| Clone Name | basd26n02 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF186240.1|AF186240 Secale cereale thioredoxin-like protein (Trx) mRNA, partial cds Length = 826 Score = 531 bits (268), Expect = e-148 Identities = 278/280 (99%), Gaps = 1/280 (0%) Strand = Plus / Plus Query: 387 atggggggctgtgtgggcaagggtcgtggcattgtggaagaaaagcttgatttcaaaggt 446 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 470 atggggggctgtgtgggcaagggtcgtagcattgtggaagaaaagcttgatttcaaaggt 529 Query: 447 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 530 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 589 Query: 507 aaggatgggaaaattgttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtc 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 590 aaggatgggaaaattgttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtc 649 Query: 567 attgcacctgtttatgctgagatgtccaagacttatcctcaactcatgttcttgacaatt 626 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 650 attgcacctgtttatgctgagatgtccaagacttatcctcaactcatgttcttgacaa-t 708 Query: 627 tgatgttgatgacctaatggatttcagctcaacatgggac 666 |||||||||||||||||||||||||||||||||||||||| Sbjct: 709 tgatgttgatgacctaatggatttcagctcaacatgggac 748 Score = 266 bits (134), Expect = 9e-68 Identities = 183/199 (91%), Gaps = 4/199 (2%) Strand = Plus / Plus Query: 160 gagctctcccttttacgtcaatcaatcgaaacccagttaaagaacctcttaattgcccgc 219 |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| Sbjct: 265 gagctctcccttttacgttaatcaatcgaa-cccagttaaagaacctcttaattgcccgc 323 Query: 220 caggagatccgccaggcttatcttcgccgtctcctccgacctcgcctccannnnnnntcg 279 ||||||||||||||||||||||||| ||||||||||||||||| ||| | ||| Sbjct: 324 caggagatccgccaggcttatcttctccgtctcctccgacctcaccttc---ccctctcg 380 Query: 280 ccccgcggcttctgggttccttggcgccaaaatccccgcttccgatcccaggccttcagg 339 |||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| Sbjct: 381 ccccgcggcttctgggctccttggcgccaaaatcctcgcttccgatcccaggccttcagg 440 Query: 340 aatcagggggcctttcatt 358 || |||||||||||||||| Sbjct: 441 aaccagggggcctttcatt 459 Score = 99.6 bits (50), Expect = 1e-17 Identities = 74/81 (91%), Gaps = 2/81 (2%) Strand = Plus / Plus Query: 23 cccagcagcaataaaaaagcaagccattcccct--cctcttcctccgattaatcaaaccg 80 ||||||| |||||||||||||||||| ||||| |||| ||||||||||||||||||| Sbjct: 140 cccagcaacaataaaaaagcaagccaatcccccaccctccccctccgattaatcaaaccg 199 Query: 81 cgcggcggcggcggcgagcgt 101 ||||||||||||||||||||| Sbjct: 200 cgcggcggcggcggcgagcgt 220
>gb|AF435815.1| Hordeum vulgare thioredoxin h-like protein mRNA, complete cds Length = 396 Score = 523 bits (264), Expect = e-145 Identities = 277/280 (98%), Gaps = 1/280 (0%) Strand = Plus / Plus Query: 387 atggggggctgtgtgggcaagggtcgtggcattgtggaagaaaagcttgatttcaaaggt 446 ||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 1 atgggaggctgtgtgggcaagggtcgtggcgttgtggaagaaaagcttgatttcaaaggt 60 Query: 447 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 120 Query: 507 aaggatgggaaaattgttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtc 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 aaggatgggaaaattgttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtc 180 Query: 567 attgcacctgtttatgctgagatgtccaagacttatcctcaactcatgttcttgacaatt 626 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 181 attgcacctgtttatgctgagatgtccaagacttatcctcaactcatgttcttgacaa-t 239 Query: 627 tgatgttgatgacctaatggatttcagctcaacatgggac 666 |||||||||||||||||||||||||||||||||||||||| Sbjct: 240 tgatgttgatgacctaatggatttcagctcaacatgggac 279
>gb|AF159386.1| Secale cereale thioredoxin-like protein (Trx) mRNA, complete cds Length = 939 Score = 507 bits (256), Expect = e-140 Identities = 275/280 (98%), Gaps = 1/280 (0%) Strand = Plus / Plus Query: 387 atggggggctgtgtgggcaagggtcgtggcattgtggaagaaaagcttgatttcaaaggt 446 ||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| Sbjct: 544 atggggggctgtgtggggaagggtcgtagcattgtggaagaaaagcttgatttcaaaggt 603 Query: 447 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 604 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 663 Query: 507 aaggatgggaaaattgttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtc 566 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 664 aaggatgggaaaattgttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtc 723 Query: 567 attgcacctgtttatgctgagatgtccaagacttatcctcaactcatgttcttgacaatt 626 |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | Sbjct: 724 gttgcacctgtttatgctgggatgtccaagacttatcctcaactcatgttcttgacaa-t 782 Query: 627 tgatgttgatgacctaatggatttcagctcaacatgggac 666 |||||||||||||||||||||||||||||||||||||||| Sbjct: 783 tgatgttgatgacctaatggatttcagctcaacatgggac 822 Score = 153 bits (77), Expect = 9e-34 Identities = 93/97 (95%), Gaps = 1/97 (1%) Strand = Plus / Plus Query: 160 gagctctcccttttacgtcaatcaatcgaaacccagttaaagaacctcttaattgcccgc 219 |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| Sbjct: 319 gagctctcccttttacgttaatcaatcgaa-cccagttaaagaacctcttaattgcccgc 377 Query: 220 caggagatccgccaggcttatcttcgccgtctcctcc 256 |||||||||||||||||||| |||| ||||||||||| Sbjct: 378 caggagatccgccaggcttaccttctccgtctcctcc 414 Score = 109 bits (55), Expect = 1e-20 Identities = 70/74 (94%), Gaps = 2/74 (2%) Strand = Plus / Plus Query: 277 tcgccccgcggcttctgggttccttggcgccaaaatccccgcttccgatcccaggccttc 336 ||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 434 tcgccccgcgg--tctgggttccttggcgccaaaatcgtcgcttccgatcccaggccttc 491 Query: 337 aggaatcagggggc 350 |||||||||||||| Sbjct: 492 aggaatcagggggc 505 Score = 97.6 bits (49), Expect = 5e-17 Identities = 72/77 (93%), Gaps = 2/77 (2%) Strand = Plus / Plus Query: 23 cccagcagcaataaaaaagcaagccattcccct-cctctt-cctccgattaatcaaaccg 80 ||||||| |||||||||||||||||| ||||| |||||| ||||||||||||||||||| Sbjct: 186 cccagcaacaataaaaaagcaagccaatcccccacctctttcctccgattaatcaaaccg 245 Query: 81 cgcggcggcggcggcga 97 ||||||||||||||||| Sbjct: 246 cgcggcggcggcggcga 262
>gb|AF438359.1| Triticum aestivum thioredoxin mRNA, complete cds Length = 396 Score = 500 bits (252), Expect = e-138 Identities = 274/280 (97%), Gaps = 1/280 (0%) Strand = Plus / Plus Query: 387 atggggggctgtgtgggcaagggtcgtggcattgtggaagaaaagcttgatttcaaaggt 446 |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| Sbjct: 1 atggggggctgtgtgggcaaggatcgtagcattgtggaagaaaagcttgatttcaaaggt 60 Query: 447 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 506 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 120 Query: 507 aaggatgggaaaattgttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtc 566 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 121 aaggatgggaaaattgttgtagcaaacttaagtgcttcgtggtgtgggccatgccgtgtc 180 Query: 567 attgcacctgtttatgctgagatgtccaagacttatcctcaactcatgttcttgacaatt 626 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | Sbjct: 181 attgcacctgtttatgccgagatgtccaagacttatcctcaactcatgttcttgacaa-t 239 Query: 627 tgatgttgatgacctaatggatttcagctcaacatgggac 666 |||||||||||||||||||||||||||||| ||||||||| Sbjct: 240 tgatgttgatgacctaatggatttcagctctacatgggac 279
>gb|AF159388.1| Phalaris coerulescens thioredoxin-like protein (Trx) mRNA, Trx-1 allele, complete cds Length = 978 Score = 436 bits (220), Expect = e-119 Identities = 266/280 (95%), Gaps = 1/280 (0%) Strand = Plus / Plus Query: 387 atggggggctgtgtgggcaagggtcgtggcattgtggaagaaaagcttgatttcaaaggt 446 ||||| |||||||||||||||| |||||||||||||||||| |||||||||||||||||| Sbjct: 583 atgggaggctgtgtgggcaaggatcgtggcattgtggaagacaagcttgatttcaaaggt 642 Query: 447 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 506 || ||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||| Sbjct: 643 gggaatgtgcatgtcataactaccaaagaggactgggaccagaaaattgcagaagcaaac 702 Query: 507 aaggatgggaaaattgttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtc 566 |||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||| Sbjct: 703 aaggatgggaaaattgttgtggcaaatttcagtgcttcctggtgtgggccatgccgtgtc 762 Query: 567 attgcacctgtttatgctgagatgtccaagacttatcctcaactcatgttcttgacaatt 626 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| | Sbjct: 763 attgcacctgtttatgctgagatgtcaaagacgtatcctcaactcatgttcttgacaa-t 821 Query: 627 tgatgttgatgacctaatggatttcagctcaacatgggac 666 |||||||||||||||| ||||||||||||||||||||||| Sbjct: 822 tgatgttgatgacctagtggatttcagctcaacatgggac 861 Score = 52.0 bits (26), Expect = 0.002 Identities = 39/42 (92%), Gaps = 1/42 (2%) Strand = Plus / Plus Query: 299 cttggcgccaaaatccccgcttccgatccca-ggccttcagg 339 ||||||||||||||||||||| || |||||| |||||||||| Sbjct: 493 cttggcgccaaaatccccgctccccatcccagggccttcagg 534 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 56 cctcttcctccgattaatcaaacc 79 |||| ||||||||||||||||||| Sbjct: 279 cctcctcctccgattaatcaaacc 302
>gb|AF159385.1| Hordeum bulbosum thioredoxin-like protein (Trx) mRNA, complete cds Length = 1010 Score = 436 bits (220), Expect = e-119 Identities = 266/280 (95%), Gaps = 1/280 (0%) Strand = Plus / Plus Query: 387 atggggggctgtgtgggcaagggtcgtggcattgtggaagaaaagcttgatttcaaaggt 446 ||||| |||||||||||||||| ||| ||||||| ||||| |||||||||||||||||| Sbjct: 615 atgggaggctgtgtgggcaaggaccgtagcattgtagaagataagcttgatttcaaaggt 674 Query: 447 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 506 ||||||||||||||||| ||||||||||||||||||||||| ||| ||| |||||||||| Sbjct: 675 ggaaatgtgcatgtcatcacaaccaaagaggactgggaccaaaaggttgcagaagcaaac 734 Query: 507 aaggatgggaaaattgttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtc 566 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| Sbjct: 735 aaggatgggaaaattgttgttgcaaacttcagtgcttcgtggtgtgggccatgccgcgtc 794 Query: 567 attgcacctgtttatgctgagatgtccaagacttatcctcaactcatgttcttgacaatt 626 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 795 attgcacctgtttatgctgagatgtccaagacttatcctcaactcatgttcttgacaa-t 853 Query: 627 tgatgttgatgacctaatggatttcagctcaacatgggac 666 ||||||||||||||||||||||||| |||||||||||||| Sbjct: 854 tgatgttgatgacctaatggatttcggctcaacatgggac 893 Score = 69.9 bits (35), Expect = 1e-08 Identities = 69/80 (86%), Gaps = 4/80 (5%) Strand = Plus / Plus Query: 160 gagctctcccttttacgtcaatcaatcgaaacccagttaaagaacctcttaattgcccgc 219 ||||||| |||| ||||| |||||||| || || |||||| ||||||||||||||||| Sbjct: 413 gagctcttccttgtacgttaatcaatccaacccgagttaaggaacctcttaattgccc-- 470 Query: 220 caggagatccgccaggctta 239 |||||||||||||||||| Sbjct: 471 --ggagatccgccaggctta 488 Score = 52.0 bits (26), Expect = 0.002 Identities = 39/42 (92%), Gaps = 1/42 (2%) Strand = Plus / Plus Query: 299 cttggcgccaaaatccccgcttccgatccca-ggccttcagg 339 |||||||||||||||||| ||||||||| || |||||||||| Sbjct: 525 cttggcgccaaaatccccccttccgatctcagggccttcagg 566
