Clone Information

BLAST Search Result

Clone Name	basd26n21
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	dbj\|AK058988.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	192	9e-46
2	dbj\|AP008212.1\| Oryza sativa (japonica cultivar-group) genomic D...	86	2e-13
3	dbj\|AP003573.3\| Oryza sativa (japonica cultivar-group) genomic D...	86	2e-13
4	dbj\|AP003571.4\| Oryza sativa (japonica cultivar-group) genomic D...	86	2e-13
5	gb\|AE009432.1\| Agrobacterium tumefaciens str. C58 Ti plasmid, se...	42	2.1
6	gb\|AE007940.1\| Agrobacterium tumefaciens str. C58 plasmid Ti, se...	42	2.1
7	gb\|AC109170.10\| Mus musculus chromosome 8, clone RP23-87B3, comp...	42	2.1
8	gb\|AC123794.4\| Mus musculus BAC clone RP24-315P14 from chromosom...	42	2.1
9	gb\|AF010180.1\| Agrobacterium tumefaciens plasmid pTiC58 TraI reg...	42	2.1
10	dbj\|AB016260.1\| Agrobacterium tumefaciens plasmid pTi-SAKURA, co...	42	2.1
11	gb\|DQ265193.1\| Plasmodium falciparum isolate Pf42_08 RIFIN (rif)...	42	2.1
12	gb\|AC122888.5\| Mus musculus BAC clone RP23-93F11 from chromosome...	40	8.1
13	gb\|AC161043.9\| Mus musculus chromosome 1, clone wi1-483A16, comp...	40	8.1
14	gb\|L41732.4\|ABCLSDA Gluconacetobacter diazotrophicus levansucras...	40	8.1
15	gb\|CP000125.1\| Burkholderia pseudomallei 1710b chromosome II, co...	40	8.1
16	gb\|AC108909.15\| Mus musculus chromosome 3, clone RP24-245I16, co...	40	8.1
17	emb\|CT025601.7\| Mouse DNA sequence from clone RP23-424B7 on chro...	40	8.1
18	gb\|BC032721.1\| Homo sapiens HIR histone cell cycle regulation de...	40	8.1
19	gb\|AC005816.6\| Mus musculus strain 129/Sv clone ct7-326b16 map 1...	40	8.1
20	gb\|AC115452.4\| Rattus norvegicus 7 BAC CH230-309G3 (Children's H...	40	8.1
21	emb\|X92590.1\|MMHIRAPRT M.musculus mRNA for HIRA protein	40	8.1
22	emb\|X75295.1\|MMTUPLE1 M.musculus TUP1-like enhancer of split gen...	40	8.1
23	emb\|BX571966.1\| Burkholderia pseudomallei strain K96243, chromos...	40	8.1
24	emb\|BX908783.8\| Zebrafish DNA sequence from clone DKEY-86M2 in l...	40	8.1
25	emb\|BX323796.14\| Zebrafish DNA sequence from clone DKEY-106N21 i...	40	8.1
26	emb\|CR931738.1\| Medicago truncatula chromosome 5 clone mth2-56k1...	40	8.1
27	emb\|X75296.1\|HSTUPLE1 H.sapiens TUP1-like enhancer of split gene...	40	8.1
28	gb\|AC135960.14\| Pan troglodytes clone rp43-55o12, complete sequence	40	8.1
29	gb\|AC079222.17\| Mus musculus chromosome 1, clone RP22-292L24, co...	40	8.1
30	gb\|AC003062.2\| Mouse Chromosome 16 Region Syntenic to DGCR BAC C...	40	8.1
31	gb\|AC155333.5\| Mus musculus 6 BAC RP24-475M8 (Roswell Park Cance...	40	8.1
32	emb\|BX255948.4\| Zebrafish DNA sequence from clone CH211-250J1, c...	40	8.1
33	emb\|BX248087.9\| Zebrafish DNA sequence from clone CH211-191J22, ...	40	8.1
34	ref\|XM_344057.2\| PREDICTED: Rattus norvegicus similar to histone...	40	8.1
35	gb\|AC133573.11\| Mus musculus strain C57BL/6J clone rp23-139f17, ...	40	8.1
36	gb\|BC039835.1\| Homo sapiens HIR histone cell cycle regulation de...	40	8.1
37	gb\|AF065246.1\|AF065246 Agrobacterium tumefaciens strain Chry5 pl...	40	8.1
38	dbj\|AB110090.1\| Lactobacillus crispatus LbsA gene for surface la...	40	8.1
39	gb\|AC113264.21\| Mus musculus strain C57BL/6J chromosome 16 clone...	40	8.1
40	gb\|AC124442.3\| Mus musculus BAC clone RP24-178G20 from 7, comple...	40	8.1
41	gb\|BC060181.1\| Mus musculus cDNA clone IMAGE:6831824, containing...	40	8.1
42	ref\|NM_010435.2\| Mus musculus histone cell cycle regulation defe...	40	8.1
43	emb\|X91501.1\|HSHIRAHGN H.sapiens HIRAHs gene	40	8.1
44	emb\|X89887.1\|HSHIRAGN1 Homo sapiens mRNA for WD repeat protein (...	40	8.1

