Clone Information

BLAST Search Result

Clone Name	basd25c13
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	143	6e-31
2	gb\|AC146619.1\| Genomic sequence for Oryza sativa, Nipponbare str...	143	6e-31
3	gb\|AC134241.2\| Oryza sativa (japonica cultivar-group) chromosome...	143	6e-31
4	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	143	6e-31
5	gb\|BT024025.1\| Zea mays clone EL01N0417D02 mRNA sequence	56	1e-04
6	gb\|AC137529.3\| Carollia perspicillata clone 6M17, complete sequence	46	0.11
7	gb\|DP000018.1\| Carollia perspicillata target 1 genomic scaffold	46	0.11
8	gb\|AY656992.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
9	gb\|AY656991.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
10	gb\|AF396844.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
11	gb\|AF396843.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
12	gb\|AF396842.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
13	gb\|AY545985.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
14	ref\|NM_013385.2\| Homo sapiens pleckstrin homology, Sec7 and coil...	44	0.44
15	gb\|DQ494267.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
16	gb\|AY424271.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
17	gb\|AY318772.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
18	gb\|AY318771.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
19	gb\|AY318770.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
20	gb\|AY318769.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
21	gb\|AY318768.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
22	gb\|AY318767.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
23	gb\|AY318766.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
24	gb\|DQ478397.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
25	gb\|DQ478390.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
26	gb\|DQ478349.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
27	gb\|DQ478330.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
28	gb\|DQ478297.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
29	gb\|DQ478288.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
30	gb\|DQ478285.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
31	gb\|DQ478255.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
32	gb\|DQ478241.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
33	gb\|DQ478199.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
34	gb\|DQ478173.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
35	gb\|DQ478153.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
36	gb\|DQ478152.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
37	gb\|DQ478145.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
38	gb\|DQ478133.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
39	gb\|DQ478123.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
40	gb\|DQ478098.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
41	gb\|DQ478097.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
42	gb\|DQ478074.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
43	gb\|DQ478037.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
44	gb\|DQ478018.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
45	gb\|DQ477997.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
46	gb\|DQ477977.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
47	gb\|DQ477961.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
48	gb\|DQ477952.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
49	gb\|DQ477950.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
50	gb\|DQ477948.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
51	gb\|DQ477940.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
52	gb\|DQ477937.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
53	gb\|DQ477930.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
54	gb\|DQ477922.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
55	gb\|DQ477898.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
56	gb\|DQ477806.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
57	gb\|DQ477796.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
58	gb\|DQ477625.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
59	gb\|DQ477613.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
60	gb\|DQ477442.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
61	gb\|DQ477317.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
62	gb\|DQ477272.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
63	gb\|DQ477246.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
64	gb\|DQ477239.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
65	gb\|DQ477197.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
66	gb\|DQ477189.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
67	gb\|DQ477184.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
68	gb\|DQ477165.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
69	gb\|DQ477157.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
70	gb\|DQ477146.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
71	gb\|DQ477132.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
72	gb\|DQ477128.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
73	gb\|DQ477121.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
74	gb\|DQ477109.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
75	gb\|DQ477091.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
76	gb\|DQ477082.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
77	gb\|DQ477067.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
78	gb\|DQ477024.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
79	gb\|DQ477018.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
80	gb\|DQ476905.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
81	gb\|DQ476887.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
82	gb\|DQ476867.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
83	gb\|DQ476845.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
84	gb\|DQ476840.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
85	gb\|DQ476839.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
86	gb\|DQ476809.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
87	gb\|DQ476766.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
88	gb\|DQ476763.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
89	gb\|DQ476760.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
90	gb\|DQ476722.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
91	gb\|DQ476720.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
92	gb\|DQ476699.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
93	gb\|DQ476683.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
94	gb\|DQ476678.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
95	gb\|DQ476669.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
96	gb\|DQ476642.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
97	gb\|DQ476641.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
98	gb\|DQ476634.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
99	gb\|DQ476621.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
100	gb\|DQ476611.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
101	gb\|DQ476603.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
