| Clone Name | basd25c13 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 143 bits (72), Expect = 6e-31 Identities = 123/140 (87%) Strand = Plus / Plus Query: 211 ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 270 |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 5868450 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 5868509 Query: 271 gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 330 ||||||||| ||||||||||| ||||| ||||| | ||||||||||| || | || ||| Sbjct: 5868510 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 5868569 Query: 331 gtcaacgccaacctctcccg 350 ||||||||| |||||||||| Sbjct: 5868570 gtcaacgcccacctctcccg 5868589 Score = 79.8 bits (40), Expect = 8e-12 Identities = 58/64 (90%) Strand = Plus / Plus Query: 355 tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 414 |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | |||| Sbjct: 5868714 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 5868773 Query: 415 agcg 418 |||| Sbjct: 5868774 agcg 5868777
>gb|AC146619.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNAa0021B21, from chromosome 3, complete sequence Length = 139208 Score = 143 bits (72), Expect = 6e-31 Identities = 123/140 (87%) Strand = Plus / Plus Query: 211 ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 270 |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 97280 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 97339 Query: 271 gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 330 ||||||||| ||||||||||| ||||| ||||| | ||||||||||| || | || ||| Sbjct: 97340 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 97399 Query: 331 gtcaacgccaacctctcccg 350 ||||||||| |||||||||| Sbjct: 97400 gtcaacgcccacctctcccg 97419 Score = 79.8 bits (40), Expect = 8e-12 Identities = 58/64 (90%) Strand = Plus / Plus Query: 355 tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 414 |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | |||| Sbjct: 97544 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 97603 Query: 415 agcg 418 |||| Sbjct: 97604 agcg 97607
>gb|AC134241.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0085F02, complete sequence Length = 128535 Score = 143 bits (72), Expect = 6e-31 Identities = 123/140 (87%) Strand = Plus / Plus Query: 211 ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 270 |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 18072 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 18131 Query: 271 gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 330 ||||||||| ||||||||||| ||||| ||||| | ||||||||||| || | || ||| Sbjct: 18132 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 18191 Query: 331 gtcaacgccaacctctcccg 350 ||||||||| |||||||||| Sbjct: 18192 gtcaacgcccacctctcccg 18211 Score = 79.8 bits (40), Expect = 8e-12 Identities = 58/64 (90%) Strand = Plus / Plus Query: 355 tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 414 |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | |||| Sbjct: 18336 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 18395 Query: 415 agcg 418 |||| Sbjct: 18396 agcg 18399
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 143 bits (72), Expect = 6e-31 Identities = 123/140 (87%) Strand = Plus / Plus Query: 211 ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 270 |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| Sbjct: 5867663 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 5867722 Query: 271 gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 330 ||||||||| ||||||||||| ||||| ||||| | ||||||||||| || | || ||| Sbjct: 5867723 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 5867782 Query: 331 gtcaacgccaacctctcccg 350 ||||||||| |||||||||| Sbjct: 5867783 gtcaacgcccacctctcccg 5867802 Score = 79.8 bits (40), Expect = 8e-12 Identities = 58/64 (90%) Strand = Plus / Plus Query: 355 tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 414 |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | |||| Sbjct: 5867927 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 5867986 Query: 415 agcg 418 |||| Sbjct: 5867987 agcg 5867990
>gb|BT024025.1| Zea mays clone EL01N0417D02 mRNA sequence Length = 1565 Score = 56.0 bits (28), Expect = 1e-04 Identities = 85/104 (81%) Strand = Plus / Plus Query: 325 gcgctcgtcaacgccaacctctcccgtggttacatgccagggatggatttgggagtgctc 384 ||||||||||||| | |||||||| | | ||||||| |||||||||||| |||||| Sbjct: 561 gcgctcgtcaacgtccacctctcctgcaggaacatgccgacgatggatttgggggtgctc 620 Query: 385 aaggacatgcccaggatccgcgacagggcgagcgccaaattggc 428 ||||| ||||| |||||||||| | ||||| | |||| ||||| Sbjct: 621 aaggatatgccggggatccgcgataaggcgaactccaagttggc 664
>gb|AC137529.3| Carollia perspicillata clone 6M17, complete sequence Length = 118381 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 176 cctcctccccatccccaaccccg 198 ||||||||||||||||||||||| Sbjct: 71013 cctcctccccatccccaaccccg 71035
>gb|DP000018.1| Carollia perspicillata target 1 genomic scaffold Length = 1501503 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 176 cctcctccccatccccaaccccg 198 ||||||||||||||||||||||| Sbjct: 518665 cctcctccccatccccaaccccg 518687
>gb|AY656992.1| Porcine reproductive and respiratory syndrome virus isolate MN-184 glycoprotein 5 (ORF5) gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|AY656991.1| Porcine reproductive and respiratory syndrome virus strain Ingelvac ATP glycoprotein 5 (ORF5) gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|AF396844.1| Porcine reproductive and respiratory syndrome virus isolate JA-142 (252p) GP2 glycoprotein, GP3 glycoprotein, GP4 glycoprotein, GP5 glycosylated envelope protein, membrane protein, and nucleocapsid protein mRNAs, complete cds Length = 3188 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 1790 tgctgcgctcgtcaacgccaac 1811
>gb|AF396843.1| Porcine reproductive and respiratory syndrome virus isolate JA-142 (251) GP2 glycoprotein, GP3 glycoprotein, GP4 glycoprotein, GP5 glycosylated envelope protein, membrane protein, and nucleocapsid protein mRNAs, complete cds Length = 3188 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 1790 tgctgcgctcgtcaacgccaac 1811
>gb|AF396842.1| Porcine reproductive and respiratory syndrome virus isolate JA-142 (E) GP2 glycoprotein, GP3 glycoprotein, GP4 glycoprotein, GP5 glycosylated envelope protein, membrane protein, and nucleocapsid protein mRNAs, complete cds Length = 3188 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 1790 tgctgcgctcgtcaacgccaac 1811
>gb|AY545985.1| Porcine reproductive and respiratory syndrome virus strain NVSL 97-7895, complete genome Length = 15414 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 13864 tgctgcgctcgtcaacgccaac 13885
>ref|NM_013385.2| Homo sapiens pleckstrin homology, Sec7 and coiled-coil domains 4 (PSCD4), mRNA Length = 3221 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 tttctggctcagccactgcctc 85 |||||||||||||||||||||| Sbjct: 2361 tttctggctcagccactgcctc 2340
>gb|DQ494267.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004571 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|AY424271.1| Porcine reproductive and respiratory syndrome virus strain JA142, complete genome Length = 15413 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 13864 tgctgcgctcgtcaacgccaac 13885
