ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd26b13
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|CT010464.7| M.truncatula DNA sequence from clone MTH2-95O22 ... 60 1e-05
2ref|NM_117068.3| Arabidopsis thaliana unknown protein AT4G10000 ... 58 4e-05
3ref|NM_179022.2| Arabidopsis thaliana unknown protein AT4G10000 ... 58 4e-05
4emb|BX827417.1|CNS0A3NX Arabidopsis thaliana Full-length cDNA Co... 58 4e-05
5gb|AY087989.1| Arabidopsis thaliana clone 40182 mRNA, complete s... 58 4e-05
6gb|AC120791.13| Mus musculus chromosome 7, clone RP23-56I4, comp... 44 0.60
7gb|AC123030.4| Mus musculus BAC clone RP24-573I5 from chromosome... 44 0.60
8emb|BX827148.1|CNS0A3P4 Arabidopsis thaliana Full-length cDNA Co... 44 0.60
9gb|AC138528.8| Mus musculus chromosome 3, clone RP23-329L9, comp... 42 2.4
10ref|XM_466499.1| Oryza sativa (japonica cultivar-group), mRNA 40 9.3
11ref|XM_466500.1| Oryza sativa (japonica cultivar-group), mRNA 40 9.3
12gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 40 9.3
13gb|AC068605.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 9.3
14gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 9.3
15gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 9.3
16ref|XM_707544.1| Candida albicans SC5314 hypothetical protein (C... 40 9.3
17ref|XM_707694.1| Candida albicans SC5314 hypothetical protein (C... 40 9.3
18gb|AC121497.15| Mus musculus chromosome 6, clone RP23-2M23, comp... 40 9.3
19gb|AC078859.13| Homo sapiens 3 BAC RP11-588N12 (Roswell Park Can... 40 9.3
20gb|AC135048.2| Homo sapiens chromosome 16 clone RP11-1072A3, com... 40 9.3
21gb|AC125119.2| Mus musculus BAC clone RP24-266E24 from chromosom... 40 9.3
22gb|DQ153261.1| Bacillus weihenstephanensis strain WSBC 10394 Nhe... 40 9.3
23gb|DQ153260.1| Bacillus weihenstephanensis strain WSBC 10386 Nhe... 40 9.3
24gb|DQ153259.1| Bacillus weihenstephanensis strain WSBC 10204 Nhe... 40 9.3
25gb|DQ153258.1| Bacillus weihenstephanensis strain NVH 453-92 Nhe... 40 9.3
26gb|DQ153257.1| Bacillus cereus strain NVH 0075-95 NheA (nheA), N... 40 9.3
27gb|CP000001.1| Bacillus cereus E33L, complete genome 40 9.3
28emb|AL442071.30| Human DNA sequence from clone RP11-420K8 on chr... 40 9.3
29emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chr... 40 9.3
30gb|AY293827.1| Triticum aestivum phosphate transporter 2-1 (PT2-... 40 9.3
31emb|AL606470.15| Mouse DNA sequence from clone RP23-293J11 on ch... 40 9.3
32gb|DQ019312.1| Bacillus cereus strain F4430/73 non-hemolytic ent... 40 9.3
33gb|AF325332.1|F325326S07 Homo sapiens macrophin 1 isoforms (MACF... 40 9.3
34dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.3
35dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.3
36gb|AC108476.5| Homo sapiens BAC clone RP11-1413K20 from 2, compl... 40 9.3
37gb|AC135050.3| Homo sapiens chromosome 16 clone RP11-196G11, com... 40 9.3
38gb|AC108846.15| Mus musculus chromosome 9, clone RP23-12I4, comp... 40 9.3
39gb|AC154008.1| Mus musculus 6 BAC RP24-470H20 (Roswell Park Canc... 40 9.3
40dbj|AP004079.2| Oryza sativa (japonica cultivar-group) genomic D... 40 9.3
41dbj|AP005874.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.3
42dbj|AP005657.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.3
43dbj|AB099298.1| Bacillus thuringiensis genes for non hemolytic e... 40 9.3
44dbj|AK104702.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.3
45dbj|AK067498.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.3
46emb|AJ937161.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
47emb|AJ937160.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
48emb|AJ937156.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
49emb|AJ937155.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
50emb|AJ937154.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
51emb|AJ937153.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
52emb|AJ937152.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
53emb|AJ937151.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
54emb|AJ937150.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
55emb|AJ937149.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
56emb|AJ937148.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
57emb|AJ937147.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
58emb|AJ937146.1| Bacillus thuringiensis partial nheA gene for Ent... 40 9.3
59emb|AJ937145.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
60emb|AJ937144.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
61emb|AJ937143.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
62emb|AJ937141.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
63emb|AJ937140.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 9.3
64gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 40 9.3
65gb|AY835995.1| Bacillus cereus isolate A6 non-hemolytic enteroto... 40 9.3
66gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 40 9.3
67gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 9.3
68gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 40 9.3
69gb|AC170997.2| Mus musculus BAC clone RP24-198N9 from chromosome... 40 9.3 
>emb|CT010464.7| M.truncatula DNA sequence from clone MTH2-95O22 on chromosome 3,
             complete sequence
          Length = 117153

