ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd26g22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 617 e-173
2emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 484 e-133
3emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 444 e-122
4gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 159 8e-36
5gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 139 7e-30
6gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 139 7e-30
7emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 90 6e-15
8emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 66 9e-08
9emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 66 9e-08
10gb|AF126290.1|AF126290 Sphagnum palustre 18S ribosomal RNA gene,... 66 9e-08
11gb|AF104340.1|AF104340 Chorioactis geaster 18S ribosomal RNA gen... 66 9e-08
12gb|U63471.1|TLU63471 Trichaptum laricinum 18S ribosomal RNA gene... 66 9e-08
13gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 66 9e-08
14emb|AJ242436.1|CMI242436 Cordyceps militaris partial 18S rRNA ge... 62 1e-06
15emb|AJ242435.1|CMI242435 Cordyceps militaris partial 18S rRNA ge... 62 1e-06
16gb|AF007540.1|AF007540 Smittium culisetae 18S ribosomal RNA gene... 62 1e-06
17gb|AY773775.1| Uncultured soil ascomycete isolate Soil.14.14 18S... 60 5e-06
18gb|AY497574.1| Liagora valida small subunit ribosomal RNA gene, ... 58 2e-05
19gb|AF535029.1| Attacus ricini 18S ribosomal RNA gene, complete s... 58 2e-05
20emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 58 2e-05
21gb|AF463459.1| Attacus ricini ribosomal DNA repeat unit, complet... 58 2e-05
22dbj|AK095100.1| Homo sapiens cDNA FLJ37781 fis, clone BRHIP2027054 58 2e-05
23gb|AC092834.3| Homo sapiens BAC clone RP13-497K6 from 4, complet... 58 2e-05
24emb|V01335.1|SCRNA5 Yeast 18S ribosomal RNA 58 2e-05
25gb|J01353.1|YSCRGEA Yeast (S.cerevisiae) 18S ribosomal RNA gene 58 2e-05
26emb|AJ242434.1|PNI242434 Phytocordyceps ninchukispora partial 18... 58 2e-05
27dbj|AB061218.1| Placidia cafeteriopsis gene for 18S ribosomal RN... 58 2e-05
28gb|AY818951.1| Plantago rugelii 18S ribosomal RNA (rrn18) gene, ... 56 8e-05
29gb|AY850007.1| Cerrena unicolor 18S ribosomal RNA gene, partial ... 56 8e-05
30gb|AY856456.1| Uncultured Glomus isolate 3 18S ribosomal RNA gen... 56 8e-05
31gb|AY856455.1| Uncultured Glomus isolate 2 18S ribosomal RNA gen... 56 8e-05
32gb|AY654887.1| Fibulorhizoctonia sp. LA082103L 18S ribosomal RNA... 56 8e-05
33gb|AY692319.1| Amphibiocystidium ranae strain 2-04 18S ribosomal... 56 8e-05
34gb|AY550245.1| Amphibiocystidium ranae 18S ribosomal RNA gene, i... 56 8e-05
35gb|AY572312.1| Aristolochia grandiflora 18S ribosomal RNA gene, ... 56 8e-05
36gb|AY572311.1| Cinnamosma madagascariensis 18S ribosomal RNA gen... 56 8e-05
37gb|AY572310.1| Pseudowintera axillaris 18S ribosomal RNA gene, p... 56 8e-05
38gb|AY572309.1| Gymnotheca involucrata 18S ribosomal RNA gene, pa... 56 8e-05
39gb|AY572308.1| Gymnotheca chinensis 18S ribosomal RNA gene, part... 56 8e-05
40gb|AY572307.1| Drimys winteri 18S ribosomal RNA gene, partial se... 56 8e-05
41gb|AY572306.1| Aristolochia gigantea 18S ribosomal RNA gene, par... 56 8e-05
42gb|AY572305.1| Houttuynia cordata 18S ribosomal RNA gene, partia... 56 8e-05
43gb|AY572304.1| Anemopsis californica 18S ribosomal RNA gene, par... 56 8e-05
44gb|AY572303.1| Saururus chinensis 18S ribosomal RNA gene, partia... 56 8e-05
45gb|AY572301.1| Sarcorhachis sydowii 18S ribosomal RNA gene, part... 56 8e-05
46gb|AY572300.1| Zippelia begoniifolia 18S ribosomal RNA gene, par... 56 8e-05
47gb|AY572299.1| Piper arborescens 18S ribosomal RNA gene, partial... 56 8e-05
48gb|AY572298.1| Piper aduncum 18S ribosomal RNA gene, partial seq... 56 8e-05
49gb|AY572297.1| Piper umbellatum 18S ribosomal RNA gene, partial ... 56 8e-05
50gb|AY572296.1| Piper excelsum 18S ribosomal RNA gene, partial se... 56 8e-05
51gb|AY572295.1| Piper hispidum 18S ribosomal RNA gene, partial se... 56 8e-05
52gb|AY665533.1| Yemma signatus 18S ribosomal RNA gene, partial se... 56 8e-05
53gb|AY665532.1| Phaenacantha bicolor 18S ribosomal RNA gene, part... 56 8e-05
54gb|AY665531.1| Panaorus albomaculatus 18S ribosomal RNA gene, pa... 56 8e-05
55gb|AY665530.1| Oxycarenus brunneus 18S ribosomal RNA gene, parti... 56 8e-05
56gb|AY665529.1| Macropes exilis 18S ribosomal RNA gene, partial s... 56 8e-05
57gb|AY665527.1| Geocoris pallidipennis 18S ribosomal RNA gene, pa... 56 8e-05
58gb|AY665526.1| Cymus tumescens 18S ribosomal RNA gene, partial s... 56 8e-05
59gb|AY206425.1| Caulerpa cupressoides 18S ribosomal RNA gene, par... 56 8e-05
60gb|AY206424.1| Caulerpa cupressoides 18S ribosomal RNA gene, par... 56 8e-05
61gb|AY652582.1| Trichoplax sp. H3 18S ribosomal RNA gene, partial... 56 8e-05
62gb|AY652581.1| Trichoplax sp. H8 18S ribosomal RNA gene, partial... 56 8e-05
63gb|AY652580.1| Trichoplax sp. H4 18S ribosomal RNA gene, partial... 56 8e-05
64gb|AY652579.1| Trichoplax sp. H7 18S ribosomal RNA gene, partial... 56 8e-05
65gb|AY652578.1| Trichoplax sp. H1 18S ribosomal RNA gene, partial... 56 8e-05
66gb|AY652577.1| Trichoplax sp. H2 18S ribosomal RNA gene, partial... 56 8e-05
67gb|AF084235.1| Stephanoeca diplocostata 18S ribosomal RNA gene, ... 56 8e-05
68gb|AF084234.1| Diaphanoeca grandis 18S ribosomal RNA gene, parti... 56 8e-05
69gb|AF084233.1| Acanthoeca spectabilis 18S ribosomal RNA gene, pa... 56 8e-05
70gb|AF084230.1| Monosiga ovata 18S ribosomal RNA gene, partial se... 56 8e-05
71gb|AF528564.1| Peronospora corydalis from Corydalis speciosa Max... 56 8e-05
72gb|AF528563.1| Peronospora corydalis from Corydalis speciosa Max... 56 8e-05
73gb|AF528562.1| Peronospora corydalis from Corydalis ochotensis T... 56 8e-05
74gb|AF528561.1| Peronospora corydalis from Corydalis ochotensis T... 56 8e-05
75gb|AF528560.1| Peronospora farinosa from Spinacia oleracea 18S r... 56 8e-05
76gb|AF528559.1| Peronospora farinosa from Spinacia oleracea 18S r... 56 8e-05
77gb|AF528558.1| Peronospora farinosa from Chenopodium ficifolium ... 56 8e-05
78gb|AF528556.1| Peronospora farinosa from Chenopodium album L. 18... 56 8e-05
79gb|AY261369.1| Beauveria felina strain CBS 250.34 18S ribosomal ... 56 8e-05
80gb|AY261368.1| Beauveria felina strain CBS 173.71 18S ribosomal ... 56 8e-05
81gb|AY261367.1| Beauveria felina strain HL-51-ALSP16-I003 18S rib... 56 8e-05
82gb|AY249900.1| Bionectria pityrodes strain CBS 246.78 18S riboso... 56 8e-05
83gb|AY249899.1| Bionectria pityrodes strain CBS 102033 18S riboso... 56 8e-05
84gb|AY249898.1| Bionectria pityrodes 18S ribosomal RNA gene, comp... 56 8e-05
85gb|AY313034.2| Bullera nakhonratchasimensis 18S ribosomal RNA ge... 56 8e-05
86gb|AY037173.1| Oxya chinensis 18S ribosomal RNA gene, complete s... 56 8e-05
87gb|AY839843.1| Diehliomyces microsporus 18S ribosomal RNA gene, ... 56 8e-05
88gb|AY839830.1| Inonotus baumii 18S ribosomal RNA gene, partial s... 56 8e-05
89gb|AY839829.1| Inonotus linteus 18S ribosomal RNA gene, partial ... 56 8e-05
90gb|AY839828.1| Inonotus linteus strain ASI26082 18S ribosomal RN... 56 8e-05
91gb|AY672801.1| Euphausia superba small subunit ribosomal RNA gen... 56 8e-05
92gb|AY672802.1| Fragilariopsis cylindrus small subunit ribosomal ... 56 8e-05
93gb|AY422222.1| Uncultured phototrophic eukaryote clone Nccln9shd... 56 8e-05
94gb|AY422221.1| Uncultured phototrophic eukaryote clone NCcln5shd... 56 8e-05
95gb|AY422220.1| Uncultured phototrophic eukaryote clone NCcln6shd... 56 8e-05
96gb|AY422219.1| Uncultured phototrophic eukaryote clone NCcln1shd... 56 8e-05
97gb|AY422218.1| Uncultured phototrophic eukaryote clone NCcln2shd... 56 8e-05
98gb|AY422217.1| Uncultured phototrophic eukaryote clone NCcln10sh... 56 8e-05
99gb|AY422216.1| Uncultured phototrophic eukaryote clone NCcln4shd... 56 8e-05
100gb|DQ092918.1| Anamika angustilamellata isolate AFTOL-ID 543 18S... 56 8e-05
101gb|AY465354.1| Bangia sp. WELT A23126 18S ribosomal RNA gene, pa... 56 8e-05
102gb|AY465355.1| Bangia sp. WELT A25775 18S ribosomal RNA gene, pa... 56 8e-05
103gb|AY289649.1| Nypa fruticans 18S ribosomal RNA gene, partial se... 56 8e-05
104gb|AY289648.1| Aegiceras corniculatum 18S ribosomal RNA gene, pa... 56 8e-05
105gb|AY289647.1| Barringtonia racemosa 18S ribosomal RNA gene, par... 56 8e-05
106gb|AY289646.1| Scyphiphora hydrophyllacea 18S ribosomal RNA gene... 56 8e-05
107gb|AY289645.1| Cerbera manghas 18S ribosomal RNA gene, partial s... 56 8e-05
108gb|AY289644.1| Clerodendrum inerme 18S ribosomal RNA gene, parti... 56 8e-05
109gb|AY289643.1| Dolichandrone spathacea 18S ribosomal RNA gene, p... 56 8e-05
110gb|AY289642.1| Acanthus ebracteatus 18S ribosomal RNA gene, part... 56 8e-05
111gb|AY289641.1| Avicennia marina 18S ribosomal RNA gene, partial ... 56 8e-05
112gb|AY289640.1| Aegialitis annulata 18S ribosomal RNA gene, parti... 56 8e-05
113gb|AY289639.1| Pemphis acidula 18S ribosomal RNA gene, partial s... 56 8e-05
114gb|AY289638.1| Sonneratia ovata 18S ribosomal RNA gene, partial ... 56 8e-05
115gb|AY289637.1| Lumnitzera littorea 18S ribosomal RNA gene, parti... 56 8e-05
116gb|AY289636.1| Conocarpus erectus 18S ribosomal RNA gene, partia... 56 8e-05
117gb|AY289635.1| Laguncularia racemosa 18S ribosomal RNA gene, par... 56 8e-05
118gb|AY289634.1| Xylocarpus granatum 18S ribosomal RNA gene, parti... 56 8e-05
119gb|AY289633.1| Heritiera littoralis 18S ribosomal RNA gene, part... 56 8e-05
120gb|AY289632.1| Thespesia populnea 18S ribosomal RNA gene, partia... 56 8e-05
121gb|AY289631.1| Hibiscus tiliaceus 18S ribosomal RNA gene, partia... 56 8e-05
122gb|AY289630.1| Cynometra iripa 18S ribosomal RNA gene, partial s... 56 8e-05
123gb|AY289629.1| Pongamia pinnata 18S ribosomal RNA gene, partial ... 56 8e-05
124gb|AY289628.1| Excoecaria agallocha 18S ribosomal RNA gene, part... 56 8e-05
125gb|AY289627.1| Rhizophora stylosa 18S ribosomal RNA gene, partia... 56 8e-05
126gb|AY289626.1| Bruguiera sexangula 18S ribosomal RNA gene, parti... 56 8e-05
127gb|AY289625.1| Kandelia candel 18S ribosomal RNA gene, partial s... 56 8e-05
128gb|AY289624.1| Ceriops tagal 18S ribosomal RNA gene, partial seq... 56 8e-05
129gb|AY823528.1| Jatropha curcas 18S ribosomal RNA gene, partial s... 56 8e-05
130gb|AY734450.1| Haliclona oculata 18S ribosomal RNA gene, complet... 56 8e-05
131gb|AY734449.1| Dysidea sp. 23-XI-02-2-001 N27 18S ribosomal RNA ... 56 8e-05
132gb|AY734448.1| Ircinia felix 18S ribosomal RNA gene, complete se... 56 8e-05
133gb|AY734447.1| Calyx podatypa 18S ribosomal RNA gene, complete s... 56 8e-05
134gb|AY734444.1| Haliclona sp. sp5 18S ribosomal RNA gene, complet... 56 8e-05
135gb|AY734443.1| Agelas conifera 18S ribosomal RNA gene, complete ... 56 8e-05
136gb|AY734442.1| Pseudaxinella lunaecharta 18S ribosomal RNA gene,... 56 8e-05
137gb|AY734440.1| Spheciospongia vesparium 18S ribosomal RNA gene, ... 56 8e-05
138gb|AY734439.1| Cinachyrella sp. sp11 18S ribosomal RNA gene, com... 56 8e-05
139gb|AY734438.1| Cinachyrella sp. 24-XI-02-3-2 N28 18S ribosomal R... 56 8e-05
140gb|AY734437.1| Cinachyrella sp. 22-XI-02-1-13 N25 18S ribosomal ... 56 8e-05
141gb|AF005243.2| Blattella germanica 18S ribosomal RNA gene, parti... 56 8e-05
142gb|AF280078.1| Phalansterium solitarium 18S ribosomal RNA gene, ... 56 8e-05
143gb|DQ227859.1| Porphyra yezoensis isolate NS007 small subunit ri... 56 8e-05
144gb|DQ227858.1| Porphyra yezoensis isolate NS006 small subunit ri... 56 8e-05
145gb|DQ227857.1| Porphyra yezoensis isolate NS005 small subunit ri... 56 8e-05
146gb|DQ227856.1| Porphyra yezoensis isolate NS004 small subunit ri... 56 8e-05
147gb|DQ227855.1| Porphyra yezoensis isolate NS003 small subunit ri... 56 8e-05
148gb|DQ227854.1| Porphyra yezoensis isolate NS002 small subunit ri... 56 8e-05
149gb|DQ227853.1| Porphyra yezoensis isolate NS001 small subunit ri... 56 8e-05
150gb|DQ234257.1| Chaetomium globosum 18S ribosomal RNA gene, parti... 56 8e-05
151gb|DQ234563.1| Platygloea disciformis isolate AFTOL-ID 710 18S s... 56 8e-05
152gb|DQ234543.1| Bensingtonia yuccicola isolate AFTOL-ID 857 18S s... 56 8e-05
153gb|DQ234542.1| Auricularia sp. PBM2295 18S small subunit ribosom... 56 8e-05
154gb|AY755703.1| Ephedra pachyclada voucher (S) C-7844 18S ribosom... 56 8e-05
155gb|AY755701.1| Ephedra campylopoda voucher (S) C-7605 18S riboso... 56 8e-05
156gb|AY755700.1| Ephedra ciliata voucher (S) C-591 18S ribosomal R... 56 8e-05
157gb|AY755699.1| Ephedra foliata voucher (S) C-7808 18S ribosomal ... 56 8e-05
158gb|AY755698.1| Ephedra alata voucher (S) C-303 18S ribosomal RNA... 56 8e-05
159gb|AY755697.1| Ephedra altissima voucher (S) C-7688 18S ribosoma... 56 8e-05
160gb|AY755696.1| Ephedra altissima voucher (S) C-628 18S ribosomal... 56 8e-05
161gb|AY755695.1| Ephedra aphylla voucher (S) C-7791 18S ribosomal ... 56 8e-05
162gb|AY755694.1| Ephedra equisetina voucher (S) C-465-2 18S riboso... 56 8e-05
163gb|AY755693.1| Ephedra distachya voucher (S) 03-684 18S ribosoma... 56 8e-05
164gb|AY755692.1| Ephedra tweediana voucher (UC) 66-0742 18S riboso... 56 8e-05
165gb|AY755691.1| Ephedra chilensis voucher (UC) 49-0542 18S riboso... 56 8e-05
166gb|AY755689.1| Ephedra rupestris voucher (UC) 87-1368 18S riboso... 56 8e-05
167gb|AY755688.1| Ephedra nevadensis voucher (UC) 66-1033 18S ribos... 56 8e-05
168gb|AY755687.1| Ephedra trifurca voucher (Mo) 04630447 18S riboso... 56 8e-05