102	gb\|DQ476594.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
103	gb\|DQ476581.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
104	gb\|DQ476563.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
105	gb\|DQ476541.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
106	gb\|DQ476533.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
107	gb\|DQ476529.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
108	gb\|DQ476518.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
109	gb\|DQ476512.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
110	gb\|DQ476496.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
111	gb\|DQ476487.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
112	gb\|DQ476460.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
113	gb\|DQ476456.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
114	gb\|DQ476452.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
115	gb\|DQ476448.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
116	gb\|DQ476439.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
117	gb\|DQ476437.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
118	gb\|DQ476416.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
119	gb\|DQ476412.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
120	gb\|DQ476394.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
121	gb\|DQ476387.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
122	gb\|DQ476376.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
123	gb\|DQ476375.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
124	gb\|DQ476371.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
125	gb\|DQ476369.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
126	gb\|DQ476350.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
127	gb\|DQ476338.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
128	gb\|DQ476329.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
129	gb\|DQ476322.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
130	gb\|DQ476314.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
131	gb\|DQ476296.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
132	gb\|DQ476285.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
133	gb\|DQ476257.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
134	gb\|DQ476247.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
135	gb\|DQ476245.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
136	gb\|DQ476238.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
137	gb\|DQ476236.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
138	gb\|DQ476196.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
139	gb\|DQ476185.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
140	gb\|DQ476168.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
141	gb\|DQ476158.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
142	gb\|DQ476138.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
143	gb\|DQ476124.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
144	gb\|DQ476114.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
145	gb\|DQ476106.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
146	gb\|DQ476101.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
147	gb\|DQ476086.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
148	gb\|DQ476037.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
149	gb\|DQ475972.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
150	gb\|DQ475959.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
151	gb\|DQ475942.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
152	gb\|DQ475941.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
153	gb\|DQ475937.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
154	gb\|DQ475922.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
155	gb\|DQ475913.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
156	gb\|DQ475912.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
157	gb\|DQ475908.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
158	gb\|DQ475904.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
159	gb\|DQ475890.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
160	gb\|DQ475887.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
161	gb\|DQ475882.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
162	gb\|DQ475847.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
163	gb\|DQ475841.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
164	gb\|DQ475840.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
165	gb\|DQ475839.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
166	gb\|DQ475834.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
167	gb\|DQ475827.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
168	gb\|DQ475820.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
169	gb\|DQ475810.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
170	gb\|DQ475800.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
171	gb\|DQ475798.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
172	gb\|DQ475748.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
173	gb\|DQ475745.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
174	gb\|DQ475731.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
175	gb\|DQ475714.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
176	gb\|DQ475700.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
177	gb\|DQ475689.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
178	gb\|DQ475687.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
179	gb\|DQ475548.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
180	gb\|DQ475519.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
181	gb\|DQ475513.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
182	gb\|DQ475507.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
183	gb\|DQ475504.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
184	gb\|DQ475499.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
185	gb\|DQ475448.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
186	gb\|DQ475436.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
187	gb\|DQ475390.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
188	gb\|DQ475353.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
189	gb\|DQ475342.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
190	gb\|DQ475208.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
191	gb\|DQ475173.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
192	gb\|DQ475103.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
193	gb\|DQ475100.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
194	gb\|DQ475060.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
195	gb\|DQ475058.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
196	gb\|DQ475056.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
197	gb\|DQ475050.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
198	gb\|DQ475049.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
199	gb\|DQ474989.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
200	gb\|DQ474977.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
201	gb\|DQ474975.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
202	gb\|DQ474939.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