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                         
Query: 69    gaggcatgccccttctgtaggagggttagggaggccatgaccgagcttgatctttctgca 128
             ||||||||||| || ||||| |||||  | |||||||||||||| || |||||||||| |
Sbjct: 50512 gaggcatgccctttttgtagaagggtacgagaggccatgaccgaactagatctttctgta 50571

                   
Query: 129   gaggtt 134
             ||||||
Sbjct: 50572 gaggtt 50577
to top
>ref|NM_117068.3| Arabidopsis thaliana unknown protein AT4G10000 transcript variant
           AT4G10000.1 mRNA, complete cds
          Length = 1257

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 66  tttgaggcatgccccttctgtaggagggttagggaggccatgaccgagcttgatctttct 125
           ||||||||||| ||||| ||| |||| ||  |||| |||||||| ||||| || ||||| 
Sbjct: 509 tttgaggcatgtcccttttgtcggagagtgcgggaagccatgactgagctagacctttca 568

                                        
Query: 126 gcagaggtttatccttgcccaaaaggatc 154
           | ||| ||||||||||| || ||||||||
Sbjct: 569 gtagaagtttatccttgtcctaaaggatc 597
to top
>ref|NM_179022.2| Arabidopsis thaliana unknown protein AT4G10000 transcript variant
           AT4G10000.2 mRNA, complete cds
          Length = 1291

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 66  tttgaggcatgccccttctgtaggagggttagggaggccatgaccgagcttgatctttct 125
           ||||||||||| ||||| ||| |||| ||  |||| |||||||| ||||| || ||||| 
Sbjct: 534 tttgaggcatgtcccttttgtcggagagtgcgggaagccatgactgagctagacctttca 593

                                        
Query: 126 gcagaggtttatccttgcccaaaaggatc 154
           | ||| ||||||||||| || ||||||||
Sbjct: 594 gtagaagtttatccttgtcctaaaggatc 622
to top
>emb|BX827417.1|CNS0A3NX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS52ZA06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1297

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 66  tttgaggcatgccccttctgtaggagggttagggaggccatgaccgagcttgatctttct 125
           ||||||||||| ||||| ||| |||| ||  |||| |||||||| ||||| || ||||| 
Sbjct: 533 tttgaggcatgtcccttttgtcggagagtgcgggaagccatgactgagctagacctttca 592

                                        
Query: 126 gcagaggtttatccttgcccaaaaggatc 154
           | ||| ||||||||||| || ||||||||
Sbjct: 593 gtagaagtttatccttgtcctaaaggatc 621
to top
>gb|AY087989.1| Arabidopsis thaliana clone 40182 mRNA, complete sequence
          Length = 1230

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 66  tttgaggcatgccccttctgtaggagggttagggaggccatgaccgagcttgatctttct 125
           ||||||||||| ||||| ||| |||| ||  |||| |||||||| ||||| || ||||| 
Sbjct: 482 tttgaggcatgtcccttttgtcggagagtgcgggaagccatgactgagctagacctttca 541

                                        
Query: 126 gcagaggtttatccttgcccaaaaggatc 154
           | ||| ||||||||||| || ||||||||
Sbjct: 542 gtagaagtttatccttgtcctaaaggatc 570
to top
>gb|AC120791.13| Mus musculus chromosome 7, clone RP23-56I4, complete sequence
          Length = 246249

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 296    cccttcttttggcctccttgag 317
              ||||||||||||||||||||||
Sbjct: 218842 cccttcttttggcctccttgag 218821
to top
>gb|AC123030.4| Mus musculus BAC clone RP24-573I5 from chromosome 7, complete sequence
          Length = 173971

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 296   cccttcttttggcctccttgag 317
             ||||||||||||||||||||||
Sbjct: 30936 cccttcttttggcctccttgag 30915
to top
>emb|BX827148.1|CNS0A3P4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS16ZC10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1230

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 74/90 (82%), Gaps = 1/90 (1%)
 Strand = Plus / Plus