169gb|AY755686.1| Ephedra distachya voucher (S) 04-481 18S ribosoma... 56 8e-05
170gb|AY755685.1| Ephedra gerardiana voucher (O) 74-460 18S ribosom... 56 8e-05
171gb|AY755684.1| Ephedra torreyana voucher (S) 04-487 18S ribosoma... 56 8e-05
172gb|AY755683.1| Ephedra intermedia voucher (S) 04-483 18S ribosom... 56 8e-05
173gb|AY755682.1| Ephedra antisyphilitica voucher (S) 04-488 18S ri... 56 8e-05
174gb|AY755681.1| Ephedra minuta voucher (S) 04-486 18S ribosomal R... 56 8e-05
175gb|AY755680.1| Ephedra minuta voucher (S) 04-485 18S ribosomal R... 56 8e-05
176gb|AY755679.1| Ephedra chilensis voucher (E) E00130260 18S ribos... 56 8e-05
177gb|AY755678.1| Ephedra gerardiana voucher (E) E00130259 18S ribo... 56 8e-05
178gb|AY755676.1| Ephedra californica voucher (O) 68-154 18S riboso... 56 8e-05
179gb|AY755675.1| Ephedra sinica voucher (S) CRetoh 18S ribosomal R... 56 8e-05
180gb|AY755674.1| Ephedra frustillata voucher (K) 10218 18S ribosom... 56 8e-05
181gb|AY755672.1| Ephedra monosperma voucher (K) 10142 18S ribosoma... 56 8e-05
182gb|AY755671.1| Ephedra gerardiana voucher (K) 10141 18S ribosoma... 56 8e-05
183gb|AY755670.1| Ephedra andina voucher (K) 10140 18S ribosomal RN... 56 8e-05
184gb|AY755669.1| Ephedra frustillata voucher (S) 04-482 18S riboso... 56 8e-05
185gb|AY755668.1| Ephedra minuta voucher (S) 03-930 18S ribosomal R... 56 8e-05
186gb|AY755667.1| Ephedra intermedia voucher (S) 03-925 18S ribosom... 56 8e-05
187gb|AY755666.1| Ephedra equisetina voucher (S) 03-928 18S ribosom... 56 8e-05
188gb|AY755665.1| Ephedra likiangensis voucher (S) 03-926 18S ribos... 56 8e-05
189gb|AY755664.1| Gnetum montanum voucher (E) E00130261 18S ribosom... 56 8e-05
190gb|AY755663.1| Gnetum indicum voucher (E) E00130257 18S ribosoma... 56 8e-05
191gb|AY755662.1| Gnetum parvifolium voucher (S) CRetoh 18S ribosom... 56 8e-05
192gb|AY755661.1| Gnetum costatum voucher (K) 10219 18S ribosomal R... 56 8e-05
193gb|AY755660.1| Gnetum gnemon voucher (S) 03-926 18S ribosomal RN... 56 8e-05
194gb|AY744286.1| Uncultured Leptosphaeriaceae clone Arch3573.1 18S... 56 8e-05
195gb|AY744285.1| Uncultured mycorrhiza (Archaeosporaceae) clone Ar... 56 8e-05
196gb|AY744279.1| Uncultured glomeraceous AM fungus clone Glom3538.... 56 8e-05
197gb|AY744278.1| Uncultured glomeraceous AM fungus clone Glom3524.... 56 8e-05
198gb|AY744277.1| Uncultured glomeraceous AM fungus clone Glom3523.... 56 8e-05
199gb|AY803753.1| Trechispora sp. PBM418 isolate AFTOL-ID 678 18S r... 56 8e-05
200gb|AY803752.1| Tilletiaria anomala isolate AFTOL-ID 865 18S ribo... 56 8e-05
201gb|AY676694.1| Syneta adamsi 18S ribosomal RNA gene, partial seq... 56 8e-05
202gb|AY676693.1| Polyoptilis sp. Sa02 18S ribosomal RNA gene, part... 56 8e-05
203gb|AY676692.1| Sagra sp. Sa04 18S ribosomal RNA gene, partial se... 56 8e-05
204gb|AY676691.1| Sagra sp. Sa03 18S ribosomal RNA gene, partial se... 56 8e-05
205gb|AY676688.1| Lamprosoma sp. LP01 18S ribosomal RNA gene, parti... 56 8e-05
206gb|AY676686.1| Lema trilineata 18S ribosomal RNA gene, partial s... 56 8e-05
207gb|AY676685.1| Ornithia sp. ORN01 18S ribosomal RNA gene, partia... 56 8e-05
208gb|AY773761.1| Uncultured rhizosphere basidiomycete isolate Root... 56 8e-05
209gb|AY773760.1| Uncultured rhizosphere ascomycete isolate Root.24... 56 8e-05
210gb|AY773759.1| Uncultured rhizosphere ascomycete isolate Root.23... 56 8e-05
211gb|AY773758.1| Uncultured rhizosphere ascomycete isolate Root.23... 56 8e-05
212gb|AY773757.1| Uncultured rhizosphere ascomycete isolate Root.23... 56 8e-05
213gb|AY773754.1| Uncultured rhizosphere ascomycete isolate Root.23... 56 8e-05
214gb|AY773752.1| Uncultured rhizosphere ascomycete isolate Root.22... 56 8e-05
215gb|AY773750.1| Uncultured rhizosphere ascomycete isolate Root.22... 56 8e-05
216gb|AY773749.1| Uncultured rhizosphere basidiomycete isolate Root... 56 8e-05
217gb|AY773748.1| Uncultured rhizosphere basidiomycete isolate Root... 56 8e-05
218gb|AY773746.1| Uncultured rhizosphere ascomycete isolate Root.21... 56 8e-05
219gb|AY773745.1| Uncultured rhizosphere zygomycete isolate Root.21... 56 8e-05
220gb|AY773744.1| Uncultured rhizosphere basidiomycete isolate Root... 56 8e-05
221gb|AY773743.1| Uncultured rhizosphere basidiomycete isolate Root... 56 8e-05
222gb|AY773740.1| Uncultured rhizosphere basidiomycete isolate Root... 56 8e-05
223gb|AY773739.1| Uncultured rhizosphere basidiomycete isolate Root... 56 8e-05
224gb|AY773737.1| Uncultured rhizosphere basidiomycete isolate Root... 56 8e-05
225gb|AY773734.1| Uncultured rhizosphere ascomycete isolate Root.18... 56 8e-05
226gb|AY773733.1| Uncultured rhizosphere ascomycete isolate Root.18... 56 8e-05
227gb|AY773732.1| Uncultured rhizosphere ascomycete isolate Root.18... 56 8e-05
228gb|AY773731.1| Uncultured rhizosphere basidiomycete isolate Root... 56 8e-05
229gb|AY773730.1| Uncultured rhizosphere ascomycete isolate Root.18... 56 8e-05
230gb|AY773729.1| Uncultured rhizosphere ascomycete isolate Root.18... 56 8e-05
231gb|AY773728.1| Uncultured rhizosphere basidiomycete isolate Root... 56 8e-05
232gb|AY773727.1| Uncultured rhizosphere basidiomycete isolate Root... 56 8e-05
233gb|AY773726.1| Uncultured rhizosphere ascomycete isolate Root.17... 56 8e-05
234gb|AY773725.1| Uncultured rhizosphere ascomycete isolate Root.17... 56 8e-05
235gb|AY773723.1| Uncultured rhizosphere zygomycete isolate Root.16... 56 8e-05
236gb|AY773721.1| Uncultured rhizosphere ascomycete isolate Root.14... 56 8e-05
237gb|AY773720.1| Uncultured rhizosphere ascomycete isolate Root.14... 56 8e-05
238gb|AY773718.1| Uncultured rhizosphere zygomycete isolate Root.14... 56 8e-05
239gb|AY773717.1| Uncultured soil basidiomycete isolate Root.14.08 ... 56 8e-05
240gb|AY773716.1| Uncultured rhizosphere ascomycete isolate Root.14... 56 8e-05
241gb|AY773810.1| Uncultured soil ascomycete isolate Soil.24.19 18S... 56 8e-05
242gb|AY773809.1| Uncultured soil ascomycete isolate Soil.24.11 18S... 56 8e-05
243gb|AY773808.1| Uncultured soil ascomycete isolate Soil.23.20 18S... 56 8e-05
244gb|AY773807.1| Uncultured soil zygomycete isolate Soil.22.07 18S... 56 8e-05
245gb|AY773806.1| Uncultured soil ascomycete isolate Soil.20.18 18S... 56 8e-05
246gb|AY773805.1| Uncultured soil ascomycete isolate Soil.20.04 18S... 56 8e-05
247gb|AY773804.1| Uncultured soil ascomycete isolate Soil.20.02 18S... 56 8e-05
248gb|AY773803.1| Uncultured soil ascomycete isolate Soil.19.19 18S... 56 8e-05
249gb|AY773802.1| Uncultured soil ascomycete isolate Soil.19.18 18S... 56 8e-05
250gb|AY773801.1| Uncultured soil basidiomycete isolate Soil.19.15 ... 56 8e-05
251gb|AY773800.1| Uncultured soil ascomycete isolate Soil.19.14 18S... 56 8e-05
252gb|AY773798.1| Uncultured soil ascomycete isolate Soil.18.16 18S... 56 8e-05
253gb|AY773797.1| Uncultured soil ascomycete isolate Soil.18.14 18S... 56 8e-05
254gb|AY773796.1| Uncultured soil ascomycete isolate Soil.18.09 18S... 56 8e-05
255gb|AY773795.1| Uncultured soil ascomycete isolate Soil.18.08 18S... 56 8e-05
256gb|AY773794.1| Uncultured soil ascomycete isolate Soil.18.05 18S... 56 8e-05
257gb|AY773792.1| Uncultured soil basidiomycete isolate Soil.17.19 ... 56 8e-05
258gb|AY773791.1| Uncultured soil ascomycete isolate Soil.17.18 18S... 56 8e-05
259gb|AY773790.1| Uncultured soil ascomycete isolate Soil.17.16 18S... 56 8e-05
260gb|AY773789.1| Uncultured soil ascomycete isolate Soil.17.14 18S... 56 8e-05
261gb|AY773787.1| Uncultured soil ascomycete isolate Soil.17.03 18S... 56 8e-05
262gb|AY773786.1| Uncultured soil basidiomycete isolate Soil.16.19 ... 56 8e-05
263gb|AY773785.1| Uncultured soil ascomycete isolate Soil.16.09 18S... 56 8e-05
264gb|AY773784.1| Uncultured soil ascomycete isolate Soil.16.06 18S... 56 8e-05
265gb|AY773781.1| Uncultured soil ascomycete isolate Soil.15.19 18S... 56 8e-05
266gb|AY773780.1| Uncultured soil basidiomycete isolate Soil.15.14 ... 56 8e-05
267gb|AY773779.1| Uncultured soil ascomycete isolate Soil.15.13 18S... 56 8e-05
268gb|AY773778.1| Uncultured soil basidiomycete isolate Soil.15.06 ... 56 8e-05
269gb|AY773777.1| Uncultured soil basidiomycete isolate Soil.15.02 ... 56 8e-05
270gb|AY773776.1| Uncultured soil ascomycete isolate Soil.14.16 18S... 56 8e-05
271gb|AY773774.1| Uncultured soil basidiomycete isolate Soil.14.11 ... 56 8e-05
272gb|AY773773.1| Uncultured soil ascomycete isolate Soil.14.07 18S... 56 8e-05
273gb|AY773772.1| Uncultured soil basidiomycete isolate Soil.14.06 ... 56 8e-05
274gb|AY773771.1| Uncultured soil zygomycete isolate Soil.14.03 18S... 56 8e-05
275gb|AY773770.1| Uncultured soil basidiomycete isolate Soil.14.02 ... 56 8e-05
276gb|AY773769.1| Uncultured soil ascomycete isolate Soil.13.17 18S... 56 8e-05
277gb|AY773768.1| Uncultured soil ascomycete isolate Soil.13.10 18S... 56 8e-05
278gb|AY773767.1| Uncultured soil basidiomycete isolate Soil.13.06 ... 56 8e-05
279gb|AY773766.1| Uncultured soil basidiomycete isolate Soil.13.03 ... 56 8e-05
280gb|AY773764.1| Uncultured soil ascomycete isolate Soil.11.14 18S... 56 8e-05
281gb|AY773344.1| Melipona quinquefasciata 18S small subunit riboso... 56 8e-05
282gb|AY773343.1| Melipona subnitida 18S small subunit ribosomal RN... 56 8e-05
283gb|AY422078.1| Paradoxia multiseta 18S small subunit ribosomal R... 56 8e-05
284gb|AY422077.1| Picochlorum sp. UTEX 2491 18S small subunit ribos... 56 8e-05
285gb|AY422076.1| Picochlorum sp. UTEX 2378 18S small subunit ribos... 56 8e-05
286gb|AY422075.1| Picochlorum oculatum 18S small subunit ribosomal ... 56 8e-05
287gb|AY422074.1| Gloeotila contorta 18S small subunit ribosomal RN... 56 8e-05
288gb|AY422073.1| Picochlorum oklahomensis 18S small subunit riboso... 56 8e-05
289gb|AY787216.1| Agaricus bisporus isolate AFTOL-ID 448 18S riboso... 56 8e-05
290gb|AY787215.1| Hypholoma sublateritium isolate AFTOL-ID 597 18S ... 56 8e-05
291gb|AY787214.1| Marasmius alliaceus isolate AFTOL-ID 556 18S ribo... 56 8e-05
292gb|AY425322.1| Uncultured prasinophyte clone BL010625.18 small s... 56 8e-05
293gb|AY425321.1| Prasinophyte sp. RCC 391 small subunit ribosomal ... 56 8e-05
294gb|AY425320.1| Micromonas pusilla small subunit ribosomal RNA ge... 56 8e-05
295gb|AY425319.1| Uncultured prasinophyte clone RA000412.97 small s... 56 8e-05
296gb|AY425318.1| Uncultured prasinophyte clone BL000921.10 small s... 56 8e-05
297gb|AY425317.1| Uncultured prasinophyte clone RA000412.37 small s... 56 8e-05
298gb|AY425316.1| Micromonas pusilla small subunit ribosomal RNA ge... 56 8e-05
299gb|AY425315.1| Bathycoccus prasinos small subunit ribosomal RNA ... 56 8e-05
300gb|AY425314.1| Bathycoccus prasinos small subunit ribosomal RNA ... 56 8e-05
301gb|AY425313.1| Ostreococcus sp. RCC 501 small subunit ribosomal ... 56 8e-05
302gb|AY425312.1| Uncultured prasinophyte clone RA000412.150 small ... 56 8e-05
303gb|AY425311.1| Ostreococcus sp. RCC 393 small subunit ribosomal ... 56 8e-05
304gb|AY425310.1| Ostreococcus sp. RCC 143 small subunit ribosomal ... 56 8e-05
305gb|AY425309.1| Uncultured prasinophyte clone RA010412.39 small s... 56 8e-05
306gb|AY425308.1| Ostreococcus sp. RCC 356 clone 1 small subunit ri... 56 8e-05
307gb|AY425307.1| Ostreococcus sp. RCC 344 small subunit ribosomal ... 56 8e-05
308gb|AY425306.1| Nephroselmis pyriformis small subunit ribosomal R... 56 8e-05
309gb|AY425305.1| Pycnococcus provasolii small subunit ribosomal RN... 56 8e-05
310gb|AY425303.1| Uncultured prasinophyte clone RA001219.46 small s... 56 8e-05
311gb|AY425302.1| Prasinophyte sp. RCC 287 small subunit ribosomal ... 56 8e-05
312gb|AY425301.1| Uncultured prasinophyte clone BL010625.2 small su... 56 8e-05
313gb|AY425300.1| Uncultured prasinophyte clone BL010625.1 small su... 56 8e-05
314gb|AY425299.1| Tetraselmis sp. RCC 500 small subunit ribosomal R... 56 8e-05
315gb|AY786053.1| Megacollybia platyphylla isolate AFTOL-ID 560 18S... 56 8e-05
316gb|AY789928.1| Rhodotorula sp. RG2005 18S ribosomal RNA gene, pa... 56 8e-05
317gb|AY732223.1| Sabellaria cementarium 18S ribosomal RNA gene, pa... 56 8e-05
318gb|AY839573.1| Pholoe baltica 18S ribosomal RNA gene, partial se... 56 8e-05
319gb|AY839568.1| Dysponetus caecus 18S ribosomal RNA gene, partial... 56 8e-05
320gb|DQ079770.1| Typhlatya pearsei voucher MLP85_1 18S ribosomal R... 56 8e-05
321gb|DQ079769.1| Stenopus hispidus voucher MLP119 18S ribosomal RN... 56 8e-05
322gb|DQ079768.1| Sergio mericeae voucher KC1865 18S ribosomal RNA ... 56 8e-05
323gb|DQ079767.1| Scyllarus arctus voucher KC2159 18S ribosomal RNA... 56 8e-05
324gb|DQ079765.1| Panulirus regius voucher KC2167 18S ribosomal RNA... 56 8e-05
325gb|DQ079763.1| Pachygrapsus marmoratus voucher KCpama 18S riboso... 56 8e-05
326gb|DQ079762.1| Nephrops norvegicus voucher KC2163 18S ribosomal ... 56 8e-05
327gb|DQ079761.1| Nephropsis aculeata voucher KC2117 18S ribosomal ... 56 8e-05
328gb|DQ079760.1| Nematoscelis sp. KCnesp 18S ribosomal RNA gene, p... 56 8e-05
329gb|DQ079759.1| Necora puber voucher KC2161 18S ribosomal RNA gen... 56 8e-05
330gb|DQ079758.1| Maja squinado voucher KC2168 18S ribosomal RNA ge... 56 8e-05
331gb|DQ079757.1| Necora puber voucher KCmapu 18S ribosomal RNA gen... 56 8e-05
332gb|DQ079751.1| Lepidophthalmus louisianensis voucher KC1852 18S ... 56 8e-05
333gb|DQ079750.1| Geothelphusa sp. MLP125 18S ribosomal RNA gene, p... 56 8e-05
334gb|DQ079749.1| Homarus gammarus voucher KC2162 18S ribosomal RNA... 56 8e-05
