacgccgactccat 112097

               
Query: 565    c 565
              |
Sbjct: 112098 c 112098



to top

>dbj|AK109485.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-H04, full
           insert sequence
          Length = 1198

 Score =  165 bits (83), Expect = 2e-37
 Identities = 194/231 (83%)
 Strand = Plus / Plus

                                                                       
Query: 230 gagggcgtagagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatc 289
           |||||||| |||||||| ||||||||||||  |||||| ||||||||| |||| | ||||
Sbjct: 311 gagggcgtggagatccgggaggtatgggcggggaacctggaggcggagatcgcggcgatc 370

                                                                       
Query: 290 cgtgacgtcgtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtg 349
           || ||||  |||| |   ||| ||||| |||| |||||||| ||||||||||||||||||
Sbjct: 371 cgcgacgaggtcgaccggtacccgtacgtcgccatggacacggagttcccgggcatcgtg 430

                                                                       
Query: 350 tgccgcccgctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggcc 409
           ||||||||  |||| | ||| ||| |||  ||||||| ||||||||||| |||| |||||
Sbjct: 431 tgccgccccgtcggcaacttccgcaccaccgacgagttcaactacgccaacctcgaggcc 490

                                                              
Query: 410 aacgtcgacatgctgagcctcatccagcttggtctcactctctccgacgag 460
           |||||| ||||||| |  ||||||||||| || ||||| ||||||||||||
Sbjct: 491 aacgtcaacatgctcaagctcatccagctcggcctcaccctctccgacgag 541



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 505 ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
           ||||||||||||||| || || ||||| || ||  | |||||  ||||||||||||||||
Sbjct: 586 ctggcagttcaacttccgcgggttcgacccccggaccgacccgtccaacgccgactccat 645

            
Query: 565 c 565
           |
Sbjct: 646 c 646



to top

>dbj|AK105990.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-G12, full
           insert sequence
          Length = 1257

 Score =  165 bits (83), Expect = 2e-37
 Identities = 194/231 (83%)
 Strand = Plus / Plus

                                                                       
Query: 230 gagggcgtagagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatc 289
           |||||||| |||||||| ||||||||||||  |||||| ||||||||| |||| | ||||
Sbjct: 219 gagggcgtggagatccgggaggtatgggcggggaacctggaggcggagatcgcggcgatc 278

                                                                       
Query: 290 cgtgacgtcgtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtg 349
           || ||||  |||| |   ||| ||||| |||| |||||||| ||||||||||||||||||
Sbjct: 279 cgcgacgaggtcgaccggtacccgtacgtcgccatggacacggagttcccgggcatcgtg 338

                                                                       
Query: 350 tgccgcccgctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggcc 409
           ||||||||  |||| | ||| ||| |||  ||||||| ||||||||||| |||| |||||
Sbjct: 339 tgccgccccgtcggcaacttccgcaccaccgacgagttcaactacgccaacctcgaggcc 398

                                                              
Query: 410 aacgtcgacatgctgagcctcatccagcttggtctcactctctccgacgag 460
           |||||| ||||||| |  ||||||||||| || ||||| ||||||||||||
Sbjct: 399 aacgtcaacatgctcaagctcatccagctcggcctcaccctctccgacgag 449



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 505 ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
           ||||||||||||||| || || ||||| || ||  | |||||  ||||||||||||||||
Sbjct: 494 ctggcagttcaacttccgcgggttcgacccccggaccgacccgtccaacgccgactccat 553

            
Query: 565 c 565
           |
Sbjct: 554 c 554



to top

>dbj|AK103781.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033145G16, full
           insert sequence
          Length = 1224

 Score =  165 bits (83), Expect = 2e-37
 Identities = 194/231 (83%)
 Strand = Plus / Plus

                                                                       
Query: 230 gagggcgtagagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatc 289
           |||||||| |||||||| ||||||||||||  |||||| ||||||||| |||| | ||||
Sbjct: 334 gagggcgtggagatccgggaggtatgggcggggaacctggaggcggagatcgcggcgatc 393

                                                                       
Query: 290 cgtgacgtcgtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtg 349
           || ||||  |||| |   ||| ||||| |||| |||||||| ||||||||||||||||||
Sbjct: 394 cgcgacgaggtcgaccggtacccgtacgtcgccatggacacggagttcccgggcatcgtg 453

                                                                       
Query: 350 tgccgcccgctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggcc 409
           ||||||||  |||| | ||| ||| |||  ||||||| ||||||||||| |||| |||||
Sbjct: 454 tgccgccccgtcggcaacttccgcaccaccgacgagttcaactacgccaacctcgaggcc 513

                                                              
Query: 410 aacgtcgacatgctgagcctcatccagcttggtctcactctctccgacgag 460
           |||||| ||||||| |  ||||||||||| || ||||| ||||||||||||
Sbjct: 514 aacgtcaacatgctcaagctcatccagctcggcctcaccctctccgacgag 564



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 505 ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
           ||||||||||||||| || || ||||| || ||  | |||||  ||||||||||||||||
Sbjct: 609 ctggcagttcaacttccgcgggttcgacccccggaccgacccgtccaacgccgactccat 668