>gb|AY318772.1| Porcine reproductive and respiratory syndrome virus A7 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|AY318771.1| Porcine reproductive and respiratory syndrome virus A6 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|AY318770.1| Porcine reproductive and respiratory syndrome virus A5 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|AY318769.1| Porcine reproductive and respiratory syndrome virus A4 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|AY318768.1| Porcine reproductive and respiratory syndrome virus A3 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|AY318767.1| Porcine reproductive and respiratory syndrome virus A2 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|AY318766.1| Porcine reproductive and respiratory syndrome virus A1 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478397.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004550 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478390.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004541 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478349.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004488 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478330.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004464 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478297.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004424 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478288.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004415 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478285.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004411 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478255.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004380 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478241.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004358 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478199.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004312 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478173.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004277 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478153.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004253 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478152.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004252 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478145.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004245 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478133.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004229 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478123.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004219 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478098.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004182 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478097.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004181 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478074.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004154 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478037.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004108 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ478018.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004077 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477997.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004047 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477977.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004022 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477961.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003994 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477952.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003983 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477950.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003981 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477948.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003978 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477940.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003970 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477937.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003966 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477930.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003954 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477922.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003940 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477898.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003905 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477806.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003793 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477796.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003782 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477625.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003583 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477613.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003568 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477442.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003357 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477317.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003193 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477272.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003143 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477246.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003112 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477239.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003105 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477197.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003055 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477189.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003043 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477184.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003032 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477165.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0003007 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477157.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002995 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477146.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002983 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477132.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002961 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477128.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002957 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477121.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002950 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477109.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002938 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477091.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002919 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477082.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002910 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477067.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002893 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477024.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002839 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ477018.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002831 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476905.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002686 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476887.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002665 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476867.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002644 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476845.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002620 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476840.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002614 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476839.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002613 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476809.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002580 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476766.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002525 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476763.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002521 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476760.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002516 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476722.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002464 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476720.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002462 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476699.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002436 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476683.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002413 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476678.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002408 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476669.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002398 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476642.