ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd24p11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL031178.1|HS341E18 Human DNA sequence from clone RP3-341E18... 44 0.53
2gb|AC068993.14| Homo sapiens 12 BAC RP11-123M21 (Roswell Park Ca... 44 0.53
3gb|AC104911.10| Mus musculus chromosome 3, clone RP23-427B4, com... 42 2.1
4gb|AC138330.4| Mus musculus BAC clone RP23-19L20 from chromosome... 42 2.1
5gb|AC157379.7| Mus musculus chromosome 3, clone RP23-20F10, comp... 42 2.1
6gb|AC123840.4| Mus musculus BAC clone RP23-399K5 from chromosome... 42 2.1
7emb|AL157903.16| Human DNA sequence from clone RP4-683H8 on chro... 42 2.1
8gb|AC162611.2| Mus musculus chromosome 3, clone RP24-86E1, compl... 42 2.1
9emb|Z98977.4|SPAC23H4 S.pombe chromosome I cosmid c23H4 42 2.1
10gb|AC092588.2| Homo sapiens BAC clone RP11-44A12 from 2, complet... 42 2.1
11gb|AC025809.5| Homo sapiens chromosome 19 clone CTC-439O9, compl... 42 2.1
12ref|NM_001018821.1| Schizosaccharomyces pombe 972h- hypothetical... 42 2.1
13gb|AC127360.3| Mus musculus BAC clone RP23-125F9 from 15, comple... 42 2.1
14gb|AY722946.2| Borrelia garinii PBi variable plasmid segment G11... 40 8.3
15gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 8.3
16ref|XM_956815.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.3
17ref|XM_324627.1| Neurospora crassa OR74A hypothetical protein (N... 40 8.3
18emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 40 8.3
19ref|XM_572723.1| Cryptococcus neoformans var. neoformans JEC21 D... 40 8.3
20gb|AC122850.4| Mus musculus BAC clone RP23-167J19 from 10, compl... 40 8.3
21emb|AL359259.18| Human DNA sequence from clone RP11-182B22 on ch... 40 8.3
22emb|AL035414.30|HS667H12 Human DNA sequence from clone RP4-667H1... 40 8.3
23emb|BX571659.1| Wolinella succinogenes, complete genome; segment... 40 8.3
24gb|AC105749.2| Homo sapiens chromosome 3 clone RP11-640L9, compl... 40 8.3
25gb|AC097357.2| Homo sapiens chromosome 3 clone RP11-137N22, comp... 40 8.3
26gb|AC048334.21| Homo sapiens 3 BAC RP11-572C15 (Roswell Park Can... 40 8.3
27emb|AL928633.10| Mouse DNA sequence from clone RP23-345M3 on chr... 40 8.3
28dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome 40 8.3

>emb|AL031178.1|HS341E18 Human DNA sequence from clone RP3-341E18 on chromosome 6p11.2-12.3
             Contains the KIAA0936 gene for a MAK-related kinase, a
             novel gene for NY-REN-57 antigen and CpG islands, complete
             sequence
          Length = 92558

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 365   acaaggattttaaatgaattga 386
             ||||||||||||||||||||||
Sbjct: 74490 acaaggattttaaatgaattga 74511



to top

>gb|AC068993.14| Homo sapiens 12 BAC RP11-123M21 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 186383

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 333   ggaatgaaaaaacaagccaaag 354
             ||||||||||||||||||||||
Sbjct: 96368 ggaatgaaaaaacaagccaaag 96347



to top

>gb|AC104911.10| Mus musculus chromosome 3, clone RP23-427B4, complete sequence
          Length = 190932

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 384  tgaccactcaggatgatgccc 404
            |||||||||||||||||||||
Sbjct: 6839 tgaccactcaggatgatgccc 6859



to top

>gb|AC138330.4| Mus musculus BAC clone RP23-19L20 from chromosome 13, complete sequence
          Length = 190901