            
Query: 565 c 565
           |
Sbjct: 669 c 669



to top

>ref|XM_468264.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1094

 Score =  129 bits (65), Expect = 1e-26
 Identities = 173/209 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
           |||||||| ||||| ||||||   |||||||||| |||||||||  ||||||| ||||||
Sbjct: 194 gagatccgggaggtgtgggcggacaacctcgaggaggagttcgcgctgatccgcgacgtc 253

                                                                       
Query: 299 gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
           |||| ||| | | | | | |||| |||||||| |||||||| ||||||||||||||||| 
Sbjct: 254 gtcgacgagttccccttcgtcgccatggacacggagttccctggcatcgtgtgccgcccc 313

                                                                       
Query: 359 ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
            ||||   ||| ||||||   | ||| |||||||||||||| ||||||||||||||||||
Sbjct: 314 gtcggcgccttccgctccccggccgactacaactacgccacgctcaaggccaacgtcgac 373

                                        
Query: 419 atgctgagcctcatccagcttggtctcac 447
           |||||   |||||||||||| || |||||
Sbjct: 374 atgctccacctcatccagctcggcctcac 402



to top

>ref|XM_507027.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1695_H09.27-1
           mRNA
          Length = 1415

 Score =  129 bits (65), Expect = 1e-26
 Identities = 173/209 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
           |||||||| ||||| ||||||   |||||||||| |||||||||  ||||||| ||||||
Sbjct: 201 gagatccgggaggtgtgggcggacaacctcgaggaggagttcgcgctgatccgcgacgtc 260

                                                                       
Query: 299 gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
           |||| ||| | | | | | |||| |||||||| |||||||| ||||||||||||||||| 
Sbjct: 261 gtcgacgagttccccttcgtcgccatggacacggagttccctggcatcgtgtgccgcccc 320

                                                                       
Query: 359 ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
            ||||   ||| ||||||   | ||| |||||||||||||| ||||||||||||||||||
Sbjct: 321 gtcggcgccttccgctccccggccgactacaactacgccacgctcaaggccaacgtcgac 380

                                        
Query: 419 atgctgagcctcatccagcttggtctcac 447
           |||||   |||||||||||| || |||||
Sbjct: 381 atgctccacctcatccagctcggcctcac 409



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  129 bits (65), Expect = 1e-26
 Identities = 173/209 (82%)
 Strand = Plus / Plus

                                                                            
Query: 239      gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
                |||||||| ||||| ||||||   |||||||||| |||||||||  ||||||| ||||||
Sbjct: 33872929 gagatccgggaggtgtgggcggacaacctcgaggaggagttcgcgctgatccgcgacgtc 33872988

                                                                            
Query: 299      gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
                |||| ||| | | | | | |||| |||||||| |||||||| ||||||||||||||||| 
Sbjct: 33872989 gtcgacgagttccccttcgtcgccatggacacggagttccctggcatcgtgtgccgcccc 33873048

                                                                            
Query: 359      ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
                 ||||   ||| ||||||   | ||| |||||||||||||| ||||||||||||||||||
Sbjct: 33873049 gtcggcgccttccgctccccggccgactacaactacgccacgctcaaggccaacgtcgac 33873108

                                             
Query: 419      atgctgagcctcatccagcttggtctcac 447
                |||||   |||||||||||| || |||||
Sbjct: 33873109 atgctccacctcatccagctcggcctcac 33873137



to top

>dbj|AP004094.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1695_H09
          Length = 114721

 Score =  129 bits (65), Expect = 1e-26
 Identities = 173/209 (82%)
 Strand = Plus / Plus

                                                                         
Query: 239   gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
             |||||||| ||||| ||||||   |||||||||| |||||||||  ||||||| ||||||
Sbjct: 89507 gagatccgggaggtgtgggcggacaacctcgaggaggagttcgcgctgatccgcgacgtc 89566

                                                                         
Query: 299   gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
             |||| ||| | | | | | |||| |||||||| |||||||| ||||||||||||||||| 
Sbjct: 89567 gtcgacgagttccccttcgtcgccatggacacggagttccctggcatcgtgtgccgcccc 89626

                                                                         
Query: 359   ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
              ||||   ||| ||||||   | ||| |||||||||||||| ||||||||||||||||||
Sbjct: 89627 gtcggcgccttccgctccccggccgactacaactacgccacgctcaaggccaacgtcgac 89686

                                          
Query: 419   atgctgagcctcatccagcttggtctcac 447
             |||||   |||||||||||| || |||||
Sbjct: 89687 atgctccacctcatccagctcggcctcac 89715



to top

>dbj|AP003975.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1004_E04
          Length = 133621

 Score =  129 bits (65), Expect = 1e-26
 Identities = 173/209 (82%)
 Strand = Plus / Plus

                                                                         
Query: 239   gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
             |||||||| ||||| ||||||   |||||||||| |||||||||  ||||||| ||||||
Sbjct: 31892 gagatccgggaggtgtgggcggacaacctcgaggaggagttcgcgctgatccgcgacgtc 31951