203	gb\|DQ474931.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
204	gb\|DQ474916.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
205	gb\|DQ474914.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
206	gb\|DQ474910.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
207	gb\|DQ474908.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
208	gb\|DQ474903.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
209	gb\|DQ474853.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
210	gb\|DQ474804.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
211	gb\|DQ474762.1\| Porcine respiratory and reproductive syndrome vir...	44	0.44
212	gb\|AC122726.21\| Medicago truncatula clone mth2-23o24, complete s...	44	0.44
213	emb\|Z94160.1\|HS63G5 Human DNA sequence from clone RP1-63G5 on ch...	44	0.44
214	gb\|BC033693.1\| Homo sapiens pleckstrin homology, Sec7 and coiled...	44	0.44
215	gb\|AF537950.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
216	gb\|AF537949.1\| Porcine reproductive and respiratory syndrome vir...	44	0.44
217	emb\|CR626739.1\| full-length cDNA clone CS0DI044YH21 of Placenta ...	44	0.44
218	emb\|CR610000.1\| full-length cDNA clone CS0DL005YC05 of B cells (...	44	0.44
219	emb\|CR604959.1\| full-length cDNA clone CS0DI071YO15 of Placenta ...	44	0.44
220	emb\|CR597077.1\| full-length cDNA clone CS0DJ002YI06 of T cells (...	44	0.44
221	dbj\|AK002145.1\| Homo sapiens cDNA FLJ11283 fis, clone PLACE10095...	44	0.44
222	dbj\|AB175717.1\| Porcine respiratory and reproductive syndrome vi...	44	0.44
223	dbj\|AB175714.1\| Porcine respiratory and reproductive syndrome vi...	44	0.44
224	dbj\|AK024428.1\| Homo sapiens mRNA for FLJ00017 protein, partial cds	44	0.44
225	gb\|AF075458.1\|AF075458 Homo sapiens cytohesin-4 (CYT4) mRNA, com...	44	0.44
226	gb\|BC041161.1\| Homo sapiens pleckstrin homology, Sec7 and coiled...	44	0.44
227	gb\|AY109950.1\| Zea mays CL27393_1 mRNA sequence	44	0.44
228	dbj\|AB023782.1\| Porcine reproductive and respiratory syndrome vi...	44	0.44
229	gb\|AE000516.2\| Mycobacterium tuberculosis CDC1551, complete genome	42	1.7
230	gb\|DQ478130.1\| Porcine respiratory and reproductive syndrome vir...	42	1.7
231	gb\|DQ478036.1\| Porcine respiratory and reproductive syndrome vir...	42	1.7
232	gb\|DQ476979.1\| Porcine respiratory and reproductive syndrome vir...	42	1.7
233	gb\|DQ475323.1\| Porcine respiratory and reproductive syndrome vir...	42	1.7
234	emb\|AL513366.11\| Human DNA sequence from clone CTD-2522E6 on chr...	42	1.7
235	emb\|AL031587.3\|HS1039K5 Human DNA sequence from clone RP5-1039K5...	42	1.7
236	emb\|BX842574.1\| Mycobacterium tuberculosis H37Rv complete genome...	42	1.7
237	emb\|BX248336.1\| Mycobacterium bovis subsp. bovis AF2122/97 compl...	42	1.7
238	emb\|CR860972.1\| Pongo pygmaeus mRNA; cDNA DKFZp459P0527 (from cl...	42	1.7
239	gb\|AF006501.4\| Homo sapiens chromosome 22q13.1 Cosmid Clone c115...	42	1.7
240	emb\|BX842567.2\| Mouse DNA sequence from clone RP23-340H9 on chro...	42	1.7
241	dbj\|AK110353.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.7
242	dbj\|AP003040.2\| Homo sapiens genomic DNA, chromosome 11q clone:R...	42	1.7
243	gb\|DQ246451.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
244	gb\|AC102039.8\| Mus musculus chromosome 5, clone RP23-262L7, comp...	40	6.8
245	gb\|AC168117.2\| Mus musculus BAC clone RP23-461G13 from chromosom...	40	6.8
246	gb\|AC135417.3\| Oryza sativa (japonica cultivar-group) chromosome...	40	6.8
247	ref\|XM_960617.1\| Neurospora crassa OR74A hypothetical protein (N...	40	6.8
248	gb\|AC148991.2\| Mus musculus BAC clone RP23-52N2 from chromosome ...	40	6.8
249	ref\|XM_331777.1\| Neurospora crassa OR74A hypothetical protein (N...	40	6.8
250	gb\|DQ181609.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
251	gb\|DQ181608.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
252	gb\|DQ181607.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
253	gb\|DQ181606.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
254	gb\|DQ181603.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
255	gb\|DQ181602.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
256	gb\|DQ181601.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
257	gb\|DQ181600.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
258	gb\|DQ181599.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
259	gb\|DQ181598.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
260	gb\|DQ181596.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
261	gb\|DQ181593.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
262	gb\|DQ181591.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
263	gb\|DQ494276.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
264	gb\|DQ494275.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
265	gb\|BT012675.1\| Drosophila melanogaster RH57795 full insert cDNA	40	6.8
266	gb\|DQ168640.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
267	gb\|AC108909.15\| Mus musculus chromosome 3, clone RP24-245I16, co...	40	6.8
268	gb\|AC132402.3\| Mus musculus BAC clone RP23-404I24 from chromosom...	40	6.8
269	gb\|AC127563.4\| Mus musculus BAC clone RP24-283E13 from chromosom...	40	6.8
270	gb\|AC105407.5\| Mus musculus BAC clone RP24-196J17 from 13, compl...	40	6.8
271	gb\|DQ478386.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
272	gb\|DQ478378.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
273	gb\|DQ478374.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
274	gb\|DQ478372.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
275	gb\|DQ478367.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
276	gb\|DQ478363.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
277	gb\|DQ478362.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
278	gb\|DQ478351.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
279	gb\|DQ478344.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
280	gb\|DQ478334.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
281	gb\|DQ478333.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
282	gb\|DQ478329.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
283	gb\|DQ478314.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
284	gb\|DQ478313.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
285	gb\|DQ478309.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
286	gb\|DQ478302.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
287	gb\|DQ478300.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
288	gb\|DQ478296.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
289	gb\|DQ478287.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
290	gb\|DQ478259.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
291	gb\|DQ478256.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
292	gb\|DQ478252.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
293	gb\|DQ478227.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
294	gb\|DQ478226.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
295	gb\|DQ478223.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
296	gb\|DQ478220.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
297	gb\|DQ478217.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
298	gb\|DQ478216.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
