ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd26d16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC133179.3| Mus musculus BAC clone RP24-134P14 from chromosom... 40 1.9
2gb|AF016420.1| Caenorhabditis elegans cosmid C13D9, complete seq... 40 1.9
3emb|AL512451.7| Human DNA sequence from clone RP11-401G10 on chr... 40 1.9
4emb|BX927386.11| Zebrafish DNA sequence from clone CH211-54F10 i... 40 1.9
5ref|NM_071939.1| Caenorhabditis elegans Serpentine Receptor, cla... 40 1.9
6dbj|AP006398.1| Lotus japonicus genomic DNA, chromosome 5, clone... 40 1.9
7ref|XM_642233.1| Dictyostelium discoideum hypothetical protein (... 38 7.7
8gb|AY431942.1| Aedes aegypti ASAP ID: 35887 mitochondrial small ... 38 7.7
9gb|AF137286.1| Homo sapiens keratin 12 (KRT12) gene, complete cds 38 7.7
10gb|AY692872.1| Saccharomyces cerevisiae clone FLH111550.01X YER1... 38 7.7
11gb|AC136976.5| Mus musculus BAC clone RP23-362K12 from chromosom... 38 7.7
12ref|XM_650445.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 38 7.7
13ref|XM_652131.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 38 7.7
14emb|AL583863.16| Human DNA sequence from clone RP11-118G19 on ch... 38 7.7
15gb|CP000302.1| Shewanella denitrificans OS217, complete genome 38 7.7
16emb|AL358434.16| Human DNA sequence from clone RP11-471P6 on chr... 38 7.7
17emb|AL139016.8| Human DNA sequence from clone RP4-658C17 on chro... 38 7.7
18gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome 38 7.7
19gb|AC091189.4| Homo sapiens chromosome 8, clone RP11-606D13, com... 38 7.7
20gb|AC182462.3| Pan troglodytes BAC clone CH251-572M16 from chrom... 38 7.7
21gb|AC092825.5| Homo sapiens 3 BAC RP11-171G7 (Roswell Park Cance... 38 7.7
22gb|AC105226.4| Homo sapiens chromosome 8, clone RP11-970F14, com... 38 7.7
23gb|AC092656.1| Homo sapiens BAC clone RP11-455G16 from 4, comple... 38 7.7
24emb|BX511060.7| Zebrafish DNA sequence from clone CH211-210L19 i... 38 7.7
25gb|AC174467.2| Medicago truncatula chromosome 7 BAC clone mth2-4... 38 7.7
26gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255... 38 7.7
27gb|AF313475.1| Entamoeba histolytica retrotransposon-like elemen... 38 7.7
28gb|AF288224.1|AF288224 Brachyspira hyodysenteriae DNA Gyrase B s... 38 7.7
29gb|AC156635.2| Mus musculus BAC clone RP24-364K10 from chromosom... 38 7.7
30dbj|AB007119.2| Homo sapiens K12 gene for keratin 12, complete cds 38 7.7
31gb|U18839.1|SCE9747 Saccharomyces cerevisiae chromosome V cosmid... 38 7.7
32gb|AC118650.5| Homo sapiens chromosome 8, clone CTD-2326I15, com... 38 7.7
33gb|AC091522.23| Mus musculus strain C57BL/6J chromosome 10 clone... 38 7.7
34gb|AC127302.3| Mus musculus BAC clone RP23-269P7 from chromosome... 38 7.7
35emb|AL389895.3|CNS06C7I Human chromosome 14 DNA sequence BAC R-3... 38 7.7
36gb|AC153569.4| Mus musculus 10 BAC RP23-225D5 (Roswell Park Canc... 38 7.7
37gb|AC004231.1|AC004231 Homo sapiens chromosome 17, clone hRPC.11... 38 7.7
38dbj|AP004986.1| Lotus japonicus genomic DNA, chromosome 1, clone... 38 7.7

>gb|AC133179.3| Mus musculus BAC clone RP24-134P14 from chromosome 14, complete
            sequence
          Length = 160216

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 124  atcacttgtnccaaccacaatctctgt 150
            ||||||||| | |||||||||||||||
Sbjct: 4724 atcacttgtactaaccacaatctctgt 4698



to top

>gb|AF016420.1| Caenorhabditis elegans cosmid C13D9, complete sequence
          Length = 43487

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 78   aaaaagatggaagaaatgatgatt 101
            ||||||||||| ||||||||||||
Sbjct: 4699 aaaaagatggacgaaatgatgatt 4676



to top

>emb|AL512451.7| Human DNA sequence from clone RP11-401G10 on chromosome 6, complete
             sequence
          Length = 59449

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 78    aaaaagatggaagaaatgatgatt 101
             |||||||||||||| |||||||||
Sbjct: 10672 aaaaagatggaagacatgatgatt 10649



to top

>emb|BX927386.11| Zebrafish DNA sequence from clone CH211-54F10 in linkage group 1,
             complete sequence
          Length = 80968