                                                                         
Query: 299   gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
             |||| ||| | | | | | |||| |||||||| |||||||| ||||||||||||||||| 
Sbjct: 31952 gtcgacgagttccccttcgtcgccatggacacggagttccctggcatcgtgtgccgcccc 32011

                                                                         
Query: 359   ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
              ||||   ||| ||||||   | ||| |||||||||||||| ||||||||||||||||||
Sbjct: 32012 gtcggcgccttccgctccccggccgactacaactacgccacgctcaaggccaacgtcgac 32071

                                          
Query: 419   atgctgagcctcatccagcttggtctcac 447
             |||||   |||||||||||| || |||||
Sbjct: 32072 atgctccacctcatccagctcggcctcac 32100



to top

>dbj|AK119386.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-132-B12, full
           insert sequence
          Length = 2885

 Score =  129 bits (65), Expect = 1e-26
 Identities = 173/209 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
           |||||||| ||||| ||||||   |||||||||| |||||||||  ||||||| ||||||
Sbjct: 274 gagatccgggaggtgtgggcggacaacctcgaggaggagttcgcgctgatccgcgacgtc 333

                                                                       
Query: 299 gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
           |||| ||| | | | | | |||| |||||||| |||||||| ||||||||||||||||| 
Sbjct: 334 gtcgacgagttccccttcgtcgccatggacacggagttccctggcatcgtgtgccgcccc 393

                                                                       
Query: 359 ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
            ||||   ||| ||||||   | ||| |||||||||||||| ||||||||||||||||||
Sbjct: 394 gtcggcgccttccgctccccggccgactacaactacgccacgctcaaggccaacgtcgac 453

                                        
Query: 419 atgctgagcctcatccagcttggtctcac 447
           |||||   |||||||||||| || |||||
Sbjct: 454 atgctccacctcatccagctcggcctcac 482



to top

>dbj|AK073025.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023149N08, full
           insert sequence
          Length = 1415

 Score =  129 bits (65), Expect = 1e-26
 Identities = 173/209 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
           |||||||| ||||| ||||||   |||||||||| |||||||||  ||||||| ||||||
Sbjct: 201 gagatccgggaggtgtgggcggacaacctcgaggaggagttcgcgctgatccgcgacgtc 260

                                                                       
Query: 299 gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
           |||| ||| | | | | | |||| |||||||| |||||||| ||||||||||||||||| 
Sbjct: 261 gtcgacgagttccccttcgtcgccatggacacggagttccctggcatcgtgtgccgcccc 320

                                                                       
Query: 359 ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
            ||||   ||| ||||||   | ||| |||||||||||||| ||||||||||||||||||
Sbjct: 321 gtcggcgccttccgctccccggccgactacaactacgccacgctcaaggccaacgtcgac 380

                                        
Query: 419 atgctgagcctcatccagcttggtctcac 447
           |||||   |||||||||||| || |||||
Sbjct: 381 atgctccacctcatccagctcggcctcac 409



to top

>dbj|AK061820.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-B10, full
           insert sequence
          Length = 1094

 Score =  129 bits (65), Expect = 1e-26
 Identities = 173/209 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
           |||||||| ||||| ||||||   |||||||||| |||||||||  ||||||| ||||||
Sbjct: 194 gagatccgggaggtgtgggcggacaacctcgaggaggagttcgcgctgatccgcgacgtc 253

                                                                       
Query: 299 gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
           |||| ||| | | | | | |||| |||||||| |||||||| ||||||||||||||||| 
Sbjct: 254 gtcgacgagttccccttcgtcgccatggacacggagttccctggcatcgtgtgccgcccc 313

                                                                       
Query: 359 ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
            ||||   ||| ||||||   | ||| |||||||||||||| ||||||||||||||||||
Sbjct: 314 gtcggcgccttccgctccccggccgactacaactacgccacgctcaaggccaacgtcgac 373

                                        
Query: 419 atgctgagcctcatccagcttggtctcac 447
           |||||   |||||||||||| || |||||
Sbjct: 374 atgctccacctcatccagctcggcctcac 402



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 165/204 (80%)
 Strand = Plus / Plus

                                                                            
Query: 239      gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
                |||||||||||||| |||| |   ||||||||||| |||||||| ||||| || ||  ||
Sbjct: 14874775 gagatccgcgaggtgtgggaggacaacctcgaggccgagttcgcggtgattcgggagatc 14874834

                                                                            
Query: 299      gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
                || | ||| | | ||||| |||| |||||||| |||||||||||| |||| ||| | |||
Sbjct: 14874835 gttgacgacttcccgtacgtcgcgatggacacggagttcccgggcgtcgtctgcaggccg 14874894

                                                                            
Query: 359      ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
                |||||||  ||    ||||| | ||| | ||||||||| || ||||| ||||||||||||
Sbjct: 14874895 ctcgggacgttcaagtccaacgccgatttcaactacgcaacgctcaaagccaacgtcgac 14874954