335gb|DQ079748.1| Euphausia eximia voucher KCeuex 18S ribosomal RNA... 56 8e-05
336gb|DQ079745.1| Cherax glaber voucher KCchgl 18S ribosomal RNA ge... 56 8e-05
337gb|DQ079744.1| Carcinus maenas voucher KCcama 18S ribosomal RNA ... 56 8e-05
338gb|DQ079743.1| Cancer pagurus voucher KC2158 18S ribosomal RNA g... 56 8e-05
339gb|DQ079742.1| Cambaroides japonicus voucher KC695 18S ribosomal... 56 8e-05
340gb|DQ079741.1| Callichirus major voucher KC1864 18S ribosomal RN... 56 8e-05
341gb|DQ079740.1| Callianassa subterranea voucher KCcasu 18S riboso... 56 8e-05
342gb|DQ079739.1| Biffarius arenosus voucher BaV3 18S ribosomal RNA... 56 8e-05
343gb|DQ079738.1| Atyoida bisulcata voucher KC2138 18S ribosomal RN... 56 8e-05
344gb|DQ079737.1| Astacopsis gouldi voucher KC1883 18S ribosomal RN... 56 8e-05
345gb|DQ079736.1| Acanthacaris caeca voucher KC1877 18S ribosomal R... 56 8e-05
346gb|AY742885.1| Graptostethus sp. HL-2004 18S ribosomal RNA gene,... 56 8e-05
347gb|AY742883.1| Cletus trigonus 18S ribosomal RNA gene, partial s... 56 8e-05
348gb|AY627329.1| Anoplocnemis binotata 18S ribosomal RNA gene, par... 56 8e-05
349gb|AY627323.1| Cletus punctiger 18S ribosomal RNA gene, partial ... 56 8e-05
350gb|AY627320.1| Leptocorisa sp. HL-2004 18S ribosomal RNA gene, p... 56 8e-05
351gb|AY627314.1| Aponsila montana 18S ribosomal RNA gene, partial ... 56 8e-05
352gb|AY627313.1| Megacopta cribraria 18S ribosomal RNA gene, parti... 56 8e-05
353gb|AY627312.1| Tessaratoma papillosa 18S ribosomal RNA gene, par... 56 8e-05
354gb|DQ002501.1| Tetraplatia volitans 18S small subunit ribosomal ... 56 8e-05
355gb|AY543588.1| Shiraia bambusicola isolate TFC Pa2003 18S riboso... 56 8e-05
356gb|AY584679.1| Lobaria scrobiculata isolate AFTOL-ID 128 18S rib... 56 8e-05
357gb|AY584674.1| Megalospora tuberculosa isolate AFTOL-ID 107 18S ... 56 8e-05
358gb|AY584673.1| Gyalideopsis vulgaris isolate AFTOL-ID 105 18S ri... 56 8e-05
359gb|AY584667.1| Acarosporina microspora isolate AFTOL-ID 78 18S r... 56 8e-05
360gb|AY584666.1| Ostropa barbara isolate AFTOL-ID 77 18S ribosomal... 56 8e-05
361gb|AY584662.1| Lithothelium septemseptatum isolate AFTOL-ID 12 1... 56 8e-05
362gb|AY584661.1| Menegazzia terebrata isolate AFTOL-ID 10 18S ribo... 56 8e-05
363gb|AY584659.1| Parmotrema tinctorum isolate AFTOL-ID 7 18S ribos... 56 8e-05
364gb|AY584658.1| Canoparmelia caroliniana isolate AFTOL-ID 6 18S r... 56 8e-05
365gb|AY604526.1| Endoconidioma populi strain UAMH 10297 18S riboso... 56 8e-05
366gb|AY781664.1| Chlamydomonas incerta 18S ribosomal RNA gene, par... 56 8e-05
367gb|AY781663.1| Chlamydomonas globosa 18S ribosomal RNA gene, par... 56 8e-05
368gb|AY781662.1| Schizochlamys gelatinosa 18S ribosomal RNA gene, ... 56 8e-05
369gb|AY766363.1| Bangiopsis sp. DM-Brazil-2004 18S ribosomal RNA g... 56 8e-05
370gb|AY766362.1| Porphyra drewiana 18S ribosomal RNA gene, complet... 56 8e-05
371gb|AY766361.1| Porphyra capensis 18S ribosomal RNA gene, complet... 56 8e-05
372gb|AY766360.1| Porphyra spiralis var. spiralis 18S ribosomal RNA... 56 8e-05
373gb|AY766359.1| Porphyra acanthophora var. brasiliensis 18S ribos... 56 8e-05
374gb|AY766358.1| Porphyra sp. Baleia 18S ribosomal RNA gene, compl... 56 8e-05
375gb|AY766357.1| Porphyra sp. Piaui 18S ribosomal RNA gene, comple... 56 8e-05
376gb|AY218384.1| Laetiporus sulphureus 18S ribosomal RNA gene, par... 56 8e-05
377gb|AY218383.1| Grifola frondosa 18S ribosomal RNA gene, partial ... 56 8e-05
378gb|AY218382.1| Sparassis sp. TENN50289/ss31 18S ribosomal RNA ge... 56 8e-05
379gb|AY218380.1| Sparassis spathulata strain zw-clarku004/ss11 18S... 56 8e-05
380gb|AY218379.1| Sparassis crispa strain zw-clarku003/ss9 18S ribo... 56 8e-05
381gb|AY218378.1| Sparassis spathulata strain zw-clarku002/ss8 18S ... 56 8e-05
382gb|AY218377.1| Sparassis spathulata strain zw-clarku001/ss7 18S ... 56 8e-05
383gb|AY218375.1| Sparassis crispa strain MBUH-SAVOLAINEN/ss4 18S r... 56 8e-05
384gb|AY218374.1| Sparassis crispa strain YCD2470/ss2 18S ribosomal... 56 8e-05
385gb|AY218373.1| Sparassis crispa strain YCD2145/ss1 18S ribosomal... 56 8e-05
386gb|AY773276.1| Thraustochytriidae sp. FJN-10 18S ribosomal RNA g... 56 8e-05
387gb|AY634164.1| Uncultured ectomycorrhiza (Pyronemataceae) 1.1.a ... 56 8e-05
388gb|AY771612.1| Ampulloclitocybe clavipes isolate AFTOL-ID 542 18... 56 8e-05
389gb|AY771611.1| Basidioradulum radula isolate AFTOL-ID 451 18S ri... 56 8e-05
390gb|AY771610.1| Calocera cornea isolate AFTOL-ID 438 18S ribosoma... 56 8e-05
391gb|AY771609.1| Clitocybe candicans isolate AFTOL-ID 541 18S ribo... 56 8e-05
392gb|AY771608.1| Clitocybe subditopoda isolate AFTOL-ID 533 18S ri... 56 8e-05
393gb|AY771607.1| Clitopilus prunulus isolate AFTOL-ID 522 18S ribo... 56 8e-05
394gb|AY771606.1| Collybia tuberosa isolate AFTOL-ID 557 18S riboso... 56 8e-05
395gb|AY771605.1| Cortinarius iodes isolate AFTOL-ID 285 18S riboso... 56 8e-05
396gb|AY771603.1| Dacryopinax spathularia isolate AFTOL-ID 454 18S ... 56 8e-05
397gb|AY771602.1| Macrolepiota dolichaula isolate AFTOL-ID 481 18S ... 56 8e-05
398gb|AY771601.1| Phallus hadriani isolate AFTOL-ID 683 18S ribosom... 56 8e-05
399gb|AY771600.1| Polyozellus multiplex isolate AFTOL-ID 677 18S ri... 56 8e-05
400gb|AY771599.1| Rickenella fibula isolate AFTOL-ID 486 18S riboso... 56 8e-05
401gb|AY454432.1| Phaeophila dendroides isolate WA1.15D small subun... 56 8e-05
402gb|AY454431.1| Phaeophila dendroides isolate WA2.4a1 small subun... 56 8e-05
403gb|AY454430.1| Phaeophila dendroides isolate FR1.2a2 small subun... 56 8e-05
404gb|AY454429.1| Phaeophila dendroides isolate MA2.4a1 small subun... 56 8e-05
405gb|AY454428.1| Ochlochaete hystrix isolate MA1.8d1 small subunit... 56 8e-05
406gb|AY454427.1| Ochlochaete hystrix isolate MA1.08d2 small subuni... 56 8e-05
407gb|AY454426.1| Ruthnielsenia tenuis isolate Ma2.6a1 small subuni... 56 8e-05
408gb|AY454425.1| Ruthnielsenia tenuis isolate WA2.22b3 small subun... 56 8e-05
409gb|AY766081.1| Tremellodendron sp. PBM2324 isolate AFTOL-ID 699 ... 56 8e-05
410gb|AY648095.1| Cetradonia linearis 18S ribosomal RNA gene, parti... 56 8e-05
411gb|AY607868.1| Trichocolea tomentosa 18S ribosomal RNA gene, par... 56 8e-05
412gb|AY607867.1| Scapania nemorosa 18S ribosomal RNA gene, partial... 56 8e-05
413gb|AY607865.1| Porella pinnata 18S ribosomal RNA gene, partial s... 56 8e-05
414gb|AY607863.1| Petalophyllum ralfsii 18S ribosomal RNA gene, par... 56 8e-05
415gb|AY607862.1| Odontoschisma denudatum 18S ribosomal RNA gene, p... 56 8e-05
416gb|AY607861.1| Metzgeria sp. Davis 361 18S ribosomal RNA gene, p... 56 8e-05
417gb|AY607860.1| Marsupidium latifolium 18S ribosomal RNA gene, pa... 56 8e-05
418gb|AY607859.1| Lepidozia reptans 18S ribosomal RNA gene, partial... 56 8e-05
419gb|AY607858.1| Jubula pennsylvanica 18S ribosomal RNA gene, part... 56 8e-05
420gb|AY607857.1| Isotachis lyallii 18S ribosomal RNA gene, partial... 56 8e-05
421gb|AY607856.1| Herbertus sakurai 18S ribosomal RNA gene, partial... 56 8e-05
422gb|AY607855.1| Haplomitrium gibbsiae 18S ribosomal RNA gene, par... 56 8e-05
423gb|AY607854.1| Haplomitrium blumei 18S ribosomal RNA gene, parti... 56 8e-05
424gb|AY607853.1| Gackstroemia weindorferi 18S ribosomal RNA gene, ... 56 8e-05
425gb|AY607852.1| Dumortiera hirsuta 18S ribosomal RNA gene, partia... 56 8e-05
426gb|AY607851.1| Dendrohypopterygium arbuscula 18S ribosomal RNA g... 56 8e-05
427gb|AY607850.1| Ceratolejeunea coarina 18S ribosomal RNA gene, pa... 56 8e-05
428gb|AY607849.1| Calypogeia muelleriana 18S ribosomal RNA gene, pa... 56 8e-05
429gb|AY743957.1| Stenopus hispidus 18S ribosomal RNA gene, complet... 56 8e-05
430gb|AY743955.1| Panulirus argus 18S ribosomal RNA gene, complete ... 56 8e-05
431gb|AY743953.1| Libinia emarginata 18S ribosomal RNA gene, comple... 56 8e-05
432gb|AY743949.1| Emerita talpoida 18S ribosomal RNA gene, complete... 56 8e-05
433gb|AY743947.1| Gonodactylus viridus 18S ribosomal RNA gene, comp... 56 8e-05
434gb|AY743946.1| Heteromysis sp. CCB-2004 18S ribosomal RNA gene, ... 56 8e-05
435gb|AY743945.1| Homarus americanus 18S ribosomal RNA gene, comple... 56 8e-05
436gb|AY743943.1| Limnoria sp. CCB-2004 18S ribosomal RNA gene, com... 56 8e-05
437gb|AY743942.1| Ocypode quadrata 18S ribosomal RNA gene, complete... 56 8e-05
438gb|AY752975.1| Cortinarius sodagnitus isolate AFTOL-ID 811 18S r... 56 8e-05
439gb|AY752974.1| Callistosporium sp. PBM2341 isolate AFTOL-ID 978 ... 56 8e-05
440gb|AY752973.1| Cyphellostereum laeve isolate AFTOL-ID 983 18S ri... 56 8e-05
441gb|AY752972.1| Hebeloma velutipes isolate AFTOL-ID 980 18S ribos... 56 8e-05
442gb|AY752971.1| Hydnellum geogenium isolate AFTOL-ID 680 18S ribo... 56 8e-05
443gb|AY752970.1| Phaeomarasmius proximans isolate AFTOL-ID 979 18S... 56 8e-05
444gb|AY752969.1| Chrysomphalina grossula isolate AFTOL-ID 981 18S ... 56 8e-05
445gb|AY752968.1| Gomphus clavatus isolate AFTOL-ID 725 18S ribosom... 56 8e-05
446gb|AY752967.1| Inocybe cookei isolate AFTOL-ID 520 18S ribosomal... 56 8e-05
447gb|AY752966.1| Rhodocollybia maculata isolate AFTOL-ID 540 18S r... 56 8e-05
448gb|AY752965.1| Hygrocybe conica isolate AFTOL-ID 729 18S ribosom... 56 8e-05
449gb|AF008957.1| Luffa quinquefida 18S ribosomal RNA gene, complet... 56 8e-05
450gb|AF008956.1| Marah macrocarpus 18S ribosomal RNA gene, complet... 56 8e-05
451gb|AF008955.1| Corallocarpus bainesii 18S ribosomal RNA gene, co... 56 8e-05
452gb|AF008954.1| Coriaria arborea 18S ribosomal RNA gene, complete... 56 8e-05
453gb|AF008953.1| Octomeles sumatrana 18S ribosomal RNA gene, compl... 56 8e-05
454gb|AF008951.1| Hillebrandia sandwichensis 18S ribosomal RNA gene... 56 8e-05
455gb|AF008950.1| Begonia oxyloba 18S ribosomal RNA gene, complete ... 56 8e-05
456gb|AF008949.1| Begonia glabra 18S ribosomal RNA gene, complete s... 56 8e-05
457gb|AF008948.1| Begonia boisiana 18S ribosomal RNA gene, complete... 56 8e-05
458gb|AY630560.1| Clematoscenea sp. KY-2004 18S ribosomal RNA gene,... 56 8e-05
459gb|AY630559.1| Psococerastis nubila voucher KY218 18S ribosomal ... 56 8e-05
460gb|AY630558.1| Metylophorus novaescotiae voucher Menov.2.3.2001.... 56 8e-05
461gb|AY630557.1| Podopterocus sp. KY-2004 18S ribosomal RNA gene, ... 56 8e-05
462gb|AY630556.1| Sigmatoneura kolbei voucher KY181 18S ribosomal R... 56 8e-05
463gb|AY630555.1| Psocus sp. KY-2004 18S ribosomal RNA gene, partia... 56 8e-05
464gb|AY630554.1| Trichadenotecnum sp. KPJ-2003 18S ribosomal RNA g... 56 8e-05
465gb|AY630553.1| Ptycta sp. KY-2002 18S ribosomal RNA gene, partia... 56 8e-05
466gb|AY630552.1| Ptyctini sp. KY180 18S ribosomal RNA gene, partia... 56 8e-05
467gb|AY630551.1| Atrichadenotecnum sp. KY-2004 18S ribosomal RNA g... 56 8e-05
468gb|AY630550.1| Loensia moesta voucher Lomoe.8.31.2001.2 18S ribo... 56 8e-05
469gb|AY630549.1| Loensia variegata voucher KY179 18S ribosomal RNA... 56 8e-05
470gb|AY630548.1| Blastopsocus lithinus voucher Bllit.8.31.2001.11 ... 56 8e-05
471gb|AY630547.1| Blaste quieta voucher Blqui.2.3.2001.5 18S riboso... 56 8e-05
472gb|AY630546.1| Amphigerontia jezoensis voucher KY213 18S ribosom... 56 8e-05
473gb|AY630545.1| Hemipsocus chloroticus voucher Hechl.5.16.2002.6 ... 56 8e-05
474gb|AY630544.1| Hemipsocus sp. KY-2004c 18S ribosomal RNA gene, p... 56 8e-05
475gb|AY630543.1| Hemipsocus sp. KY-2004b 18S ribosomal RNA gene, p... 56 8e-05
476gb|AY630542.1| Hemipsocus sp. KY-2004a 18S ribosomal RNA gene, p... 56 8e-05
477gb|AY630541.1| Psilopsocus malayanus voucher KY195 18S ribosomal... 56 8e-05
478gb|AY630540.1| Lichenomima sp. KY-2004 18S ribosomal RNA gene, p... 56 8e-05
479gb|AY630539.1| Epipsocus sp. KY-2004 18S ribosomal RNA gene, par... 56 8e-05
480gb|AY630538.1| Goja sp. KY-2004 18S ribosomal RNA gene, partial ... 56 8e-05
481gb|AY630537.1| Bertkauia crosbyana voucher Becro.8.31.2001.14 18... 56 8e-05
482gb|AY630536.1| Trichopsocus dalii voucher KY248 18S ribosomal RN... 56 8e-05
483gb|AY630535.1| Zelandopsocus sp. KY-2004 18S ribosomal RNA gene,... 56 8e-05
484gb|AY630534.1| Australopsocus sp. KY-2004 18S ribosomal RNA gene... 56 8e-05
485gb|AY630533.1| Aaroniella sp. KY-2004 18S ribosomal RNA gene, pa... 56 8e-05
486gb|AY630532.1| Aaroniella badonneli voucher Aabad.8.31.2001.8 18... 56 8e-05
487gb|AY630531.1| Philotarsopsis ornatus voucher Prsp.12.4.2003.6 1... 56 8e-05
488gb|AY630530.1| Philotarsus kwakiutl voucher Phkwa.11.17.2003.10 ... 56 8e-05
489gb|AY630529.1| Haplophallus sp. KY-2002 18S ribosomal RNA gene, ... 56 8e-05
490gb|AY630528.1| Haplophallus wongae voucher Hawon.12.4.2003.5 18S... 56 8e-05
491gb|AY630527.1| Pseudocaecilius citricola voucher Pccit.11.17.200... 56 8e-05
492gb|AY630526.1| Allocaecilius sinensis voucher KY232 18S ribosoma... 56 8e-05
493gb|AY630525.1| Mepleres suzukii voucher KY242 18S ribosomal RNA ... 56 8e-05
494gb|AY630524.1| Ophiodopelma glyptocephalum voucher KY234 18S rib... 56 8e-05
495gb|AY630523.1| Phallocaecilius hirsutus voucher KY217 18S riboso... 56 8e-05
496gb|AY630522.1| Lobocaecilius monicus voucher Lomon.12.4.2003.10 ... 56 8e-05
497gb|AY630521.1| Heterocaecilius solocipennis voucher Hcsol.12.4.2... 56 8e-05
498gb|AY630520.1| Heterocaecilius fuscus voucher KY237 18S ribosoma... 56 8e-05
499gb|AY630519.1| Calopsocus furcata voucher KY199 18S ribosomal RN... 56 8e-05
500gb|AY630517.1| Kilauella sp. KY-2004 18S ribosomal RNA gene, par... 56 8e-05

