ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd26e02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL034351.1|HS879K22 Human DNA sequence from clone RP5-879K22... 46 0.15
2emb|BX067361.1|CNS09O51 Single read from an extremity of a full-... 44 0.60
3emb|BX065039.1|CNS09MCJ Single read from an extremity of a full-... 44 0.60
4emb|BX056667.1|CNS09FVZ Single read from an extremity of a full-... 44 0.60
5emb|BX056666.1|CNS09FVY Single read from an extremity of a full-... 44 0.60
6emb|BX056897.1|CNS09G2D Single read from an extremity of a full-... 44 0.60
7emb|BX053071.1|CNS09D43 Single read from an extremity of a full-... 44 0.60
8emb|BX042815.1|CNS09577 Single read from an extremity of a full-... 44 0.60
9emb|BX039805.1|CNS092VL Single read from an extremity of a full-... 44 0.60
10emb|BX034094.1|CNS08YGY Single read from an extremity of a full-... 44 0.60
11emb|BX020010.1|CNS08NLQ Single read from an extremity of a full-... 44 0.60
12emb|BX011839.1|CNS08HAR Single read from an extremity of a full-... 44 0.60
13emb|BX011624.1|CNS08H4S Single read from an extremity of a full-... 44 0.60
14emb|BX009000.1|CNS08F3W Single read from an extremity of a full-... 44 0.60
15emb|BX006361.1|CNS08D2L Single read from an extremity of a full-... 44 0.60
16dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 44 0.60
17ref|XM_316470.2| Anopheles gambiae str. PEST ENSANGP00000021035 ... 44 0.60
18ref|XM_450799.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.4
19ref|XM_506663.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 2.4
20ref|XM_463580.1| Oryza sativa (japonica cultivar-group), predic... 42 2.4
21ref|XM_476390.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.4
22gb|AY504966.1| Iris hollandica putative cysteine protease 1 (CYS... 42 2.4
23emb|BX071926.1|CNS09RNU Single read from an extremity of a full-... 42 2.4
24emb|BX071892.1|CNS09RMW Single read from an extremity of a full-... 42 2.4
25emb|BX068916.1|CNS09PC8 Single read from an extremity of a full-... 42 2.4
26emb|BX067978.1|CNS09OM6 Single read from an extremity of a full-... 42 2.4
27emb|BX067274.1|CNS09O2M Single read from an extremity of a full-... 42 2.4
28emb|BX067273.1|CNS09O2L Single read from an extremity of a full-... 42 2.4
29emb|BX065623.1|CNS09MSR Single read from an extremity of a full-... 42 2.4
30emb|BX065469.1|CNS09MOH Single read from an extremity of a full-... 42 2.4
31emb|BX065401.1|CNS09MML Single read from an extremity of a full-... 42 2.4
32emb|BX058037.1|CNS09GY1 Single read from an extremity of a full-... 42 2.4
33emb|BX053305.1|CNS09DAL Single read from an extremity of a full-... 42 2.4
34emb|BX053304.1|CNS09DAK Single read from an extremity of a full-... 42 2.4
35emb|BX054975.1|CNS09EKZ Single read from an extremity of a full-... 42 2.4
36emb|BX054726.1|CNS09EE2 Single read from an extremity of a full-... 42 2.4
37emb|BX054725.1|CNS09EE1 Single read from an extremity of a full-... 42 2.4
38emb|BX046548.1|CNS0982W Single read from an extremity of a full-... 42 2.4
39emb|BX045680.1|CNS097ES Single read from an extremity of a full-... 42 2.4
40emb|BX042580.1|CNS0950O Single read from an extremity of a full-... 42 2.4
41emb|BX042579.1|CNS0950N Single read from an extremity of a full-... 42 2.4
42emb|BX041880.1|CNS094H8 Single read from an extremity of a full-... 42 2.4
43emb|BX041463.1|CNS0945N Single read from an extremity of a full-... 42 2.4
44emb|BX041349.1|CNS0942H Single read from an extremity of a full-... 42 2.4
45emb|BX040977.1|CNS093S5 Single read from an extremity of a full-... 42 2.4
46emb|BX033733.1|CNS08Y6X Single read from an extremity of a full-... 42 2.4
47emb|BX031543.1|CNS08WI3 Single read from an extremity of a full-... 42 2.4
48emb|BX027561.1|CNS08TFH Single read from an extremity of a full-... 42 2.4
49emb|BX025600.1|CNS08RX0 Single read from an extremity of a full-... 42 2.4
50emb|BX021322.1|CNS08OM6 Single read from an extremity of a full-... 42 2.4
51emb|BX020409.1|CNS08NWT Single read from an extremity of a full-... 42 2.4
52emb|BX017672.1|CNS08LSS Single read from an extremity of a full-... 42 2.4
53emb|BX015014.1|CNS08JQY Single read from an extremity of a full-... 42 2.4
54emb|BX012160.1|CNS08HJO Single read from an extremity of a full-... 42 2.4
55emb|BX012159.1|CNS08HJN Single read from an extremity of a full-... 42 2.4
56emb|BX011957.1|CNS08HE1 Single read from an extremity of a full-... 42 2.4
57emb|BX011093.1|CNS08GQ1 Single read from an extremity of a full-... 42 2.4