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 78    aaaaagatggaagaaatgat 97
             ||||||||||||||||||||
Sbjct: 78339 aaaaagatggaagaaatgat 78358



to top

>ref|NM_071939.1| Caenorhabditis elegans Serpentine Receptor, class SX family member
           (srsx-13) (srsx-13) mRNA, complete cds
          Length = 876

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 78  aaaaagatggaagaaatgatgatt 101
           ||||||||||| ||||||||||||
Sbjct: 572 aaaaagatggacgaaatgatgatt 595



to top

>dbj|AP006398.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT29J15, TM0280b,
             complete sequence
          Length = 68747

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 76    tgaaaaagatggaagaaatg 95
             ||||||||||||||||||||
Sbjct: 14853 tgaaaaagatggaagaaatg 14872



to top

>ref|XM_642233.1| Dictyostelium discoideum hypothetical protein (DDB0189561), partial
            mRNA
          Length = 2970

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 102  tgatgcagggtttggttgtacaa 124
            ||||||||| |||||||||||||
Sbjct: 1899 tgatgcaggatttggttgtacaa 1877



to top

>gb|AY431942.1| Aedes aegypti ASAP ID: 35887 mitochondrial small ribosomal subunit
           S7 mRNA sequence
          Length = 709

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 8   atatttgaaacactaactagttt 30
           |||||||||||| ||||||||||
Sbjct: 114 atatttgaaacaataactagttt 92



to top

>gb|AF137286.1| Homo sapiens keratin 12 (KRT12) gene, complete cds
          Length = 5919

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 7    aatatttgaaacactaact 25
            |||||||||||||||||||
Sbjct: 5411 aatatttgaaacactaact 5429



to top

>gb|AY692872.1| Saccharomyces cerevisiae clone FLH111550.01X YER104W gene, complete
           cds
          Length = 627

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 79  aaaagatggaagaaatgat 97
           |||||||||||||||||||
Sbjct: 371 aaaagatggaagaaatgat 389



to top

>gb|AC136976.5| Mus musculus BAC clone RP23-362K12 from chromosome 13, complete sequence
          Length = 147695

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 98     gatttgatgcagggtttgg 116
              |||||||||||||||||||
Sbjct: 100954 gatttgatgcagggtttgg 100972



to top

>ref|XM_650445.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (27.t00045)
           partial mRNA
          Length = 420

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 76  tgaaaaagatggaagaaat 94
           |||||||||||||||||||
Sbjct: 263 tgaaaaagatggaagaaat 281



to top

>ref|XM_652131.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (3.t00118)
           partial mRNA
          Length = 309

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 76  tgaaaaagatggaagaaat 94
           |||||||||||||||||||
Sbjct: 113 tgaaaaagatggaagaaat 131



to top

>emb|AL583863.16| Human DNA sequence from clone RP11-118G19 on chromosome 1, complete
             sequence
          Length = 113372

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 77    gaaaaagatggaagaaatg 95
             |||||||||||||||||||
Sbjct: 45867 gaaaaagatggaagaaatg 45849



to top

>gb|CP000302.1| Shewanella denitrificans OS217, complete genome
          Length = 4545906

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 63      tggattatcgagctgaaaaagat 85
               ||||||||||||||| |||||||
Sbjct: 2951594 tggattatcgagctggaaaagat 2951616



to top

>emb|AL358434.16| Human DNA sequence from clone RP11-471P6 on chromosome 1 Contains the
             5' end of the XPR1 gene for xenotropic and polytropic
             retrovirus receptor, complete sequence
          Length = 178375

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 1     tgatgaaatatttgaaacactaa 23
             ||||||||||||| |||||||||
Sbjct: 95481 tgatgaaatattttaaacactaa 95459



to top

>emb|AL139016.8| Human DNA sequence from clone RP4-658C17 on chromosome 1p11.1-13.3,
             complete sequence
          Length = 100643

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 40    tatgacattcnaagaaatgttt 61
             |||||||||| |||||||||||
Sbjct: 60032 tatgacattcaaagaaatgttt 60011



to top

>gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome
          Length = 1842899

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 100   tttgatgcagggtttggtt 118
             |||||||||||||||||||
Sbjct: 47789 tttgatgcagggtttggtt 47807



to top

>gb|AC091189.4| Homo sapiens chromosome 8, clone RP11-606D13, complete sequence
          Length = 174458

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 99    atttgatgcagggtttggttgta 121
             ||||| |||||||||||||||||
Sbjct: 33457 atttgctgcagggtttggttgta 33435



to top

>gb|AC182462.3| Pan troglodytes BAC clone CH251-572M16 from chromosome 1, complete
             sequence
          Length = 158275

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 40    tatgacattcnaagaaatgttt 61
             |||||||||| |||||||||||
Sbjct: 75429 tatgacattcaaagaaatgttt 75450



to top

>gb|AC092825.5| Homo sapiens 3 BAC RP11-171G7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 157842

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     gaaatatttgaaacactaa 23
             |||||||||||||||||||
Sbjct: 77620 gaaatatttgaaacactaa 77638



to top

>gb|AC105226.4| Homo sapiens chromosome 8, clone RP11-970F14, complete sequence
          Length = 107318