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002367 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476641.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002366 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476634.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002359 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476621.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002344 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476611.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002332 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476603.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002320 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476594.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002309 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476581.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002295 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476563.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002273 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476541.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002244 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476533.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002236 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476529.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002232 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476518.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002218 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476512.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002212 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476496.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002196 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476487.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002186 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476460.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002153 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476456.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002149 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476452.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002145 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476448.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002141 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476439.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002132 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476437.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002129 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476416.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002103 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476412.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002099 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476394.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002081 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476387.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002074 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476376.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002062 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476375.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002061 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476371.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002057 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476369.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002055 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476350.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002029 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476338.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002014 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476329.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001997 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476322.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001987 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476314.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001976 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476296.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001951 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476285.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001929 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476257.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001869 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476247.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001857 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476245.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001855 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476238.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001848 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476236.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001846 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476196.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001798 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476185.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001783 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476168.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001759 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476158.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001743 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476138.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001717 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476124.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001702 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476114.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001686 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476106.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001676 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476101.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001670 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476086.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001652 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ476037.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001594 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475972.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001517 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475959.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001499 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475942.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001476 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475941.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001475 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475937.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001468 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475922.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001451 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475913.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001440 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475912.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001439 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475908.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001435 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475904.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001431 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475890.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001413 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475887.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001410 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475882.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001405 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475847.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001359 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475841.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001352 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475840.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001350 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475839.