>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score =  617 bits (311), Expect = e-173
 Identities = 318/319 (99%), Gaps = 1/319 (0%)
 Strand = Plus / Plus

                                                                       
Query: 42  ctacacgatcagcgccagtgtcgactgctctaagatccactgatcgaacacgtgctcccc 101
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 376 ctacacgatcagcgccagtgtcgactgctctaagatccactgatcgaacacgtgctcccc 435

                                                                       
Query: 102 atatctccagcgatcgacgcttggtaggttgaggtcacatacacatatatacatatacat 161
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 436 atatctccagcgatcgacgcttggtaggttgaggtcacatacacatatatacatatacat 495

                                                                       
Query: 162 gaataaatcctctgttatgatctccatgagagagagaggggaggacgtacgctgagccag 221
           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 496 gaataaatcctctgttatgatctccatgagagagagaggg-aggacgtacgctgagccag 554

                                                                       
Query: 222 ctctacatggccgctcactgttgtatcggttttgtatcagtgtttgattgtttgttcact 281
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 555 ctctacatggccgctcactgttgtatcggttttgtatcagtgtttgattgtttgttcact 614

                                                                       
Query: 282 ccctttgaggagacacatacgggagtttgctgtacgttgtaccatgggcacttatggtat 341
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 615 ccctttgaggagacacatacgggagtttgctgtacgttgtaccatgggcacttatggtat 674

                              
Query: 342 atggattataaattaatct 360
           |||||||||||||||||||
Sbjct: 675 atggattataaattaatct 693



to top

>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score =  484 bits (244), Expect = e-133
 Identities = 256/260 (98%)
 Strand = Plus / Plus

                                                                       
Query: 101 catatctccagcgatcgacgcttggtaggttgaggtcacatacacatatatacatataca 160
           |||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 450 catacctccagcgatcgacgcttggaaggttgaggtcacatacgcatatatacatataca 509

                                                                       
Query: 161 tgaataaatcctctgttatgatctccatgagagagagaggggaggacgtacgctgagcca 220
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 510 tgaataaatcctctgttatgatctccatgggagagagaggggaggacgtacgctgagcca 569

                                                                       
Query: 221 gctctacatggccgctcactgttgtatcggttttgtatcagtgtttgattgtttgttcac 280
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 570 gctctacatggccgctcactgttgtatcggttttgtatcagtgtttgattgtttgttcac 629

                                                                       
Query: 281 tccctttgaggagacacatacgggagtttgctgtacgttgtaccatgggcacttatggta 340
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 630 tccctttgaggagacacatacgggagtttgctgtacgttgtaccatgggcacttatggta 689

                               
Query: 341 tatggattataaattaatct 360
           ||||||||||||||||||||
Sbjct: 690 tatggattataaattaatct 709



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 48/49 (97%)
 Strand = Plus / Plus

                                                            
Query: 42  ctacacgatcagcgccagtgtcgactgctctaagatccactgatcgaac 90
           |||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 379 ctacacgatcagcgccagtgtcgactgctccaagatccactgatcgaac 427



to top

>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score =  444 bits (224), Expect = e-122
 Identities = 239/244 (97%)
 Strand = Plus / Plus

                                                                       
Query: 101 catatctccagcgatcgacgcttggtaggttgaggtcacatacacatatatacatataca 160
           |||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||
Sbjct: 379 catacctccagcgatcgacgcttggcaggttgaggtcacatacgcatatatacatataca 438

                                                                       
Query: 161 tgaataaatcctctgttatgatctccatgagagagagaggggaggacgtacgctgagcca 220
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 439 tgaataaatcctctgttatgatctccatgggagagagaggggaggacgtacgctgagcca 498

                                                                       
Query: 221 gctctacatggccgctcactgttgtatcggttttgtatcagtgtttgattgtttgttcac 280
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 499 gctctacatggccgctcactgttgtatcggttttgtatcagtgtttgattgtttgttcac 558

                                                                       
Query: 281 tccctttgaggagacacatacgggagtttgctgtacgttgtaccatgggcacttatggta 340
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 559 tccctttaaggagacacatacgggagtttgctgtacgttgtaccatgggcacttatggta 618

               
Query: 341 tatg 344
           ||||
Sbjct: 619 tatg 622



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 48/49 (97%)
 Strand = Plus / Plus