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 99    atttgatgcagggtttggttgta 121
             ||||| |||||||||||||||||
Sbjct: 39206 atttgctgcagggtttggttgta 39184



to top

>gb|AC092656.1| Homo sapiens BAC clone RP11-455G16 from 4, complete sequence
          Length = 191840

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 13     tgaaacactaactagtttc 31
              |||||||||||||||||||
Sbjct: 101122 tgaaacactaactagtttc 101140



to top

>emb|BX511060.7| Zebrafish DNA sequence from clone CH211-210L19 in linkage group 10,
             complete sequence
          Length = 139250

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 78    aaaaagatggaagaaatga 96
             |||||||||||||||||||
Sbjct: 73193 aaaaagatggaagaaatga 73211



to top

>gb|AC174467.2| Medicago truncatula chromosome 7 BAC clone mth2-44j14, complete
             sequence
          Length = 127007

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 3     atgaaatatttgaaacact 21
             |||||||||||||||||||
Sbjct: 41930 atgaaatatttgaaacact 41912



to top

>gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 25586, complete genome
          Length = 2174500

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 73     agctgaaaaagatggaagaaatgatga 99
              ||||||||||  |||||||||||||||
Sbjct: 462483 agctgaaaaacttggaagaaatgatga 462457



to top

>gb|AF313475.1| Entamoeba histolytica retrotransposon-like element RLEEh3
          Length = 5422

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 76   tgaaaaagatggaagaaat 94
            |||||||||||||||||||
Sbjct: 2732 tgaaaaagatggaagaaat 2714



to top

>gb|AF288224.1|AF288224 Brachyspira hyodysenteriae DNA Gyrase B subunit gene, complete cds
          Length = 3422

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 1    tgatgaaatatttgaaaca 19
            |||||||||||||||||||
Sbjct: 1290 tgatgaaatatttgaaaca 1308



to top

>gb|AC156635.2| Mus musculus BAC clone RP24-364K10 from chromosome 9, complete sequence
          Length = 187038

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 100   tttgatgcagggtttggtt 118
             |||||||||||||||||||
Sbjct: 15657 tttgatgcagggtttggtt 15675



to top

>dbj|AB007119.2| Homo sapiens K12 gene for keratin 12, complete cds
          Length = 5108

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 7    aatatttgaaacactaact 25
            |||||||||||||||||||
Sbjct: 4603 aatatttgaaacactaact 4621



to top

>gb|U18839.1|SCE9747 Saccharomyces cerevisiae chromosome V cosmids 9747, 8198, 9781, and
             lambda clones 3612 and 6052
          Length = 64797

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 79    aaaagatggaagaaatgat 97
             |||||||||||||||||||
Sbjct: 57155 aaaagatggaagaaatgat 57173



to top

>gb|AC118650.5| Homo sapiens chromosome 8, clone CTD-2326I15, complete sequence
          Length = 105410

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 99   atttgatgcagggtttggttgta 121
            ||||| |||||||||||||||||
Sbjct: 5105 atttgctgcagggtttggttgta 5127



to top

>gb|AC091522.23| Mus musculus strain C57BL/6J chromosome 10 clone rp23-199g2, complete
              sequence
          Length = 214798

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 111    gtttggttgtacaatcact 129
              |||||||||||||||||||
Sbjct: 182098 gtttggttgtacaatcact 182116



to top

>gb|AC127302.3| Mus musculus BAC clone RP23-269P7 from chromosome 9, complete sequence
          Length = 200073

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 100    tttgatgcagggtttggtt 118
              |||||||||||||||||||
Sbjct: 105618 tttgatgcagggtttggtt 105636



to top

>emb|AL389895.3|CNS06C7I Human chromosome 14 DNA sequence BAC R-395B20 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 166054

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 99    atttgatgcagggtttggt 117
             |||||||||||||||||||
Sbjct: 99992 atttgatgcagggtttggt 99974



to top

>gb|AC153569.4| Mus musculus 10 BAC RP23-225D5 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 193135

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 111   gtttggttgtacaatcact 129
             |||||||||||||||||||
Sbjct: 67348 gtttggttgtacaatcact 67366



to top

>gb|AC004231.1|AC004231 Homo sapiens chromosome 17, clone hRPC.1110_E_20, complete sequence
          Length = 137022

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 7      aatatttgaaacactaact 25
              |||||||||||||||||||
Sbjct: 102136 aatatttgaaacactaact 102154



to top

>dbj|AP004986.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT33P04, TM0476b,
             complete sequence
          Length = 75682

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    aagatggaagaaatgatga 99
             |||||||||||||||||||
Sbjct: 62585 aagatggaagaaatgatga 62603


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,745,509
Number of Sequences: 3902068
Number of extensions: 1745509
Number of successful extensions: 138876
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 138693
Number of HSP's gapped (non-prelim): 183
length of query: 159
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 137
effective length of database: 17,147,199,772
effective search space: 2349166368764
effective search space used: 2349166368764
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top