>gb|AF159389.1|AF159389 Phalaris coerulescens thioredoxin-like protein (Trx) mRNA, Trx-2 allele, complete cds Length = 975 Score = 436 bits (220), Expect = e-119 Identities = 266/280 (95%), Gaps = 1/280 (0%) Strand = Plus / Plus Query: 387 atggggggctgtgtgggcaagggtcgtggcattgtggaagaaaagcttgatttcaaaggt 446 ||||| |||||||||||||||| |||||||||||||||||| |||||||||||||||||| Sbjct: 580 atgggaggctgtgtgggcaaggatcgtggcattgtggaagacaagcttgatttcaaaggt 639 Query: 447 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 506 || ||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||| Sbjct: 640 gggaatgtgcatgtcataactaccaaagaggactgggaccagaaaattgcagaagcaaac 699 Query: 507 aaggatgggaaaattgttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtc 566 |||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||| Sbjct: 700 aaggatgggaaaattgttgtggcaaatttcagtgcttcctggtgtgggccatgccgtgtc 759 Query: 567 attgcacctgtttatgctgagatgtccaagacttatcctcaactcatgttcttgacaatt 626 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| | Sbjct: 760 attgcacctgtttatgctgagatgtcaaagacgtatcctcaactcatgttcttgacaa-t 818 Query: 627 tgatgttgatgacctaatggatttcagctcaacatgggac 666 |||||||||||||||| ||||||||||||||||||||||| Sbjct: 819 tgatgttgatgacctagtggatttcagctcaacatgggac 858 Score = 52.0 bits (26), Expect = 0.002 Identities = 39/42 (92%), Gaps = 1/42 (2%) Strand = Plus / Plus Query: 299 cttggcgccaaaatccccgcttccgatccca-ggccttcagg 339 ||||||||||||||||||||| || |||||| |||||||||| Sbjct: 490 cttggcgccaaaatccccgctccccatcccagggccttcagg 531 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 56 cctcttcctccgattaatcaaacc 79 |||| ||||||||||||||||||| Sbjct: 279 cctcctcctccgattaatcaaacc 302
>gb|AF159387.1| Lolium perenne thioredoxin-like protein (Trx) mRNA, complete cds Length = 1024 Score = 381 bits (192), Expect = e-102 Identities = 259/280 (92%), Gaps = 1/280 (0%) Strand = Plus / Plus Query: 387 atggggggctgtgtgggcaagggtcgtggcattgtggaagaaaagcttgatttcaaaggt 446 ||||| |||||||||||||||| ||| ||||||||||||| |||||||||||||||||| Sbjct: 629 atgggaggctgtgtgggcaaggaccgtagcattgtggaagataagcttgatttcaaaggt 688 Query: 447 ggaaatgtgcatgtcataacaaccaaagaggactgggaccagaagattgaagaagcaaac 506 ||||||||||||||||| ||||||||||||||||||||||| ||| ||| |||||| ||| Sbjct: 689 ggaaatgtgcatgtcatcacaaccaaagaggactgggaccaaaaggttgcagaagctaac 748 Query: 507 aaggatgggaaaattgttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtc 566 || ||||||||||||||||| || || ||||| ||||| |||||||| |||||||||||| Sbjct: 749 aaagatgggaaaattgttgtggcgaatttcagcgcttcctggtgtggcccatgccgtgtc 808 Query: 567 attgcacctgtttatgctgagatgtccaagacttatcctcaactcatgttcttgacaatt 626 |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| | Sbjct: 809 attgcacctgtttatgctgagatgtcaaagacttatccccaactcatgttcttgacaa-t 867 Query: 627 tgatgttgatgacctaatggatttcagctcaacatgggac 666 ||| |||||||||||||||||||||||||||||||||||| Sbjct: 868 tgacgttgatgacctaatggatttcagctcaacatgggac 907 Score = 60.0 bits (30), Expect = 1e-05 Identities = 73/87 (83%), Gaps = 4/87 (4%) Strand = Plus / Plus Query: 168 ccttttacgtcaatcaatcgaaacccagttaaagaacctcttaattgcccgccaggagat 227 |||| |||||||||||||| | || |||||| | ||||||||||||||| |||||| Sbjct: 434 ccttctacgtcaatcaatccagcccgagttaagggacctcttaattgccc----ggagat 489 Query: 228 ccgccaggcttatcttcgccgtctcct 254 |||||||||||||| || |||||||| Sbjct: 490 ccgccaggcttatcgtcttcgtctcct 516 Score = 44.1 bits (22), Expect = 0.58 Identities = 38/42 (90%), Gaps = 1/42 (2%) Strand = Plus / Plus Query: 299 cttggcgccaaaatccccgcttccgatccca-ggccttcagg 339 |||||||||||||||||| |||||||| || |||||||||| Sbjct: 539 cttggcgccaaaatccccctttccgatctcagggccttcagg 580
>ref|XM_476046.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 399 Score = 343 bits (173), Expect = 5e-91 Identities = 231/249 (92%), Gaps = 1/249 (0%) Strand = Plus / Plus Query: 417 attgtggaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagag 476 |||| |||||| |||||||||||||||||||||||||| ||||||||||||| ||||||| Sbjct: 34 attgaggaagacaagcttgatttcaaaggtggaaatgttcatgtcataacaagcaaagag 93 Query: 477 gactgggaccagaagattgaagaagcaaacaaggatgggaaaattgttgtagcaaacttc 536 |||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 94 gactgggataggaagattgaagaagcaaacaaggatgggaaaattgttgtggcaaatttc 153 Query: 537 agtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtccaag 596 |||||||| |||||||| ||||| ||||| ||||||||| |||||||||||||||| ||| Sbjct: 154 agtgcttcctggtgtggaccatgtcgtgttattgcacctatttatgctgagatgtcaaag 213 Query: 597 acttatcctcaactcatgttcttgacaatttgatgttgatgacctaatggatttcagctc 656 |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 214 acttatcctcaactcatgttcttgacaa-tagatgttgatgacctaatggatttcagctc 272 Query: 657 aacatggga 665 | ||||||| Sbjct: 273 atcatggga 281
>dbj|AK060918.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G10, full insert sequence Length = 1012 Score = 343 bits (173), Expect = 5e-91 Identities = 231/249 (92%), Gaps = 1/249 (0%) Strand = Plus / Plus Query: 417 attgtggaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagag 476 |||| |||||| |||||||||||||||||||||||||| ||||||||||||| ||||||| Sbjct: 342 attgaggaagacaagcttgatttcaaaggtggaaatgttcatgtcataacaagcaaagag 401 Query: 477 gactgggaccagaagattgaagaagcaaacaaggatgggaaaattgttgtagcaaacttc 536 |||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 402 gactgggataggaagattgaagaagcaaacaaggatgggaaaattgttgtggcaaatttc 461 Query: 537 agtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtccaag 596 |||||||| |||||||| ||||| ||||| ||||||||| |||||||||||||||| ||| Sbjct: 462 agtgcttcctggtgtggaccatgtcgtgttattgcacctatttatgctgagatgtcaaag 521 Query: 597 acttatcctcaactcatgttcttgacaatttgatgttgatgacctaatggatttcagctc 656 |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 522 acttatcctcaactcatgttcttgacaa-tagatgttgatgacctaatggatttcagctc 580 Query: 657 aacatggga 665 | ||||||| Sbjct: 581 atcatggga 589
>gb|AF435817.1| Oryza sativa thioredoxin h-like protein mRNA, complete cds Length = 399 Score = 343 bits (173), Expect = 5e-91 Identities = 231/249 (92%), Gaps = 1/249 (0%) Strand = Plus / Plus Query: 417 attgtggaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagag 476 |||| |||||| |||||||||||||||||||||||||| ||||||||||||| ||||||| Sbjct: 34 attgaggaagacaagcttgatttcaaaggtggaaatgttcatgtcataacaagcaaagag 93 Query: 477 gactgggaccagaagattgaagaagcaaacaaggatgggaaaattgttgtagcaaacttc 536 |||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 94 gactgggataggaagattgaagaagcaaacaaggatgggaaaattgttgtggcaaatttc 153 Query: 537 agtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtccaag 596 |||||||| |||||||| ||||| ||||| ||||||||| |||||||||||||||| ||| Sbjct: 154 agtgcttcctggtgtggaccatgtcgtgttattgcacctatttatgctgagatgtcaaag 213 Query: 597 acttatcctcaactcatgttcttgacaatttgatgttgatgacctaatggatttcagctc 656 |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| Sbjct: 214 acttatcctcaactcatgttcttgacaa-tagatgttgatgacctaatggatttcagctc 272 Query: 657 aacatggga 665 | ||||||| Sbjct: 273 atcatggga 281
>gb|AF435816.1| Zea mays thioredoxin h-like protein mRNA, complete cds Length = 402 Score = 270 bits (136), Expect = 5e-69 Identities = 218/244 (89%), Gaps = 1/244 (0%) Strand = Plus / Plus Query: 423 gaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagaggactgg 482 ||||||||||||||||| |||||||||||||| ||| | ||||||| ||| |||| |||| Sbjct: 37 gaagaaaagcttgattttaaaggtggaaatgttcatattataacaagcaatgagggctgg 96 Query: 483 gaccagaagattgaagaagcaaacaaggatgggaaaattgttgtagcaaacttcagtgct 542 ||||||||||||| ||||||||||| |||||||||| |||||| ||||| ||||| ||| Sbjct: 97 gaccagaagattgcagaagcaaacagagatgggaaaactgttgttgcaaatttcagcgct 156 Query: 543 tcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtccaagacttat 602 || |||||||||||||||||||||||||| ||||| |||||||| ||||| ||||||||| Sbjct: 157 tcctggtgtgggccatgccgtgtcattgctcctgtctatgctgaaatgtcaaagacttat 216 Query: 603 cctcaactcatgttcttgacaatttgatgttgatgacctaatggatttcagctcaacatg 662 |||||||||||||||||||||| | || ||||||||||| ||||| |||||||| |||| Sbjct: 217 cctcaactcatgttcttgacaa-tagacgttgatgacctgatggacttcagctcttcatg 275 Query: 663 ggac 666 |||| Sbjct: 276 ggac 279
>gb|AY204511.1| Leymus chinensis thioredoxin h gene, complete cds Length = 2257 Score = 226 bits (114), Expect = 7e-56 Identities = 117/118 (99%) Strand = Plus / Plus Query: 406 agggtcgtggcattgtggaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataa 465 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 822 agggtcgtagcattgtggaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataa 881 Query: 466 caaccaaagaggactgggaccagaagattgaagaagcaaacaaggatgggaaaattgt 523 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 882 caaccaaagaggactgggaccagaagattgaagaagcaaacaaggatgggaaaattgt 939 Score = 224 bits (113), Expect = 3e-55 Identities = 123/125 (98%), Gaps = 1/125 (0%) Strand = Plus / Plus Query: 522 gttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttat 581 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1609 gttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttat 1668 Query: 582 gctgagatgtccaagacttatcctcaactcatgttcttgacaatttgatgttgatgacct 641 |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| Sbjct: 1669 gctgagatgtccaagacttatcctcagctcatgttcttgacaa-ttgatgttgatgacct 1727 Query: 642 aatgg 646 ||||| Sbjct: 1728 aatgg 1732 Score = 135 bits (68), Expect = 2e-28 Identities = 113/128 (88%), Gaps = 6/128 (4%) Strand = Plus / Plus Query: 204 cctcttaattgcccgccaggagatccgccaggcttatcttcgccgtctcctccgacctcg 263 |||||||||||||||||||||||||||||||||||||| || |||||||||||||||| Sbjct: 1 cctcttaattgcccgccaggagatccgccaggcttatcgtcttcgtctcctccgacctca 60 Query: 264 cctccannnnnnntcgccccgcggcttctgggttccttggcgccaaaatccccgcttccg 323 ||||| ||||||||||| ||||||||||||||||||||||||| |||||||| Sbjct: 61 cctcc----cccgtcgccccgcgg--tctgggttccttggcgccaaaatcctcgcttccg 114 Query: 324 atcccagg 331 |||||||| Sbjct: 115 atcccagg 122 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 329 aggccttcaggaatcagggggccttt 354 |||||||||||||||||||||||||| Sbjct: 656 aggccttcaggaatcagggggccttt 681 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 2119 ggatttcagctcaacatgggac 2140
>gb|AF290448.1|AF290448 Lolium perenne clone LpTrx unknown sequence Length = 1574 Score = 168 bits (85), Expect = 1e-38 Identities = 107/113 (94%), Gaps = 1/113 (0%) Strand = Plus / Minus Query: 534 ttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtcc 593 ||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 895 ttcagcgcttcctggtgtggyccatgccgtgtcattgcacctgtttatgctgagatgtca 836 Query: 594 aagacttatcctcaactcatgttcttgacaatttgatgttgatgacctaatgg 646 ||||||||||| ||||||||||||||||||| ||||||||||||||||||||| Sbjct: 835 aagacttatccccaactcatgttcttgacaa-ttgatgttgatgacctaatgg 784 Score = 50.1 bits (25), Expect = 0.009 Identities = 25/25 (100%) Strand = Plus / Minus Query: 499 aagcaaacaaggatgggaaaattgt 523 ||||||||||||||||||||||||| Sbjct: 1574 aagcaaacaaggatgggaaaattgt 1550 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 263 ggatttcagctcaacatgggac 242