                                                            
Query: 42  ctacacgatcagcgccagtgtcgactgctctaagatccactgatcgaac 90
           |||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 308 ctacacgatcagcgccagtgtcgactgctccaagatccactgatcgaac 356



to top

>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  159 bits (80), Expect = 8e-36
 Identities = 168/196 (85%), Gaps = 6/196 (3%)
 Strand = Plus / Plus

                                                                       
Query: 146 atatatacatatacatgaataaatcctctgttatgatctccatgagagagagaggggagg 205
           ||||| |||||||||||||||||| ||||| ||||||||||||| |||||| |||  || 
Sbjct: 498 atatacacatatacatgaataaatgctctgatatgatctccatgtgagagacagg--agt 555

                                                                       
Query: 206 acgtacgctgagccagctctacatggccgctcactgttgtatcggttttgtatcagtgtt 265
           |||||||  ||||||||||| ||| ||||  ||||||||||||  ||||||||||| |||
Sbjct: 556 acgtacgtcgagccagctctgcatagccggccactgttgtatctattttgtatcagcgtt 615

                                                                       
Query: 266 tgattgtttgttcactccctttgaggagacacatacgggagtttgctgtacgttgtacca 325
           |||||||| ||||||||||||||||    || | ||||||||||| ||||| ||||||||
Sbjct: 616 tgattgttcgttcactccctttgag----cagagacgggagtttgttgtactttgtacca 671

                           
Query: 326 tgggcacttatggtat 341
           || ||||| |||||||
Sbjct: 672 tgtgcactcatggtat 687



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 64  gactgctctaagatccactgatcga 88
           |||||||||||||||||||||||||
Sbjct: 388 gactgctctaagatccactgatcga 412



to top

>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  139 bits (70), Expect = 7e-30
 Identities = 127/145 (87%), Gaps = 2/145 (1%)
 Strand = Plus / Plus

                                                                        
Query: 146  atatatacatatacatgaataaatcctctgttatgatctccatgagagagagaggggagg 205
            ||||| |||||||||||||||||| ||||| ||||||||||||| |||||| |||  || 
Sbjct: 3294 atatacacatatacatgaataaatgctctgatatgatctccatgtgagagacagg--agt 3351

                                                                        
Query: 206  acgtacgctgagccagctctacatggccgctcactgttgtatcggttttgtatcagtgtt 265
            |||||||  ||||||||||| ||| ||||  ||||||||||||  ||||||||||| |||
Sbjct: 3352 acgtacgtcgagccagctctgcatagccggccactgttgtatctattttgtatcagcgtt 3411

                                     
Query: 266  tgattgtttgttcactccctttgag 290
            |||||||| ||||||||||||||||
Sbjct: 3412 tgattgttcgttcactccctttgag 3436



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 64   gactgctctaagatccactgatcga 88
            |||||||||||||||||||||||||
Sbjct: 3184 gactgctctaagatccactgatcga 3208



to top

>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  139 bits (70), Expect = 7e-30
 Identities = 190/226 (84%), Gaps = 8/226 (3%)
 Strand = Plus / Plus

                                                                       
Query: 136 tcacatacacatatatacatatacatgaataaatcctctgttatgatctccatgagagag 195
           ||||| |||||||||||||||||||||||||||| ||||| ||||||||||||| |||||
Sbjct: 493 tcacacacacatatatacatatacatgaataaatgctctgatatgatctccatgtgagag 552

                                                                       
Query: 196 agaggggaggacgtacgctgagccagctctacatggccgctcactgttgtatcggttttg 255
           | |  |||| ||||||   ||||||||| | ||| || |  ||||||||||||  |||||
Sbjct: 553 ata--ggagtacgtacatcgagccagctttgcatagctggccactgttgtatctattttg 610

                                                                       
Query: 256 tatcagtgtttgattgtttgttcactccctttgag-gagacacatacgggagtttgctgt 314
           |||||| ||||||||||| ||||||||||||||||  ||||    ||||||||||| |||
Sbjct: 611 tatcagcgtttgattgttcgttcactccctttgagctagac----acgggagtttgttgt 666

                                                         
Query: 315 acgttgtaccatgggcacttatggtatatggattataaattaatct 360
           || |||||| |||  | |||||  |||| |||||||||||||||||
Sbjct: 667 actttgtacgatgtacgcttatcatata-ggattataaattaatct 711



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 42  ctacacgatcagcgccagtgtcgactgctctaagatccactgatcga 88
           |||||||||||||||    || |||||||||||||||||||||||||
Sbjct: 385 ctacacgatcagcgcatccgtggactgctctaagatccactgatcga 431



to top

>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 57/61 (93%)
 Strand = Plus / Plus

                                                                       
Query: 136 tcacatacacatatatacatatacatgaataaatcctctgttatgatctccatgagagag 195
           ||||| |||||||||||||||||||||||||||| ||||| ||||||||||||| |||||
Sbjct: 434 tcacacacacatatatacatatacatgaataaatgctctgatatgatctccatgtgagag 493

            
Query: 196 a 196
           |
Sbjct: 494 a 494



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 42  ctacacgatcagcgccagtgtcgactgctctaagatccactgatcga 88
           |||||||||||||||    || |||||||||||||||||||||||||
Sbjct: 326 ctacacgatcagcgcatccgtggactgctctaagatccactgatcga 372



to top

>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 88/106 (83%), Gaps = 4/106 (3%)
 Strand = Plus / Plus

                                                                        
Query: 64   gactgctctaagatccactgatcgaacacgtgctccccatatctccagcgatcgacgctt 123
            |||||||||||||| | |||||| | ||| |||| || ||| | ||||||||||||||| 
Sbjct: 992  gactgctctaagattcgctgatcaaccacttgctgcctatagccccagcgatcgacgctg 1051

                                                          
Query: 124  ggtaggttgaggtcacatacacatatatacatatacatgaataaat 169
             ||| |||||||||    ||||||| ||||||||| ||||||||||
Sbjct: 1052 agtacgttgaggtc----acacatacatacatatatatgaataaat 1093



to top

>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 94/114 (82%), Gaps = 4/114 (3%)
 Strand = Plus / Plus

                                                                       
Query: 61  gtcgactgctctaagatccactgatcgaacacgtgctccccatatctccagcgatcgacg 120
           ||||||||||||||||| | |||||| | ||| |||| || ||| | ||||| |||||||
Sbjct: 384 gtcgactgctctaagattcgctgatcaaccacttgctgcctatagccccagcaatcgacg 443

                                                                 
Query: 121 cttggtaggttgaggtcacatacacatatatacatatacatgaataaatcctct 174
           ||  ||| |||||||||    ||||||| ||||||||| |||||||||| ||||
Sbjct: 444 ctgagtacgttgaggtc----acacatacatacatatatatgaataaatgctct 493



to top

>gb|AF126290.1|AF126290 Sphagnum palustre 18S ribosomal RNA gene, partial sequence
          Length = 1768

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1418 gcccttagaatgttctgggccgcacgcgcgctacac 1453



to top

>gb|AF104340.1|AF104340 Chorioactis geaster 18S ribosomal RNA gene, complete sequence
          Length = 1737

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1398 gcccttagaatgttctgggccgcacgcgcgctacac 1433



to top

>gb|U63471.1|TLU63471 Trichaptum laricinum 18S ribosomal RNA gene, internal transcribed
            spacer 1, 5.8S ribosomal RNA gene, and internal
            transcribed spacer 2, complete sequence, and 28S
            ribosomal RNA gene, partial sequence
          Length = 2377

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1398 gcccttagaatgttctgggccgcacgcgcgctacac 1433



to top

>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 88/106 (83%), Gaps = 4/106 (3%)
 Strand = Plus / Plus

                                                                        
Query: 64   gactgctctaagatccactgatcgaacacgtgctccccatatctccagcgatcgacgctt 123
            |||||||||||||| | |||||| | ||| |||| || ||| | ||||||||||||||| 
Sbjct: 2388 gactgctctaagattcgctgatcaaccacttgctgcctatagccccagcgatcgacgctg 2447

                                                          
Query: 124  ggtaggttgaggtcacatacacatatatacatatacatgaataaat 169
             ||| |||||||||    ||||||| ||||||||| ||||||||||
Sbjct: 2448 agtacgttgaggtc----acacatacatacatatatatgaataaat 2489



to top

>emb|AJ242436.1|CMI242436 Cordyceps militaris partial 18S rRNA gene, Specimen voucher
          LM1207
          Length = 351

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                            
Query: 14 ccttagnatgttctgggccgcacgcgcgctacac 47
          |||||| |||||||||||||||||||||||||||
Sbjct: 1  ccttagtatgttctgggccgcacgcgcgctacac 34



to top

>emb|AJ242435.1|CMI242435 Cordyceps militaris partial 18S rRNA gene, specimen voucher
          Cm824a
          Length = 351

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 33/34 (97%)
 Strand = Plus / Plus

                                            
Query: 14 ccttagnatgttctgggccgcacgcgcgctacac 47
          |||||| |||||||||||||||||||||||||||
Sbjct: 1  ccttagtatgttctgggccgcacgcgcgctacac 34



to top

>gb|AF007540.1|AF007540 Smittium culisetae 18S ribosomal RNA gene, partial sequence
          Length = 1816

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 38/39 (97%), Gaps = 1/39 (2%)
 Strand = Plus / Plus

                                                   
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacacgat 50
            |||||||| ||||||||||||||||||||||||||||||
Sbjct: 1476 gcccttag-atgttctgggccgcacgcgcgctacacgat 1513



to top

>gb|AY773775.1| Uncultured soil ascomycete isolate Soil.14.14 18S ribosomal RNA
           gene, partial sequence
          Length = 715

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||  |||||||||||||||||||||||||||
Sbjct: 601 gcccttangatgttctgggccgcacgcgcgctacac 636



to top

>gb|AY497574.1| Liagora valida small subunit ribosomal RNA gene, partial
          sequence; internal transcribed spacer 1, 5.8S ribosomal
          RNA gene, and internal transcribed spacer 2, complete
          sequence; and large subunit ribosomal RNA gene, partial
          sequence
          Length = 975

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                              
Query: 12 gcccttagnatgttctgggccgcacgcgcgctacac 47
          |||||||| |||||||||| ||||||||||||||||
Sbjct: 23 gcccttagtatgttctgggtcgcacgcgcgctacac 58



to top

>gb|AF535029.1| Attacus ricini 18S ribosomal RNA gene, complete sequence
          Length = 1895

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||| ||||||||||||||||||||||
Sbjct: 1539 gcccttagaatgtcctgggccgcacgcgcgctacac 1574



to top

>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 54/61 (88%), Gaps = 1/61 (1%)
 Strand = Plus / Plus

                                                                        
Query: 190  agagagagaggggaggacgtacgctgagccagctctacatggcc-gctcactgttgtatc 248
            |||||||||| | || ||||||| |||||||||||| ||||||| || ||||||||||||
Sbjct: 1520 agagagagagagaagtacgtacgttgagccagctctgcatggccggcacactgttgtatc 1579

             
Query: 249  g 249
            |
Sbjct: 1580 g 1580



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 61   gtcgactgctctaagatccactgatcgaacacgtgct 97
            ||||||||||||||||| | |||||||| ||| ||||
Sbjct: 1354 gtcgactgctctaagattcgctgatcgaccacttgct 1390



to top

>gb|AF463459.1| Attacus ricini ribosomal DNA repeat unit, complete sequence
          Length = 10324

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||| ||||||||||||||||||||||
Sbjct: 2987 gcccttagaatgtcctgggccgcacgcgcgctacac 3022



to top

>dbj|AK095100.1| Homo sapiens cDNA FLJ37781 fis, clone BRHIP2027054
          Length = 2772

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 138  acatacacatatatacatatacatgaata 166
            |||||||||||||||||||||||||||||
Sbjct: 1841 acatacacatatatacatatacatgaata 1813



to top

>gb|AC092834.3| Homo sapiens BAC clone RP13-497K6 from 4, complete sequence
          Length = 146708

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                           
Query: 138    acatacacatatatacatatacatgaata 166
              |||||||||||||||||||||||||||||
Sbjct: 102434 acatacacatatatacatatacatgaata 102462



to top

>emb|V01335.1|SCRNA5 Yeast 18S ribosomal RNA
          Length = 1798

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| | |||||||||||||||||||||||||
Sbjct: 1435 gcccttagaacgttctgggccgcacgcgcgctacac 1470



to top

>gb|J01353.1|YSCRGEA Yeast (S.cerevisiae) 18S ribosomal RNA gene
          Length = 1798

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| | |||||||||||||||||||||||||
Sbjct: 1435 gcccttagaacgttctgggccgcacgcgcgctacac 1470



to top

>emb|AJ242434.1|PNI242434 Phytocordyceps ninchukispora partial 18S rRNA gene strain CCRC
          31900
          Length = 350

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                          
Query: 16 ttagnatgttctgggccgcacgcgcgctacac 47
          |||| |||||||||||||||||||||||||||
Sbjct: 1  ttagtatgttctgggccgcacgcgcgctacac 32



to top

>dbj|AB061218.1| Placidia cafeteriopsis gene for 18S ribosomal RNA, partial sequence
          Length = 1751

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||| ||||||||||||||||||||||
Sbjct: 1403 gcccttagaatgtcctgggccgcacgcgcgctacac 1438



to top

>gb|AY818951.1| Plantago rugelii 18S ribosomal RNA (rrn18) gene, partial sequence
          Length = 1182

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 875 gcccttag-atgttctgggccgcacgcgcgctacac 909



to top

>gb|AY850007.1| Cerrena unicolor 18S ribosomal RNA gene, partial sequence
          Length = 1775

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1421 gcccttag-atgttctgggccgcacgcgcgctacac 1455



to top

>gb|AY856456.1| Uncultured Glomus isolate 3 18S ribosomal RNA gene, partial
           sequence; and internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence
          Length = 930

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 180 gcccttag-atgttctgggccgcacgcgcgctacac 214



to top

>gb|AY856455.1| Uncultured Glomus isolate 2 18S ribosomal RNA gene, partial
           sequence; and internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence
          Length = 930

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 176 gcccttag-atgttctgggccgcacgcgcgctacac 210



to top

>gb|AY654887.1| Fibulorhizoctonia sp. LA082103L 18S ribosomal RNA gene, partial
            sequence
          Length = 1773

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1430 gcccttag-atgttctgggccgcacgcgcgctacac 1464



to top

>gb|AY692319.1| Amphibiocystidium ranae strain 2-04 18S ribosomal RNA gene, complete
            sequence
          Length = 1767

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1406 gcccttag-atgttctgggccgcacgcgcgctacac 1440



to top

>gb|AY550245.1| Amphibiocystidium ranae 18S ribosomal RNA gene, internal transcribed
            spacer 1, 5.8S ribosomal RNA gene, internal transcribed
            spacer 2, and 28S ribosomal RNA gene, complete sequence
          Length = 3028