58emb|BX010949.1|CNS08GM1 Single read from an extremity of a full-... 42 2.4
59emb|BX010605.1|CNS08GCH Single read from an extremity of a full-... 42 2.4
60emb|BX010604.1|CNS08GCG Single read from an extremity of a full-... 42 2.4
61emb|BX010581.1|CNS08GBT Single read from an extremity of a full-... 42 2.4
62emb|BX010191.1|CNS08G0Z Single read from an extremity of a full-... 42 2.4
63emb|BX008394.1|CNS08EN2 Single read from an extremity of a full-... 42 2.4
64emb|BX005487.1|CNS08CEB Single read from an extremity of a full-... 42 2.4
65emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine pro... 42 2.4
66dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
67dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
68dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
69dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
70dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
71dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
72dbj|AP005702.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
73dbj|AP005312.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
74gb|AF099203.1|AF099203 Oryza sativa cysteine endopeptidase precu... 42 2.4
75dbj|AK071091.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
76gb|AY112580.1| Zea mays CL875_1 mRNA sequence 42 2.4
77dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
78gb|AY109437.1| Zea mays CL903_-1 mRNA sequence 42 2.4
79emb|Z98304.1|HS54B20 Human DNA sequence from clone RP1-54B20 on ... 42 2.4
80dbj|AP006697.1| Lotus japonicus genomic DNA, chromosome 4, clone... 42 2.4
81dbj|AP004519.1| Lotus japonicus genomic DNA, chromosome 4, clone... 42 2.4
82dbj|D76415.1| Rice seedling mRNA for cysteine proteinase, comple... 42 2.4
83dbj|AB004819.1| Oryza sativa Rep1 gene for cysteine endopeptidas... 42 2.4
84gb|AY838803.1| Periplaneta americana Parcxpwnx02 mRNA, complete cds 40 9.4
85gb|AC162614.2| Mus musculus chromosome 7, clone RP23-421O10, com... 40 9.4
86gb|AC150540.2| Bos taurus BAC CH240-385H19 (Children's Hospital... 40 9.4
87gb|AC124322.7| Mus musculus chromosome 7, clone RP24-330M21, com... 40 9.4
88gb|AC119211.8| Mus musculus chromosome 7, clone RP24-191C15, com... 40 9.4
89gb|AC110175.14| Mus musculus chromosome 12, clone RP23-124B21, c... 40 9.4
90gb|DQ160197.1| Homo sapiens RAD51-like 1 (S. cerevisiae) (RAD51L... 40 9.4
91emb|CT010432.7| Mouse DNA sequence from clone RP23-337G13 on chr... 40 9.4
92ref|XM_762816.1| Giardia lamblia ATCC 50803 hypothetical protein... 40 9.4
93ref|XM_723930.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 40 9.4
94gb|AC158310.3| Mus musculus chromosome 5, clone RP23-106N8, comp... 40 9.4
95emb|AL008721.1|HS390C10 Human DNA sequence from clone CTA-390C10... 40 9.4
96gb|AC164000.2| Mus musculus chromosome 7, clone RP23-157G7, comp... 40 9.4
97gb|AC105987.21| Mus musculus chromosome 5, clone RP24-446I1, com... 40 9.4
98gb|AC026394.11| Homo sapiens chromosome 10 clone RP11-427O20, co... 40 9.4
99dbj|AK163793.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 40 9.4
100gb|AC048330.20| Homo sapiens 12 BAC RP11-334L2 (Roswell Park Can... 40 9.4
101gb|AC068292.8| Homo sapiens BAC clone RP11-738L3 from 2, complet... 40 9.4
102gb|AC079193.10| Homo sapiens chromosome 8, clone RP11-468H14, co... 40 9.4
103gb|AC136305.6| Homo sapiens chromosome 8, clone RP11-104K22, com... 40 9.4
104dbj|AK199351.1| Mus musculus cDNA, clone:Y1G0130O18, strand:plus... 40 9.4
105dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 9.4
106dbj|AP005399.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.4
107gb|AF512031.3| Choristoneura fumiferana MNPV polyhedrin, complet... 40 9.4
108emb|AL122013.5|CNS01DSU Human chromosome 14 DNA sequence BAC R-2... 40 9.4
109dbj|AP006300.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1... 40 9.4
110gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 40 9.4
111gb|AE001826.1| Deinococcus radiodurans R1 plasmid MP1, complete ... 40 9.4
112gb|AF007101.1|AF007101 Streptomyces hygroscopicus putative pteri... 40 9.4
113gb|M97906.1|NPHCATH Choristoneura fumiferana nuclear polyhedrosi... 40 9.4
114emb|AL607142.16| Mouse DNA sequence from clone RP23-98J9 on chro... 40 9.4
115dbj|AB020858.1| Homo sapiens genomic DNA of 8p21.3-p22 anti-onco... 40 9.4 
>emb|AL034351.1|HS879K22 Human DNA sequence from clone RP5-879K22 on chromosome 1q32.1-41
             Contains part of the gene for melanoma antigen recognized
             by T cells 2 protein (MART2), complete sequence
          Length = 137678