>ref|NM_184534.2| Oryza sativa (japonica cultivar-group), mRNA Length = 938 Score = 167 bits (84), Expect = 6e-38 Identities = 205/244 (84%), Gaps = 1/244 (0%) Strand = Plus / Plus Query: 423 gaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagaggactgg 482 ||||| ||| |||| ||||||||||| ||||||||||| || | | ||||||| | ||| Sbjct: 188 gaagacaagattgacttcaaaggtggcaatgtgcatgtgattagtaacaaagagaattgg 247 Query: 483 gaccagaagattgaagaagcaaacaaggatgggaaaattgttgtagcaaacttcagtgct 542 ||||| || |||| ||| ||||||||||||||||||||||| | ||||| ||||||||| Sbjct: 248 gaccacaaaattgcagaggcaaacaaggatgggaaaattgtgattgcaaatttcagtgct 307 Query: 543 tcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtccaagacttat 602 | |||||||| ||||||||||||||||||||||| |||||||||||||| |||| || Sbjct: 308 gcatggtgtggaccatgccgtgtcattgcacctgtatatgctgagatgtcacagacatac 367 Query: 603 cctcaactcatgttcttgacaatttgatgttgatgacctaatggatttcagctcaacatg 662 || || ||||||||||||| | | ||||| || || ||||||| ||||||||| |||| Sbjct: 368 ccccagttcatgttcttgacta-tagatgtcgacgagttaatggacttcagctcatcatg 426 Query: 663 ggac 666 |||| Sbjct: 427 ggac 430
>dbj|AK103756.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033143D23, full insert sequence Length = 938 Score = 167 bits (84), Expect = 6e-38 Identities = 205/244 (84%), Gaps = 1/244 (0%) Strand = Plus / Plus Query: 423 gaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagaggactgg 482 ||||| ||| |||| ||||||||||| ||||||||||| || | | ||||||| | ||| Sbjct: 188 gaagacaagattgacttcaaaggtggcaatgtgcatgtgattagtaacaaagagaattgg 247 Query: 483 gaccagaagattgaagaagcaaacaaggatgggaaaattgttgtagcaaacttcagtgct 542 ||||| || |||| ||| ||||||||||||||||||||||| | ||||| ||||||||| Sbjct: 248 gaccacaaaattgcagaggcaaacaaggatgggaaaattgtgattgcaaatttcagtgct 307 Query: 543 tcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtccaagacttat 602 | |||||||| ||||||||||||||||||||||| |||||||||||||| |||| || Sbjct: 308 gcatggtgtggaccatgccgtgtcattgcacctgtatatgctgagatgtcacagacatac 367 Query: 603 cctcaactcatgttcttgacaatttgatgttgatgacctaatggatttcagctcaacatg 662 || || ||||||||||||| | | ||||| || || ||||||| ||||||||| |||| Sbjct: 368 ccccagttcatgttcttgacta-tagatgtcgacgagttaatggacttcagctcatcatg 426 Query: 663 ggac 666 |||| Sbjct: 427 ggac 430
>gb|AC084817.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0419C04, complete sequence Length = 136713 Score = 161 bits (81), Expect = 4e-36 Identities = 115/125 (92%), Gaps = 1/125 (0%) Strand = Plus / Minus Query: 522 gttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttat 581 ||||| ||||| ||||||||||| |||||||| ||||| ||||| ||||||||| ||||| Sbjct: 52921 gttgtggcaaatttcagtgcttcctggtgtggaccatgtcgtgttattgcacctatttat 52862 Query: 582 gctgagatgtccaagacttatcctcaactcatgttcttgacaatttgatgttgatgacct 641 ||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||| Sbjct: 52861 gctgagatgtcaaagacttatcctcaactcatgttcttgacaa-tagatgttgatgacct 52803 Query: 642 aatgg 646 ||||| Sbjct: 52802 aatgg 52798 Score = 157 bits (79), Expect = 6e-35 Identities = 100/107 (93%) Strand = Plus / Minus Query: 417 attgtggaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagag 476 |||| |||||| |||||||||||||||||||||||||| ||||||||||||| ||||||| Sbjct: 53817 attgaggaagacaagcttgatttcaaaggtggaaatgttcatgtcataacaagcaaagag 53758 Query: 477 gactgggaccagaagattgaagaagcaaacaaggatgggaaaattgt 523 |||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 53757 gactgggataggaagattgaagaagcaaacaaggatgggaaaattgt 53711
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 161 bits (81), Expect = 4e-36 Identities = 115/125 (92%), Gaps = 1/125 (0%) Strand = Plus / Minus Query: 522 gttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttat 581 ||||| ||||| ||||||||||| |||||||| ||||| ||||| ||||||||| ||||| Sbjct: 4078227 gttgtggcaaatttcagtgcttcctggtgtggaccatgtcgtgttattgcacctatttat 4078168 Query: 582 gctgagatgtccaagacttatcctcaactcatgttcttgacaatttgatgttgatgacct 641 ||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||| Sbjct: 4078167 gctgagatgtcaaagacttatcctcaactcatgttcttgacaa-tagatgttgatgacct 4078109 Query: 642 aatgg 646 ||||| Sbjct: 4078108 aatgg 4078104 Score = 157 bits (79), Expect = 6e-35 Identities = 100/107 (93%) Strand = Plus / Minus Query: 417 attgtggaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagag 476 |||| |||||| |||||||||||||||||||||||||| ||||||||||||| ||||||| Sbjct: 4079123 attgaggaagacaagcttgatttcaaaggtggaaatgttcatgtcataacaagcaaagag 4079064 Query: 477 gactgggaccagaagattgaagaagcaaacaaggatgggaaaattgt 523 |||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 4079063 gactgggataggaagattgaagaagcaaacaaggatgggaaaattgt 4079017 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 accgcgcggcggcggcggcg 96 |||||||||||||||||||| Sbjct: 28737533 accgcgcggcggcggcggcg 28737514 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 27484736 cgcggcggcggcggcgagcg 27484717 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 17488860 cgcggcggcggcggcgagcg 17488879
>dbj|AK067480.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106B08, full insert sequence Length = 3066 Score = 161 bits (81), Expect = 4e-36 Identities = 115/125 (92%), Gaps = 1/125 (0%) Strand = Plus / Plus Query: 522 gttgtagcaaacttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttat 581 ||||| ||||| ||||||||||| |||||||| ||||| ||||| ||||||||| ||||| Sbjct: 1899 gttgtggcaaatttcagtgcttcctggtgtggaccatgtcgtgttattgcacctatttat 1958 Query: 582 gctgagatgtccaagacttatcctcaactcatgttcttgacaatttgatgttgatgacct 641 ||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||| Sbjct: 1959 gctgagatgtcaaagacttatcctcaactcatgttcttgacaa-tagatgttgatgacct 2017 Query: 642 aatgg 646 ||||| Sbjct: 2018 aatgg 2022 Score = 147 bits (74), Expect = 5e-32 Identities = 98/106 (92%) Strand = Plus / Plus Query: 417 attgtggaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagag 476 |||| |||||| ||||||||||||| |||||||||||| ||||||||||||| ||||||| Sbjct: 1004 attgaggaagacaagcttgatttcagaggtggaaatgttcatgtcataacaagcaaagag 1063 Query: 477 gactgggaccagaagattgaagaagcaaacaaggatgggaaaattg 522 |||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 1064 gactgggataggaagattgaagaagcaaacaaggatgggaaaattg 1109
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 145 bits (73), Expect = 2e-31 Identities = 104/113 (92%), Gaps = 1/113 (0%) Strand = Plus / Plus Query: 534 ttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtcc 593 ||||||||||| |||||||| ||||| ||||||||||||||| |||||||||||||||| Sbjct: 17877466 ttcagtgcttcctggtgtggaccatgtcgtgtcattgcacctatttatgctgagatgtca 17877525 Query: 594 aagacttatcctcaactcatgttcttgacaat-ttgatgttgatgacctaatg 645 |||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 17877526 aagacttatcctcaactcatgttcttgacaatagatatgttgatgacctaatg 17877578 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 80 gcgcggcggcggcggcgagcg 100 ||||||||||||||||||||| Sbjct: 22217508 gcgcggcggcggcggcgagcg 22217528
>dbj|AK101462.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033040F19, full insert sequence Length = 851 Score = 145 bits (73), Expect = 2e-31 Identities = 104/113 (92%), Gaps = 1/113 (0%) Strand = Plus / Plus Query: 534 ttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtcc 593 ||||||||||| |||||||| ||||| ||||||||||||||| |||||||||||||||| Sbjct: 686 ttcagtgcttcctggtgtggaccatgtcgtgtcattgcacctatttatgctgagatgtca 745 Query: 594 aagacttatcctcaactcatgttcttgacaat-ttgatgttgatgacctaatg 645 |||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 746 aagacttatcctcaactcatgttcttgacaatagatatgttgatgacctaatg 798
>emb|AL731587.2|OSJN00230 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0016N04, complete sequence Length = 164645 Score = 145 bits (73), Expect = 2e-31 Identities = 104/113 (92%), Gaps = 1/113 (0%) Strand = Plus / Plus Query: 534 ttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgagatgtcc 593 ||||||||||| |||||||| ||||| ||||||||||||||| |||||||||||||||| Sbjct: 74221 ttcagtgcttcctggtgtggaccatgtcgtgtcattgcacctatttatgctgagatgtca 74280 Query: 594 aagacttatcctcaactcatgttcttgacaat-ttgatgttgatgacctaatg 645 |||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 74281 aagacttatcctcaactcatgttcttgacaatagatatgttgatgacctaatg 74333
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 528 gcaaacttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgag 587 ||||| ||||||||| | |||||||| ||||||||||||||||||||||| ||||||||| Sbjct: 3489112 gcaaatttcagtgctgcatggtgtggaccatgccgtgtcattgcacctgtatatgctgag 3489053 Query: 588 atgtccaagacttatcctcaactcatgttcttgac 622 ||||| |||| || || || ||||||||||||| Sbjct: 3489052 atgtcacagacatacccccagttcatgttcttgac 3489018 Score = 81.8 bits (41), Expect = 3e-12 Identities = 86/101 (85%) Strand = Plus / Minus Query: 423 gaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagaggactgg 482 ||||| ||| |||| ||||||||||| ||||||||||| || | | ||||||| | ||| Sbjct: 3489976 gaagacaagattgacttcaaaggtggcaatgtgcatgtgattagtaacaaagagaattgg 3489917 Query: 483 gaccagaagattgaagaagcaaacaaggatgggaaaattgt 523 ||||| || |||| ||| ||||||||||||||||||||||| Sbjct: 3489916 gaccacaaaattgcagaggcaaacaaggatgggaaaattgt 3489876 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 39501844 gcggcggcggcggcgagcgt 39501825 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 32824695 cgcggcggcggcggcgagcg 32824676 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 28397279 cgcggcggcggcggcgagcg 28397260 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 accgcgcggcggcggcggcg 96 |||||||||||||||||||| Sbjct: 12684865 accgcgcggcggcggcggcg 12684884
>dbj|AP003301.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0701D05 Length = 172161 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 528 gcaaacttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgag 587 ||||| ||||||||| | |||||||| ||||||||||||||||||||||| ||||||||| Sbjct: 167482 gcaaatttcagtgctgcatggtgtggaccatgccgtgtcattgcacctgtatatgctgag 167423 Query: 588 atgtccaagacttatcctcaactcatgttcttgac 622 ||||| |||| || || || ||||||||||||| Sbjct: 167422 atgtcacagacatacccccagttcatgttcttgac 167388 Score = 81.8 bits (41), Expect = 3e-12 Identities = 86/101 (85%) Strand = Plus / Minus Query: 423 gaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagaggactgg 482 ||||| ||| |||| ||||||||||| ||||||||||| || | | ||||||| | ||| Sbjct: 168346 gaagacaagattgacttcaaaggtggcaatgtgcatgtgattagtaacaaagagaattgg 168287 Query: 483 gaccagaagattgaagaagcaaacaaggatgggaaaattgt 523 ||||| || |||| ||| ||||||||||||||||||||||| Sbjct: 168286 gaccacaaaattgcagaggcaaacaaggatgggaaaattgt 168246
>dbj|AP003339.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1276_B06 Length = 175174 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 528 gcaaacttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgag 587 ||||| ||||||||| | |||||||| ||||||||||||||||||||||| ||||||||| Sbjct: 57180 gcaaatttcagtgctgcatggtgtggaccatgccgtgtcattgcacctgtatatgctgag 57121 Query: 588 atgtccaagacttatcctcaactcatgttcttgac 622 ||||| |||| || || || ||||||||||||| Sbjct: 57120 atgtcacagacatacccccagttcatgttcttgac 57086 Score = 81.8 bits (41), Expect = 3e-12 Identities = 86/101 (85%) Strand = Plus / Minus Query: 423 gaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagaggactgg 482 ||||| ||| |||| ||||||||||| ||||||||||| || | | ||||||| | ||| Sbjct: 58044 gaagacaagattgacttcaaaggtggcaatgtgcatgtgattagtaacaaagagaattgg 57985 Query: 483 gaccagaagattgaagaagcaaacaaggatgggaaaattgt 523 ||||| || |||| ||| ||||||||||||||||||||||| Sbjct: 57984 gaccacaaaattgcagaggcaaacaaggatgggaaaattgt 57944