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1409 gcccttag-atgttctgggccgcacgcgcgctacac 1443



to top

>gb|AY572312.1| Aristolochia grandiflora 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1400 gcccttag-atgttctgggccgcacgcgcgctacac 1434



to top

>gb|AY572311.1| Cinnamosma madagascariensis 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1708

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1400 gcccttag-atgttctgggccgcacgcgcgctacac 1434



to top

>gb|AY572310.1| Pseudowintera axillaris 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1709

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1401 gcccttag-atgttctgggccgcacgcgcgctacac 1435



to top

>gb|AY572309.1| Gymnotheca involucrata 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1708

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1400 gcccttag-atgttctgggccgcacgcgcgctacac 1434



to top

>gb|AY572308.1| Gymnotheca chinensis 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1699

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1400 gcccttag-atgttctgggccgcacgcgcgctacac 1434



to top

>gb|AY572307.1| Drimys winteri 18S ribosomal RNA gene, partial sequence; chloroplast
          Length = 1705

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1398 gcccttag-atgttctgggccgcacgcgcgctacac 1432



to top

>gb|AY572306.1| Aristolochia gigantea 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1708

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1400 gcccttag-atgttctgggccgcacgcgcgctacac 1434



to top

>gb|AY572305.1| Houttuynia cordata 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1707

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1400 gcccttag-atgttctgggccgcacgcgcgctacac 1434



to top

>gb|AY572304.1| Anemopsis californica 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1702

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1399 gcccttag-atgttctgggccgcacgcgcgctacac 1433



to top

>gb|AY572303.1| Saururus chinensis 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1708

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1400 gcccttag-atgttctgggccgcacgcgcgctacac 1434



to top

>gb|AY572301.1| Sarcorhachis sydowii 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1707

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1399 gcccttag-atgttctgggccgcacgcgcgctacac 1433



to top

>gb|AY572300.1| Zippelia begoniifolia 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1696

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1399 gcccttag-atgttctgggccgcacgcgcgctacac 1433



to top

>gb|AY572299.1| Piper arborescens 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1708

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1400 gcccttag-atgttctgggccgcacgcgcgctacac 1434



to top

>gb|AY572298.1| Piper aduncum 18S ribosomal RNA gene, partial sequence; chloroplast
          Length = 1707

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1399 gcccttag-atgttctgggccgcacgcgcgctacac 1433



to top

>gb|AY572297.1| Piper umbellatum 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1697

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1399 gcccttag-atgttctgggccgcacgcgcgctacac 1433



to top

>gb|AY572296.1| Piper excelsum 18S ribosomal RNA gene, partial sequence; chloroplast
          Length = 1707

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1399 gcccttag-atgttctgggccgcacgcgcgctacac 1433



to top

>gb|AY572295.1| Piper hispidum 18S ribosomal RNA gene, partial sequence; chloroplast
          Length = 1697

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1399 gcccttag-atgttctgggccgcacgcgcgctacac 1433



to top

>gb|AY665533.1| Yemma signatus 18S ribosomal RNA gene, partial sequence
          Length = 738

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 408 gcccttag-atgttctgggccgcacgcgcgctacac 442



to top

>gb|AY665532.1| Phaenacantha bicolor 18S ribosomal RNA gene, partial sequence
          Length = 740

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 408 gcccttag-atgttctgggccgcacgcgcgctacac 442



to top

>gb|AY665531.1| Panaorus albomaculatus 18S ribosomal RNA gene, partial sequence
          Length = 737

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 409 gcccttag-atgttctgggccgcacgcgcgctacac 443



to top

>gb|AY665530.1| Oxycarenus brunneus 18S ribosomal RNA gene, partial sequence
          Length = 735

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 406 gcccttag-atgttctgggccgcacgcgcgctacac 440



to top

>gb|AY665529.1| Macropes exilis 18S ribosomal RNA gene, partial sequence
          Length = 741

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 410 gcccttag-atgttctgggccgcacgcgcgctacac 444



to top

>gb|AY665527.1| Geocoris pallidipennis 18S ribosomal RNA gene, partial sequence
          Length = 738

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 408 gcccttag-atgttctgggccgcacgcgcgctacac 442



to top

>gb|AY665526.1| Cymus tumescens 18S ribosomal RNA gene, partial sequence
          Length = 738

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 407 gcccttag-atgttctgggccgcacgcgcgctacac 441



to top

>gb|AY206425.1| Caulerpa cupressoides 18S ribosomal RNA gene, partial sequence;
          internal transcribed spacer 1, 5.8S ribosomal RNA gene
          and internal transcribed spacer 2, complete sequence;
          and 28S ribosomal RNA gene, partial sequence
          Length = 981

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                              
Query: 12 gcccttagnatgttctgggccgcacgcgcgctacac 47
          |||||||| |||||||||||||||||||||||||||
Sbjct: 23 gcccttag-atgttctgggccgcacgcgcgctacac 57



to top

>gb|AY206424.1| Caulerpa cupressoides 18S ribosomal RNA gene, partial sequence;
          internal transcribed spacer 1, 5.8S ribosomal RNA gene
          and internal transcribed spacer 2, complete sequence;
          and 28S ribosomal RNA gene, partial sequence
          Length = 980

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                              
Query: 12 gcccttagnatgttctgggccgcacgcgcgctacac 47
          |||||||| |||||||||||||||||||||||||||
Sbjct: 22 gcccttag-atgttctgggccgcacgcgcgctacac 56



to top

>gb|AY652582.1| Trichoplax sp. H3 18S ribosomal RNA gene, partial sequence
          Length = 442

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 234 gcccttag-atgttctgggccgcacgcgcgctacac 268



to top

>gb|AY652581.1| Trichoplax sp. H8 18S ribosomal RNA gene, partial sequence
          Length = 1781

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1430 gcccttag-atgttctgggccgcacgcgcgctacac 1464



to top

>gb|AY652580.1| Trichoplax sp. H4 18S ribosomal RNA gene, partial sequence
          Length = 1202

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 857 gcccttag-atgttctgggccgcacgcgcgctacac 891



to top

>gb|AY652579.1| Trichoplax sp. H7 18S ribosomal RNA gene, partial sequence
          Length = 1775

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1431 gcccttag-atgttctgggccgcacgcgcgctacac 1465



to top

>gb|AY652578.1| Trichoplax sp. H1 18S ribosomal RNA gene, partial sequence
          Length = 1742

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1393 gcccttag-atgttctgggccgcacgcgcgctacac 1427



to top

>gb|AY652577.1| Trichoplax sp. H2 18S ribosomal RNA gene, partial sequence
          Length = 1730

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1393 gcccttag-atgttctgggccgcacgcgcgctacac 1427



to top

>gb|AF084235.1| Stephanoeca diplocostata 18S ribosomal RNA gene, partial sequence
          Length = 1788

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1434 gcccttag-atgttctgggccgcacgcgcgctacac 1468



to top

>gb|AF084234.1| Diaphanoeca grandis 18S ribosomal RNA gene, partial sequence
          Length = 1794

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1430 gcccttag-atgttctgggccgcacgcgcgctacac 1464



to top

>gb|AF084233.1| Acanthoeca spectabilis 18S ribosomal RNA gene, partial sequence
          Length = 1740

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1414 gcccttag-atgttctgggccgcacgcgcgctacac 1448



to top

>gb|AF084230.1| Monosiga ovata 18S ribosomal RNA gene, partial sequence
          Length = 1765

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1405 gcccttag-atgttctgggccgcacgcgcgctacac 1439



to top

>gb|AF528564.1| Peronospora corydalis from Corydalis speciosa Max. 18S ribosomal
          RNA gene, partial sequence; internal transcribed spacer
          1 and 5.8S ribosomal RNA gene, complete sequence; and
          internal transcribed spacer 2, partial sequence
          Length = 1202

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                              
Query: 12 gcccttagnatgttctgggccgcacgcgcgctacac 47
          |||||||| |||||||||||||||||||||||||||
Sbjct: 38 gcccttag-atgttctgggccgcacgcgcgctacac 72



to top

>gb|AF528563.1| Peronospora corydalis from Corydalis speciosa Max. 18S ribosomal
          RNA gene, partial sequence; internal transcribed spacer
          1 and 5.8S ribosomal RNA gene, complete sequence; and
          internal transcribed spacer 2, partial sequence
          Length = 1201

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                              
Query: 12 gcccttagnatgttctgggccgcacgcgcgctacac 47
          |||||||| |||||||||||||||||||||||||||
Sbjct: 38 gcccttag-atgttctgggccgcacgcgcgctacac 72



to top

>gb|AF528562.1| Peronospora corydalis from Corydalis ochotensis Turcz. 18S
          ribosomal RNA gene, partial sequence; internal
          transcribed spacer 1 and 5.8S ribosomal RNA gene,
          complete sequence; and internal transcribed spacer 2,
          partial sequence
          Length = 1201

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                              
Query: 12 gcccttagnatgttctgggccgcacgcgcgctacac 47
          |||||||| |||||||||||||||||||||||||||
Sbjct: 38 gcccttag-atgttctgggccgcacgcgcgctacac 72



to top

>gb|AF528561.1| Peronospora corydalis from Corydalis ochotensis Turcz. 18S
          ribosomal RNA gene, partial sequence; internal
          transcribed spacer 1 and 5.8S ribosomal RNA gene,
          complete sequence; and internal transcribed spacer 2,
          partial sequence
          Length = 1201

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                              
Query: 12 gcccttagnatgttctgggccgcacgcgcgctacac 47
          |||||||| |||||||||||||||||||||||||||
Sbjct: 38 gcccttag-atgttctgggccgcacgcgcgctacac 72



to top

>gb|AF528560.1| Peronospora farinosa from Spinacia oleracea 18S ribosomal RNA
          gene, partial sequence; internal transcribed spacer 1
          and 5.8S ribosomal RNA gene, complete sequence; and
          internal transcribed spacer 2, partial sequence
          Length = 1201

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                              
Query: 12 gcccttagnatgttctgggccgcacgcgcgctacac 47
          |||||||| |||||||||||||||||||||||||||
Sbjct: 38 gcccttag-atgttctgggccgcacgcgcgctacac 72



to top

>gb|AF528559.1| Peronospora farinosa from Spinacia oleracea 18S ribosomal RNA
          gene, partial sequence; internal transcribed spacer 1
          and 5.8S ribosomal RNA gene, complete sequence; and
          internal transcribed spacer 2, partial sequence
          Length = 1201

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                              
Query: 12 gcccttagnatgttctgggccgcacgcgcgctacac 47
          |||||||| |||||||||||||||||||||||||||
Sbjct: 38 gcccttag-atgttctgggccgcacgcgcgctacac 72



to top

>gb|AF528558.1| Peronospora farinosa from Chenopodium ficifolium Smith. 18S
          ribosomal RNA gene, partial sequence; internal
          transcribed spacer 1 and 5.8S ribosomal RNA gene,
          complete sequence; and internal transcribed spacer 2,
          partial sequence
          Length = 1197

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                              
Query: 12 gcccttagnatgttctgggccgcacgcgcgctacac 47
          |||||||| |||||||||||||||||||||||||||
Sbjct: 38 gcccttag-atgttctgggccgcacgcgcgctacac 72



to top

>gb|AF528556.1| Peronospora farinosa from Chenopodium album L. 18S ribosomal RNA
          gene, partial sequence; internal transcribed spacer 1
          and 5.8S ribosomal RNA gene, complete sequence; and
          internal transcribed spacer 2, partial sequence
          Length = 1198

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                              
Query: 12 gcccttagnatgttctgggccgcacgcgcgctacac 47
          |||||||| |||||||||||||||||||||||||||
Sbjct: 38 gcccttag-atgttctgggccgcacgcgcgctacac 72



to top

>gb|AY261369.1| Beauveria felina strain CBS 250.34 18S ribosomal RNA gene, internal
            transcribed spacer 1, 5.8S ribosomal RNA gene and
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 2286

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1396 gcccttag-atgttctgggccgcacgcgcgctacac 1430



to top

>gb|AY261368.1| Beauveria felina strain CBS 173.71 18S ribosomal RNA gene, internal
            transcribed spacer 1, 5.8S ribosomal RNA gene and
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 2285

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1396 gcccttag-atgttctgggccgcacgcgcgctacac 1430



to top

>gb|AY261367.1| Beauveria felina strain HL-51-ALSP16-I003 18S ribosomal RNA gene,
            internal transcribed spacer 1, 5.8S ribosomal RNA gene
            and internal transcribed spacer 2, complete sequence; and
            28S ribosomal RNA gene, partial sequence
          Length = 2286

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1396 gcccttag-atgttctgggccgcacgcgcgctacac 1430



to top

>gb|AY249900.1| Bionectria pityrodes strain CBS 246.78 18S ribosomal RNA gene,
            complete sequence
          Length = 1728

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1396 gcccttag-atgttctgggccgcacgcgcgctacac 1430



to top

>gb|AY249899.1| Bionectria pityrodes strain CBS 102033 18S ribosomal RNA gene,
            complete sequence
          Length = 1728

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1396 gcccttag-atgttctgggccgcacgcgcgctacac 1430



to top

>gb|AY249898.1| Bionectria pityrodes 18S ribosomal RNA gene, complete sequence
          Length = 1728

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1396 gcccttag-atgttctgggccgcacgcgcgctacac 1430



to top

>gb|AY313034.2| Bullera nakhonratchasimensis 18S ribosomal RNA gene, partial
            sequence; internal transcribed spacer 1, 5.8S ribosomal
            RNA gene, and internal transcribed spacer 2, complete
            sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 2270

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1418 gcccttag-atgttctgggccgcacgcgcgctacac 1452



to top

>gb|AY037173.1| Oxya chinensis 18S ribosomal RNA gene, complete sequence
          Length = 1888

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1546 gcccttag-atgttctgggccgcacgcgcgctacac 1580



to top

>gb|AY839843.1| Diehliomyces microsporus 18S ribosomal RNA gene, partial sequence
          Length = 1773

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1419 gcccttag-atgttctgggccgcacgcgcgctacac 1453



to top

>gb|AY839830.1| Inonotus baumii 18S ribosomal RNA gene, partial sequence
          Length = 1779

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1422 gcccttag-atgttctgggccgcacgcgcgctacac 1456



to top

>gb|AY839829.1| Inonotus linteus 18S ribosomal RNA gene, partial sequence
          Length = 1777

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1422 gcccttag-atgttctgggccgcacgcgcgctacac 1456



to top

>gb|AY839828.1| Inonotus linteus strain ASI26082 18S ribosomal RNA gene, partial
            sequence
          Length = 1777

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1422 gcccttag-atgttctgggccgcacgcgcgctacac 1456



to top

>gb|AY672801.1| Euphausia superba small subunit ribosomal RNA gene, partial sequence
          Length = 1806