>dbj|AK058988.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-020-F01, full
           insert sequence
          Length = 1528

 Score =  192 bits (97), Expect = 9e-46
 Identities = 199/233 (85%)
 Strand = Plus / Plus

                                                                       
Query: 168 atgtcgatccagggccagctcctcgaggtcagagtgacggggtgcaggaagctgcgggac 227
           |||||||| || |||||| ||||||| |||||||| || ||||||||||||||| |||||
Sbjct: 1   atgtcgatacaaggccagatcctcgaagtcagagtcactgggtgcaggaagctgagggac 60

                                                                       
Query: 228 accgagttcttctcgcgccaggacccctacgtcatcatcgactacgccaacaacaagctg 287
           || ||||||||| |||| ||||| |||||||||  |||||| || |||| ||||||| | 
Sbjct: 61  acggagttcttcacgcggcaggatccctacgtctgcatcgagtatgccaccaacaagttc 120

                                                                       
Query: 288 cgcaccaggacatgcaccgatggaggaaggaacccgtcctttgacgagaagtttcatata 347
           |||||| | || ||||||||||| |||||||||||  | |||||||||||||||||||||
Sbjct: 121 cgcacccgcacctgcaccgatgggggaaggaaccctacttttgacgagaagtttcatata 180

                                                                
Query: 348 ccactcatcgaggggctccgtgagctgagtatcaacgtgtggaacagcaacac 400
           || ||||| |||||||| |||||||| |   |||  |||||||||||||||||
Sbjct: 181 cctctcattgaggggcttcgtgagctaaccgtcacagtgtggaacagcaacac 233



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 54/58 (93%)
 Strand = Plus / Plus

                                                                     
Query: 506 gtctgccggggaagtgatgctcattatgcactttgatgtctcagcaatgaagaacaag 563
           |||||| |||||||||| |||||||||||| |||||||| ||||||||||||||||||
Sbjct: 478 gtctgctggggaagtgacgctcattatgcattttgatgtttcagcaatgaagaacaag 535



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                       
Query: 432 agggtgccgctgaacaaggtgctcacgagtggcttcgatgacgcctcatggcccctccag 491
           ||||||| |||| | |||||||| ||| ||||||  ||||| ||||||||||||||||||
Sbjct: 337 agggtgcagctgcataaggtgcttacgcgtggctatgatgatgcctcatggcccctccag 396

                        
Query: 492 acacgccatatga 504
           |||||||||||||
Sbjct: 397 acacgccatatga 409

to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                            
Query: 306      gatggaggaaggaacccgtcctttgacgagaagtttcatataccactcatcgaggggctc 365
                ||||| |||||||||||  | ||||||||||||||||||||||| ||||| |||||||| 
Sbjct: 25581794 gatgggggaaggaaccctacttttgacgagaagtttcatatacctctcattgaggggctt 25581735

                                                   
Query: 366      cgtgagctgagtatcaacgtgtggaacagcaacac 400
                |||||||| |   |||  |||||||||||||||||
Sbjct: 25581734 cgtgagctaaccgtcacagtgtggaacagcaacac 25581700



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                            
Query: 432      agggtgccgctgaacaaggtgctcacgagtggcttcgatgacgcctcatggcccctccag 491
                ||||||| |||| | |||||||| ||| ||||||  ||||| ||||||||||||||||||
Sbjct: 25581596 agggtgcagctgcataaggtgcttacgcgtggctatgatgatgcctcatggcccctccag 25581537

                             
Query: 492      acacgccatatga 504
                |||||||||||||
Sbjct: 25581536 acacgccatatga 25581524



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                            
Query: 207      gggtgcaggaagctgcgggacaccgagttcttctcgcgccaggacccctacgtcatcatc 266
                ||||||||||||||| ||||||| ||||||||| |||| ||||| |||||||||  ||||
Sbjct: 25583511 gggtgcaggaagctgagggacacggagttcttcacgcggcaggatccctacgtctgcatc 25583452