>dbj|AP002912.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0028E10 Length = 140791 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 528 gcaaacttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctgag 587 ||||| ||||||||| | |||||||| ||||||||||||||||||||||| ||||||||| Sbjct: 75872 gcaaatttcagtgctgcatggtgtggaccatgccgtgtcattgcacctgtatatgctgag 75813 Query: 588 atgtccaagacttatcctcaactcatgttcttgac 622 ||||| |||| || || || ||||||||||||| Sbjct: 75812 atgtcacagacatacccccagttcatgttcttgac 75778 Score = 81.8 bits (41), Expect = 3e-12 Identities = 86/101 (85%) Strand = Plus / Minus Query: 423 gaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagaggactgg 482 ||||| ||| |||| ||||||||||| ||||||||||| || | | ||||||| | ||| Sbjct: 76736 gaagacaagattgacttcaaaggtggcaatgtgcatgtgattagtaacaaagagaattgg 76677 Query: 483 gaccagaagattgaagaagcaaacaaggatgggaaaattgt 523 ||||| || |||| ||| ||||||||||||||||||||||| Sbjct: 76676 gaccacaaaattgcagaggcaaacaaggatgggaaaattgt 76636
>dbj|AB024702.1| Oryza sativa (japonica cultivar-group) S-trn-l pseudogene for S-type thioredoxin, partial sequence Length = 1841 Score = 81.8 bits (41), Expect = 3e-12 Identities = 86/101 (85%) Strand = Plus / Plus Query: 423 gaagaaaagcttgatttcaaaggtggaaatgtgcatgtcataacaaccaaagaggactgg 482 ||||| ||| |||| ||||||||||| ||||||||||| || | | ||||||| | ||| Sbjct: 918 gaagacaagattgacttcaaaggtggcaatgtgcatgtgattagtaacaaagagaattgg 977 Query: 483 gaccagaagattgaagaagcaaacaaggatgggaaaattgt 523 ||||| || |||| ||| ||||||||||||||||||||||| Sbjct: 978 gaccacaaaattgcagaggcaaacaaggatgggaaaattgt 1018 Score = 75.8 bits (38), Expect = 2e-10 Identities = 53/58 (91%) Strand = Plus / Plus Query: 528 gcaaacttcagtgcttcgtggtgtgggccatgccgtgtcattgcacctgtttatgctg 585 ||||| ||||||||| | |||||||| ||||||||||||||||||||||| ||||||| Sbjct: 1784 gcaaatttcagtgctgcatggtgtggaccatgccgtgtcattgcacctgtatatgctg 1841
>gb|BT013093.1| Lycopersicon esculentum clone 114359R, mRNA sequence Length = 1102 Score = 58.0 bits (29), Expect = 4e-05 Identities = 68/81 (83%) Strand = Plus / Plus Query: 479 ctgggaccagaagattgaagaagcaaacaaggatgggaaaattgttgtagcaaacttcag 538 |||||| |||||| | | ||||||||| || || || ||||||||| | ||||| ||||| Sbjct: 276 ctgggatcagaagttggcagaagcaaaaaaagagggcaaaattgttattgcaaatttcag 335 Query: 539 tgcttcgtggtgtgggccatg 559 |||||| |||||||| ||||| Sbjct: 336 tgcttcatggtgtggtccatg 356
>gb|AY589274.1| Poa secunda voucher PI 504370 clone 3 thioredoxin-like protein (Trx) gene, partial sequence Length = 548 Score = 48.1 bits (24), Expect = 0.037 Identities = 31/32 (96%), Gaps = 1/32 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgacctaatgg 646 |||||||||||| ||||||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgacctaatgg 31 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 522 ggatttcagctcaacatgggac 543
>gb|AF435818.1| Nicotiana tabacum thioredoxin h-like protein mRNA, complete cds Length = 459 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Plus Query: 480 tgggaccagaagattgaagaagcaaacaaggatgggaaaattgttgtagcaaacttcagt 539 ||||| |||||| | | ||||||||| || || || ||||||||| | || || |||||| Sbjct: 133 tgggatcagaagttggcagaagcaaataaagagggcaaaattgttattgcgaatttcagt 192 Query: 540 gcttcgtggtgtgggccatg 559 ||||| |||||||| ||||| Sbjct: 193 gcttcatggtgtggtccatg 212
>emb|AJ844021.1| Plantago major mRNA for thioredoxin 1 (trx1 gene) Length = 600 Score = 46.1 bits (23), Expect = 0.15 Identities = 29/31 (93%) Strand = Plus / Plus Query: 532 acttcagtgcttcgtggtgtgggccatgccg 562 |||||| ||||||||||||||| |||||||| Sbjct: 176 acttcactgcttcgtggtgtggaccatgccg 206
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgagcgt 101 ||||||||||||||||||||||| Sbjct: 1963939 cgcgcggcggcggcggcgagcgt 1963961
>emb|CR692597.2|CNS0FXCX Tetraodon nigroviridis full-length cDNA Length = 886 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgagcg 100 |||||||||||||||||||||| Sbjct: 735 cgcgcggcggcggcggcgagcg 756
>gb|BC051722.1| Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 6, mRNA (cDNA clone IMAGE:5262480), complete cds Length = 5035 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgagcg 100 |||||||||||||||||||||| Sbjct: 4 cgcgcggcggcggcggcgagcg 25
>emb|AL139294.15| Human DNA sequence from clone RP5-1044H5 on chromosome 1p31.2-32.3 Contains the 5' end of the DNAJC6 gene for DnaJ (Hsp40) homolog subfamily C member 6, a novel gene and a cytochrome c oxidase subunit VIc (COX6C) pseudogene, complete sequence Length = 93614 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgagcg 100 |||||||||||||||||||||| Sbjct: 4921 cgcgcggcggcggcggcgagcg 4942
>emb|CR858035.1| Pongo pygmaeus mRNA; cDNA DKFZp459M0333 (from clone DKFZp459M0333) Length = 2719 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 80 gcgcggcggcggcggcgagcgt 101 |||||||||||||||||||||| Sbjct: 12 gcgcggcggcggcggcgagcgt 33
>dbj|AK123450.1| Homo sapiens cDNA FLJ41456 fis, clone BRSTN2012320 Length = 1704 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgagcg 100 |||||||||||||||||||||| Sbjct: 4 cgcgcggcggcggcggcgagcg 25
>gb|AC025781.8|AC025781 Arabidopsis thaliana chromosome 1 BAC F15C21 genomic sequence, complete sequence Length = 112862 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 194 agttaaagaacctcttaattgc 215 |||||||||||||||||||||| Sbjct: 70787 agttaaagaacctcttaattgc 70766
>gb|AC132936.9| Homo sapiens chromosome 11, clone RP13-569C6, complete sequence Length = 178778 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 80 gcgcggcggcggcggcgagcgt 101 |||||||||||||||||||||| Sbjct: 140561 gcgcggcggcggcggcgagcgt 140582
>dbj|AP006621.1| Homo sapiens genomic DNA, chromosome 11, clone:CMB9-55F22, complete sequence Length = 129989 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 80 gcgcggcggcggcggcgagcgt 101 |||||||||||||||||||||| Sbjct: 93134 gcgcggcggcggcggcgagcgt 93113
>gb|AY589291.1| Phalaris arundinacea thioredoxin-like protein (Trx) gene, partial sequence Length = 572 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 546 ggatttcagctcaacatgggac 567 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589290.1| Poa sieberiana voucher PI 263863 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 555 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 529 ggatttcagctcaacatgggac 550 Score = 40.1 bits (20), Expect = 9.1 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgacctaatgg 646 |||||||||||| |||||||||||||| |||| Sbjct: 1 ttcttgacaatt-gatgttgatgacctgatgg 31
>gb|AY589289.1| Poa nervosa voucher PI 236901 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 555 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 529 ggatttcagctcaacatgggac 550 Score = 40.1 bits (20), Expect = 9.1 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgacctaatgg 646 |||||||||||| |||||||||||||| |||| Sbjct: 1 ttcttgacaatt-gatgttgatgacctgatgg 31
>gb|AY589288.1| Poa iridifolia voucher PI 284254 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 555 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 529 ggatttcagctcaacatgggac 550 Score = 40.1 bits (20), Expect = 9.1 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgacctaatgg 646 |||||||||||| |||||||||||||| |||| Sbjct: 1 ttcttgacaatt-gatgttgatgacctgatgg 31
>gb|AY589287.1| Poa fendleriana clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 555 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 529 ggatttcagctcaacatgggac 550 Score = 40.1 bits (20), Expect = 9.1 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgacctaatgg 646 |||||||||||| |||||||||||||| |||| Sbjct: 1 ttcttgacaatt-gatgttgatgacctgatgg 31
>gb|AY589286.1| Poa arachnifera voucher W6 19191 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 554 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 528 ggatttcagctcaacatgggac 549 Score = 40.1 bits (20), Expect = 9.1 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgacctaatgg 646 |||||||||||| |||||||||||||| |||| Sbjct: 1 ttcttgacaatt-gatgttgatgacctgatgg 31
>gb|AY589285.1| Poa interior voucher PI 236909 clone 3 thioredoxin-like protein (Trx) gene, partial sequence Length = 538 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 512 ggatttcagctcaacatgggac 533 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589284.1| Poa secunda x Poa pratensis voucher PI 578818 clone 5 thioredoxin-like protein (Trx) gene, partial sequence Length = 564 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 538 ggatttcagctcaacatgggac 559
>gb|AY589283.1| Poa secunda x Poa pratensis voucher PI 578808 clone 6 thioredoxin-like protein (Trx) gene, partial sequence Length = 564 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 538 ggatttcagctcaacatgggac 559 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589282.1| Poa iberica voucher PI 325462 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 564 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 538 ggatttcagctcaacatgggac 559 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589281.1| Poa hybrida voucher PI 249765 thioredoxin-like protein (Trx) gene, partial sequence Length = 566 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 540 ggatttcagctcaacatgggac 561 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589280.1| Poa pratensis cultivar Kenblue clone 4 thioredoxin-like protein (Trx) gene, partial sequence Length = 563 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 537 ggatttcagctcaacatgggac 558 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589279.1| Poa pratensis cultivar Coventry clone 5 thioredoxin-like protein (Trx) gene, partial sequence Length = 563 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 537 ggatttcagctcaacatgggac 558 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589278.1| Poa arctica voucher PI 236901 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 563 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 537 ggatttcagctcaacatgggac 558 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589277.1| Poa secunda clone 4 thioredoxin-like protein (Trx) gene, partial sequence Length = 547 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 521 ggatttcagctcaacatgggac 542 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589276.1| Poa secunda x Poa pratensis voucher PI 578818 clone 4 thioredoxin-like protein (Trx) gene, partial sequence Length = 548 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 522 ggatttcagctcaacatgggac 543 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589275.1| Poa secunda voucher PI 578851 clone 3 thioredoxin-like protein (Trx) gene, partial sequence Length = 548 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 522 ggatttcagctcaacatgggac 543 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589273.1| Poa arida voucher PI 578806 clone 4 thioredoxin-like protein (Trx) gene, partial sequence Length = 545 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 519 ggatttcagctcaacatgggac 540