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 108   gtcgctgctgacaagtgatgttc 130
             |||||||||||||||||||||||
Sbjct: 47274 gtcgctgctgacaagtgatgttc 47252
to top
>emb|BX067361.1|CNS09O51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 487 tgtggatgacggtgcacaacag 508
to top
>emb|BX065039.1|CNS09MCJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX056667.1|CNS09FVZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX056666.1|CNS09FVY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 690 tgtggatgacggtgcacaacag 669
to top
>emb|BX056897.1|CNS09G2D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 644

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 491 tgtggatgacggtgcacaacag 512
to top
>emb|BX053071.1|CNS09D43 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 406

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 228 tgtggatgacggtgcacaacag 249
to top
>emb|BX042815.1|CNS09577 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 519 tgtggatgacggtgcacaacag 540
to top
>emb|BX039805.1|CNS092VL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 500 tgtggatgacggtgcacaacag 521
to top
>emb|BX034094.1|CNS08YGY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX020010.1|CNS08NLQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 512

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 345 tgtggatgacggtgcacaacag 366
to top
>emb|BX011839.1|CNS08HAR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX011624.1|CNS08H4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA18CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 479 tgtggatgacggtgcacaacag 500
to top
>emb|BX009000.1|CNS08F3W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 344 tgtggatgacggtgcacaacag 365
to top
>emb|BX006361.1|CNS08D2L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 438 tgtggatgacggtgcacaacag 459
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 592     tgctgggcattccccaccgtcgctac 617
               ||||||||||||||||||||| ||||
Sbjct: 7244970 tgctgggcattccccaccgtcactac 7244945
to top
>ref|XM_316470.2| Anopheles gambiae str. PEST ENSANGP00000021035
           (ENSANGG00000018546), partial mRNA
          Length = 1077

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 197 tgtggatgacggtgcacaacag 218
           ||||||||||||||||||||||
Sbjct: 902 tgtggatgacggtgcacaacag 881
to top
>ref|XM_450799.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1419

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 653 ctggtgtctctgtcggagcaacagctgatagactgcg 689
           ||||| |||||||||||||| |||||| | |||||||
Sbjct: 622 ctggtctctctgtcggagcagcagctggtggactgcg 658
to top
>ref|XM_506663.1| PREDICTED Oryza sativa (japonica cultivar-group), P0027G10.55 mRNA
          Length = 1882

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 653 ctggtgtctctgtcggagcaacagctgatagactgcg 689
           ||||| |||||||||||||| |||||| | |||||||
Sbjct: 630 ctggtctctctgtcggagcagcagctggtggactgcg 666
to top
>ref|XM_463580.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1116