                                                        
Query: 267      gactacgccaacaacaagctgcgcaccaggacatgcaccg 306
                || || |||| ||||||| | |||||| | || |||||||
Sbjct: 25583451 gagtatgccaccaacaagttccgcacccgcacctgcaccg 25583412



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                                 
Query: 506      gtctgccggggaagtgatgctcattatgcactttgatgtctcagcaatg 554
                |||||| |||||||||| |||||||||||| |||||||| |||||||||
Sbjct: 25581455 gtctgctggggaagtgacgctcattatgcattttgatgtttcagcaatg 25581407

to top

>dbj|AP003573.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0523F01
          Length = 146419

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                          
Query: 306    gatggaggaaggaacccgtcctttgacgagaagtttcatataccactcatcgaggggctc 365
              ||||| |||||||||||  | ||||||||||||||||||||||| ||||| |||||||| 
Sbjct: 100111 gatgggggaaggaaccctacttttgacgagaagtttcatatacctctcattgaggggctt 100052

                                                 
Query: 366    cgtgagctgagtatcaacgtgtggaacagcaacac 400
              |||||||| |   |||  |||||||||||||||||
Sbjct: 100051 cgtgagctaaccgtcacagtgtggaacagcaacac 100017



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                         
Query: 432   agggtgccgctgaacaaggtgctcacgagtggcttcgatgacgcctcatggcccctccag 491
             ||||||| |||| | |||||||| ||| ||||||  ||||| ||||||||||||||||||
Sbjct: 99913 agggtgcagctgcataaggtgcttacgcgtggctatgatgatgcctcatggcccctccag 99854

                          
Query: 492   acacgccatatga 504
             |||||||||||||
Sbjct: 99853 acacgccatatga 99841



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                          
Query: 207    gggtgcaggaagctgcgggacaccgagttcttctcgcgccaggacccctacgtcatcatc 266
              ||||||||||||||| ||||||| ||||||||| |||| ||||| |||||||||  ||||
Sbjct: 101828 gggtgcaggaagctgagggacacggagttcttcacgcggcaggatccctacgtctgcatc 101769

                                                      
Query: 267    gactacgccaacaacaagctgcgcaccaggacatgcaccg 306
              || || |||| ||||||| | |||||| | || |||||||
Sbjct: 101768 gagtatgccaccaacaagttccgcacccgcacctgcaccg 101729



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                              
Query: 506   gtctgccggggaagtgatgctcattatgcactttgatgtctcagcaatg 554
             |||||| |||||||||| |||||||||||| |||||||| |||||||||
Sbjct: 99772 gtctgctggggaagtgacgctcattatgcattttgatgtttcagcaatg 99724

to top

>dbj|AP003571.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
            clone:P0458E02
          Length = 154458

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                        
Query: 306  gatggaggaaggaacccgtcctttgacgagaagtttcatataccactcatcgaggggctc 365
            ||||| |||||||||||  | ||||||||||||||||||||||| ||||| |||||||| 
Sbjct: 5239 gatgggggaaggaaccctacttttgacgagaagtttcatatacctctcattgaggggctt 5180

                                               
Query: 366  cgtgagctgagtatcaacgtgtggaacagcaacac 400
            |||||||| |   |||  |||||||||||||||||
Sbjct: 5179 cgtgagctaaccgtcacagtgtggaacagcaacac 5145



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                        
Query: 432  agggtgccgctgaacaaggtgctcacgagtggcttcgatgacgcctcatggcccctccag 491
            ||||||| |||| | |||||||| ||| ||||||  ||||| ||||||||||||||||||
Sbjct: 5041 agggtgcagctgcataaggtgcttacgcgtggctatgatgatgcctcatggcccctccag 4982

                         
Query: 492  acacgccatatga 504
            |||||||||||||
Sbjct: 4981 acacgccatatga 4969



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 207  gggtgcaggaagctgcgggacaccgagttcttctcgcgccaggacccctacgtcatcatc 266
            ||||||||||||||| ||||||| ||||||||| |||| ||||| |||||||||  ||||
Sbjct: 6956 gggtgcaggaagctgagggacacggagttcttcacgcggcaggatccctacgtctgcatc 6897

                                                    
Query: 267  gactacgccaacaacaagctgcgcaccaggacatgcaccg 306
            || || |||| ||||||| | |||||| | || |||||||
Sbjct: 6896 gagtatgccaccaacaagttccgcacccgcacctgcaccg 6857