>gb|AY589272.1| Poa secunda x Poa pratensis voucher PI 578808 clone 5 thioredoxin-like protein (Trx) gene, partial sequence Length = 540 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 514 ggatttcagctcaacatgggac 535
>gb|AY589271.1| Poa annua clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 499 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 473 ggatttcagctcaacatgggac 494
>gb|AY589270.1| Poa annua clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 579 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 553 ggatttcagctcaacatgggac 574
>gb|AY589269.1| Poa supina thioredoxin-like protein (Trx) gene, partial sequence Length = 579 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 553 ggatttcagctcaacatgggac 574
>gb|AY589267.1| Poa bulbosa voucher PI 314304 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 562 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 536 ggatttcagctcaacatgggac 557
>gb|AY589266.1| Poa alpina voucher PI 372559 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 562 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 536 ggatttcagctcaacatgggac 557
>gb|AY589265.1| Poa trivialis voucher PI 204484 thioredoxin-like protein (Trx) gene, partial sequence Length = 586 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 560 ggatttcagctcaacatgggac 581 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589264.1| Poa secunda voucher PI 578851 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 571 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 545 ggatttcagctcaacatgggac 566 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589263.1| Poa pratensis cultivar Coventry clone 4 thioredoxin-like protein (Trx) gene, partial sequence Length = 571 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 545 ggatttcagctcaacatgggac 566 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589262.1| Poa secunda x Poa pratensis voucher PI 578818 clone 3 thioredoxin-like protein (Trx) gene, partial sequence Length = 571 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 545 ggatttcagctcaacatgggac 566 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589261.1| Poa pratensis cultivar Kenblue clone 3 thioredoxin-like protein (Trx) gene, partial sequence Length = 570 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 545 ggatttcagctcaacatgggac 566 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589260.1| Poa secunda clone 3 thioredoxin-like protein (Trx) gene, partial sequence Length = 643 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 617 ggatttcagctcaacatgggac 638 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589259.1| Poa arida voucher PI 578806 clone 3 thioredoxin-like protein (Trx) gene, partial sequence Length = 634 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 608 ggatttcagctcaacatgggac 629 Score = 40.1 bits (20), Expect = 9.1 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 615 ttcttgacaatttgatgttgatgaccta 642 |||||||||||| ||||||||||||||| Sbjct: 1 ttcttgacaatt-gatgttgatgaccta 27
>gb|AY589258.1| Poa alpina voucher PI 372559 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 599 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 573 ggatttcagctcaacatgggac 594
>gb|AY589257.1| Poa secunda x Poa pratensis voucher PI 578808 clone 4 thioredoxin-like protein (Trx) gene, partial sequence Length = 595 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 569 ggatttcagctcaacatgggac 590
>gb|AY589256.1| Poa sinaica voucher PI 206741 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 598 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 572 ggatttcagctcaacatgggac 593
>gb|AY589255.1| Poa sinaica voucher PI 206741 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 592 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 566 ggatttcagctcaacatgggac 587
>gb|AY589254.1| Poa ligulata voucher PI 517033 thioredoxin-like protein (Trx) gene, partial sequence Length = 538 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 512 ggatttcagctcaacatgggac 533
>gb|AY589253.1| Poa bulbosa voucher PI 314304 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 589 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 563 ggatttcagctcaacatgggac 584
>gb|AY589252.1| Poa pratensis cultivar Kenblue clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 672 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 646 ggatttcagctcaacatgggac 667
>gb|AY589251.1| Poa sieberiana voucher PI 263863 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 662 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 636 ggatttcagctcaacatgggac 657
>gb|AY589250.1| Poa pratensis cultivar Coventry clone 3 thioredoxin-like protein (Trx) gene, partial sequence Length = 652 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 626 ggatttcagctcaacatgggac 647
>gb|AY589249.1| Poa iridifolia voucher PI 284254 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 670 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 644 ggatttcagctcaacatgggac 665
>gb|AY589248.1| Poa arachnifera voucher W6 19191 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 667 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 641 ggatttcagctcaacatgggac 662
>gb|AY589247.1| Poa fendleriana clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 617 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 591 ggatttcagctcaacatgggac 612
>gb|AY589246.1| Poa nervosa voucher PI 236901 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 553 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 527 ggatttcagctcaacatgggac 548
>gb|AY589245.1| Poa secunda x Poa pratensis voucher PI 578808 clone 3 thioredoxin-like protein (Trx) gene, partial sequence Length = 671 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 645 ggatttcagctcaacatgggac 666
>gb|AY589244.1| Poa secunda x Poa pratensis voucher PI 578818 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 671 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 645 ggatttcagctcaacatgggac 666
>gb|AY589243.1| Poa pratensis cultivar Coventry clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 671 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 645 ggatttcagctcaacatgggac 666
>gb|AY589242.1| Poa interior voucher PI 236909 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 563 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 537 ggatttcagctcaacatgggac 558
>gb|AY589241.1| Poa compressa voucher PI 243216 clone 3 thioredoxin-like protein (Trx) gene, partial sequence Length = 563 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 537 ggatttcagctcaacatgggac 558
>gb|AY589240.1| Poa arida voucher PI 578806 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 564 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 538 ggatttcagctcaacatgggac 559
>gb|AY589239.1| Poa secunda x Poa pratensis voucher PI 578818 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 563 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 537 ggatttcagctcaacatgggac 558
>gb|AY589238.1| Poa pratensis cultivar Coventry clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 563 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 537 ggatttcagctcaacatgggac 558
>gb|AY589237.1| Poa pratensis cultivar Kenblue clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 563 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 537 ggatttcagctcaacatgggac 558
>gb|AY589236.1| Poa compressa voucher PI 243216 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 564 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 538 ggatttcagctcaacatgggac 559
>gb|AY589235.1| Poa secunda x Poa pratensis voucher PI 578808 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 564 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 538 ggatttcagctcaacatgggac 559
>gb|AY589234.1| Poa palustris voucher PI 232351 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 565 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 539 ggatttcagctcaacatgggac 560
>gb|AY589233.1| Poa nemoralis voucher PI 371759 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 564 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 538 ggatttcagctcaacatgggac 559
>gb|AY589232.1| Poa secunda clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 478 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 452 ggatttcagctcaacatgggac 473
>gb|AY589231.1| Poa arida voucher PI 578806 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 478 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 452 ggatttcagctcaacatgggac 473
>gb|AY589230.1| Poa secunda voucher PI 504370 clone 2 thioredoxin-like protein (Trx) gene, partial sequence Length = 478 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 452 ggatttcagctcaacatgggac 473
>gb|AY589229.1| Poa arctica voucher PI 236901 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 564 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 538 ggatttcagctcaacatgggac 559
>gb|AY589228.1| Poa compressa voucher PI 243216 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 531 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 505 ggatttcagctcaacatgggac 526
>gb|AY589227.1| Poa secunda voucher PI 578851 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 532 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 506 ggatttcagctcaacatgggac 527
>gb|AY589226.1| Poa palustris voucher PI 232351 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 535 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 509 ggatttcagctcaacatgggac 530
>gb|AY589225.1| Poa iberica voucher PI 325462 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 533 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 507 ggatttcagctcaacatgggac 528
>gb|AY589224.1| Poa nemoralis voucher PI 371759 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 533 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 507 ggatttcagctcaacatgggac 528
>gb|AY589223.1| Poa interior voucher PI 236909 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 531 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 505 ggatttcagctcaacatgggac 526
>gb|AY589222.1| Poa secunda x Poa pratensis voucher PI 578808 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 531 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 505 ggatttcagctcaacatgggac 526
>gb|AY589221.1| Poa secunda clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 531 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 505 ggatttcagctcaacatgggac 526