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 653 ctggtgtctctgtcggagcaacagctgatagactgcg 689
           |||||||| |||||||||||  ||||||| |||||||
Sbjct: 535 ctggtgtcgctgtcggagcaggagctgatcgactgcg 571
to top
>ref|XM_476390.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1059

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 653 ctggtgtctctgtcggagcaacagctgatagactgcg 689
           |||||||| ||||||||||| |||||| | |||||||
Sbjct: 517 ctggtgtccctgtcggagcagcagctgctcgactgcg 553
to top
>gb|AY504966.1| Iris hollandica putative cysteine protease 1 (CYS1) mRNA, complete
           cds
          Length = 1171

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 583 tgtggatcttgctgggcattc 603
           |||||||||||||||||||||
Sbjct: 427 tgtggatcttgctgggcattc 447
to top
>emb|BX071926.1|CNS09RNU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 486 tgtggatgacggtgcacaaca 506
to top
>emb|BX071892.1|CNS09RMW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1058

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 494 tgtggatgacggtgcacaaca 514
to top
>emb|BX068916.1|CNS09PC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 640

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 496 tgtggatgacggtgcacaaca 516
to top
>emb|BX067978.1|CNS09OM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 876

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 506 tgtggatgacggtgcacaaca 526
to top
>emb|BX067274.1|CNS09O2M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 477 tgtggatgacggtgcacaaca 497
to top
>emb|BX067273.1|CNS09O2L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 753 tgtggatgacggtgcacaaca 733
to top
>emb|BX065623.1|CNS09MSR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 696

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 482 tgtggatgacggtgcacaaca 502
to top
>emb|BX065469.1|CNS09MOH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 479 tgtggatgacggtgcacaaca 499
to top
>emb|BX065401.1|CNS09MML Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 478 tgtggatgacggtgcacaaca 498
to top
>emb|BX058037.1|CNS09GY1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 549

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 463 tgtggatgacggtgcacaaca 483
to top
>emb|BX053305.1|CNS09DAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 487 tgtggatgacggtgcacaaca 507
to top
>emb|BX053304.1|CNS09DAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 712 tgtggatgacggtgcacaaca 692
to top
>emb|BX054975.1|CNS09EKZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 466 tgtggatgacggtgcacaaca 486
to top
>emb|BX054726.1|CNS09EE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 486 tgtggatgacggtgcacaaca 506
to top
>emb|BX054725.1|CNS09EE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 363 tgtggatgacggtgcacaaca 343
to top
>emb|BX046548.1|CNS0982W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20BA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 454 tgtggatgacggtgcacaaca 474
to top
>emb|BX045680.1|CNS097ES Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 489 tgtggatgacggtgcacaaca 509
to top
>emb|BX042580.1|CNS0950O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 561

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 504 tgtggatgacggtgcacaaca 524
to top
>emb|BX042579.1|CNS0950N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 743 tgtggatgacggtgcacaaca 723
to top
>emb|BX041880.1|CNS094H8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 361 tgtggatgacggtgcacaaca 341
to top
>emb|BX041463.1|CNS0945N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 503 tgtggatgacggtgcacaaca 523
to top
>emb|BX041349.1|CNS0942H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 397 tgtggatgacggtgcacaaca 417
to top
>emb|BX040977.1|CNS093S5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 511 tgtggatgacggtgcacaaca 531
to top
>emb|BX033733.1|CNS08Y6X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 481 tgtggatgacggtgcacaaca 501
to top
>emb|BX031543.1|CNS08WI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 480 tgtggatgacggtgcacaaca 500
to top
>emb|BX027561.1|CNS08TFH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 500 tgtggatgacggtgcacaaca 520
to top
>emb|BX025600.1|CNS08RX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 490 tgtggatgacggtgcacaaca 510
to top
>emb|BX021322.1|CNS08OM6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 512 tgtggatgacggtgcacaaca 532
to top
>emb|BX020409.1|CNS08NWT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 490 tgtggatgacggtgcacaaca 510
to top
>emb|BX017672.1|CNS08LSS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 500 tgtggatgacggtgcacaaca 520
to top
>emb|BX015014.1|CNS08JQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 493 tgtggatgacggtgcacaaca 513
to top
>emb|BX012160.1|CNS08HJO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 484 tgtggatgacggtgcacaaca 504
to top
>emb|BX012159.1|CNS08HJN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 654 tgtggatgacggtgcacaaca 634
to top
>emb|BX011957.1|CNS08HE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19AC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 541 tgtggatgacggtgcacaaca 521
to top
>emb|BX011093.1|CNS08GQ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 482 tgtggatgacggtgcacaaca 502
to top
>emb|BX010949.1|CNS08GM1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 497 tgtggatgacggtgcacaaca 517
to top
>emb|BX010605.1|CNS08GCH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 485 tgtggatgacggtgcacaaca 505
to top
>emb|BX010604.1|CNS08GCG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA17AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 656 tgtggatgacggtgcacaaca 636
to top
>emb|BX010581.1|CNS08GBT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 799

