>gb|DQ163912.1| Bacteriophage F10, complete genome
          Length = 39199

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 361   tccggagacctaccgggacgag 382
             ||||||||||||||||||||||
Sbjct: 14437 tccggagacctaccgggacgag 14458

>gb|DQ386648.1| Astatotilapia burtoni clone BAC 26M7 platelet-derived growth factor
             receptor beta a (pdgfrba) and colony-stimulating factor 1
             receptor a (csf1ra) genes, complete cds
          Length = 97628

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 40    tccaaaggctgctcctcaactctcc 64
             ||||||||||||||||||| |||||
Sbjct: 87126 tccaaaggctgctcctcaagtctcc 87102

>emb|X52255.1|HSCST3G Human CST3 gene for cystatin C
          Length = 7292

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 309 aggagtggaggagggagatg 328
           ||||||||||||||||||||
Sbjct: 419 aggagtggaggagggagatg 438

>ref|NG_000839.1| Homo sapiens cystatin locus (CST@) on chromosome 20
          Length = 477159

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 309    aggagtggaggagggagatg 328
              ||||||||||||||||||||
Sbjct: 277917 aggagtggaggagggagatg 277936

>ref|XM_849502.1| PREDICTED: Canis familiaris similar to S-adenosylhomocysteine
           hydrolase-like 1 (LOC611790), mRNA
          Length = 3920

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 310 ggagtggaggagggagatgt 329
           ||||||||||||||||||||
Sbjct: 26  ggagtggaggagggagatgt 45

>emb|AL121894.26|HSA218C14 Human DNA sequence from clone RP11-218C14 on chromosome 20 Contains the
              3' end of a novel gene, two genes for novel proteins
              similar to cystatin 9-like (mouse) (CST9L), the CST9L gene
              for cystatin 9-like (mouse), a cystatin 9-like (mouse)
              pseudogene, the CST3 gene for cystatin C, a novel gene and
              a CpG island, complete sequence
          Length = 141079

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 309    aggagtggaggagggagatg 328
              ||||||||||||||||||||
Sbjct: 108099 aggagtggaggagggagatg 108080

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 456      tttggccttgattgatcgtc 475
                ||||||||||||||||||||
Sbjct: 25121953 tttggccttgattgatcgtc 25121972

>dbj|AP007205.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0048L03
          Length = 142377

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 456   tttggccttgattgatcgtc 475
             ||||||||||||||||||||
Sbjct: 68139 tttggccttgattgatcgtc 68158

>emb|X61681.1|HSCYSTC1 Homo sapiens partial gene for cystatin C, exon 1 and joined CDS
          Length = 1662

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 309 aggagtggaggagggagatg 328
           ||||||||||||||||||||
Sbjct: 255 aggagtggaggagggagatg 274

>gb|AC132312.4| Mus musculus BAC clone RP24-298A20 from 12, complete sequence
          Length = 177464

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 373    ccgggacgagtgggatggtggtga 396
              |||||| |||||||||||||||||
Sbjct: 171836 ccgggaagagtgggatggtggtga 171813

>gb|AC132354.2| Mus musculus BAC clone RP24-112H7 from 12, complete sequence
          Length = 180298

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 373   ccgggacgagtgggatggtggtga 396
             |||||| |||||||||||||||||
Sbjct: 68566 ccgggaagagtgggatggtggtga 68543

>emb|AL732485.8| Mouse DNA sequence from clone RP23-70G24 on chromosome 2, complete
             sequence
          Length = 92562

 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 510   agtggaacggaggttgagga 529
             ||||||||||||||||||||
Sbjct: 26293 agtggaacggaggttgagga 26274


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,015,127
Number of Sequences: 3902068
Number of extensions: 4015127
Number of successful extensions: 65403
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65357
Number of HSP's gapped (non-prelim): 46
length of query: 628
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 605
effective length of database: 17,143,297,704
effective search space: 10371695110920
effective search space used: 10371695110920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)