>gb|AY589220.1| Poa secunda voucher PI 504370 clone 1 thioredoxin-like protein (Trx) gene, partial sequence Length = 531 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Plus Query: 645 ggatttcagctcaacatgggac 666 |||||||||||||||||||||| Sbjct: 505 ggatttcagctcaacatgggac 526
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 44.1 bits (22), Expect = 0.58 Identities = 22/22 (100%) Strand = Plus / Minus Query: 11 aggctccccaggcccagcagca 32 |||||||||||||||||||||| Sbjct: 1574964 aggctccccaggcccagcagca 1574943
>ref|XM_467261.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1428 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 79 cgcgcggcggcggcggcgagc 99 ||||||||||||||||||||| Sbjct: 437 cgcgcggcggcggcggcgagc 417
>ref|XM_472653.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1752 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 80 gcgcggcggcggcggcgagcg 100 ||||||||||||||||||||| Sbjct: 349 gcgcggcggcggcggcgagcg 329
>ref|XM_850141.1| PREDICTED: Canis familiaris similar to transcriptional regulator interacting with the PHD-bromodomain 2 (LOC612407), mRNA Length = 1329 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 80 gcgcggcggcggcggcgagcg 100 ||||||||||||||||||||| Sbjct: 913 gcgcggcggcggcggcgagcg 893
>gb|AC103975.9| Homo sapiens chromosome 15, clone RP11-1001M11, complete sequence Length = 213676 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 326 cccaggccttcaggaatcagg 346 ||||||||||||||||||||| Sbjct: 71355 cccaggccttcaggaatcagg 71335
>gb|AC117502.4| Homo sapiens 12 BAC RP11-159A18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 104295 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 484 accagaagattgaagaagcaaacaaggat 512 |||||||| ||||||||||||| |||||| Sbjct: 78724 accagaagtttgaagaagcaaagaaggat 78752
>gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytansinoid antitumor agent ansamitocin biosynthetic gene cluster I, partial sequence Length = 82746 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 80 gcgcggcggcggcggcgagcg 100 ||||||||||||||||||||| Sbjct: 80024 gcgcggcggcggcggcgagcg 80044
>gb|AC022748.10| Homo sapiens chromosome 15, clone RP11-160C18, complete sequence Length = 163642 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 326 cccaggccttcaggaatcagg 346 ||||||||||||||||||||| Sbjct: 72065 cccaggccttcaggaatcagg 72085
>gb|AC019294.7| Homo sapiens chromosome , clone RP11-24M17, complete sequence Length = 164310 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 326 cccaggccttcaggaatcagg 346 ||||||||||||||||||||| Sbjct: 118059 cccaggccttcaggaatcagg 118079
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 aaccgcgcggcggcggcggcg 96 ||||||||||||||||||||| Sbjct: 26330533 aaccgcgcggcggcggcggcg 26330553 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 23074528 cgcggcggcggcggcgagcg 23074547
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 ccgcgcggcggcggcggcgag 98 ||||||||||||||||||||| Sbjct: 22183262 ccgcgcggcggcggcggcgag 22183282 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 25883710 gcggcggcggcggcgagcgt 25883729 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 20566007 cgcggcggcggcggcgagcg 20565988 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 8627472 gcggcggcggcggcgagcgt 8627491 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 4219939 gcggcggcggcggcgagcgt 4219920
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgagc 99 ||||||||||||||||||||| Sbjct: 28532047 cgcgcggcggcggcggcgagc 28532067 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgagc 99 ||||||||||||||||||||| Sbjct: 2761181 cgcgcggcggcggcggcgagc 2761201 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 33487772 gcggcggcggcggcgagcgt 33487791 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 24965060 cgcggcggcggcggcgagcg 24965079 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 22362813 gcggcggcggcggcgagcgt 22362832 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 ccgcgcggcggcggcggcga 97 |||||||||||||||||||| Sbjct: 8404733 ccgcgcggcggcggcggcga 8404714 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 7097438 cgcggcggcggcggcgagcg 7097457 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 4796606 cgcggcggcggcggcgagcg 4796587 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 2041473 gcggcggcggcggcgagcgt 2041454 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 1726945 cgcgcggcggcggcggcgag 1726964
>gb|AC010931.17| Homo sapiens chromosome 15, clone RP11-247C2, complete sequence Length = 93600 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 326 cccaggccttcaggaatcagg 346 ||||||||||||||||||||| Sbjct: 65574 cccaggccttcaggaatcagg 65554
>gb|AC068338.14| Homo sapiens chromosome 15, clone RP11-817O13, complete sequence Length = 174192 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 326 cccaggccttcaggaatcagg 346 ||||||||||||||||||||| Sbjct: 46666 cccaggccttcaggaatcagg 46686
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 80 gcgcggcggcggcggcgagcg 100 ||||||||||||||||||||| Sbjct: 4551690 gcgcggcggcggcggcgagcg 4551670 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgagc 99 ||||||||||||||||||||| Sbjct: 2833000 cgcgcggcggcggcggcgagc 2833020 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 1597883 cgcggcggcggcggcgagcg 1597902 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 798223 cgcgcggcggcggcggcgag 798204
>gb|AC104758.12| Homo sapiens chromosome 15, clone RP11-114H24, complete sequence Length = 175763 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 326 cccaggccttcaggaatcagg 346 ||||||||||||||||||||| Sbjct: 97374 cccaggccttcaggaatcagg 97394
>gb|AC105137.17| Homo sapiens chromosome 15, clone CTD-2562G15, complete sequence Length = 178059 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 326 cccaggccttcaggaatcagg 346 ||||||||||||||||||||| Sbjct: 25712 cccaggccttcaggaatcagg 25692
>dbj|AP004786.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0017H11 Length = 158374 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgagc 99 ||||||||||||||||||||| Sbjct: 100888 cgcgcggcggcggcggcgagc 100908
>dbj|AP005412.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0050G13 Length = 150685 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgagc 99 ||||||||||||||||||||| Sbjct: 29409 cgcgcggcggcggcggcgagc 29429
>dbj|AP003871.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1117_F10 Length = 169948 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 ccgcgcggcggcggcggcgag 98 ||||||||||||||||||||| Sbjct: 146225 ccgcgcggcggcggcggcgag 146245
>gb|DQ149153.1| Cercopithecine herpesvirus 16 strain X313, complete genome Length = 156487 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 80 gcgcggcggcggcggcgagcg 100 ||||||||||||||||||||| Sbjct: 105830 gcgcggcggcggcggcgagcg 105810
>dbj|AP002376.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-349I16, complete sequence Length = 161406 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 79 cgcgcggcggcggcggcgagc 99 ||||||||||||||||||||| Sbjct: 112956 cgcgcggcggcggcggcgagc 112936
>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence Length = 3809201 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 80 gcgcggcggcggcggcgagcg 100 ||||||||||||||||||||| Sbjct: 3264964 gcgcggcggcggcggcgagcg 3264944 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 gcgcggcggcggcggcgagc 99 |||||||||||||||||||| Sbjct: 2754307 gcgcggcggcggcggcgagc 2754326
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 aaccgcgcggcggcggcggcg 96 ||||||||||||||||||||| Sbjct: 26258701 aaccgcgcggcggcggcggcg 26258721 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 23002719 cgcggcggcggcggcgagcg 23002738
>gb|AC163711.3| Gallus gallus BAC clone CH261-27J21 from chromosome ul, complete sequence Length = 232951 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 417 attgtggaagaaaagcttgatttcaaagg 445 ||||| |||||||| |||||||||||||| Sbjct: 174528 attgttgaagaaaatcttgatttcaaagg 174556
>emb|AL731593.2|OSJN00235 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0027P08, complete sequence Length = 118959 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 80 gcgcggcggcggcggcgagcg 100 ||||||||||||||||||||| Sbjct: 87369 gcgcggcggcggcggcgagcg 87389
>emb|AL731885.4|CNS08C8P Oryza sativa chromosome 12, . BAC OSJNBb0016A10 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 133978 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 aaccgcgcggcggcggcggcg 96 ||||||||||||||||||||| Sbjct: 94517 aaccgcgcggcggcggcggcg 94537
>emb|AL845347.4|CNS08CB9 Oryza sativa chromosome 12, . BAC OSJNBb0101I10 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 131689 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 aaccgcgcggcggcggcggcg 96 ||||||||||||||||||||| Sbjct: 44805 aaccgcgcggcggcggcggcg 44825
>ref|NM_119486.1| Arabidopsis thaliana unknown protein AT4G33320 mRNA, complete cds Length = 879 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 486 cagaagattgaagaagcaaacaag 509 ||||||||||| |||||||||||| Sbjct: 361 cagaagattgaggaagcaaacaag 384
>ref|XM_483372.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2037 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 790 gcggcggcggcggcgagcgt 809
>ref|XM_483371.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1601 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 1459 gcggcggcggcggcgagcgt 1478
>ref|XM_480304.1| Oryza sativa (japonica cultivar-group), mRNA Length = 495 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 96 gcggcggcggcggcgagcgt 77
>ref|XM_475946.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 894 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 accgcgcggcggcggcggcg 96 |||||||||||||||||||| Sbjct: 794 accgcgcggcggcggcggcg 813
>ref|XM_469086.1| Oryza sativa (japonica cultivar-group), mRNA Length = 810 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 239 cgcgcggcggcggcggcgag 258
>ref|XM_468176.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3248 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 144 gcggcggcggcggcgagcgt 163
>ref|XM_506873.1| PREDICTED Oryza sativa (japonica cultivar-group), B1215B07.34 mRNA Length = 1334 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 83 cgcggcggcggcggcgagcg 64
>ref|XM_466836.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1334 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 83 cgcggcggcggcggcgagcg 64
>ref|XM_464749.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2148 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 876 cgcggcggcggcggcgagcg 895
>ref|XM_464826.1| Oryza sativa (japonica cultivar-group), mRNA Length = 588 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 ccgcgcggcggcggcggcga 97 |||||||||||||||||||| Sbjct: 334 ccgcgcggcggcggcggcga 353