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                             
Query: 506  gtctgccggggaagtgatgctcattatgcactttgatgtctcagcaatg 554
            |||||| |||||||||| |||||||||||| |||||||| |||||||||
Sbjct: 4900 gtctgctggggaagtgacgctcattatgcattttgatgtttcagcaatg 4852

to top

>gb|AE009432.1| Agrobacterium tumefaciens str. C58 Ti plasmid, section 15 of 21 of
            the complete sequence
          Length = 6849

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 257  cgtcatcatcgactacgccaacaac 281
            |||||||||||||||||||| ||||
Sbjct: 5186 cgtcatcatcgactacgccatcaac 5162

to top

>gb|AE007940.1| Agrobacterium tumefaciens str. C58 plasmid Ti, section 18 of 20 of
           the complete sequence
          Length = 12492

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 257 cgtcatcatcgactacgccaacaac 281
           |||||||||||||||||||| ||||
Sbjct: 532 cgtcatcatcgactacgccatcaac 508

to top

>gb|AC109170.10| Mus musculus chromosome 8, clone RP23-87B3, complete sequence
          Length = 274518

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 540    gatgtctcagcaatgaagaac 560
              |||||||||||||||||||||
Sbjct: 124458 gatgtctcagcaatgaagaac 124478

to top

>gb|AC123794.4| Mus musculus BAC clone RP24-315P14 from chromosome 8, complete sequence
          Length = 187246

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 540    gatgtctcagcaatgaagaac 560
              |||||||||||||||||||||
Sbjct: 133759 gatgtctcagcaatgaagaac 133779

to top

>gb|AF010180.1| Agrobacterium tumefaciens plasmid pTiC58 TraI region, TraII region and
             acc operon, complete sequence; and unknown genes
          Length = 24708

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 257   cgtcatcatcgactacgccaacaac 281
             |||||||||||||||||||| ||||
Sbjct: 14969 cgtcatcatcgactacgccatcaac 14945

to top

>dbj|AB016260.1| Agrobacterium tumefaciens plasmid pTi-SAKURA, complete sequence
          Length = 206479

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 257    cgtcatcatcgactacgccaacaac 281
              |||||||||||||||||||| ||||
Sbjct: 112416 cgtcatcatcgactacgccatcaac 112392

to top

>gb|DQ265193.1| Plasmodium falciparum isolate Pf42_08 RIFIN (rif) gene, exon 2 and
           partial cds
          Length = 841

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 59  tcaagaagcaaaagtcgcttt 79
           |||||||||||||||||||||
Sbjct: 679 tcaagaagcaaaagtcgcttt 699

to top

>gb|AC122888.5| Mus musculus BAC clone RP23-93F11 from chromosome 3, complete sequence
          Length = 206760

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 526    tcattatgcactttgatgtc 545
              ||||||||||||||||||||
Sbjct: 181045 tcattatgcactttgatgtc 181064

to top

>gb|AC161043.9| Mus musculus chromosome 1, clone wi1-483A16, complete sequence
          Length = 31683

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 405  aacaccgatgacttcattgg 424
            ||||||||||||||||||||
Sbjct: 7936 aacaccgatgacttcattgg 7917

to top

>gb|L41732.4|ABCLSDA Gluconacetobacter diazotrophicus levansucrase precursor (lsdA),
            levanase precursor (lsdB), pseudopilin G precursor
            (lsdG), prepilin peptidase and N-methyltransferase O
            (gspO), kinase E (lsdE), LsdF (lsdF), pseudopilin H
            precursor (lsdH), pseudopilin I precursor (lsdI),
            pseudopilin J precursor (lsdJ), LsdL (lsdL), LsdM (lsdM),
            and LsdN (lsdN) genes, complete cds; secretin D (lsdD)
            gene, partial cds; and unknown gene
          Length = 13897

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 242  gcgccaggacccctacgtcatcat 265
            ||||||||||||| ||||||||||
Sbjct: 7444 gcgccaggaccccgacgtcatcat 7467

to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 153   ccgcgccgcccgcccatgtcgatc 176
             ||||||||||||||| ||||||||
Sbjct: 83170 ccgcgccgcccgcccgtgtcgatc 83193

to top

>gb|AC108909.15| Mus musculus chromosome 3, clone RP24-245I16, complete sequence
          Length = 194252