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1472 gcccttag-atgttctgggccgcacgcgcgctacac 1506



to top

>gb|AY672802.1| Fragilariopsis cylindrus small subunit ribosomal RNA gene, partial
            sequence
          Length = 1744

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1412 gcccttag-atgttctgggccgcacgcgcgctacac 1446



to top

>gb|AY422222.1| Uncultured phototrophic eukaryote clone Nccln9shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 686

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 520 gcccttag-atgttctgggccgcacgcgcgctacac 554



to top

>gb|AY422221.1| Uncultured phototrophic eukaryote clone NCcln5shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 686

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 520 gcccttag-atgttctgggccgcacgcgcgctacac 554



to top

>gb|AY422220.1| Uncultured phototrophic eukaryote clone NCcln6shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 686

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 520 gcccttag-atgttctgggccgcacgcgcgctacac 554



to top

>gb|AY422219.1| Uncultured phototrophic eukaryote clone NCcln1shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 686

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 520 gcccttag-atgttctgggccgcacgcgcgctacac 554



to top

>gb|AY422218.1| Uncultured phototrophic eukaryote clone NCcln2shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 685

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 519 gcccttag-atgttctgggccgcacgcgcgctacac 553



to top

>gb|AY422217.1| Uncultured phototrophic eukaryote clone NCcln10shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 685

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 519 gcccttag-atgttctgggccgcacgcgcgctacac 553



to top

>gb|AY422216.1| Uncultured phototrophic eukaryote clone NCcln4shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 685

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 519 gcccttag-atgttctgggccgcacgcgcgctacac 553



to top

>gb|DQ092918.1| Anamika angustilamellata isolate AFTOL-ID 543 18S ribosomal RNA gene,
            partial sequence
          Length = 1792

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1438 gcccttag-atgttctgggccgcacgcgcgctacac 1472



to top

>gb|AY465354.1| Bangia sp. WELT A23126 18S ribosomal RNA gene, partial sequence
          Length = 1749

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1425 gcccttag-atgttctgggccgcacgcgcgctacac 1459



to top

>gb|AY465355.1| Bangia sp. WELT A25775 18S ribosomal RNA gene, partial sequence
          Length = 1756

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1432 gcccttag-atgttctgggccgcacgcgcgctacac 1466



to top

>gb|AY289649.1| Nypa fruticans 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289648.1| Aegiceras corniculatum 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289647.1| Barringtonia racemosa 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1383 gcccttag-atgttctgggccgcacgcgcgctacac 1417



to top

>gb|AY289646.1| Scyphiphora hydrophyllacea 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289645.1| Cerbera manghas 18S ribosomal RNA gene, partial sequence
          Length = 1668

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1382 gcccttag-atgttctgggccgcacgcgcgctacac 1416



to top

>gb|AY289644.1| Clerodendrum inerme 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1383 gcccttag-atgttctgggccgcacgcgcgctacac 1417



to top

>gb|AY289643.1| Dolichandrone spathacea 18S ribosomal RNA gene, partial sequence
          Length = 1668

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1382 gcccttag-atgttctgggccgcacgcgcgctacac 1416



to top

>gb|AY289642.1| Acanthus ebracteatus 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1383 gcccttag-atgttctgggccgcacgcgcgctacac 1417



to top

>gb|AY289641.1| Avicennia marina 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1383 gcccttag-atgttctgggccgcacgcgcgctacac 1417



to top

>gb|AY289640.1| Aegialitis annulata 18S ribosomal RNA gene, partial sequence
          Length = 1671

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1385 gcccttag-atgttctgggccgcacgcgcgctacac 1419



to top

>gb|AY289639.1| Pemphis acidula 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1383 gcccttag-atgttctgggccgcacgcgcgctacac 1417



to top

>gb|AY289638.1| Sonneratia ovata 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289637.1| Lumnitzera littorea 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289636.1| Conocarpus erectus 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289635.1| Laguncularia racemosa 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289634.1| Xylocarpus granatum 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289633.1| Heritiera littoralis 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289632.1| Thespesia populnea 18S ribosomal RNA gene, partial sequence
          Length = 1668

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1382 gcccttag-atgttctgggccgcacgcgcgctacac 1416



to top

>gb|AY289631.1| Hibiscus tiliaceus 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1383 gcccttag-atgttctgggccgcacgcgcgctacac 1417



to top

>gb|AY289630.1| Cynometra iripa 18S ribosomal RNA gene, partial sequence
          Length = 1668

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1383 gcccttag-atgttctgggccgcacgcgcgctacac 1417



to top

>gb|AY289629.1| Pongamia pinnata 18S ribosomal RNA gene, partial sequence
          Length = 1668

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1382 gcccttag-atgttctgggccgcacgcgcgctacac 1416



to top

>gb|AY289628.1| Excoecaria agallocha 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289627.1| Rhizophora stylosa 18S ribosomal RNA gene, partial sequence
          Length = 1671

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1385 gcccttag-atgttctgggccgcacgcgcgctacac 1419



to top

>gb|AY289626.1| Bruguiera sexangula 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289625.1| Kandelia candel 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY289624.1| Ceriops tagal 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1384 gcccttag-atgttctgggccgcacgcgcgctacac 1418



to top

>gb|AY823528.1| Jatropha curcas 18S ribosomal RNA gene, partial sequence
          Length = 1451

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1387 gcccttag-atgttctgggccgcacgcgcgctacac 1421



to top

>gb|AY734450.1| Haliclona oculata 18S ribosomal RNA gene, complete sequence
          Length = 1975

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1617 gcccttag-atgttctgggccgcacgcgcgctacac 1651



to top

>gb|AY734449.1| Dysidea sp. 23-XI-02-2-001 N27 18S ribosomal RNA gene, complete
            sequence
          Length = 1769

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1426 gcccttag-atgttctgggccgcacgcgcgctacac 1460



to top

>gb|AY734448.1| Ircinia felix 18S ribosomal RNA gene, complete sequence
          Length = 1791

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1438 gcccttag-atgttctgggccgcacgcgcgctacac 1472



to top

>gb|AY734447.1| Calyx podatypa 18S ribosomal RNA gene, complete sequence
          Length = 1788

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1441 gcccttag-atgttctgggccgcacgcgcgctacac 1475



to top

>gb|AY734444.1| Haliclona sp. sp5 18S ribosomal RNA gene, complete sequence
          Length = 1983

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1631 gcccttag-atgttctgggccgcacgcgcgctacac 1665



to top

>gb|AY734443.1| Agelas conifera 18S ribosomal RNA gene, complete sequence
          Length = 1798

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1448 gcccttag-atgttctgggccgcacgcgcgctacac 1482



to top

>gb|AY734442.1| Pseudaxinella lunaecharta 18S ribosomal RNA gene, complete sequence
          Length = 1794

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1447 gcccttag-atgttctgggccgcacgcgcgctacac 1481



to top

>gb|AY734440.1| Spheciospongia vesparium 18S ribosomal RNA gene, complete sequence
          Length = 1786

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1442 gcccttag-atgttctgggccgcacgcgcgctacac 1476



to top

>gb|AY734439.1| Cinachyrella sp. sp11 18S ribosomal RNA gene, complete sequence
          Length = 1792

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1439 gcccttag-atgttctgggccgcacgcgcgctacac 1473



to top

>gb|AY734438.1| Cinachyrella sp. 24-XI-02-3-2 N28 18S ribosomal RNA gene, complete
            sequence
          Length = 1786

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1439 gcccttag-atgttctgggccgcacgcgcgctacac 1473



to top

>gb|AY734437.1| Cinachyrella sp. 22-XI-02-1-13 N25 18S ribosomal RNA gene, complete
            sequence
          Length = 1802

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1449 gcccttag-atgttctgggccgcacgcgcgctacac 1483



to top

>gb|AF005243.2| Blattella germanica 18S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 1, 5.8S ribosomal RNA gene,
            internal transcribed spacer 2, and 28S ribosomal RNA
            gene, complete sequence; and intergenic spacer and
            external transcribed spacer regions
          Length = 9015

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1598 gcccttag-atgttctgggccgcacgcgcgctacac 1632



to top

>gb|AF280078.1| Phalansterium solitarium 18S ribosomal RNA gene, partial sequence
          Length = 1876

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1511 gcccttag-atgttctgggccgcacgcgcgctacac 1545



to top

>gb|DQ227859.1| Porphyra yezoensis isolate NS007 small subunit ribosomal RNA gene,
            partial sequence
          Length = 2345

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1969 gcccttag-atgttctgggccgcacgcgcgctacac 2003



to top

>gb|DQ227858.1| Porphyra yezoensis isolate NS006 small subunit ribosomal RNA gene,
            partial sequence
          Length = 3281

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1946 gcccttag-atgttctgggccgcacgcgcgctacac 1980



to top

>gb|DQ227857.1| Porphyra yezoensis isolate NS005 small subunit ribosomal RNA gene,
            partial sequence
          Length = 2876

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1971 gcccttag-atgttctgggccgcacgcgcgctacac 2005



to top

>gb|DQ227856.1| Porphyra yezoensis isolate NS004 small subunit ribosomal RNA gene,
            partial sequence
          Length = 3314

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1972 gcccttag-atgttctgggccgcacgcgcgctacac 2006



to top

>gb|DQ227855.1| Porphyra yezoensis isolate NS003 small subunit ribosomal RNA gene,
            partial sequence
          Length = 3280

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1971 gcccttag-atgttctgggccgcacgcgcgctacac 2005



to top

>gb|DQ227854.1| Porphyra yezoensis isolate NS002 small subunit ribosomal RNA gene,
            partial sequence
          Length = 2877

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1972 gcccttag-atgttctgggccgcacgcgcgctacac 2006



to top

>gb|DQ227853.1| Porphyra yezoensis isolate NS001 small subunit ribosomal RNA gene,
            partial sequence
          Length = 2874

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1969 gcccttag-atgttctgggccgcacgcgcgctacac 2003



to top

>gb|DQ234257.1| Chaetomium globosum 18S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 1, 5.8S ribosomal RNA gene,
            and internal transcribed spacer 2, complete sequence; and
            26S ribosomal RNA gene, partial sequence
          Length = 2225

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1369 gcccttag-atgttctgggccgcacgcgcgctacac 1403



to top

>gb|DQ234563.1| Platygloea disciformis isolate AFTOL-ID 710 18S small subunit
            ribosomal RNA gene, partial sequence
          Length = 1788

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1424 gcccttag-atgttctgggccgcacgcgcgctacac 1458



to top

>gb|DQ234543.1| Bensingtonia yuccicola isolate AFTOL-ID 857 18S small subunit
            ribosomal RNA gene, partial sequence
          Length = 1799

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1435 gcccttag-atgttctgggccgcacgcgcgctacac 1469



to top

>gb|DQ234542.1| Auricularia sp. PBM2295 18S small subunit ribosomal RNA gene, partial
            sequence
          Length = 1788

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1424 gcccttag-atgttctgggccgcacgcgcgctacac 1458



to top

>gb|AY755703.1| Ephedra pachyclada voucher (S) C-7844 18S ribosomal RNA gene, partial
            sequence
          Length = 1624

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1369 gcccttag-atgttctgggccgcacgcgcgctacac 1403



to top

>gb|AY755701.1| Ephedra campylopoda voucher (S) C-7605 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755700.1| Ephedra ciliata voucher (S) C-591 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755699.1| Ephedra foliata voucher (S) C-7808 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755698.1| Ephedra alata voucher (S) C-303 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755697.1| Ephedra altissima voucher (S) C-7688 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755696.1| Ephedra altissima voucher (S) C-628 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755695.1| Ephedra aphylla voucher (S) C-7791 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755694.1| Ephedra equisetina voucher (S) C-465-2 18S ribosomal RNA gene,
            partial sequence
          Length = 1467

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755693.1| Ephedra distachya voucher (S) 03-684 18S ribosomal RNA gene, partial
            sequence
          Length = 1461

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755692.1| Ephedra tweediana voucher (UC) 66-0742 18S ribosomal RNA gene,
            partial sequence
          Length = 1467

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755691.1| Ephedra chilensis voucher (UC) 49-0542 18S ribosomal RNA gene,
            partial sequence
          Length = 1646

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755689.1| Ephedra rupestris voucher (UC) 87-1368 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755688.1| Ephedra nevadensis voucher (UC) 66-1033 18S ribosomal RNA gene,
            partial sequence
          Length = 1689

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755687.1| Ephedra trifurca voucher (Mo) 04630447 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755686.1| Ephedra distachya voucher (S) 04-481 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755685.1| Ephedra gerardiana voucher (O) 74-460 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755684.1| Ephedra torreyana voucher (S) 04-487 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755683.1| Ephedra intermedia voucher (S) 04-483 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755682.1| Ephedra antisyphilitica voucher (S) 04-488 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755681.1| Ephedra minuta voucher (S) 04-486 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755680.1| Ephedra minuta voucher (S) 04-485 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755679.1| Ephedra chilensis voucher (E) E00130260 18S ribosomal RNA gene,
            partial sequence
          Length = 1689

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755678.1| Ephedra gerardiana voucher (E) E00130259 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755676.1| Ephedra californica voucher (O) 68-154 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755675.1| Ephedra sinica voucher (S) CRetoh 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755674.1| Ephedra frustillata voucher (K) 10218 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755672.1| Ephedra monosperma voucher (K) 10142 18S ribosomal RNA gene, partial
            sequence
          Length = 1661

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755671.1| Ephedra gerardiana voucher (K) 10141 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755670.1| Ephedra andina voucher (K) 10140 18S ribosomal RNA gene, partial
            sequence
          Length = 1463

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1390 gcccttag-atgttctgggccgcacgcgcgctacac 1424



to top

>gb|AY755669.1| Ephedra frustillata voucher (S) 04-482 18S ribosomal RNA gene,
            partial sequence
          Length = 1689

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755668.1| Ephedra minuta voucher (S) 03-930 18S ribosomal RNA gene, partial
            sequence
          Length = 1462

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755667.1| Ephedra intermedia voucher (S) 03-925 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755666.1| Ephedra equisetina voucher (S) 03-928 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755665.1| Ephedra likiangensis voucher (S) 03-926 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1394 gcccttag-atgttctgggccgcacgcgcgctacac 1428



to top

>gb|AY755664.1| Gnetum montanum voucher (E) E00130261 18S ribosomal RNA gene, partial
            sequence
          Length = 1690

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1395 gcccttag-atgttctgggccgcacgcgcgctacac 1429



to top

>gb|AY755663.1| Gnetum indicum voucher (E) E00130257 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1395 gcccttag-atgttctgggccgcacgcgcgctacac 1429



to top

>gb|AY755662.1| Gnetum parvifolium voucher (S) CRetoh 18S ribosomal RNA gene, partial
            sequence
          Length = 1690

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1395 gcccttag-atgttctgggccgcacgcgcgctacac 1429



to top

>gb|AY755661.1| Gnetum costatum voucher (K) 10219 18S ribosomal RNA gene, partial
            sequence
          Length = 1691