>ref|XM_464373.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1620 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 528 cgcggcggcggcggcgagcg 509
>ref|XM_464074.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2103 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 104 gcggcggcggcggcgagcgt 85
>ref|NM_196669.1| Oryza sativa (japonica cultivar-group) putative nucleolar protein (OSJNBb0040I11.5), mRNA Length = 2658 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 98 cgcgcggcggcggcggcgag 79
>ref|NM_191464.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 972 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 591 cgcggcggcggcggcgagcg 572
>ref|NM_192112.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1284 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 612 cgcggcggcggcggcgagcg 593
>ref|XM_477206.1| Oryza sativa (japonica cultivar-group), mRNA Length = 972 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 accgcgcggcggcggcggcg 96 |||||||||||||||||||| Sbjct: 400 accgcgcggcggcggcggcg 381
>gb|AC099404.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone OSJNBa0019D02, complete sequence Length = 154692 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 150029 gcggcggcggcggcgagcgt 150048
>gb|AC108763.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone OSJNBb0004A05, complete sequence Length = 157913 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 34703 gcggcggcggcggcgagcgt 34722
>gb|AC137618.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0090H02, complete sequence Length = 135231 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 116210 cgcggcggcggcggcgagcg 116229
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 ccgcgcggcggcggcggcga 97 |||||||||||||||||||| Sbjct: 1574095 ccgcgcggcggcggcggcga 1574114
>gb|AC104709.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03, complete sequence Length = 144601 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 80866 cgcggcggcggcggcgagcg 80847
>gb|AC098573.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1651_G11, complete sequence Length = 112796 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 accgcgcggcggcggcggcg 96 |||||||||||||||||||| Sbjct: 56246 accgcgcggcggcggcggcg 56227
>ref|NM_031997.3| Mus musculus transmembrane protein 2 (Tmem2), transcript variant 1, mRNA Length = 6667 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 attcccctcctcttcctccg 67 |||||||||||||||||||| Sbjct: 163 attcccctcctcttcctccg 182
>ref|NM_001033759.1| Mus musculus transmembrane protein 2 (Tmem2), transcript variant 2, mRNA Length = 6585 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 attcccctcctcttcctccg 67 |||||||||||||||||||| Sbjct: 163 attcccctcctcttcctccg 182
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 665380 cgcgcggcggcggcggcgag 665399
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 ccgcgcggcggcggcggcga 97 |||||||||||||||||||| Sbjct: 2810896 ccgcgcggcggcggcggcga 2810915
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07, complete sequence Length = 159932 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 18665 cgcggcggcggcggcgagcg 18684
>gb|BC067327.1| Xenopus tropicalis nucleoporin 93kDa, mRNA (cDNA clone MGC:76268 IMAGE:5379233), complete cds Length = 2592 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 ccgatcccaggccttcagga 340 |||||||||||||||||||| Sbjct: 934 ccgatcccaggccttcagga 953
>gb|AC165962.4| Mus musculus BAC clone RP23-362B7 from chromosome 17, complete sequence Length = 179745 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 384 ggcatggggggctgtgtggg 403 |||||||||||||||||||| Sbjct: 58900 ggcatggggggctgtgtggg 58919
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome Length = 3402093 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 ccgcgcggcggcggcggcga 97 |||||||||||||||||||| Sbjct: 48853 ccgcgcggcggcggcggcga 48834
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 25378765 cgcgcggcggcggcggcgag 25378784 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 11587343 cgcggcggcggcggcgagcg 11587324 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 10054872 cgcgcggcggcggcggcgag 10054891 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 5411968 gcggcggcggcggcgagcgt 5411949
>gb|AC113483.7| Mus musculus chromosome 1, clone RP23-343E12, complete sequence Length = 207188 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 485 ccagaagattgaagaagcaaacaa 508 ||||||| |||||||||||||||| Sbjct: 142818 ccagaagcttgaagaagcaaacaa 142795
>emb|CR940310.6| M.truncatula DNA sequence from clone MTH2-5D8 on chromosome 3, complete sequence Length = 121689 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 612 atgttcttgacaatttgatg 631 |||||||||||||||||||| Sbjct: 47089 atgttcttgacaatttgatg 47108
>gb|AC125544.4| Mus musculus BAC clone RP23-364A24 from chromosome 17, complete sequence Length = 159298 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 384 ggcatggggggctgtgtggg 403 |||||||||||||||||||| Sbjct: 66345 ggcatggggggctgtgtggg 66326
>gb|AC122496.2| Mus musculus BAC clone RP24-400K16 from 5, complete sequence Length = 180081 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 cattcccctcctcttcctcc 66 |||||||||||||||||||| Sbjct: 130263 cattcccctcctcttcctcc 130244
>gb|AC118681.6| Mus musculus chromosome 16, clone RP23-473M11, complete sequence Length = 279112 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 338 ggaatcagggggcctttcat 357 |||||||||||||||||||| Sbjct: 119008 ggaatcagggggcctttcat 119027
>gb|AC137075.2| Genomic sequence for Oryza sativa, Nipponbare striain, clone OSJNBb0027B12, from chromosome 3, complete sequence Length = 127426 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 104788 cgcgcggcggcggcggcgag 104807
>gb|AC146702.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0009J13, from chromosome 3, complete sequence Length = 147205 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 118136 gcggcggcggcggcgagcgt 118117
>ref|XM_503622.1| Yarrowia lipolytica CLIB122, YALI0E06347g predicted mRNA Length = 1314 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 10 gaggctccccaggcccagcagcaa 33 |||||||||||||| ||||||||| Sbjct: 778 gaggctccccaggctcagcagcaa 801
>gb|AC133859.4| Oryza sativa chromosome 3 BAC OSJNBa0075A22 genomic sequence, complete sequence Length = 152828 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 64595 cgcgcggcggcggcggcgag 64576
>emb|BX957220.1| Methanococcus maripaludis S2 complete genome; segment 2/5 Length = 349648 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 506 caaggatgggaaaattgttg 525 |||||||||||||||||||| Sbjct: 167296 caaggatgggaaaattgttg 167315
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 1984456 cgcgcggcggcggcggcgag 1984475
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 ccgcgcggcggcggcggcga 97 |||||||||||||||||||| Sbjct: 2551129 ccgcgcggcggcggcggcga 2551148
>ref|NM_213714.1| Xenopus tropicalis nucleoporin 93kDa (nup93), mRNA Length = 2592 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 ccgatcccaggccttcagga 340 |||||||||||||||||||| Sbjct: 934 ccgatcccaggccttcagga 953
>emb|AL161583.2|ATCHRIV79 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 79 Length = 199536 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 486 cagaagattgaagaagcaaacaag 509 ||||||||||| |||||||||||| Sbjct: 85646 cagaagattgaggaagcaaacaag 85623
>emb|AL035678.1|ATF17M5 Arabidopsis thaliana DNA chromosome 4, BAC clone F17M5 (ESSA project) Length = 96475 Score = 40.1 bits (20), Expect = 9.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 486 cagaagattgaagaagcaaacaag 509 ||||||||||| |||||||||||| Sbjct: 20867 cagaagattgaggaagcaaacaag 20844
>gb|AC048351.18| Homo sapiens 3 BAC RP11-175P19 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 161687 Score = 40.1 bits (20), Expect = 9.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 484 accagaagattgaagaagcaaacaagga 511 |||||||||| ||| ||||||||||||| Sbjct: 67881 accagaagatggaataagcaaacaagga 67854
>gb|AC006518.17| Homo sapiens 12 BAC RPCI11-144O23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 173735 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 623 aatttgatgttgatgaccta 642 |||||||||||||||||||| Sbjct: 125010 aatttgatgttgatgaccta 124991
>gb|AC005908.1| Homo sapiens 12p13.3 BAC RPCI11-476M19 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 196501 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 cattcccctcctcttcctcc 66 |||||||||||||||||||| Sbjct: 18577 cattcccctcctcttcctcc 18596
>dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0497A05 Length = 130919 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 56286 gcggcggcggcggcgagcgt 56267
>dbj|AB232384.1| Oryza sativa (japonica cultivar-group) OsFAD7-1 gene for plastid omega-3 fatty acid desaturase, complete cds Length = 5636 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 2448 cgcgcggcggcggcggcgag 2429
>dbj|AB232382.1| Oryza sativa (japonica cultivar-group) OsFAD7-1 mRNA for plastid omega-3 fatty acid desaturase, complete cds Length = 1755 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 568 cgcgcggcggcggcggcgag 549
>gb|AC138582.22| Pan troglodytes clone rp43-21p1, complete sequence Length = 119613 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 ccgcgcggcggcggcggcga 97 |||||||||||||||||||| Sbjct: 112624 ccgcgcggcggcggcggcga 112605
>gb|AC123568.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1345H02, from chromosome 3, complete sequence Length = 145290 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 8562 gcggcggcggcggcgagcgt 8543
>dbj|AK024231.1| Homo sapiens cDNA FLJ14169 fis, clone NT2RP2002056 Length = 2616 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 aaaaaagcaagccattcccc 54 |||||||||||||||||||| Sbjct: 513 aaaaaagcaagccattcccc 494
>gb|AC119748.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0042L15, from chromosome 3, complete sequence Length = 172475 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 137915 cgcggcggcggcggcgagcg 137896
>dbj|AB239805.1| Oryza sativa (japonica cultivar-group) OsIPT8 gene for adenylate isopentenyltransferase, complete cds Length = 1011 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 339 cgcggcggcggcggcgagcg 320
>gb|AC095064.3| Homo sapiens BAC clone RP11-620C21 from 4, complete sequence Length = 87943 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 attcccctcctcttcctccg 67 |||||||||||||||||||| Sbjct: 33433 attcccctcctcttcctccg 33414
>dbj|AK149803.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:G530019I12 product:similar to Transmembrane protein 2 [Homo sapiens], full insert sequence Length = 1202 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 attcccctcctcttcctccg 67 |||||||||||||||||||| Sbjct: 119 attcccctcctcttcctccg 138