                                                                       
Query: 66  tttgaggcatgccccttctgtaggagggttagggaggccatgaccgagcttgatcttt-c 124
           ||||||||||| ||||| ||| |||| ||  |||| |||||||| ||||| || |||| |
Sbjct: 492 tttgaggcatgtcccttttgtcggagagtgcgggaagccatgactgagctagacctttac 551

                                         
Query: 125 tgcagaggtttatccttgcccaaaaggatc 154
            | ||| ||||||||||| || ||||||||
Sbjct: 552 agtagaagtttatccttgtcctaaaggatc 581
to top
>gb|AC138528.8| Mus musculus chromosome 3, clone RP23-329L9, complete sequence
          Length = 188290

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 297    ccttcttttggcctccttgag 317
              |||||||||||||||||||||
Sbjct: 151235 ccttcttttggcctccttgag 151215
to top
>ref|XM_466499.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2158

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 23   catcactgcaccaacaagtg 42
            ||||||||||||||||||||
Sbjct: 1676 catcactgcaccaacaagtg 1657
to top
>ref|XM_466500.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1929

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 23   catcactgcaccaacaagtg 42
            ||||||||||||||||||||
Sbjct: 1442 catcactgcaccaacaagtg 1423
to top
>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 245     aagtggagatattgtgaaat 264
               ||||||||||||||||||||
Sbjct: 1809744 aagtggagatattgtgaaat 1809763
to top
>gb|AC068605.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-284I15, complete
             sequence
          Length = 198551

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 167   agatgtggtcaggaaaattg 186
             ||||||||||||||||||||
Sbjct: 34388 agatgtggtcaggaaaattg 34407
to top
>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 245     aagtggagatattgtgaaat 264
               ||||||||||||||||||||
Sbjct: 1771518 aagtggagatattgtgaaat 1771537
to top
>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 245     aagtggagatattgtgaaat 264
               ||||||||||||||||||||
Sbjct: 1771462 aagtggagatattgtgaaat 1771481
to top
>ref|XM_707544.1| Candida albicans SC5314 hypothetical protein (CaO19.4183), mRNA
          Length = 2664

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 215  tgatgcaagtactggtgtca 234
            ||||||||||||||||||||
Sbjct: 2454 tgatgcaagtactggtgtca 2473
to top
>ref|XM_707694.1| Candida albicans SC5314 hypothetical protein (CaO19.11659), mRNA
          Length = 2664

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 215  tgatgcaagtactggtgtca 234
            ||||||||||||||||||||
Sbjct: 2454 tgatgcaagtactggtgtca 2473
to top
>gb|AC121497.15| Mus musculus chromosome 6, clone RP23-2M23, complete sequence
          Length = 231059

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 167    agatgtggtcaggaaaattg 186
              ||||||||||||||||||||
Sbjct: 121443 agatgtggtcaggaaaattg 121424
to top
>gb|AC078859.13| Homo sapiens 3 BAC RP11-588N12 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 176802

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 169    atgtggtcaggaaaattgga 188
              ||||||||||||||||||||
Sbjct: 167409 atgtggtcaggaaaattgga 167390
to top
>gb|AC135048.2| Homo sapiens chromosome 16 clone RP11-1072A3, complete sequence
          Length = 177719

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 155   actgaggcatagagatgtggtcag 178
             ||||||||| ||||||||||||||
Sbjct: 28763 actgaggcacagagatgtggtcag 28786
to top
>gb|AC125119.2| Mus musculus BAC clone RP24-266E24 from chromosome 6, complete
            sequence
          Length = 194445

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  tcaggaaaattggagggaag 194
            ||||||||||||||||||||
Sbjct: 3563 tcaggaaaattggagggaag 3544
to top
>gb|DQ153261.1| Bacillus weihenstephanensis strain WSBC 10394 NheA (nheA), NheB
            (nheB), and NheC (nheC) genes, complete cds
          Length = 4517

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 245  aagtggagatattgtgaaat 264
            ||||||||||||||||||||
Sbjct: 1477 aagtggagatattgtgaaat 1496
to top
>gb|DQ153260.1| Bacillus weihenstephanensis strain WSBC 10386 NheA (nheA), NheB
            (nheB), and NheC (nheC) genes, complete cds
          Length = 4524

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 245  aagtggagatattgtgaaat 264
            ||||||||||||||||||||
Sbjct: 1478 aagtggagatattgtgaaat 1497
to top
>gb|DQ153259.1| Bacillus weihenstephanensis strain WSBC 10204 NheA (nheA), NheB
            (nheB), and NheC (nheC) genes, complete cds
          Length = 4504