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 492 tgtggatgacggtgcacaaca 512
to top
>emb|BX010191.1|CNS08G0Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 484 tgtggatgacggtgcacaaca 504
to top
>emb|BX008394.1|CNS08EN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 435 tgtggatgacggtgcacaaca 455
to top
>emb|BX005487.1|CNS08CEB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA1AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 197 tgtggatgacggtgcacaaca 217
           |||||||||||||||||||||
Sbjct: 483 tgtggatgacggtgcacaaca 503
to top
>emb|Z97022.1|HVZ97022 Hordeum vulgare gene encoding cysteine proteinase
          Length = 5593

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 653  ctggtgtctctgtcggagcaacagctgatagactgcg 689
            |||||||| ||||||||||| |||||| | |||||||
Sbjct: 4394 ctggtgtcgctgtcggagcagcagctggtggactgcg 4430
to top
>dbj|AP003380.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0497A05
          Length = 130919

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 653   ctggtgtctctgtcggagcaacagctgatagactgcg 689
             |||||||| |||||||||||  ||||||| |||||||
Sbjct: 49714 ctggtgtcgctgtcggagcaggagctgatcgactgcg 49750
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                     
Query: 653      ctggtgtctctgtcggagcaacagctgatagactgcg 689
                ||||| |||||||||||||| |||||| | |||||||
Sbjct: 12845073 ctggtctctctgtcggagcagcagctggtggactgcg 12845037



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 535      gactggaggaagagaggcgt 554
                ||||||||||||||||||||
Sbjct: 17742972 gactggaggaagagaggcgt 17742991
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
              complete sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 653    ctggtgtctctgtcggagcaacagctgatagactgcg 689
              |||||||| ||||||||||| |||||| | |||||||
Sbjct: 463799 ctggtgtccctgtcggagcagcagctgctcgactgcg 463835
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                     
Query: 653      ctggtgtctctgtcggagcaacagctgatagactgcg 689
                |||||||| |||||||||||  ||||||| |||||||
Sbjct: 39495272 ctggtgtcgctgtcggagcaggagctgatcgactgcg 39495308
to top
>dbj|AP006531.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1417F08
          Length = 155536

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 653   ctggtgtctctgtcggagcaacagctgatagactgcg 689
             |||||||| |||||||||||  ||||||| |||||||
Sbjct: 70286 ctggtgtcgctgtcggagcaggagctgatcgactgcg 70322
to top
>dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0585H11
          Length = 149371

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 653   ctggtgtctctgtcggagcaacagctgatagactgcg 689
             |||||||| ||||||||||| |||||| | |||||||
Sbjct: 65963 ctggtgtccctgtcggagcagcagctgctcgactgcg 65999
to top
>dbj|AP005702.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0027G10
          Length = 184759

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                   
Query: 653    ctggtgtctctgtcggagcaacagctgatagactgcg 689
              ||||| |||||||||||||| |||||| | |||||||
Sbjct: 152850 ctggtctctctgtcggagcagcagctggtggactgcg 152814
to top
>dbj|AP005312.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
            clone:P0505H05
          Length = 152845

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 653  ctggtgtctctgtcggagcaacagctgatagactgcg 689
            ||||| |||||||||||||| |||||| | |||||||
Sbjct: 7057 ctggtctctctgtcggagcagcagctggtggactgcg 7021
to top
>gb|AF099203.1|AF099203 Oryza sativa cysteine endopeptidase precursor (EP3A) gene, complete
            cds
          Length = 2588

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 653  ctggtgtctctgtcggagcaacagctgatagactgcg 689
            |||||||| |||||||||||  ||||||| |||||||
Sbjct: 1502 ctggtgtcgctgtcggagcaggagctgatcgactgcg 1538
to top
>dbj|AK071091.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079N05, full
           insert sequence
          Length = 1419