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 526   tcattatgcactttgatgtc 545
             ||||||||||||||||||||
Sbjct: 56238 tcattatgcactttgatgtc 56257

to top

>emb|CT025601.7| Mouse DNA sequence from clone RP23-424B7 on chromosome 17, complete
            sequence
          Length = 197841

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 177  cagggccagctcctcgaggt 196
            ||||||||||||||||||||
Sbjct: 8076 cagggccagctcctcgaggt 8095

to top

>gb|BC032721.1| Homo sapiens HIR histone cell cycle regulation defective homolog A
           (S. cerevisiae), mRNA (cDNA clone IMAGE:5505105),
           containing frame-shift errors
          Length = 2188

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 148 tcctcccgcgccgcccgccc 167
           ||||||||||||||||||||
Sbjct: 177 tcctcccgcgccgcccgccc 158

to top

>gb|AC005816.6| Mus musculus strain 129/Sv clone ct7-326b16 map 16, complete sequence
          Length = 136687

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 148   tcctcccgcgccgcccgccc 167
             ||||||||||||||||||||
Sbjct: 99213 tcctcccgcgccgcccgccc 99194

to top

>gb|AC115452.4| Rattus norvegicus 7 BAC CH230-309G3 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 169133

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     agcagtatcaatcttggatc 30
              ||||||||||||||||||||
Sbjct: 116813 agcagtatcaatcttggatc 116794

to top

>emb|X92590.1|MMHIRAPRT M.musculus mRNA for HIRA protein
          Length = 4018

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 148 tcctcccgcgccgcccgccc 167
           ||||||||||||||||||||
Sbjct: 148 tcctcccgcgccgcccgccc 129

to top

>emb|X75295.1|MMTUPLE1 M.musculus TUP1-like enhancer of split gene 1 (TUPLE1) mRNA
          Length = 1991

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 148 tcctcccgcgccgcccgccc 167
           ||||||||||||||||||||
Sbjct: 151 tcctcccgcgccgcccgccc 132

to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 153     ccgcgccgcccgcccatgtcgatc 176
               ||||||||||||||| ||||||||
Sbjct: 1478724 ccgcgccgcccgcccgtgtcgatc 1478747

to top

>emb|BX908783.8| Zebrafish DNA sequence from clone DKEY-86M2 in linkage group 25, complete
              sequence
          Length = 216800

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 405    aacaccgatgacttcattgg 424
              ||||||||||||||||||||
Sbjct: 105647 aacaccgatgacttcattgg 105666

to top

>emb|BX323796.14| Zebrafish DNA sequence from clone DKEY-106N21 in linkage group 25,
              complete sequence
          Length = 204383

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 405    aacaccgatgacttcattgg 424
              ||||||||||||||||||||
Sbjct: 140272 aacaccgatgacttcattgg 140253

to top

>emb|CR931738.1| Medicago truncatula chromosome 5 clone mth2-56k10, COMPLETE SEQUENCE
          Length = 132450

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 526   tcattatgcactttgatgtc 545
             ||||||||||||||||||||
Sbjct: 85097 tcattatgcactttgatgtc 85116

to top

>emb|X75296.1|HSTUPLE1 H.sapiens TUP1-like enhancer of split gene 1 (TUPLE1) mRNA
          Length = 3420

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 148 tcctcccgcgccgcccgccc 167
           ||||||||||||||||||||
Sbjct: 146 tcctcccgcgccgcccgccc 127

to top

>gb|AC135960.14| Pan troglodytes clone rp43-55o12, complete sequence
          Length = 157430

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 148   tcctcccgcgccgcccgccc 167
             ||||||||||||||||||||
Sbjct: 24600 tcctcccgcgccgcccgccc 24619

to top

>gb|AC079222.17| Mus musculus chromosome 1, clone RP22-292L24, complete sequence
          Length = 159700

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 405    aacaccgatgacttcattgg 424
              ||||||||||||||||||||
Sbjct: 117422 aacaccgatgacttcattgg 117441

to top

>gb|AC003062.2| Mouse Chromosome 16 Region Syntenic to DGCR BAC Clone b264n1, complete
             sequence
          Length = 89743

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 148   tcctcccgcgccgcccgccc 167
             ||||||||||||||||||||
Sbjct: 20238 tcctcccgcgccgcccgccc 20219

to top

>gb|AC155333.5| Mus musculus 6 BAC RP24-475M8 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 189462

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 555   aagaacaagatggcaggtaa 574
             ||||||||||||||||||||
Sbjct: 55767 aagaacaagatggcaggtaa 55786

to top

>emb|BX255948.4| Zebrafish DNA sequence from clone CH211-250J1, complete sequence
          Length = 194257

