| Clone Name | basd24p11 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL031178.1|HS341E18 Human DNA sequence from clone RP3-341E18 on chromosome 6p11.2-12.3 Contains the KIAA0936 gene for a MAK-related kinase, a novel gene for NY-REN-57 antigen and CpG islands, complete sequence Length = 92558 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Plus Query: 365 acaaggattttaaatgaattga 386 |||||||||||||||||||||| Sbjct: 74490 acaaggattttaaatgaattga 74511
>gb|AC068993.14| Homo sapiens 12 BAC RP11-123M21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 186383 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Minus Query: 333 ggaatgaaaaaacaagccaaag 354 |||||||||||||||||||||| Sbjct: 96368 ggaatgaaaaaacaagccaaag 96347
>gb|AC104911.10| Mus musculus chromosome 3, clone RP23-427B4, complete sequence Length = 190932 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 384 tgaccactcaggatgatgccc 404 ||||||||||||||||||||| Sbjct: 6839 tgaccactcaggatgatgccc 6859
>gb|AC138330.4| Mus musculus BAC clone RP23-19L20 from chromosome 13, complete sequence Length = 190901 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 114 tatgtggggaacctttggggc 134 ||||||||||||||||||||| Sbjct: 157865 tatgtggggaacctttggggc 157885
>gb|AC157379.7| Mus musculus chromosome 3, clone RP23-20F10, complete sequence Length = 183455 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 388 cactcaggatgatgcccatac 408 ||||||||||||||||||||| Sbjct: 76783 cactcaggatgatgcccatac 76803
>gb|AC123840.4| Mus musculus BAC clone RP23-399K5 from chromosome 13, complete sequence Length = 191185 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 114 tatgtggggaacctttggggc 134 ||||||||||||||||||||| Sbjct: 14972 tatgtggggaacctttggggc 14992
>emb|AL157903.16| Human DNA sequence from clone RP4-683H8 on chromosome 1p22.3-31.2 Contains part of the LPHN2 gene for latrophilin 2, complete sequence Length = 74630 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 333 ggaatgaaaaaacaagccaaa 353 ||||||||||||||||||||| Sbjct: 35271 ggaatgaaaaaacaagccaaa 35251
>gb|AC162611.2| Mus musculus chromosome 3, clone RP24-86E1, complete sequence Length = 229643 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 384 tgaccactcaggatgatgccc 404 ||||||||||||||||||||| Sbjct: 119041 tgaccactcaggatgatgccc 119021
>emb|Z98977.4|SPAC23H4 S.pombe chromosome I cosmid c23H4 Length = 40387 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 151 accagcaaacataatgattac 171 ||||||||||||||||||||| Sbjct: 7257 accagcaaacataatgattac 7277
>gb|AC092588.2| Homo sapiens BAC clone RP11-44A12 from 2, complete sequence Length = 140401 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 334 gaatgaaaaaacaagccaaag 354 ||||||||||||||||||||| Sbjct: 86443 gaatgaaaaaacaagccaaag 86423
>gb|AC025809.5| Homo sapiens chromosome 19 clone CTC-439O9, complete sequence Length = 241424 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 481 acagcaaaacccagccacaac 501 ||||||||||||||||||||| Sbjct: 162759 acagcaaaacccagccacaac 162779
>ref|NM_001018821.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAC23H4.17c), partial mRNA Length = 1059 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 151 accagcaaacataatgattac 171 ||||||||||||||||||||| Sbjct: 426 accagcaaacataatgattac 446
>gb|AC127360.3| Mus musculus BAC clone RP23-125F9 from 15, complete sequence Length = 192315 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 255 gggatgacagtgaagcagtaacctc 279 |||||||||||| |||||||||||| Sbjct: 43192 gggatgacagtgcagcagtaacctc 43168
>gb|AY722946.2| Borrelia garinii PBi variable plasmid segment G11a19d04.r1, WORKING DRAFT SEQUENCE Length = 2438 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 325 caagattcggaatgaaaaaacaag 348 ||||||| |||||||||||||||| Sbjct: 914 caagattgggaatgaaaaaacaag 937
>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete sequence Length = 1178688 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 122 gaacctttggggccactgtcatct 145 ||||||||||||| |||||||||| Sbjct: 246752 gaacctttggggcaactgtcatct 246775
>ref|XM_956815.1| Neurospora crassa OR74A hypothetical protein (NCU05271.1) partial mRNA Length = 3951 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 cccagttgcttgcattggct 207 |||||||||||||||||||| Sbjct: 458 cccagttgcttgcattggct 477