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001348 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475834.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001342 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475827.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001334 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475820.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001325 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475810.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001314 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475800.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001299 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475798.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001297 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475748.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001229 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475745.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001226 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475731.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001210 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475714.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001192 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475700.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001176 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475689.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001164 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475687.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001161 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475548.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0001001 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475519.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000965 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475513.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000958 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475507.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000949 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475504.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000945 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475499.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000940 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475448.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000872 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475436.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000853 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475390.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000800 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475353.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000750 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475342.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000735 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475208.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000575 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475173.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000528 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475103.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000441 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475100.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000434 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475060.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000380 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475058.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000378 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475056.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000376 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475050.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000366 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ475049.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000364 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474989.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000286 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474977.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000274 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474975.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000272 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474939.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000224 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474931.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000213 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474916.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000186 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474914.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000184 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474910.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000179 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474908.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000176 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474903.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000170 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474853.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000116 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474804.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000047 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|DQ474762.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000002 envelope glycoprotein gene, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>gb|AC122726.21| Medicago truncatula clone mth2-23o24, complete sequence Length = 130999 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Minus Query: 44 gtggcccactctattatttgtttctggctcagccactg 81 ||||||||||||| |||| |||||||||| ||||||| Sbjct: 117387 gtggcccactctaacatttttttctggctccgccactg 117350
>emb|Z94160.1|HS63G5 Human DNA sequence from clone RP1-63G5 on chromosome 22q12.3-13.1, complete sequence Length = 97585 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 tttctggctcagccactgcctc 85 |||||||||||||||||||||| Sbjct: 34091 tttctggctcagccactgcctc 34070
>gb|BC033693.1| Homo sapiens pleckstrin homology, Sec7 and coiled-coil domains 4, mRNA (cDNA clone IMAGE:5213325), with apparent retained intron Length = 3695 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 tttctggctcagccactgcctc 85 |||||||||||||||||||||| Sbjct: 2824 tttctggctcagccactgcctc 2803
>gb|AF537950.1| Porcine reproductive and respiratory syndrome virus isolate ATP envelope glycoprotein gene, partial cds Length = 556 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 54 tgctgcgctcgtcaacgccaac 75
>gb|AF537949.1| Porcine reproductive and respiratory syndrome virus isolate JA142 envelope glycoprotein gene, partial cds Length = 556 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 54 tgctgcgctcgtcaacgccaac 75
>emb|CR626739.1| full-length cDNA clone CS0DI044YH21 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 3011 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 tttctggctcagccactgcctc 85 |||||||||||||||||||||| Sbjct: 2200 tttctggctcagccactgcctc 2179
>emb|CR610000.1| full-length cDNA clone CS0DL005YC05 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 3052 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 tttctggctcagccactgcctc 85 |||||||||||||||||||||| Sbjct: 2245 tttctggctcagccactgcctc 2224
>emb|CR604959.1| full-length cDNA clone CS0DI071YO15 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1339 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 tttctggctcagccactgcctc 85 |||||||||||||||||||||| Sbjct: 528 tttctggctcagccactgcctc 507
>emb|CR597077.1| full-length cDNA clone CS0DJ002YI06 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 2043 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 tttctggctcagccactgcctc 85 |||||||||||||||||||||| Sbjct: 1221 tttctggctcagccactgcctc 1200
>dbj|AK002145.1| Homo sapiens cDNA FLJ11283 fis, clone PLACE1009524, moderately similar to ARF NUCLEOTIDE-BINDING SITE OPENER Length = 2516 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 tttctggctcagccactgcctc 85 |||||||||||||||||||||| Sbjct: 1677 tttctggctcagccactgcctc 1656