299	gb\|DQ478214.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
300	gb\|DQ478213.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
301	gb\|DQ478203.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
302	gb\|DQ478193.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
303	gb\|DQ478175.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
304	gb\|DQ478157.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
305	gb\|DQ478156.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
306	gb\|DQ478143.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
307	gb\|DQ478121.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
308	gb\|DQ478114.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
309	gb\|DQ478111.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
310	gb\|DQ478093.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
311	gb\|DQ478092.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
312	gb\|DQ478080.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
313	gb\|DQ478077.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
314	gb\|DQ478056.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
315	gb\|DQ478047.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
316	gb\|DQ478044.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
317	gb\|DQ478033.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
318	gb\|DQ478032.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
319	gb\|DQ478024.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
320	gb\|DQ478016.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
321	gb\|DQ478009.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
322	gb\|DQ478003.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
323	gb\|DQ477989.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
324	gb\|DQ477983.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
325	gb\|DQ477982.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
326	gb\|DQ477979.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
327	gb\|DQ477978.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
328	gb\|DQ477974.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
329	gb\|DQ477973.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
330	gb\|DQ477966.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
331	gb\|DQ477957.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
332	gb\|DQ477939.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
333	gb\|DQ477808.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
334	gb\|DQ477793.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
335	gb\|DQ477787.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
336	gb\|DQ477768.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
337	gb\|DQ477752.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
338	gb\|DQ477732.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
339	gb\|DQ477716.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
340	gb\|DQ477708.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
341	gb\|DQ477515.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
342	gb\|DQ477512.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
343	gb\|DQ477395.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
344	gb\|DQ477230.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
345	gb\|DQ477229.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
346	gb\|DQ477200.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
347	gb\|DQ477190.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
348	gb\|DQ477176.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
349	gb\|DQ477170.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
350	gb\|DQ477166.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
351	gb\|DQ477151.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
352	gb\|DQ477142.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
353	gb\|DQ477141.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
354	gb\|DQ477140.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
355	gb\|DQ477127.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
356	gb\|DQ477126.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
357	gb\|DQ477119.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
358	gb\|DQ477117.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
359	gb\|DQ477114.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
360	gb\|DQ477113.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
361	gb\|DQ477112.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
362	gb\|DQ477096.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
363	gb\|DQ477092.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
364	gb\|DQ477086.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
365	gb\|DQ477085.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
366	gb\|DQ477081.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
367	gb\|DQ477070.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
368	gb\|DQ477068.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
369	gb\|DQ477056.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
370	gb\|DQ477043.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
371	gb\|DQ477033.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
372	gb\|DQ477027.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
373	gb\|DQ477021.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
374	gb\|DQ477013.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
375	gb\|DQ477012.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
376	gb\|DQ477000.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
377	gb\|DQ476990.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
378	gb\|DQ476983.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
379	gb\|DQ476981.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
380	gb\|DQ476967.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
381	gb\|DQ476964.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
382	gb\|DQ476952.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
383	gb\|DQ476949.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
384	gb\|DQ476947.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
385	gb\|DQ476940.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
386	gb\|DQ476918.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
387	gb\|DQ476917.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
388	gb\|DQ476914.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
389	gb\|DQ476910.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
390	gb\|DQ476896.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
391	gb\|DQ476895.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
392	gb\|DQ476884.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
393	gb\|DQ476881.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
394	gb\|DQ476870.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
395	gb\|DQ476861.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
396	gb\|DQ476853.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
397	gb\|DQ476851.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
398	gb\|DQ476850.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
399	gb\|DQ476843.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