>ref|XM_324627.1| Neurospora crassa OR74A hypothetical protein (NCU05271.1) partial mRNA Length = 3951 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 cccagttgcttgcattggct 207 |||||||||||||||||||| Sbjct: 458 cccagttgcttgcattggct 477
>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome Length = 2462499 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 438 catcgggctggcaatcctcc 457 |||||||||||||||||||| Sbjct: 2074545 catcgggctggcaatcctcc 2074564
>ref|XM_572723.1| Cryptococcus neoformans var. neoformans JEC21 DNA helicase (CNI01000) partial mRNA Length = 2476 Score = 40.1 bits (20), Expect = 8.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 122 gaacctttggggccactgtcatct 145 ||||||||||||| |||||||||| Sbjct: 696 gaacctttggggcaactgtcatct 719
>gb|AC122850.4| Mus musculus BAC clone RP23-167J19 from 10, complete sequence Length = 234973 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 tatgtaataagagatagtaa 101 |||||||||||||||||||| Sbjct: 111972 tatgtaataagagatagtaa 111991
>emb|AL359259.18| Human DNA sequence from clone RP11-182B22 on chromosome 1 Contains the 3' end of the MTR gene for 5-methyltetrahydrofolate-homocysteine methyltransferase, a novel gene (LOC149448), a ribosomal protein L35 (RPL35) pseudogene, and a novel gene similar to metallothionein 1H (MT1H), complete sequence Length = 172753 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 339 aaaaaacaagccaaagttca 358 |||||||||||||||||||| Sbjct: 20478 aaaaaacaagccaaagttca 20497
>emb|AL035414.30|HS667H12 Human DNA sequence from clone RP4-667H12 on chromosome 1q32.1-41 Contains a novel gene, the SERTAD4 gene for SERTA domain containing protein 4, a processed pseudogene similar to putative tumor suppressor ST13, a processed pseudogene similar to ribonuclease H1 (RNASEH1), the 5' end of the gene for melanoma antigen recognized by T cells 2 (MART2) protein and a CpG island, complete sequence Length = 131239 Score = 40.1 bits (20), Expect = 8.3 Identities = 26/28 (92%) Strand = Plus / Plus Query: 118 tggggaacctttggggccactgtcatct 145 |||||| |||||||||||||||| |||| Sbjct: 126411 tggggagcctttggggccactgttatct 126438
>emb|BX571659.1| Wolinella succinogenes, complete genome; segment 3/7 Length = 349970 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 388 cactcaggatgatgcccata 407 |||||||||||||||||||| Sbjct: 82800 cactcaggatgatgcccata 82819
>gb|AC105749.2| Homo sapiens chromosome 3 clone RP11-640L9, complete sequence Length = 200450 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 334 gaatgaaaaaacaagccaaa 353 |||||||||||||||||||| Sbjct: 52283 gaatgaaaaaacaagccaaa 52302
>gb|AC097357.2| Homo sapiens chromosome 3 clone RP11-137N22, complete sequence Length = 162277 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 500 acaggccttggtacctcaat 519 |||||||||||||||||||| Sbjct: 111335 acaggccttggtacctcaat 111354
>gb|AC048334.21| Homo sapiens 3 BAC RP11-572C15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 215719 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 atatctcccagttgcttgca 201 |||||||||||||||||||| Sbjct: 196877 atatctcccagttgcttgca 196858
>emb|AL928633.10| Mouse DNA sequence from clone RP23-345M3 on chromosome 2, complete sequence Length = 123294 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 388 cactcaggatgatgcccata 407 |||||||||||||||||||| Sbjct: 97242 cactcaggatgatgcccata 97261
>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome Length = 4303871 Score = 40.1 bits (20), Expect = 8.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 189 ccagttgcttgcattggctt 208 |||||||||||||||||||| Sbjct: 2676374 ccagttgcttgcattggctt 2676355 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,281,388 Number of Sequences: 3902068 Number of extensions: 5281388 Number of successful extensions: 146865 Number of sequences better than 10.0: 28 Number of HSP's better than 10.0 without gapping: 28 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 146743 Number of HSP's gapped (non-prelim): 122 length of query: 609 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 586 effective length of database: 17,143,297,704 effective search space: 10045972454544 effective search space used: 10045972454544 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)