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 245  aagtggagatattgtgaaat 264
            ||||||||||||||||||||
Sbjct: 1492 aagtggagatattgtgaaat 1511
to top
>gb|DQ153258.1| Bacillus weihenstephanensis strain NVH 453-92 NheA (nheA), NheB
            (nheB), and NheC (nheC) genes, complete cds
          Length = 4513

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 245  aagtggagatattgtgaaat 264
            ||||||||||||||||||||
Sbjct: 1475 aagtggagatattgtgaaat 1494
to top
>gb|DQ153257.1| Bacillus cereus strain NVH 0075-95 NheA (nheA), NheB (nheB), and NheC
            (nheC) genes, complete cds
          Length = 4463

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 245  aagtggagatattgtgaaat 264
            ||||||||||||||||||||
Sbjct: 1457 aagtggagatattgtgaaat 1476
to top
>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 245     aagtggagatattgtgaaat 264
               ||||||||||||||||||||
Sbjct: 1796872 aagtggagatattgtgaaat 1796891
to top
>emb|AL442071.30| Human DNA sequence from clone RP11-420K8 on chromosome 1 Contains part
             of the MACF1 gene for microtubule-actin crosslinking
             factor 1, a novel gene, a heat shock 10kDa protein 1
             (chaperonin 10) (HSPE1) pseudogene and a CpG island,
             complete sequence
          Length = 121295

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 659   ctctcaaatctctgcaaatc 678
             ||||||||||||||||||||
Sbjct: 73449 ctctcaaatctctgcaaatc 73430
to top
>emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chromosome 1p32.1-33
             Contains 3' end of the DAB1 gene for disabled homolog 1
             (Drosophila), a novel gene and the 5' end of a novel gene,
             complete sequence
          Length = 60856

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 480   ctcccttacgttctccagaa 499
             ||||||||||||||||||||
Sbjct: 16656 ctcccttacgttctccagaa 16675
to top
>gb|AY293827.1| Triticum aestivum phosphate transporter 2-1 (PT2-1) mRNA, complete
            cds; plastid gene for plastid product
          Length = 2094

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 23   catcactgcaccaacaagtg 42
            ||||||||||||||||||||
Sbjct: 1640 catcactgcaccaacaagtg 1621
to top
>emb|AL606470.15| Mouse DNA sequence from clone RP23-293J11 on chromosome 11 Contains a
              Friedreich ataxia protein (Frda) pseudogene, complete
              sequence
          Length = 203970

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 662    tcaaatctctgcaaatctgt 681
              ||||||||||||||||||||
Sbjct: 132033 tcaaatctctgcaaatctgt 132052
to top
>gb|DQ019312.1| Bacillus cereus strain F4430/73 non-hemolytic enterotoxin operon,
            partial sequence
          Length = 3160

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 245  aagtggagatattgtgaaat 264
            ||||||||||||||||||||
Sbjct: 1338 aagtggagatattgtgaaat 1357
to top
>gb|AF325332.1|F325326S07 Homo sapiens macrophin 1 isoforms (MACF1) gene, exons 22, 23, and 24
          Length = 6799

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 659  ctctcaaatctctgcaaatc 678
            ||||||||||||||||||||
Sbjct: 2698 ctctcaaatctctgcaaatc 2679
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8,
              complete sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 509    ggggtcgtcgaagatgagtt 528
              ||||||||||||||||||||
Sbjct: 753665 ggggtcgtcgaagatgagtt 753684
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 23       catcactgcaccaacaagtg 42
                ||||||||||||||||||||
Sbjct: 22994087 catcactgcaccaacaagtg 22994068
to top
>gb|AC108476.5| Homo sapiens BAC clone RP11-1413K20 from 2, complete sequence
          Length = 139342

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 151    gatcactgaggcatagagat 170
              ||||||||||||||||||||
Sbjct: 128834 gatcactgaggcatagagat 128853
to top
>gb|AC135050.3| Homo sapiens chromosome 16 clone RP11-196G11, complete sequence
          Length = 182230

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 155   actgaggcatagagatgtggtcag 178
             ||||||||| ||||||||||||||
Sbjct: 33846 actgaggcacagagatgtggtcag 33823
to top
>gb|AC108846.15| Mus musculus chromosome 9, clone RP23-12I4, complete sequence
          Length = 212729

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 296    cccttcttttggcctccttg 315
              ||||||||||||||||||||
Sbjct: 169802 cccttcttttggcctccttg 169783
to top
>gb|AC154008.1| Mus musculus 6 BAC RP24-470H20 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 139613