                                        
Query: 419      atgctgagcctcatccagcttggt 442
                |||||||  || ||||||||||||
Sbjct: 14874955 atgctgaagcttatccagcttggt 14874978



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                             
Query: 506      tggcagttcaactttcggggcttcgatcc 534
                ||||||||||||||||| |||||||||||
Sbjct: 14875042 tggcagttcaactttcgtggcttcgatcc 14875070



to top

>dbj|AP005636.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0707C02
          Length = 163609

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 165/204 (80%)
 Strand = Plus / Plus

                                                                          
Query: 239    gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
              |||||||||||||| |||| |   ||||||||||| |||||||| ||||| || ||  ||
Sbjct: 160164 gagatccgcgaggtgtgggaggacaacctcgaggccgagttcgcggtgattcgggagatc 160223

                                                                          
Query: 299    gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
              || | ||| | | ||||| |||| |||||||| |||||||||||| |||| ||| | |||
Sbjct: 160224 gttgacgacttcccgtacgtcgcgatggacacggagttcccgggcgtcgtctgcaggccg 160283

                                                                          
Query: 359    ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
              |||||||  ||    ||||| | ||| | ||||||||| || ||||| ||||||||||||
Sbjct: 160284 ctcgggacgttcaagtccaacgccgatttcaactacgcaacgctcaaagccaacgtcgac 160343

                                      
Query: 419    atgctgagcctcatccagcttggt 442
              |||||||  || ||||||||||||
Sbjct: 160344 atgctgaagcttatccagcttggt 160367



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 506    tggcagttcaactttcggggcttcgatcc 534
              ||||||||||||||||| |||||||||||
Sbjct: 160431 tggcagttcaactttcgtggcttcgatcc 160459



to top

>dbj|AP005784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0014G10
          Length = 164147

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 165/204 (80%)
 Strand = Plus / Plus

                                                                         
Query: 239   gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
             |||||||||||||| |||| |   ||||||||||| |||||||| ||||| || ||  ||
Sbjct: 83114 gagatccgcgaggtgtgggaggacaacctcgaggccgagttcgcggtgattcgggagatc 83173

                                                                         
Query: 299   gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
             || | ||| | | ||||| |||| |||||||| |||||||||||| |||| ||| | |||
Sbjct: 83174 gttgacgacttcccgtacgtcgcgatggacacggagttcccgggcgtcgtctgcaggccg 83233

                                                                         
Query: 359   ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
             |||||||  ||    ||||| | ||| | ||||||||| || ||||| ||||||||||||
Sbjct: 83234 ctcgggacgttcaagtccaacgccgatttcaactacgcaacgctcaaagccaacgtcgac 83293

                                     
Query: 419   atgctgagcctcatccagcttggt 442
             |||||||  || ||||||||||||
Sbjct: 83294 atgctgaagcttatccagcttggt 83317



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 506   tggcagttcaactttcggggcttcgatcc 534
             ||||||||||||||||| |||||||||||
Sbjct: 83381 tggcagttcaactttcgtggcttcgatcc 83409



to top

>dbj|AK099984.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013129L05, full
           insert sequence
          Length = 1114

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 165/204 (80%)
 Strand = Plus / Plus

                                                                       
Query: 239 gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
           |||||||||||||| |||| |   ||||||||||| |||||||| ||||| || ||  ||
Sbjct: 271 gagatccgcgaggtgtgggaggacaacctcgaggccgagttcgcggtgattcgggagatc 330

                                                                       
Query: 299 gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
           || | ||| | | ||||| |||| |||||||| |||||||||||| |||| ||| | |||
Sbjct: 331 gttgacgacttcccgtacgtcgcgatggacacggagttcccgggcgtcgtctgcaggccg 390

                                                                       
Query: 359 ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
           |||||||  ||    ||||| | ||| | ||||||||| || ||||| ||||||||||||
Sbjct: 391 ctcgggacgttcaagtccaacgccgatttcaactacgcaacgctcaaagccaacgtcgac 450

                                   
Query: 419 atgctgagcctcatccagcttggt 442
           |||||||  || ||||||||||||
Sbjct: 451 atgctgaagcttatccagcttggt 474



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 506 tggcagttcaactttcggggcttcgatcc 534
           ||||||||||||||||| |||||||||||
Sbjct: 538 tggcagttcaactttcgtggcttcgatcc 566



to top

>dbj|AK065377.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013021M02, full
           insert sequence
          Length = 3225

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 165/204 (80%)
 Strand = Plus / Plus

                                                                       
Query: 239 gagatccgcgaggtatgggcgacgaacctcgaggcggagttcgccgtgatccgtgacgtc 298
           |||||||||||||| |||| |   ||||||||||| |||||||| ||||| || ||  ||
Sbjct: 254 gagatccgcgaggtgtgggaggacaacctcgaggccgagttcgcggtgattcgggagatc 313

                                                                       
Query: 299 gtcggcgattactcgtacatcgctatggacaccgagttcccgggcatcgtgtgccgcccg 358
           || | ||| | | ||||| |||| |||||||| |||||||||||| |||| ||| | |||
Sbjct: 314 gttgacgacttcccgtacgtcgcgatggacacggagttcccgggcgtcgtctgcaggccg 373