>dbj|AB175717.1| Porcine respiratory and reproductive syndrome virus gene for envelope glycoprotein GP5, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>dbj|AB175714.1| Porcine respiratory and reproductive syndrome virus gene for envelope glycoprotein GP5, complete cds Length = 603 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaac 96
>dbj|AK024428.1| Homo sapiens mRNA for FLJ00017 protein, partial cds Length = 4459 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 tttctggctcagccactgcctc 85 |||||||||||||||||||||| Sbjct: 3620 tttctggctcagccactgcctc 3599
>gb|AF075458.1|AF075458 Homo sapiens cytohesin-4 (CYT4) mRNA, complete cds Length = 3150 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 tttctggctcagccactgcctc 85 |||||||||||||||||||||| Sbjct: 2290 tttctggctcagccactgcctc 2269
>gb|BC041161.1| Homo sapiens pleckstrin homology, Sec7 and coiled-coil domains 4, mRNA (cDNA clone MGC:48780 IMAGE:5745783), complete cds Length = 3164 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 64 tttctggctcagccactgcctc 85 |||||||||||||||||||||| Sbjct: 2219 tttctggctcagccactgcctc 2198
>gb|AY109950.1| Zea mays CL27393_1 mRNA sequence Length = 996 Score = 44.1 bits (22), Expect = 0.44 Identities = 28/30 (93%) Strand = Plus / Minus Query: 454 atgcttctatcagcctacaaggagatggtc 483 |||||||| || |||||||||||||||||| Sbjct: 943 atgcttctgtcggcctacaaggagatggtc 914
>dbj|AB023782.1| Porcine reproductive and respiratory syndrome virus ORF 2 to 7 genes, partial and complete cds, strain:Kitasato 93-1 Length = 3065 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaac 342 |||||||||||||||||||||| Sbjct: 1502 tgctgcgctcgtcaacgccaac 1523
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 282 ccggtggctggccgccaccgc 302 ||||||||||||||||||||| Sbjct: 964124 ccggtggctggccgccaccgc 964104
>gb|DQ478130.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004226 envelope glycoprotein gene, complete cds Length = 603 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaa 341 ||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaa 95
>gb|DQ478036.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0004107 envelope glycoprotein gene, complete cds Length = 603 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaa 341 ||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaa 95
>gb|DQ476979.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0002781 envelope glycoprotein gene, complete cds Length = 603 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaa 341 ||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaa 95
>gb|DQ475323.1| Porcine respiratory and reproductive syndrome virus isolate PRRSV0000714 envelope glycoprotein gene, complete cds Length = 603 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgccaa 341 ||||||||||||||||||||| Sbjct: 75 tgctgcgctcgtcaacgccaa 95
>emb|AL513366.11| Human DNA sequence from clone CTD-2522E6 on chromosome X Contains the RGN gene for regucalcin (senescence marker protein-30) (RC, SMP30), the gene for neuronal protein 17.3 (P17.3), the RBM10 gene for RNA binding motif protein 10 (MGC997, MGC1132, DXS8237E, KIAA0122), an inositol 1,3,4-triphosphate 5/6 kinase (ITPK1) pseudogene, the UBE1 gene for ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing) (A1S9, A1ST, GXP1, A1S9T, UBE1X, MGC4781), the 5' UTR of the PCTK1 gene for PCTAIRE protein kinase 1 and five CpG islands, complete sequence Length = 145456 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 176 cctcctccccatccccaaccc 196 ||||||||||||||||||||| Sbjct: 24033 cctcctccccatccccaaccc 24053
>emb|AL031587.3|HS1039K5 Human DNA sequence from clone RP5-1039K5 on chromosome 22q12.3-13.2, complete sequence Length = 142723 Score = 42.1 bits (21), Expect = 1.7 Identities = 30/33 (90%) Strand = Plus / Minus Query: 174 cccctcctccccatccccaaccccgtctccctt 206 ||||||||||||| ||| |||||| |||||||| Sbjct: 26424 cccctcctccccagcccaaaccccatctccctt 26392
>emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome; segment 3/13 Length = 349564 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 282 ccggtggctggccgccaccgc 302 ||||||||||||||||||||| Sbjct: 279847 ccggtggctggccgccaccgc 279827
>emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 3/14 Length = 320050 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 282 ccggtggctggccgccaccgc 302 ||||||||||||||||||||| Sbjct: 297820 ccggtggctggccgccaccgc 297800
>emb|CR860972.1| Pongo pygmaeus mRNA; cDNA DKFZp459P0527 (from clone DKFZp459P0527) Length = 2099 Score = 42.1 bits (21), Expect = 1.7 Identities = 30/33 (90%) Strand = Plus / Minus Query: 174 cccctcctccccatccccaaccccgtctccctt 206 ||||||||||||| ||| |||||| |||||||| Sbjct: 1914 cccctcctccccagcccaaaccccatctccctt 1882
>gb|AF006501.4| Homo sapiens chromosome 22q13.1 Cosmid Clone c1155, complete sequence Length = 40129 Score = 42.1 bits (21), Expect = 1.7 Identities = 30/33 (90%) Strand = Plus / Minus Query: 174 cccctcctccccatccccaaccccgtctccctt 206 ||||||||||||| ||| |||||| |||||||| Sbjct: 22477 cccctcctccccagcccaaaccccatctccctt 22445
>emb|BX842567.2| Mouse DNA sequence from clone RP23-340H9 on chromosome 4, complete sequence Length = 18979 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 172 gacccctcctccccatcccca 192 ||||||||||||||||||||| Sbjct: 12735 gacccctcctccccatcccca 12715
>dbj|AK110353.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-H09, full insert sequence Length = 3907 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 67 ctggctcagccactgcctcag 87 ||||||||||||||||||||| Sbjct: 164 ctggctcagccactgcctcag 144
>dbj|AP003040.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-335F8, complete sequence Length = 80198 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 ccctcctccccatccccaacc 195 ||||||||||||||||||||| Sbjct: 72429 ccctcctccccatccccaacc 72449
>gb|DQ246451.1| Porcine respiratory and reproductive syndrome virus strain FJ04A GP2 glycoprotein, GP3 glycoprotein, GP4 glycoprotein, GP5 glycosylated envelope protein, membrane protein M, and nucleocapsid protein N genes, complete cds Length = 3188 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgcca 340 |||||||||||||||||||| Sbjct: 1790 tgctgcgctcgtcaacgcca 1809
>gb|AC102039.8| Mus musculus chromosome 5, clone RP23-262L7, complete sequence Length = 168142 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 tcctccccatccccaacccc 197 |||||||||||||||||||| Sbjct: 84574 tcctccccatccccaacccc 84593
>gb|AC168117.2| Mus musculus BAC clone RP23-461G13 from chromosome 17, complete sequence Length = 169205 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 aggcagtcctccactacatc 28 |||||||||||||||||||| Sbjct: 68413 aggcagtcctccactacatc 68394
>gb|AC135417.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1314_A05, complete sequence Length = 109853 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 274 gccaagacccggtggctggccgcc 297 |||||||||||||||| ||||||| Sbjct: 23248 gccaagacccggtggccggccgcc 23271
>ref|XM_960617.1| Neurospora crassa OR74A hypothetical protein (NCU02579.1) partial mRNA Length = 738 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 agcgcagcgcaacctgcgca 250 |||||||||||||||||||| Sbjct: 462 agcgcagcgcaacctgcgca 481
>gb|AC148991.2| Mus musculus BAC clone RP23-52N2 from chromosome 19, complete sequence Length = 221043 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 386 aggacatgcccaggatccgc 405 |||||||||||||||||||| Sbjct: 158629 aggacatgcccaggatccgc 158610
>ref|XM_331777.1| Neurospora crassa OR74A hypothetical protein (NCU02579.1) partial mRNA Length = 738 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 agcgcagcgcaacctgcgca 250 |||||||||||||||||||| Sbjct: 462 agcgcagcgcaacctgcgca 481
>gb|DQ181609.1| Porcine respiratory and reproductive syndrome virus isolate Col 928 Ant-00 envelope protein gene, partial cds Length = 537 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 tgctgcgctcgtcaacgcca 340 |||||||||||||||||||| Sbjct: 59 tgctgcgctcgtcaacgcca 78 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,020,480 Number of Sequences: 3902068 Number of extensions: 4020480 Number of successful extensions: 84086 Number of sequences better than 10.0: 593 Number of HSP's better than 10.0 without gapping: 593 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 83197 Number of HSP's gapped (non-prelim): 888 length of query: 502 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 480 effective length of database: 17,147,199,772 effective search space: 8230655890560 effective search space used: 8230655890560 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)