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 653 ctggtgtctctgtcggagcaacagctgatagactgcg 689
           ||||| |||||||||||||| |||||| | |||||||
Sbjct: 622 ctggtctctctgtcggagcagcagctggtggactgcg 658
to top
>gb|AY112580.1| Zea mays CL875_1 mRNA sequence
          Length = 1553

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 653 ctggtgtctctgtcggagcaacagctgatagactgcg 689
           |||||||| |||||||||||  ||||||| |||||||
Sbjct: 593 ctggtgtcgctgtcggagcaggagctgatcgactgcg 629
to top
>dbj|AP003759.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1567_G09
          Length = 121388

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 653   ctggtgtctctgtcggagcaacagctgatagactgcg 689
             |||||||| ||||||||||| |||||| | |||||||
Sbjct: 17711 ctggtgtccctgtcggagcagcagctgctcgactgcg 17747
to top
>gb|AY109437.1| Zea mays CL903_-1 mRNA sequence
          Length = 1664

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 653 ctggtgtctctgtcggagcaacagctgatagactgcg 689
           |||||||| |||||||||||  ||||||| |||||||
Sbjct: 629 ctggtgtcgctgtcggagcaggagctgatcgactgcg 665
to top
>emb|Z98304.1|HS54B20 Human DNA sequence from clone RP1-54B20 on chromosome Xp11.1-11.3
              Contains the 5' end of the SSX6 gene for synovial sarcoma X
              breakpoint 6, two novel genes similar to a C2H2 type zinc
              finger protein, a novel gene, a novel gene similar to
              lysozyme C (1,4-beta-N-acetylmuramidase), the ZNF81 gene
              for zinc finger protein 81 (HFZ20) and three CpG islands,
              complete sequence
          Length = 209618

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 641    agagagggacctctggtgtct 661
              |||||||||||||||||||||
Sbjct: 125909 agagagggacctctggtgtct 125929
to top
>dbj|AP006697.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT41M05, TM0404,
             complete sequence
          Length = 103744

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 353   accttacaaatgaagagttca 373
             |||||||||||||||||||||
Sbjct: 27543 accttacaaatgaagagttca 27563
to top
>dbj|AP004519.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT07K08, TM0046b,
            complete sequence
          Length = 71321

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 353  accttacaaatgaagagttca 373
            |||||||||||||||||||||
Sbjct: 4738 accttacaaatgaagagttca 4758
to top
>dbj|D76415.1| Rice seedling mRNA for cysteine proteinase, complete cds
          Length = 1429

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 653 ctggtgtctctgtcggagcaacagctgatagactgcg 689
           |||||||| |||||||||||  ||||||| |||||||
Sbjct: 548 ctggtgtcgctgtcggagcaggagctgatcgactgcg 584
to top
>dbj|AB004819.1| Oryza sativa Rep1 gene for cysteine endopeptidase, complete cds
          Length = 2544

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 653  ctggtgtctctgtcggagcaacagctgatagactgcg 689
            |||||||| |||||||||||  ||||||| |||||||
Sbjct: 1461 ctggtgtcgctgtcggagcaggagctgatcgactgcg 1497
to top
>gb|AY838803.1| Periplaneta americana Parcxpwnx02 mRNA, complete cds
          Length = 1574

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 583 tgtggatcttgctgggcatt 602
           ||||||||||||||||||||
Sbjct: 685 tgtggatcttgctgggcatt 704
to top
>gb|AC162614.2| Mus musculus chromosome 7, clone RP23-421O10, complete sequence
          Length = 219414

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 567   taaaaaccaaaagcaatgtg 586
             ||||||||||||||||||||
Sbjct: 31245 taaaaaccaaaagcaatgtg 31226
to top
>gb|AC150540.2| Bos taurus  BAC CH240-385H19 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 172471

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 26    tctccagttctagatgttcatcat 49
             |||||||||||||||||| |||||
Sbjct: 63974 tctccagttctagatgttaatcat 63951
to top
>gb|AC124322.7| Mus musculus chromosome 7, clone RP24-330M21, complete sequence
          Length = 139336

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 111    gctgctgacaagtgatgttc 130
              ||||||||||||||||||||
Sbjct: 127541 gctgctgacaagtgatgttc 127522
to top
>gb|AC119211.8| Mus musculus chromosome 7, clone RP24-191C15, complete sequence
          Length = 172286