>dbj|AK149667.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:G530008N16 product:similar to Transmembrane protein 2 [Homo sapiens], full insert sequence Length = 1097 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 attcccctcctcttcctccg 67 |||||||||||||||||||| Sbjct: 138 attcccctcctcttcctccg 157
>gb|AC092445.4| Homo sapiens BAC clone RP11-676H8 from 4, complete sequence Length = 173840 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 cagcagcaataaaaaagcaa 44 |||||||||||||||||||| Sbjct: 18984 cagcagcaataaaaaagcaa 18965
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 aaccgcgcggcggcggcggc 95 |||||||||||||||||||| Sbjct: 4674976 aaccgcgcggcggcggcggc 4674957
>gb|AC137634.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0078C05, complete sequence Length = 122116 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 493 cgcgcggcggcggcggcgag 512
>gb|AC134527.5| Mus musculus BAC clone RP24-502D8 from chromosome 8, complete sequence Length = 150065 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 cattcccctcctcttcctcc 66 |||||||||||||||||||| Sbjct: 63967 cattcccctcctcttcctcc 63986
>gb|AY224510.1| Oryza sativa (japonica cultivar-group) isolate 23502 adenosine kinase-like protein mRNA, partial cds Length = 1113 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 62 cgcggcggcggcggcgagcg 43
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 gcgcggcggcggcggcgagc 99 |||||||||||||||||||| Sbjct: 63516 gcgcggcggcggcggcgagc 63535
>gb|AY224189.1| Medicago truncatula adenosylhomocysteinase (AHC2) gene, complete cds Length = 68460 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 612 atgttcttgacaatttgatg 631 |||||||||||||||||||| Sbjct: 54054 atgttcttgacaatttgatg 54073
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 817395 cgcgcggcggcggcggcgag 817376
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 358465 cgcggcggcggcggcgagcg 358446
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 15130100 cgcgcggcggcggcggcgag 15130119
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 19104744 gcggcggcggcggcgagcgt 19104763
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 accgcgcggcggcggcggcg 96 |||||||||||||||||||| Sbjct: 7666509 accgcgcggcggcggcggcg 7666528
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 25470074 cgcgcggcggcggcggcgag 25470093 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 11584106 cgcggcggcggcggcgagcg 11584087 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 10052993 cgcgcggcggcggcggcgag 10053012 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 5411183 gcggcggcggcggcgagcgt 5411164
>gb|AC087547.2|AC087547 Oryza sativa (japonica cultivar-group) chromosome 10 clone nbeb0040I11, complete sequence Length = 129420 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 38713 cgcgcggcggcggcggcgag 38732
>gb|AC104429.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0006P09, complete sequence Length = 153950 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 141612 gcggcggcggcggcgagcgt 141593
>dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1417F08 Length = 155536 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 76858 gcggcggcggcggcgagcgt 76839
>dbj|AP003455.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0519D04 Length = 193068 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 112379 cgcggcggcggcggcgagcg 112360
>dbj|AP006161.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1267B06 Length = 156989 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 121457 gcggcggcggcggcgagcgt 121476
>dbj|AP005606.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1590_E05 Length = 148205 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 119562 gcggcggcggcggcgagcgt 119543
>dbj|AP003999.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1115_A05 Length = 113326 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 19032 gcggcggcggcggcgagcgt 19051
>dbj|AP005003.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0495C02 Length = 151467 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 100857 cgcggcggcggcggcgagcg 100876
>dbj|AP004000.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1115_B01 Length = 129329 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 77196 cgcggcggcggcggcgagcg 77177
>dbj|AP003990.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1073_F05 Length = 124252 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 38765 cgcggcggcggcggcgagcg 38746
>dbj|AP003344.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0413G02 Length = 155633 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 46100 cgcggcggcggcggcgagcg 46081
>dbj|AP002869.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0554D10 Length = 158723 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 accgcgcggcggcggcggcg 96 |||||||||||||||||||| Sbjct: 51894 accgcgcggcggcggcggcg 51913
>dbj|AP004997.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0030G11 Length = 143943 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 44957 cgcgcggcggcggcggcgag 44976
>dbj|AP005509.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1003_A09 Length = 150755 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 69497 gcggcggcggcggcgagcgt 69516
>dbj|AP005249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0087F21 Length = 187401 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 139383 gcggcggcggcggcgagcgt 139402
>dbj|AP005194.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0565A07 Length = 152191 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 accgcgcggcggcggcggcg 96 |||||||||||||||||||| Sbjct: 10598 accgcgcggcggcggcggcg 10617
>dbj|AP006523.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1215B07 Length = 165957 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 126343 cgcggcggcggcggcgagcg 126362
>dbj|AP005535.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0054K20 Length = 153584 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 62647 gcggcggcggcggcgagcgt 62666
>dbj|AP005511.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0011N12 Length = 158586 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 ccgcgcggcggcggcggcga 97 |||||||||||||||||||| Sbjct: 57583 ccgcgcggcggcggcggcga 57564
>dbj|AB028608.1| Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K20I9 Length = 43500 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 454 tgcatgtcataacaaccaaa 473 |||||||||||||||||||| Sbjct: 43386 tgcatgtcataacaaccaaa 43367
>dbj|AB016471.1| Arabidopsis thaliana gene for ARR1 protein, complete cds Length = 3093 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 454 tgcatgtcataacaaccaaa 473 |||||||||||||||||||| Sbjct: 925 tgcatgtcataacaaccaaa 906
>dbj|AP005647.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0026E05 Length = 159860 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 91681 gcggcggcggcggcgagcgt 91662
>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0032E15 Length = 120419 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 69968 cgcggcggcggcggcgagcg 69949
>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1663_D06 Length = 139103 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 40379 cgcggcggcggcggcgagcg 40360
>dbj|AK110223.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-162-E03, full insert sequence Length = 2451 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 accgcgcggcggcggcggcg 96 |||||||||||||||||||| Sbjct: 243 accgcgcggcggcggcggcg 262
>dbj|AK109643.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-G09, full insert sequence Length = 1938 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 152 cgcggcggcggcggcgagcg 133
>dbj|AK108334.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-142-A04, full insert sequence Length = 933 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 208 cgcggcggcggcggcgagcg 189
>gb|AC007993.15|AC007993 Homo sapiens chromosome 17, clone RP11-527L4, complete sequence Length = 141704 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 aaaaaagcaagccattcccc 54 |||||||||||||||||||| Sbjct: 54867 aaaaaagcaagccattcccc 54886
>dbj|AK103053.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033117I07, full insert sequence Length = 1113 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 82 gcggcggcggcggcgagcgt 63
>dbj|AK101791.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033065J11, full insert sequence Length = 1334 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 83 cgcggcggcggcggcgagcg 64
>dbj|AK071978.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013088I16, full insert sequence Length = 3248 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 143 gcggcggcggcggcgagcgt 162
>dbj|AK071172.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023081A12, full insert sequence Length = 1508 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 989 cgcggcggcggcggcgagcg 970
>dbj|AK070370.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023049F22, full insert sequence Length = 1881 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 504 gcggcggcggcggcgagcgt 523
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 aaccgcgcggcggcggcggc 95 |||||||||||||||||||| Sbjct: 1960289 aaccgcgcggcggcggcggc 1960308
>dbj|AK066936.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091N21, full insert sequence Length = 3663 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 79 cgcgcggcggcggcggcgag 98 |||||||||||||||||||| Sbjct: 178 cgcgcggcggcggcggcgag 159
>dbj|AK060618.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-026-C02, full insert sequence Length = 2037 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 790 gcggcggcggcggcgagcgt 809
>dbj|AK060548.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-H04, full insert sequence Length = 1601 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 gcggcggcggcggcgagcgt 101 |||||||||||||||||||| Sbjct: 1459 gcggcggcggcggcgagcgt 1478
>dbj|AK059771.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-H06, full insert sequence Length = 1335 Score = 40.1 bits (20), Expect = 9.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 cgcggcggcggcggcgagcg 100 |||||||||||||||||||| Sbjct: 84 cgcggcggcggcggcgagcg 65 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,404,630 Number of Sequences: 3902068 Number of extensions: 6404630 Number of successful extensions: 351269 Number of sequences better than 10.0: 261 Number of HSP's better than 10.0 without gapping: 281 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 327808 Number of HSP's gapped (non-prelim): 23436 length of query: 666 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 643 effective length of database: 17,143,297,704 effective search space: 11023140423672 effective search space used: 11023140423672 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)