400	gb\|DQ476841.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
401	gb\|DQ476836.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
402	gb\|DQ476813.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
403	gb\|DQ476808.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
404	gb\|DQ476785.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
405	gb\|DQ476749.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
406	gb\|DQ476737.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
407	gb\|DQ476733.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
408	gb\|DQ476705.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
409	gb\|DQ476702.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
410	gb\|DQ476696.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
411	gb\|DQ476684.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
412	gb\|DQ476677.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
413	gb\|DQ476672.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
414	gb\|DQ476661.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
415	gb\|DQ476660.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
416	gb\|DQ476640.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
417	gb\|DQ476633.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
418	gb\|DQ476616.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
419	gb\|DQ476583.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
420	gb\|DQ476582.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
421	gb\|DQ476560.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
422	gb\|DQ476550.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
423	gb\|DQ476545.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
424	gb\|DQ476543.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
425	gb\|DQ476521.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
426	gb\|DQ476486.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
427	gb\|DQ476477.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
428	gb\|DQ476471.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
429	gb\|DQ476470.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
430	gb\|DQ476468.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
431	gb\|DQ476458.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
432	gb\|DQ476457.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
433	gb\|DQ476450.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
434	gb\|DQ476449.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
435	gb\|DQ476440.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
436	gb\|DQ476431.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
437	gb\|DQ476428.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
438	gb\|DQ476419.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
439	gb\|DQ476418.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
440	gb\|DQ476381.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
441	gb\|DQ476374.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
442	gb\|DQ476363.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
443	gb\|DQ476319.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
444	gb\|DQ476313.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
445	gb\|DQ476274.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
446	gb\|DQ476234.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
447	gb\|DQ476233.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
448	gb\|DQ476226.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
449	gb\|DQ476217.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
450	gb\|DQ476210.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
451	gb\|DQ476204.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
452	gb\|DQ476195.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
453	gb\|DQ476190.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
454	gb\|DQ476162.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
455	gb\|DQ476146.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
456	gb\|DQ476140.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
457	gb\|DQ476125.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
458	gb\|DQ476119.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
459	gb\|DQ476116.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
460	gb\|DQ476107.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
461	gb\|DQ476100.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
462	gb\|DQ476069.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
463	gb\|DQ476011.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
464	gb\|DQ476008.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
465	gb\|DQ476003.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
466	gb\|DQ476000.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
467	gb\|DQ475993.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
468	gb\|DQ475963.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
469	gb\|DQ475936.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
470	gb\|DQ475917.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
471	gb\|DQ475916.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
472	gb\|DQ475903.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
473	gb\|DQ475878.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
474	gb\|DQ475876.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
475	gb\|DQ475842.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
476	gb\|DQ475828.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
477	gb\|DQ475822.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
478	gb\|DQ475816.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
479	gb\|DQ475811.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
480	gb\|DQ475805.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
481	gb\|DQ475804.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
482	gb\|DQ475785.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
483	gb\|DQ475783.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
484	gb\|DQ475780.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
485	gb\|DQ475779.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
486	gb\|DQ475770.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
487	gb\|DQ475755.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
488	gb\|DQ475746.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
489	gb\|DQ475733.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
490	gb\|DQ475719.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
491	gb\|DQ475699.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
492	gb\|DQ475643.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
493	gb\|DQ475605.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
494	gb\|DQ475604.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
495	gb\|DQ475581.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
496	gb\|DQ475578.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
497	gb\|DQ475575.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
498	gb\|DQ475552.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
499	gb\|DQ475547.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8
500	gb\|DQ475539.1\| Porcine respiratory and reproductive syndrome vir...	40	6.8