                                                                       
Query: 359 ctcgggagctttcgctccaatgacgagtacaactacgccaccctcaaggccaacgtcgac 418
           |||||||  ||    ||||| | ||| | ||||||||| || ||||| ||||||||||||
Sbjct: 374 ctcgggacgttcaagtccaacgccgatttcaactacgcaacgctcaaagccaacgtcgac 433

                                   
Query: 419 atgctgagcctcatccagcttggt 442
           |||||||  || ||||||||||||
Sbjct: 434 atgctgaagcttatccagcttggt 457



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 506 tggcagttcaactttcggggcttcgatcc 534
           ||||||||||||||||| |||||||||||
Sbjct: 521 tggcagttcaactttcgtggcttcgatcc 549



to top

>gb|AY112022.1| Zea mays CL704_1 mRNA sequence
          Length = 1244

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 139/170 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 gaggcggagttcgccgtgatccgtgacgtcgtcggcgattactcgtacatcgctatggac 328
           |||| |||||||||  ||||||| ||| |||||| ||| ||| | | | |||| ||||||
Sbjct: 185 gaggaggagttcgcgctgatccgcgacatcgtcgacgagtacccattcgtcgcgatggac 244

                                                                       
Query: 329 accgagttcccgggcatcgtgtgccgcccgctcgggagctttcgctccaatgacgagtac 388
           || ||||||||||||||||| ||||| ||  | ||   ||| |||||    | ||| |||
Sbjct: 245 acggagttcccgggcatcgtctgccggcccgttggcgccttccgctctcccgccgactac 304

                                                             
Query: 389 aactacgccaccctcaaggccaacgtcgacatgctgagcctcatccagct 438
           |||||||||||||||||||||||||| |||||||||  ||||||||||||
Sbjct: 305 aactacgccaccctcaaggccaacgtggacatgctgcacctcatccagct 354



to top

>gb|BT009163.1| Triticum aestivum clone wl1n.pk0094.h5:fis, full insert mRNA
           sequence
          Length = 739

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                       
Query: 505 ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
           |||||||||||| || ||||||||| | |||| | |||||||   || | ||||||||||
Sbjct: 76  ctggcagttcaatttccggggcttcaacccgcacacagacccttacagccccgactccat 135

                                             
Query: 565 cgacctgctacgcaacagtgggatcgacttcgac 598
           ||||||||| |||  ||| || ||||||||||||
Sbjct: 136 cgacctgctccgccgcagcggcatcgacttcgac 169



to top

>gb|BT017748.1| Zea mays clone EL01N0450A11.c mRNA sequence
          Length = 1240

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 388 caactacgccaccctcaaggccaacgtcgacatgctgagcctcatccagcttggtctcac 447
           |||||||||| ||||| ||| ||||||| || |||| |  |||||||||||||| |||||
Sbjct: 465 caactacgccgccctcgagggcaacgtcaacgtgctcaagctcatccagcttggcctcac 524

                  
Query: 448 tctctcc 454
            ||||||
Sbjct: 525 cctctcc 531



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 76/94 (80%)
 Strand = Plus / Plus

                                                                       
Query: 505 ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
           ||||||||| ||||| ||||||||||| |||| | | |||||  | | |  |||||||||
Sbjct: 582 ctggcagtttaacttccggggcttcgacccgcacaccgacccttctagcagcgactccat 641

                                             
Query: 565 cgacctgctacgcaacagtgggatcgacttcgac 598
           ||| ||||| |||  ||| || ||||||||||||
Sbjct: 642 cgatctgctccgccgcagcggcatcgacttcgac 675



to top

>gb|AY109688.1| Zea mays CL339_1 mRNA sequence
          Length = 1928

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 388 caactacgccaccctcaaggccaacgtcgacatgctgagcctcatccagcttggtctcac 447
           |||||||||| ||||| ||| ||||||| || |||| |  |||||||||||||| |||||
Sbjct: 458 caactacgccgccctcgagggcaacgtcaacgtgctcaagctcatccagcttggcctcac 517

                  
Query: 448 tctctcc 454
            ||||||
Sbjct: 518 cctctcc 524



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 76/94 (80%)
 Strand = Plus / Plus

                                                                       
Query: 505 ctggcagttcaactttcggggcttcgatccgcgctcagaccccgccaacgccgactccat 564
           ||||||||| ||||| ||||||||||| |||| | | |||||  | | |  |||||||||
Sbjct: 575 ctggcagtttaacttccggggcttcgacccgcacaccgacccttctagcagcgactccat 634

                                             
Query: 565 cgacctgctacgcaacagtgggatcgacttcgac 598
           ||| ||||| |||  ||| || ||||||||||||
Sbjct: 635 cgatctgctccgccgcagcggcatcgacttcgac 668



to top

>ref|XM_469696.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                       
Query: 263 aacctcgaggcggagttcgccgtgatccgtgacgtcgtcggcgattactcgtacatcgct 322
           ||||| |||| |||| ||||  ||||||| |||||||||| ||| | | | | | |||| 
Sbjct: 196 aaccttgaggtggagctcgcgttgatccgcgacgtcgtcgacgagttccccttcgtcgcc 255