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 567   taaaaaccaaaagcaatgtg 586
             ||||||||||||||||||||
Sbjct: 50281 taaaaaccaaaagcaatgtg 50300
to top
>gb|AC110175.14| Mus musculus chromosome 12, clone RP23-124B21, complete sequence
          Length = 242870

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 57     ctatgtgctccttgccacaa 76
              ||||||||||||||||||||
Sbjct: 169514 ctatgtgctccttgccacaa 169495
to top
>gb|DQ160197.1| Homo sapiens RAD51-like 1 (S. cerevisiae) (RAD51L1) gene, complete cds
          Length = 660392

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    agttcatggagctatacact 387
              ||||||||||||||||||||
Sbjct: 571412 agttcatggagctatacact 571393
to top
>emb|CT010432.7| Mouse DNA sequence from clone RP23-337G13 on chromosome 12, complete
              sequence
          Length = 207186

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 57     ctatgtgctccttgccacaa 76
              ||||||||||||||||||||
Sbjct: 127264 ctatgtgctccttgccacaa 127283
to top
>ref|XM_762816.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_69_19980_21188)
            partial mRNA
          Length = 1209

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 423  tgacgacgacgagcagatta 442
            ||||||||||||||||||||
Sbjct: 1179 tgacgacgacgagcagatta 1198
to top
>ref|XM_723930.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY00109)
           partial mRNA
          Length = 1563

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 583 tgtggatcttgctgggcatt 602
           ||||||||||||||||||||
Sbjct: 895 tgtggatcttgctgggcatt 914
to top
>gb|AC158310.3| Mus musculus chromosome 5, clone RP23-106N8, complete sequence
          Length = 218714

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 660    ctctgtcggagcaacagctg 679
              ||||||||||||||||||||
Sbjct: 108776 ctctgtcggagcaacagctg 108757
to top
>emb|AL008721.1|HS390C10 Human DNA sequence from clone CTA-390C10 on chromosome 22q11.21-12.1,
             complete sequence
          Length = 114231

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 303   ggcggccacctctgggctca 322
             ||||||||||||||||||||
Sbjct: 51012 ggcggccacctctgggctca 50993
to top
>gb|AC164000.2| Mus musculus chromosome 7, clone RP23-157G7, complete sequence
          Length = 206022

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 111    gctgctgacaagtgatgttc 130
              ||||||||||||||||||||
Sbjct: 192876 gctgctgacaagtgatgttc 192895
to top
>gb|AC105987.21| Mus musculus chromosome 5, clone RP24-446I1, complete sequence
          Length = 192043

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 660    ctctgtcggagcaacagctg 679
              ||||||||||||||||||||
Sbjct: 155893 ctctgtcggagcaacagctg 155912
to top
>gb|AC026394.11| Homo sapiens chromosome 10 clone RP11-427O20, complete sequence
          Length = 174186

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 565   gttaaaaaccaaaagcaatg 584
             ||||||||||||||||||||
Sbjct: 52833 gttaaaaaccaaaagcaatg 52852
to top
>dbj|AK163793.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130031F13 product:heterogeneous nuclear
            ribonucleoprotein U-like 1, full insert sequence
          Length = 2615

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 567  taaaaaccaaaagcaatgtg 586
            ||||||||||||||||||||
Sbjct: 1882 taaaaaccaaaagcaatgtg 1863
to top
>gb|AC048330.20| Homo sapiens 12 BAC RP11-334L2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 188719

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 565   gttaaaaaccaaaagcaatg 584
             ||||||||||||||||||||
Sbjct: 11441 gttaaaaaccaaaagcaatg 11422
to top
>gb|AC068292.8| Homo sapiens BAC clone RP11-738L3 from 2, complete sequence
          Length = 113810

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 112   ctgctgacaagtgatgttct 131
             ||||||||||||||||||||
Sbjct: 57630 ctgctgacaagtgatgttct 57649
to top
>gb|AC079193.10| Homo sapiens chromosome 8, clone RP11-468H14, complete sequence
          Length = 169041

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 573   ccaaaagcaatgtggatctt 592
             ||||||||||||||||||||
Sbjct: 28641 ccaaaagcaatgtggatctt 28660
to top
>gb|AC136305.6| Homo sapiens chromosome 8, clone RP11-104K22, complete sequence
          Length = 156524