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   tcaggaaaattggagggaag 194
             ||||||||||||||||||||
Sbjct: 76020 tcaggaaaattggagggaag 76001
to top
>dbj|AP004079.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1067_B01
          Length = 100525

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    catcactgcaccaacaagtg 42
             ||||||||||||||||||||
Sbjct: 18484 catcactgcaccaacaagtg 18465
to top
>dbj|AP005874.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0016G10
          Length = 143211

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 23     catcactgcaccaacaagtg 42
              ||||||||||||||||||||
Sbjct: 113889 catcactgcaccaacaagtg 113870
to top
>dbj|AP005657.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0427G12
          Length = 185545

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 509   ggggtcgtcgaagatgagtt 528
             ||||||||||||||||||||
Sbjct: 52885 ggggtcgtcgaagatgagtt 52904
to top
>dbj|AB099298.1| Bacillus thuringiensis genes for non hemolytic enterotoxin A, non
           hemolytic enterotoxin B, non hemolytic enterotoxin C,
           complete cds
          Length = 3594

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 585 aagtggagatattgtgaaat 604
to top
>dbj|AK104702.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-C11, full
            insert sequence
          Length = 1929

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 23   catcactgcaccaacaagtg 42
            ||||||||||||||||||||
Sbjct: 1442 catcactgcaccaacaagtg 1423
to top
>dbj|AK067498.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013111N12, full
            insert sequence
          Length = 2159

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 23   catcactgcaccaacaagtg 42
            ||||||||||||||||||||
Sbjct: 1676 catcactgcaccaacaagtg 1657
to top
>emb|AJ937161.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain SL
          Length = 463

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 304 aagtggagatattgtgaaat 323
to top
>emb|AJ937160.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain SD
          Length = 417

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 281 aagtggagatattgtgaaat 300
to top
>emb|AJ937156.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain BS
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937155.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain 11
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937154.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain SM
          Length = 360

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 223 aagtggagatattgtgaaat 242
to top
>emb|AJ937153.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain C33
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937152.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain
           F2085/98
          Length = 436

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 275 aagtggagatattgtgaaat 294
to top
>emb|AJ937151.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain PF
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937150.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain I15
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937149.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain LMG
           17615
          Length = 654

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937148.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain
           F4815/94
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937147.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain
           F0285/78
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937146.1| Bacillus thuringiensis partial nheA gene for Enterotoxin A, strain
           CIP 53137
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937145.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain C13
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937144.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain WSBC
           10204
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937143.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain 1
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937141.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain C35
          Length = 663

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>emb|AJ937140.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain I21
          Length = 665

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 245 aagtggagatattgtgaaat 264
           ||||||||||||||||||||
Sbjct: 375 aagtggagatattgtgaaat 394
to top
>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 377     gtggagcaaagctggtgcgg 396
               ||||||||||||||||||||
Sbjct: 2019773 gtggagcaaagctggtgcgg 2019792
to top
>gb|AY835995.1| Bacillus cereus isolate A6 non-hemolytic enterotoxin A (nheA),
            non-hemolytic enterotoxin B (nheB), and non-hemolytic
            enterotoxin C (nheC) genes, complete cds
          Length = 4187

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 245  aagtggagatattgtgaaat 264
            ||||||||||||||||||||
Sbjct: 1173 aagtggagatattgtgaaat 1192
to top
>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 245     aagtggagatattgtgaaat 264
               ||||||||||||||||||||
Sbjct: 1765832 aagtggagatattgtgaaat 1765851
to top
>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 245     aagtggagatattgtgaaat 264
               ||||||||||||||||||||
Sbjct: 1771395 aagtggagatattgtgaaat 1771414
to top
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 245     aagtggagatattgtgaaat 264
               ||||||||||||||||||||
Sbjct: 1903317 aagtggagatattgtgaaat 1903336
to top
>gb|AC170997.2| Mus musculus BAC clone RP24-198N9 from chromosome 9, complete sequence
          Length = 146891

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 296   cccttcttttggcctccttg 315
             ||||||||||||||||||||
Sbjct: 36372 cccttcttttggcctccttg 36353


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,728,775
Number of Sequences: 3902068
Number of extensions: 5728775
Number of successful extensions: 95405
Number of sequences better than 10.0: 69
Number of HSP's better than 10.0 without gapping: 68
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 95077
Number of HSP's gapped (non-prelim): 328
length of query: 683
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 660
effective length of database: 17,143,297,704
effective search space: 11314576484640
effective search space used: 11314576484640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top