>emb|X52255.1|HSCST3G Human CST3 gene for cystatin C
          Length = 7292

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 235 aggagtggaggagggagatg 254
           ||||||||||||||||||||
Sbjct: 419 aggagtggaggagggagatg 438

>ref|NG_000839.1| Homo sapiens cystatin locus (CST@) on chromosome 20
          Length = 477159

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 235    aggagtggaggagggagatg 254
              ||||||||||||||||||||
Sbjct: 277917 aggagtggaggagggagatg 277936

>ref|XM_849502.1| PREDICTED: Canis familiaris similar to S-adenosylhomocysteine
           hydrolase-like 1 (LOC611790), mRNA
          Length = 3920

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 236 ggagtggaggagggagatgt 255
           ||||||||||||||||||||
Sbjct: 26  ggagtggaggagggagatgt 45

>emb|AL121894.26|HSA218C14 Human DNA sequence from clone RP11-218C14 on chromosome 20 Contains the
              3' end of a novel gene, two genes for novel proteins
              similar to cystatin 9-like (mouse) (CST9L), the CST9L gene
              for cystatin 9-like (mouse), a cystatin 9-like (mouse)
              pseudogene, the CST3 gene for cystatin C, a novel gene and
              a CpG island, complete sequence
          Length = 141079

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 235    aggagtggaggagggagatg 254
              ||||||||||||||||||||
Sbjct: 108099 aggagtggaggagggagatg 108080

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 382      tttggccttgattgatcgtc 401
                ||||||||||||||||||||
Sbjct: 25121953 tttggccttgattgatcgtc 25121972

>gb|DQ163912.1| Bacteriophage F10, complete genome
          Length = 39199

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 289   cggagacctaccgggacgag 308
             ||||||||||||||||||||
Sbjct: 14439 cggagacctaccgggacgag 14458

>dbj|AP007205.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0048L03
          Length = 142377

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 382   tttggccttgattgatcgtc 401
             ||||||||||||||||||||
Sbjct: 68139 tttggccttgattgatcgtc 68158

>emb|X61681.1|HSCYSTC1 Homo sapiens partial gene for cystatin C, exon 1 and joined CDS
          Length = 1662

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 235 aggagtggaggagggagatg 254
           ||||||||||||||||||||
Sbjct: 255 aggagtggaggagggagatg 274


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,121,294
Number of Sequences: 3902068
Number of extensions: 2121294
Number of successful extensions: 36751
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36723
Number of HSP's gapped (non-prelim): 28
length of query: 415
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 393
effective length of database: 17,147,199,772
effective search space: 6738849510396
effective search space used: 6738849510396
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)