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 114    tatgtggggaacctttggggc 134
              |||||||||||||||||||||
Sbjct: 157865 tatgtggggaacctttggggc 157885



to top

>gb|AC157379.7| Mus musculus chromosome 3, clone RP23-20F10, complete sequence
          Length = 183455

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 388   cactcaggatgatgcccatac 408
             |||||||||||||||||||||
Sbjct: 76783 cactcaggatgatgcccatac 76803



to top

>gb|AC123840.4| Mus musculus BAC clone RP23-399K5 from chromosome 13, complete sequence
          Length = 191185

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 114   tatgtggggaacctttggggc 134
             |||||||||||||||||||||
Sbjct: 14972 tatgtggggaacctttggggc 14992



to top

>emb|AL157903.16| Human DNA sequence from clone RP4-683H8 on chromosome 1p22.3-31.2
             Contains part of the LPHN2 gene for latrophilin 2,
             complete sequence
          Length = 74630

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 333   ggaatgaaaaaacaagccaaa 353
             |||||||||||||||||||||
Sbjct: 35271 ggaatgaaaaaacaagccaaa 35251



to top

>gb|AC162611.2| Mus musculus chromosome 3, clone RP24-86E1, complete sequence
          Length = 229643

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 384    tgaccactcaggatgatgccc 404
              |||||||||||||||||||||
Sbjct: 119041 tgaccactcaggatgatgccc 119021



to top

>emb|Z98977.4|SPAC23H4 S.pombe chromosome I cosmid c23H4
          Length = 40387

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 151  accagcaaacataatgattac 171
            |||||||||||||||||||||
Sbjct: 7257 accagcaaacataatgattac 7277



to top

>gb|AC092588.2| Homo sapiens BAC clone RP11-44A12 from 2, complete sequence
          Length = 140401

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 334   gaatgaaaaaacaagccaaag 354
             |||||||||||||||||||||
Sbjct: 86443 gaatgaaaaaacaagccaaag 86423



to top

>gb|AC025809.5| Homo sapiens chromosome 19 clone CTC-439O9, complete sequence
          Length = 241424

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 481    acagcaaaacccagccacaac 501
              |||||||||||||||||||||
Sbjct: 162759 acagcaaaacccagccacaac 162779



to top

>ref|NM_001018821.1| Schizosaccharomyces pombe 972h- hypothetical protein
           (SPAC23H4.17c), partial mRNA
          Length = 1059

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 151 accagcaaacataatgattac 171
           |||||||||||||||||||||
Sbjct: 426 accagcaaacataatgattac 446



to top

>gb|AC127360.3| Mus musculus BAC clone RP23-125F9 from 15, complete sequence
          Length = 192315

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 255   gggatgacagtgaagcagtaacctc 279
             |||||||||||| ||||||||||||
Sbjct: 43192 gggatgacagtgcagcagtaacctc 43168



to top

>gb|AY722946.2| Borrelia garinii PBi variable plasmid segment G11a19d04.r1, WORKING
           DRAFT SEQUENCE
          Length = 2438

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 325 caagattcggaatgaaaaaacaag 348
           ||||||| ||||||||||||||||
Sbjct: 914 caagattgggaatgaaaaaacaag 937



to top

>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete
              sequence
          Length = 1178688

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 122    gaacctttggggccactgtcatct 145
              ||||||||||||| ||||||||||
Sbjct: 246752 gaacctttggggcaactgtcatct 246775



to top

>ref|XM_956815.1| Neurospora crassa OR74A hypothetical protein (NCU05271.1) partial
           mRNA
          Length = 3951

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 188 cccagttgcttgcattggct 207
           ||||||||||||||||||||
Sbjct: 458 cccagttgcttgcattggct 477



to top

>ref|XM_324627.1| Neurospora crassa OR74A hypothetical protein (NCU05271.1) partial
           mRNA
          Length = 3951