                                         
Query: 323 atggacaccgagttcccgggcatcgtgtgc 352
           |||||||| |||||||| ||||||||||||
Sbjct: 256 atggacacagagttccctggcatcgtgtgc 285



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                            
Query: 263      aacctcgaggcggagttcgccgtgatccgtgacgtcgtcggcgattactcgtacatcgct 322
                ||||| |||| |||| ||||  ||||||| |||||||||| ||| | | | | | |||| 
Sbjct: 30265943 aaccttgaggtggagctcgcgttgatccgcgacgtcgtcgacgagttccccttcgtcgcc 30265884

                                              
Query: 323      atggacaccgagttcccgggcatcgtgtgc 352
                |||||||| |||||||| ||||||||||||
Sbjct: 30265883 atggacacagagttccctggcatcgtgtgc 30265854



to top

>gb|AC092558.4| Oryza sativa chromosome 3 BAC OSJNBb0036F07 genomic sequence, complete
             sequence
          Length = 130359

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                         
Query: 263   aacctcgaggcggagttcgccgtgatccgtgacgtcgtcggcgattactcgtacatcgct 322
             ||||| |||| |||| ||||  ||||||| |||||||||| ||| | | | | | |||| 
Sbjct: 57623 aaccttgaggtggagctcgcgttgatccgcgacgtcgtcgacgagttccccttcgtcgcc 57564

                                           
Query: 323   atggacaccgagttcccgggcatcgtgtgc 352
             |||||||| |||||||| ||||||||||||
Sbjct: 57563 atggacacagagttccctggcatcgtgtgc 57534



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                            
Query: 263      aacctcgaggcggagttcgccgtgatccgtgacgtcgtcggcgattactcgtacatcgct 322
                ||||| |||| |||| ||||  ||||||| |||||||||| ||| | | | | | |||| 
Sbjct: 30357365 aaccttgaggtggagctcgcgttgatccgcgacgtcgtcgacgagttccccttcgtcgcc 30357306

                                              
Query: 323      atggacaccgagttcccgggcatcgtgtgc 352
                |||||||| |||||||| ||||||||||||
Sbjct: 30357305 atggacacagagttccctggcatcgtgtgc 30357276



to top

>dbj|AP006864.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT18I21, TM1144,
             complete sequence
          Length = 135217

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 402   tcaaggccaacgtcgacatgctgagcctcatccagcttggtctcactctctccgacg 458
             ||||||||||||| ||| |||| | |||||| ||  |||||||||| ||||||||||
Sbjct: 13155 tcaaggccaacgttgacgtgctcaacctcattcaagttggtctcaccctctccgacg 13211



to top

>gb|AC090885.1|AC090885 Homo sapiens chromosome 3 clone RP11-270I6 map 3p, complete sequence
          Length = 193264

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 50     ctcctgttattactttccccac 71
              ||||||||||||||||||||||
Sbjct: 138001 ctcctgttattactttccccac 138022



to top

>gb|AC066589.3|AC066589 Homo sapiens chromosome 3 clone RP11-309M10 map 3p, complete sequence
          Length = 182171

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 50     ctcctgttattactttccccac 71
              ||||||||||||||||||||||
Sbjct: 114814 ctcctgttattactttccccac 114793



to top

>gb|AC069246.6| Homo sapiens chromosome 3 clone RP11-221A8 map 3p, complete sequence
          Length = 175121

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 50    ctcctgttattactttccccac 71
             ||||||||||||||||||||||
Sbjct: 60717 ctcctgttattactttccccac 60696



to top

>ref|XM_465099.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1822

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 216 agcccgtcgacgaggagggcg 236
           |||||||||||||||||||||
Sbjct: 351 agcccgtcgacgaggagggcg 371



to top

>emb|AL035422.12|HS164F3 Human DNA sequence from clone RP1-164F3 on chromosome Xq21.33-23
             Contains a ribosomal protein L21 (RPL21) pseudogene, the
             TIMM8A gene for translocase of inner mitochondrial
             membrane 8 homolog A (yeast), the BTK gene for Bruton
             agammaglobulinemia tyrosine kinase, the RPL36A gene for
             ribosomal protein L36a, the GLA gene for alpha
             galactosidase, the HNRPH2 gene for heterogeneous nuclear
             ribonucleoprotein H2 (H'), the gene for a novel protein, a
             peptidylprolyl isomerase A (cyclophilin A) (PPIA)
             pseudogene and two CpG islands, complete sequence
          Length = 136693

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 178   tgccccaccgccccccgcctcgtcc 202
             |||||| ||||||||||||||||||
Sbjct: 97931 tgcccccccgccccccgcctcgtcc 97955



to top

>gb|AE012493.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 401
            of 460 of the complete genome
          Length = 10907