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1396 gcccttag-atgttctgggccgcacgcgcgctacac 1430



to top

>gb|AY755660.1| Gnetum gnemon voucher (S) 03-926 18S ribosomal RNA gene, partial
            sequence
          Length = 1691

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1396 gcccttag-atgttctgggccgcacgcgcgctacac 1430



to top

>gb|AY744286.1| Uncultured Leptosphaeriaceae clone Arch3573.1 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1,
           5.8S ribosomal RNA gene, and internal transcribed spacer
           2, complete sequence; and 28S ribosomal RNA gene,
           partial sequence
          Length = 987

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 97  gcccttag-atgttctgggccgcacgcgcgctacac 131



to top

>gb|AY744285.1| Uncultured mycorrhiza (Archaeosporaceae) clone Arch3538.1 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 1007

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 100 gcccttag-atgttctgggccgcacgcgcgctacac 134



to top

>gb|AY744279.1| Uncultured glomeraceous AM fungus clone Glom3538.2 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 28S ribosomal RNA gene,
           partial sequence
          Length = 976

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 92  gcccttag-atgttctgggccgcacgcgcgctacac 126



to top

>gb|AY744278.1| Uncultured glomeraceous AM fungus clone Glom3524.1 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 28S ribosomal RNA gene,
           partial sequence
          Length = 983

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 92  gcccttag-atgttctgggccgcacgcgcgctacac 126



to top

>gb|AY744277.1| Uncultured glomeraceous AM fungus clone Glom3523.1 18S ribosomal
           RNA gene, partial sequence; and internal transcribed
           spacer 1, complete sequence
          Length = 600

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 93  gcccttag-atgttctgggccgcacgcgcgctacac 127



to top

>gb|AY803753.1| Trechispora sp. PBM418 isolate AFTOL-ID 678 18S ribosomal RNA gene,
            complete sequence
          Length = 1789

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1438 gcccttag-atgttctgggccgcacgcgcgctacac 1472



to top

>gb|AY803752.1| Tilletiaria anomala isolate AFTOL-ID 865 18S ribosomal RNA gene,
            complete sequence
          Length = 1783

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1431 gcccttag-atgttctgggccgcacgcgcgctacac 1465



to top

>gb|AY676694.1| Syneta adamsi 18S ribosomal RNA gene, partial sequence
          Length = 1888

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1557 gcccttag-atgttctgggccgcacgcgcgctacac 1591



to top

>gb|AY676693.1| Polyoptilis sp. Sa02 18S ribosomal RNA gene, partial sequence
          Length = 1689

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1475 gcccttag-atgttctgggccgcacgcgcgctacac 1509



to top

>gb|AY676692.1| Sagra sp. Sa04 18S ribosomal RNA gene, partial sequence
          Length = 741

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 533 gcccttag-atgttctgggccgcacgcgcgctacac 567



to top

>gb|AY676691.1| Sagra sp. Sa03 18S ribosomal RNA gene, partial sequence
          Length = 1776

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1566 gcccttag-atgttctgggccgcacgcgcgctacac 1600



to top

>gb|AY676688.1| Lamprosoma sp. LP01 18S ribosomal RNA gene, partial sequence
          Length = 1865

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1551 gcccttag-atgttctgggccgcacgcgcgctacac 1585



to top

>gb|AY676686.1| Lema trilineata 18S ribosomal RNA gene, partial sequence
          Length = 1796

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1503 gcccttag-atgttctgggccgcacgcgcgctacac 1537



to top

>gb|AY676685.1| Ornithia sp. ORN01 18S ribosomal RNA gene, partial sequence
          Length = 1829

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                                
Query: 12   gcccttagnatgttctgggccgcacgcgcgctacac 47
            |||||||| |||||||||||||||||||||||||||
Sbjct: 1537 gcccttag-atgttctgggccgcacgcgcgctacac 1571



to top

>gb|AY773761.1| Uncultured rhizosphere basidiomycete isolate Root.24.03 18S
           ribosomal RNA gene, partial sequence
          Length = 733

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 612 gcccttag-atgttctgggccgcacgcgcgctacac 646



to top

>gb|AY773760.1| Uncultured rhizosphere ascomycete isolate Root.24.02 18S ribosomal
           RNA gene, partial sequence
          Length = 708

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 592 gcccttag-atgttctgggccgcacgcgcgctacac 626



to top

>gb|AY773759.1| Uncultured rhizosphere ascomycete isolate Root.23.17 18S ribosomal
           RNA gene, partial sequence
          Length = 681

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 567 gcccttag-atgttctgggccgcacgcgcgctacac 601



to top

>gb|AY773758.1| Uncultured rhizosphere ascomycete isolate Root.23.12 18S ribosomal
           RNA gene, partial sequence
          Length = 716

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 602 gcccttag-atgttctgggccgcacgcgcgctacac 636



to top

>gb|AY773757.1| Uncultured rhizosphere ascomycete isolate Root.23.06 18S ribosomal
           RNA gene, partial sequence
          Length = 716

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 600 gcccttag-atgttctgggccgcacgcgcgctacac 634



to top

>gb|AY773754.1| Uncultured rhizosphere ascomycete isolate Root.23.02 18S ribosomal
           RNA gene, partial sequence
          Length = 724

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 610 gcccttag-atgttctgggccgcacgcgcgctacac 644



to top

>gb|AY773752.1| Uncultured rhizosphere ascomycete isolate Root.22.15 18S ribosomal
           RNA gene, partial sequence
          Length = 709

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 596 gcccttag-atgttctgggccgcacgcgcgctacac 630



to top

>gb|AY773750.1| Uncultured rhizosphere ascomycete isolate Root.22.07 18S ribosomal
           RNA gene, partial sequence
          Length = 715

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 601 gcccttag-atgttctgggccgcacgcgcgctacac 635



to top

>gb|AY773749.1| Uncultured rhizosphere basidiomycete isolate Root.22.06 18S
           ribosomal RNA gene, partial sequence
          Length = 733

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 611 gcccttag-atgttctgggccgcacgcgcgctacac 645



to top

>gb|AY773748.1| Uncultured rhizosphere basidiomycete isolate Root.22.01 18S
           ribosomal RNA gene, partial sequence
          Length = 733

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 611 gcccttag-atgttctgggccgcacgcgcgctacac 645



to top

>gb|AY773746.1| Uncultured rhizosphere ascomycete isolate Root.21.18 18S ribosomal
           RNA gene, partial sequence
          Length = 714

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 602 gcccttag-atgttctgggccgcacgcgcgctacac 636



to top

>gb|AY773745.1| Uncultured rhizosphere zygomycete isolate Root.21.15 18S ribosomal
           RNA gene, partial sequence
          Length = 732

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 616 gcccttag-atgttctgggccgcacgcgcgctacac 650



to top

>gb|AY773744.1| Uncultured rhizosphere basidiomycete isolate Root.21.11 18S
           ribosomal RNA gene, partial sequence
          Length = 734

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 612 gcccttag-atgttctgggccgcacgcgcgctacac 646



to top

>gb|AY773743.1| Uncultured rhizosphere basidiomycete isolate Root.21.09 18S
           ribosomal RNA gene, partial sequence
          Length = 733

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 612 gcccttag-atgttctgggccgcacgcgcgctacac 646



to top

>gb|AY773740.1| Uncultured rhizosphere basidiomycete isolate Root.20.11 18S
           ribosomal RNA gene, partial sequence
          Length = 735

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 612 gcccttag-atgttctgggccgcacgcgcgctacac 646



to top

>gb|AY773739.1| Uncultured rhizosphere basidiomycete isolate Root.20.03 18S
           ribosomal RNA gene, partial sequence
          Length = 734

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 612 gcccttag-atgttctgggccgcacgcgcgctacac 646



to top

>gb|AY773737.1| Uncultured rhizosphere basidiomycete isolate Root.19.10 18S
           ribosomal RNA gene, partial sequence
          Length = 723

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 602 gcccttag-atgttctgggccgcacgcgcgctacac 636



to top

>gb|AY773734.1| Uncultured rhizosphere ascomycete isolate Root.18.19 18S ribosomal
           RNA gene, partial sequence
          Length = 745

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 619 gcccttag-atgttctgggccgcacgcgcgctacac 653



to top

>gb|AY773733.1| Uncultured rhizosphere ascomycete isolate Root.18.14 18S ribosomal
           RNA gene, partial sequence
          Length = 714

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 602 gcccttag-atgttctgggccgcacgcgcgctacac 636



to top

>gb|AY773732.1| Uncultured rhizosphere ascomycete isolate Root.18.12 18S ribosomal
           RNA gene, partial sequence
          Length = 713

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 601 gcccttag-atgttctgggccgcacgcgcgctacac 635



to top

>gb|AY773731.1| Uncultured rhizosphere basidiomycete isolate Root.18.05 18S
           ribosomal RNA gene, partial sequence
          Length = 729

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 610 gcccttag-atgttctgggccgcacgcgcgctacac 644



to top

>gb|AY773730.1| Uncultured rhizosphere ascomycete isolate Root.18.04 18S ribosomal
           RNA gene, partial sequence
          Length = 717

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 602 gcccttag-atgttctgggccgcacgcgcgctacac 636



to top

>gb|AY773729.1| Uncultured rhizosphere ascomycete isolate Root.18.01 18S ribosomal
           RNA gene, partial sequence
          Length = 716

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 602 gcccttag-atgttctgggccgcacgcgcgctacac 636



to top

>gb|AY773728.1| Uncultured rhizosphere basidiomycete isolate Root.17.19 18S
           ribosomal RNA gene, partial sequence
          Length = 704

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 591 gcccttag-atgttctgggccgcacgcgcgctacac 625



to top

>gb|AY773727.1| Uncultured rhizosphere basidiomycete isolate Root.17.11 18S
           ribosomal RNA gene, partial sequence
          Length = 733

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 612 gcccttag-atgttctgggccgcacgcgcgctacac 646



to top

>gb|AY773726.1| Uncultured rhizosphere ascomycete isolate Root.17.09 18S ribosomal
           RNA gene, partial sequence
          Length = 706

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 593 gcccttag-atgttctgggccgcacgcgcgctacac 627



to top

>gb|AY773725.1| Uncultured rhizosphere ascomycete isolate Root.17.01 18S ribosomal
           RNA gene, partial sequence
          Length = 713

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 600 gcccttag-atgttctgggccgcacgcgcgctacac 634



to top

>gb|AY773723.1| Uncultured rhizosphere zygomycete isolate Root.16.03 18S ribosomal
           RNA gene, partial sequence
          Length = 731

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 616 gcccttag-atgttctgggccgcacgcgcgctacac 650



to top

>gb|AY773721.1| Uncultured rhizosphere ascomycete isolate Root.14.17 18S ribosomal
           RNA gene, partial sequence
          Length = 715

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 601 gcccttag-atgttctgggccgcacgcgcgctacac 635



to top

>gb|AY773720.1| Uncultured rhizosphere ascomycete isolate Root.14.14 18S ribosomal
           RNA gene, partial sequence
          Length = 747

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 621 gcccttag-atgttctgggccgcacgcgcgctacac 655



to top

>gb|AY773718.1| Uncultured rhizosphere zygomycete isolate Root.14.09 18S ribosomal
           RNA gene, partial sequence
          Length = 729

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 614 gcccttag-atgttctgggccgcacgcgcgctacac 648



to top

>gb|AY773717.1| Uncultured soil basidiomycete isolate Root.14.08 18S ribosomal RNA
           gene, partial sequence
          Length = 730

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 610 gcccttag-atgttctgggccgcacgcgcgctacac 644



to top

>gb|AY773716.1| Uncultured rhizosphere ascomycete isolate Root.14.01 18S ribosomal
           RNA gene, partial sequence
          Length = 712

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 601 gcccttag-atgttctgggccgcacgcgcgctacac 635



to top

>gb|AY773810.1| Uncultured soil ascomycete isolate Soil.24.19 18S ribosomal RNA
           gene, partial sequence
          Length = 715

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 601 gcccttag-atgttctgggccgcacgcgcgctacac 635



to top

>gb|AY773809.1| Uncultured soil ascomycete isolate Soil.24.11 18S ribosomal RNA
           gene, partial sequence
          Length = 746

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 618 gcccttag-atgttctgggccgcacgcgcgctacac 652



to top

>gb|AY773808.1| Uncultured soil ascomycete isolate Soil.23.20 18S ribosomal RNA
           gene, partial sequence
          Length = 727

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 607 gcccttag-atgttctgggccgcacgcgcgctacac 641



to top

>gb|AY773807.1| Uncultured soil zygomycete isolate Soil.22.07 18S ribosomal RNA
           gene, partial sequence
          Length = 728

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 613 gcccttag-atgttctgggccgcacgcgcgctacac 647



to top

>gb|AY773806.1| Uncultured soil ascomycete isolate Soil.20.18 18S ribosomal RNA
           gene, partial sequence
          Length = 717

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 601 gcccttag-atgttctgggccgcacgcgcgctacac 635



to top

>gb|AY773805.1| Uncultured soil ascomycete isolate Soil.20.04 18S ribosomal RNA
           gene, partial sequence
          Length = 715

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 600 gcccttag-atgttctgggccgcacgcgcgctacac 634



to top

>gb|AY773804.1| Uncultured soil ascomycete isolate Soil.20.02 18S ribosomal RNA
           gene, partial sequence
          Length = 707

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 595 gcccttag-atgttctgggccgcacgcgcgctacac 629



to top

>gb|AY773803.1| Uncultured soil ascomycete isolate Soil.19.19 18S ribosomal RNA
           gene, partial sequence
          Length = 737

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 611 gcccttag-atgttctgggccgcacgcgcgctacac 645



to top

>gb|AY773802.1| Uncultured soil ascomycete isolate Soil.19.18 18S ribosomal RNA
           gene, partial sequence
          Length = 737

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 609 gcccttag-atgttctgggccgcacgcgcgctacac 643



to top

>gb|AY773801.1| Uncultured soil basidiomycete isolate Soil.19.15 18S ribosomal RNA
           gene, partial sequence
          Length = 721

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 12  gcccttagnatgttctgggccgcacgcgcgctacac 47
           |||||||| |||||||||||||||||||||||||||
Sbjct: 601 gcccttag-atgttctgggccgcacgcgcgctacac 635


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,166,760
Number of Sequences: 3902068
Number of extensions: 8166760
Number of successful extensions: 325337
Number of sequences better than 10.0: 26107
Number of HSP's better than 10.0 without gapping: 24167
Number of HSP's successfully gapped in prelim test: 1988
Number of HSP's that attempted gapping in prelim test: 270628
Number of HSP's gapped (non-prelim): 56638
length of query: 370
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 348
effective length of database: 17,147,199,772
effective search space: 5967225520656
effective search space used: 5967225520656
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top