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 573   ccaaaagcaatgtggatctt 592
             ||||||||||||||||||||
Sbjct: 64157 ccaaaagcaatgtggatctt 64138
to top
>dbj|AK199351.1| Mus musculus cDNA, clone:Y1G0130O18, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000006948, based on BLAT search
          Length = 295

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 91  gctggctgctcttcagagtc 110
           ||||||||||||||||||||
Sbjct: 138 gctggctgctcttcagagtc 119
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 500    acgccaacttctcggccagcgcgc 523
              |||||| |||||||||||||||||
Sbjct: 915896 acgccagcttctcggccagcgcgc 915919
to top
>dbj|AP005399.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0676H02
          Length = 144252

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 535   gactggaggaagagaggcgt 554
             ||||||||||||||||||||
Sbjct: 51606 gactggaggaagagaggcgt 51625
to top
>gb|AF512031.3| Choristoneura fumiferana MNPV polyhedrin, complete genome
          Length = 129593

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 662    ctgtcggagcaacagctgatagactgcg 689
              ||||||||||||||||| || |||||||
Sbjct: 102260 ctgtcggagcaacagctcattgactgcg 102287
to top
>emb|AL122013.5|CNS01DSU Human chromosome 14 DNA sequence BAC R-204K16 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 173010

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   agttcatggagctatacact 387
             ||||||||||||||||||||
Sbjct: 69917 agttcatggagctatacact 69936
to top
>dbj|AP006300.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-1305B12, complete
              sequence
          Length = 154336

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 573    ccaaaagcaatgtggatctt 592
              ||||||||||||||||||||
Sbjct: 150303 ccaaaagcaatgtggatctt 150322
to top
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 147     ggacatcgacaccgacaacc 166
               ||||||||||||||||||||
Sbjct: 1845681 ggacatcgacaccgacaacc 1845700
to top
>gb|AE001826.1| Deinococcus radiodurans R1 plasmid MP1, complete sequence
          Length = 177466

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 510    ctcggccagcgcgccaacga 529
              ||||||||||||||||||||
Sbjct: 165772 ctcggccagcgcgccaacga 165791
to top
>gb|AF007101.1|AF007101 Streptomyces hygroscopicus putative pteridine-dependent dioxygenase,
             PKS modules 1,2,3 and 4, and putative regulatory protein
             genes, complete cds and putative hydroxylase gene, partial
             cds
          Length = 32870

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 150   catcgacaccgacaaccacc 169
             ||||||||||||||||||||
Sbjct: 18866 catcgacaccgacaaccacc 18885



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 150   catcgacaccgacaaccacc 169
             ||||||||||||||||||||
Sbjct: 13437 catcgacaccgacaaccacc 13456



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 150  catcgacaccgacaaccacc 169
            ||||||||||||||||||||
Sbjct: 8179 catcgacaccgacaaccacc 8198
to top
>gb|M97906.1|NPHCATH Choristoneura fumiferana nuclear polyhedrosis virus cathepsin gene,
           complete cds
          Length = 1338

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 662 ctgtcggagcaacagctgatagactgcg 689
           ||||||||||||||||| || |||||||
Sbjct: 715 ctgtcggagcaacagctcattgactgcg 742
to top
>emb|AL607142.16| Mouse DNA sequence from clone RP23-98J9 on chromosome 4, complete
              sequence
          Length = 188716

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 274    atgaggttcatagaggccgt 293
              ||||||||||||||||||||
Sbjct: 114953 atgaggttcatagaggccgt 114934
to top
>dbj|AB020858.1| Homo sapiens genomic DNA of 8p21.3-p22 anti-oncogene of hepatocellular
             colorectal and non-small cell lung cancer , segment 1/11
          Length = 100000

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 573   ccaaaagcaatgtggatctt 592
             ||||||||||||||||||||
Sbjct: 58795 ccaaaagcaatgtggatctt 58814


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,417,723
Number of Sequences: 3902068
Number of extensions: 5417723
Number of successful extensions: 96277
Number of sequences better than 10.0: 115
Number of HSP's better than 10.0 without gapping: 116
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95807
Number of HSP's gapped (non-prelim): 470
length of query: 689
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 666
effective length of database: 17,143,297,704
effective search space: 11417436270864
effective search space used: 11417436270864
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top