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 448  tctctccgacgagaacggcgc 468
            |||||||||||||||||||||
Sbjct: 6078 tctctccgacgagaacggcgc 6058



to top

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 448     tctctccgacgagaacggcgc 468
               |||||||||||||||||||||
Sbjct: 4489531 tctctccgacgagaacggcgc 4489511



to top

>dbj|AK066972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013089I06, full
           insert sequence
          Length = 1821

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 216 agcccgtcgacgaggagggcg 236
           |||||||||||||||||||||
Sbjct: 350 agcccgtcgacgaggagggcg 370



to top

>gb|AC122315.5| Mus musculus BAC clone RP23-302P6 from 10, complete sequence
          Length = 197288

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 28    cccctgctcccgcctccctgtcctc 52
             ||||||||||||||||||| |||||
Sbjct: 52666 cccctgctcccgcctccctctcctc 52690



to top

>gb|U78027.1|HSU78027 Homo sapiens Bruton's tyrosine kinase (BTK), alpha-D-galactosidase A
            (GLA), L44-like ribosomal protein (L44L) and FTP3 (FTP3)
            genes, complete cds
          Length = 99014

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 178  tgccccaccgccccccgcctcgtcc 202
            |||||| ||||||||||||||||||
Sbjct: 7242 tgcccccccgccccccgcctcgtcc 7218



to top

>gb|DQ141111.1| Drosophila yakuba Dscam gene, partial sequence
          Length = 56981

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   tcgacgaggagggcgtagagatcc 245
             |||||||||||||||| |||||||
Sbjct: 14561 tcgacgaggagggcgtggagatcc 14584



to top

>gb|DQ141109.1| Drosophila simulans Dscam gene, partial sequence
          Length = 45053

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  tcgacgaggagggcgtagagatcc 245
            |||||||||||||||| |||||||
Sbjct: 5159 tcgacgaggagggcgtggagatcc 5182



to top

>gb|DQ141105.1| Drosophila erecta Dscam gene, partial sequence
          Length = 36265

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  tcgacgaggagggcgtagagatcc 245
            |||||||||||||||| |||||||
Sbjct: 5404 tcgacgaggagggcgtggagatcc 5427



to top

>ref|NM_183930.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 975

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 294 acgtcgtcggcgattactcgtaca 317
           ||||||||||||| ||||||||||
Sbjct: 830 acgtcgtcggcgactactcgtaca 853



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 399     ccctcaaggccaacgtcgac 418
               ||||||||||||||||||||
Sbjct: 4850747 ccctcaaggccaacgtcgac 4850728



to top

>gb|AC009739.4| Drosophila melanogaster clone BACR26B18, complete sequence
          Length = 173641

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    tcgacgaggagggcgtagagatcc 245
              |||||||||||||||| |||||||
Sbjct: 116550 tcgacgaggagggcgtggagatcc 116527



to top

>gb|AC146440.5| Pan troglodytes BAC clone RP43-11P11 from 7, complete sequence
          Length = 181369

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 177   ctgccccaccgccccccgcc 196
             ||||||||||||||||||||
Sbjct: 61416 ctgccccaccgccccccgcc 61435



to top

>emb|AL591166.12| Human DNA sequence from clone RP11-315O13 on chromosome 1, complete
             sequence
          Length = 23352

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 28    cccctgctcccgcctccctg 47
             ||||||||||||||||||||
Sbjct: 19268 cccctgctcccgcctccctg 19249



to top

>emb|BX883045.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
              assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
              RT1n haplotype; segment 4/11
          Length = 346406

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 157    ggatgcaccagctccgatgt 176
              ||||||||||||||||||||
Sbjct: 309716 ggatgcaccagctccgatgt 309697



to top

>emb|AL939122.1|SCO939122 Streptomyces coelicolor A3(2) complete genome; segment 19/29
          Length = 311000

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 216    agcccgtcgacgaggagggcgtag 239
              ||||||||| ||||||||||||||
Sbjct: 253851 agcccgtcgccgaggagggcgtag 253828



to top

>gb|DQ317106.1| Drosophila yakuba Dscam gene, exons 3 through 24
          Length = 60717

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   tcgacgaggagggcgtagagatcc 245
             |||||||||||||||| |||||||
Sbjct: 15143 tcgacgaggagggcgtggagatcc 15166



to top

>gb|AF385930.1|AF385930 Drosophila yakuba DSCAM splice variants gene, exons 3, 4 and 5 and
            partial cds, alternatively spliced
          Length = 6995

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 222  tcgacgaggagggcgtagagatcc 245
            |||||||||||||||| |||||||
Sbjct: 5148 tcgacgaggagggcgtggagatcc 5171



to top

>gb|DQ357063.1| Phytophthora sojae cell 5A endo-1,4-betaglucanase (EGL-V.4) mRNA,
           complete cds
          Length = 1326