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 389   gaacagcaacacaatcaaca 408
             ||||||||||||||||||||
Sbjct: 83494 gaacagcaacacaatcaaca 83475

to top

>emb|BX248087.9| Zebrafish DNA sequence from clone CH211-191J22, complete sequence
          Length = 150181

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 389   gaacagcaacacaatcaaca 408
             ||||||||||||||||||||
Sbjct: 43996 gaacagcaacacaatcaaca 43977

to top

>ref|XM_344057.2| PREDICTED: Rattus norvegicus similar to histone cell cycle
           regulation defective homolog A isoform 1 (LOC363849),
           mRNA
          Length = 4507

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 148 tcctcccgcgccgcccgccc 167
           ||||||||||||||||||||
Sbjct: 634 tcctcccgcgccgcccgccc 615

to top

>gb|AC133573.11| Mus musculus strain C57BL/6J clone rp23-139f17, complete sequence
          Length = 224138

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 148    tcctcccgcgccgcccgccc 167
              ||||||||||||||||||||
Sbjct: 113545 tcctcccgcgccgcccgccc 113564

to top

>gb|BC039835.1| Homo sapiens HIR histone cell cycle regulation defective homolog A
           (S. cerevisiae), mRNA (cDNA clone MGC:48803
           IMAGE:5491361), complete cds
          Length = 4024

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 148 tcctcccgcgccgcccgccc 167
           ||||||||||||||||||||
Sbjct: 134 tcctcccgcgccgcccgccc 115

to top

>gb|AF065246.1|AF065246 Agrobacterium tumefaciens strain Chry5 plasmid pTiChry5 scl
            pseudogene, complete sequence; conjugal transfer
            regulatory protein (traR) and VirH (virH) genes, complete
            cds; and unknown gene
          Length = 4168

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 257  cgtcatcatcgactacgcca 276
            ||||||||||||||||||||
Sbjct: 1107 cgtcatcatcgactacgcca 1126

to top

>dbj|AB110090.1| Lactobacillus crispatus LbsA gene for surface layer protein,
           complete cds
          Length = 2220

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 545 ctcagcaatgaagaacaaga 564
           ||||||||||||||||||||
Sbjct: 967 ctcagcaatgaagaacaaga 986

to top

>gb|AC113264.21| Mus musculus strain C57BL/6J chromosome 16 clone rp23-357j7, complete
              sequence
          Length = 222589

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 148    tcctcccgcgccgcccgccc 167
              ||||||||||||||||||||
Sbjct: 114282 tcctcccgcgccgcccgccc 114263

to top

>gb|AC124442.3| Mus musculus BAC clone RP24-178G20 from 7, complete sequence
          Length = 177517

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 379    tcaacgtgtggaacagcaac 398
              ||||||||||||||||||||
Sbjct: 107495 tcaacgtgtggaacagcaac 107476

to top

>gb|BC060181.1| Mus musculus cDNA clone IMAGE:6831824, containing frame-shift
           errors
          Length = 4236

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 148 tcctcccgcgccgcccgccc 167
           ||||||||||||||||||||
Sbjct: 345 tcctcccgcgccgcccgccc 326

to top

>ref|NM_010435.2| Mus musculus histone cell cycle regulation defective homolog A (S.
           cerevisiae) (Hira), transcript variant 1, mRNA
          Length = 4553

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 148 tcctcccgcgccgcccgccc 167
           ||||||||||||||||||||
Sbjct: 661 tcctcccgcgccgcccgccc 642

to top

>emb|X91501.1|HSHIRAHGN H.sapiens HIRAHs gene
          Length = 1212

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 148 tcctcccgcgccgcccgccc 167
           ||||||||||||||||||||
Sbjct: 346 tcctcccgcgccgcccgccc 327

to top

>emb|X89887.1|HSHIRAGN1 Homo sapiens mRNA for WD repeat protein (HIRA)
          Length = 4018

 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 148 tcctcccgcgccgcccgccc 167
           ||||||||||||||||||||
Sbjct: 139 tcctcccgcgccgcccgccc 120


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,322,640
Number of Sequences: 3902068
Number of extensions: 4322640
Number of successful extensions: 78909
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 78704
Number of HSP's gapped (non-prelim): 201
length of query: 596
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 573
effective length of database: 17,143,297,704
effective search space: 9823109584392
effective search space used: 9823109584392
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result