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 188 cccagttgcttgcattggct 207
           ||||||||||||||||||||
Sbjct: 458 cccagttgcttgcattggct 477



to top

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 438     catcgggctggcaatcctcc 457
               ||||||||||||||||||||
Sbjct: 2074545 catcgggctggcaatcctcc 2074564



to top

>ref|XM_572723.1| Cryptococcus neoformans var. neoformans JEC21 DNA helicase
           (CNI01000) partial mRNA
          Length = 2476

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 122 gaacctttggggccactgtcatct 145
           ||||||||||||| ||||||||||
Sbjct: 696 gaacctttggggcaactgtcatct 719



to top

>gb|AC122850.4| Mus musculus BAC clone RP23-167J19 from 10, complete sequence
          Length = 234973

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 82     tatgtaataagagatagtaa 101
              ||||||||||||||||||||
Sbjct: 111972 tatgtaataagagatagtaa 111991



to top

>emb|AL359259.18| Human DNA sequence from clone RP11-182B22 on chromosome 1 Contains the
             3' end of the MTR gene for
             5-methyltetrahydrofolate-homocysteine methyltransferase, a
             novel gene (LOC149448), a ribosomal protein L35 (RPL35)
             pseudogene, and a novel gene similar to metallothionein 1H
             (MT1H), complete sequence
          Length = 172753

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 339   aaaaaacaagccaaagttca 358
             ||||||||||||||||||||
Sbjct: 20478 aaaaaacaagccaaagttca 20497



to top

>emb|AL035414.30|HS667H12 Human DNA sequence from clone RP4-667H12 on chromosome 1q32.1-41 Contains
              a novel gene, the SERTAD4 gene for SERTA domain containing
              protein 4, a processed pseudogene similar to putative tumor
              suppressor ST13, a processed pseudogene similar to
              ribonuclease H1 (RNASEH1), the 5' end of the gene for
              melanoma antigen recognized by T cells 2 (MART2) protein
              and a CpG island, complete sequence
          Length = 131239

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 118    tggggaacctttggggccactgtcatct 145
              |||||| |||||||||||||||| ||||
Sbjct: 126411 tggggagcctttggggccactgttatct 126438



to top

>emb|BX571659.1| Wolinella succinogenes, complete genome; segment 3/7
          Length = 349970

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 388   cactcaggatgatgcccata 407
             ||||||||||||||||||||
Sbjct: 82800 cactcaggatgatgcccata 82819



to top

>gb|AC105749.2| Homo sapiens chromosome 3 clone RP11-640L9, complete sequence
          Length = 200450

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 334   gaatgaaaaaacaagccaaa 353
             ||||||||||||||||||||
Sbjct: 52283 gaatgaaaaaacaagccaaa 52302



to top

>gb|AC097357.2| Homo sapiens chromosome 3 clone RP11-137N22, complete sequence
          Length = 162277

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 500    acaggccttggtacctcaat 519
              ||||||||||||||||||||
Sbjct: 111335 acaggccttggtacctcaat 111354



to top

>gb|AC048334.21| Homo sapiens 3 BAC RP11-572C15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 215719

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    atatctcccagttgcttgca 201
              ||||||||||||||||||||
Sbjct: 196877 atatctcccagttgcttgca 196858



to top

>emb|AL928633.10| Mouse DNA sequence from clone RP23-345M3 on chromosome 2, complete
             sequence
          Length = 123294

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 388   cactcaggatgatgcccata 407
             ||||||||||||||||||||
Sbjct: 97242 cactcaggatgatgcccata 97261



to top

>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome
          Length = 4303871

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 189     ccagttgcttgcattggctt 208
               ||||||||||||||||||||
Sbjct: 2676374 ccagttgcttgcattggctt 2676355


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,281,388
Number of Sequences: 3902068
Number of extensions: 5281388
Number of successful extensions: 146865
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 146743
Number of HSP's gapped (non-prelim): 122
length of query: 609
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 586
effective length of database: 17,143,297,704
effective search space: 10045972454544
effective search space used: 10045972454544
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top