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 401 ctcaaggccaacgtcgacat 420
           ||||||||||||||||||||
Sbjct: 940 ctcaaggccaacgtcgacat 959



to top

>emb|AL117038.1|CNS01DNA Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 399 ccctcaaggccaacgtcgac 418
           ||||||||||||||||||||
Sbjct: 87  ccctcaaggccaacgtcgac 106



to top

>emb|AL117035.1|CNS01DN7 Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 399 ccctcaaggccaacgtcgac 418
           ||||||||||||||||||||
Sbjct: 87  ccctcaaggccaacgtcgac 106



to top

>emb|AL116748.1|CNS01DF8 Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 399 ccctcaaggccaacgtcgac 418
           ||||||||||||||||||||
Sbjct: 346 ccctcaaggccaacgtcgac 365



to top

>emb|AL116694.1|CNS01DDQ Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 399 ccctcaaggccaacgtcgac 418
           ||||||||||||||||||||
Sbjct: 334 ccctcaaggccaacgtcgac 353



to top

>emb|AL114101.1|CNS01BDP Botrytis cinerea strain T4 cDNA library
          Length = 636

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 399 ccctcaaggccaacgtcgac 418
           ||||||||||||||||||||
Sbjct: 229 ccctcaaggccaacgtcgac 248



to top

>emb|AL112985.1|CNS01AIP Botrytis cinerea strain T4 cDNA library
          Length = 540

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 399 ccctcaaggccaacgtcgac 418
           ||||||||||||||||||||
Sbjct: 146 ccctcaaggccaacgtcgac 165



to top

>emb|AL111926.1|CNS019PA Botrytis cinerea strain T4 cDNA library
          Length = 780

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 399 ccctcaaggccaacgtcgac 418
           ||||||||||||||||||||
Sbjct: 340 ccctcaaggccaacgtcgac 359



to top

>emb|AL111623.1|CNS019GV Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 399 ccctcaaggccaacgtcgac 418
           ||||||||||||||||||||
Sbjct: 78  ccctcaaggccaacgtcgac 97



to top

>emb|AL111776.1|CNS019L4 Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 399 ccctcaaggccaacgtcgac 418
           ||||||||||||||||||||
Sbjct: 36  ccctcaaggccaacgtcgac 55



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 94      tcgcaaaccctaaccctagc 113
               ||||||||||||||||||||
Sbjct: 7452601 tcgcaaaccctaaccctagc 7452620



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 294      acgtcgtcggcgattactcgtaca 317
                ||||||||||||| ||||||||||
Sbjct: 13350444 acgtcgtcggcgactactcgtaca 13350467



to top

>gb|AY787762.1| Streptomyces filamentosus strain NRRL 11379 daptomycin biosynthetic
             gene cluster, partial sequence
          Length = 127559

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 345   tcgtgtgccgcccgctcggg 364
             ||||||||||||||||||||
Sbjct: 51869 tcgtgtgccgcccgctcggg 51850



to top

>gb|AC006343.3| Homo sapiens PAC clone RP4-548K24 from 7q34-q36, complete sequence
          Length = 124877

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 177  ctgccccaccgccccccgcc 196
            ||||||||||||||||||||
Sbjct: 5755 ctgccccaccgccccccgcc 5736



to top

>gb|AF260530.1| Drosophila melanogaster Dscam gene, complete cds
          Length = 69145

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   tcgacgaggagggcgtagagatcc 245
             |||||||||||||||| |||||||
Sbjct: 18519 tcgacgaggagggcgtggagatcc 18542



to top

>dbj|AP003331.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1088D01
          Length = 146144

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 294   acgtcgtcggcgattactcgtaca 317
             ||||||||||||| ||||||||||
Sbjct: 90802 acgtcgtcggcgactactcgtaca 90825



to top

>dbj|AP005246.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0061L20
          Length = 138926

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 94    tcgcaaaccctaaccctagc 113
             ||||||||||||||||||||
Sbjct: 30915 tcgcaaaccctaaccctagc 30934



to top

>dbj|AK098873.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001C18, full
           insert sequence
          Length = 1778

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 tgccgcccgctcgggagctt 369
           ||||||||||||||||||||
Sbjct: 230 tgccgcccgctcgggagctt 211



to top

>gb|AE003841.5| Drosophila melanogaster chromosome 2R, section 9 of 73 of the complete
              sequence
          Length = 266427

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 222    tcgacgaggagggcgtagagatcc 245
              |||||||||||||||| |||||||
Sbjct: 113603 tcgacgaggagggcgtggagatcc 113580



to top

>gb|AC005452.1|AC005452 Drosophila melanogaster, chromosome 2R, region 43B2-43C2, P1 clone
             DS07185, complete sequence
          Length = 79333

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 222   tcgacgaggagggcgtagagatcc 245
             |||||||||||||||| |||||||
Sbjct: 78963 tcgacgaggagggcgtggagatcc 78986


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,192,041
Number of Sequences: 3902068
Number of extensions: 3192041
Number of successful extensions: 70149
Number of sequences better than 10.0: 74
Number of HSP's better than 10.0 without gapping: 74
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69606
Number of HSP's gapped (non-prelim): 525
length of query: 598
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 575
effective length of database: 17,143,297,704
effective search space: 9857396179800
effective search space used: 9857396179800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top