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  143 bits (72), Expect = 6e-31
 Identities = 123/140 (87%)
 Strand = Plus / Plus

                                                                           
Query: 211     ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 270
               |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 5868450 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 5868509

                                                                           
Query: 271     gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 330
               ||||||||| ||||||||||| ||||| ||||| | ||||||||||| ||  | || |||
Sbjct: 5868510 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 5868569

                                   
Query: 331     gtcaacgccaacctctcccg 350
               ||||||||| ||||||||||
Sbjct: 5868570 gtcaacgcccacctctcccg 5868589



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                           
Query: 355     tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 414
               |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | ||||
Sbjct: 5868714 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 5868773

                   
Query: 415     agcg 418
               ||||
Sbjct: 5868774 agcg 5868777

to top

>gb|AC146619.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNAa0021B21, from chromosome 3, complete sequence
          Length = 139208

 Score =  143 bits (72), Expect = 6e-31
 Identities = 123/140 (87%)
 Strand = Plus / Plus

                                                                         
Query: 211   ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 270
             |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 97280 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 97339

                                                                         
Query: 271   gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 330
             ||||||||| ||||||||||| ||||| ||||| | ||||||||||| ||  | || |||
Sbjct: 97340 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 97399

                                 
Query: 331   gtcaacgccaacctctcccg 350
             ||||||||| ||||||||||
Sbjct: 97400 gtcaacgcccacctctcccg 97419



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                         
Query: 355   tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 414
             |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | ||||
Sbjct: 97544 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 97603

                 
Query: 415   agcg 418
             ||||
Sbjct: 97604 agcg 97607

to top

>gb|AC134241.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0085F02, complete sequence
          Length = 128535

 Score =  143 bits (72), Expect = 6e-31
 Identities = 123/140 (87%)
 Strand = Plus / Plus

                                                                         
Query: 211   ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 270
             |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 18072 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 18131

                                                                         
Query: 271   gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 330
             ||||||||| ||||||||||| ||||| ||||| | ||||||||||| ||  | || |||
Sbjct: 18132 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 18191

                                 
Query: 331   gtcaacgccaacctctcccg 350
             ||||||||| ||||||||||
Sbjct: 18192 gtcaacgcccacctctcccg 18211



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                         
Query: 355   tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 414
             |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | ||||
Sbjct: 18336 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 18395

                 
Query: 415   agcg 418
             ||||
Sbjct: 18396 agcg 18399

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  143 bits (72), Expect = 6e-31
 Identities = 123/140 (87%)
 Strand = Plus / Plus

                                                                           
Query: 211     ctgcgccagtggcgcccagcagcgcagcgcaacctgcgcaaccagtggtcacgcctgctt 270
               |||||||||||||| || || ||||||||||||||||| ||||||||||| |||||||| 
Sbjct: 5867663 ctgcgccagtggcggccggcggcgcagcgcaacctgcggaaccagtggtcgcgcctgctc 5867722

                                                                           
Query: 271     gccgccaagacccggtggctggccgccaccgccaatggccgctcccatgctgctgcgctc 330
               ||||||||| ||||||||||| ||||| ||||| | ||||||||||| ||  | || |||
Sbjct: 5867723 gccgccaaggcccggtggctgtccgccgccgccgacggccgctcccacgcctccgccctc 5867782

                                   
Query: 331     gtcaacgccaacctctcccg 350
               ||||||||| ||||||||||
Sbjct: 5867783 gtcaacgcccacctctcccg 5867802



 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                           
Query: 355     tacatgccagggatggatttgggagtgctcaaggacatgcccaggatccgcgacagggcg 414
               |||||||| || ||||||||||| |||||||||||||||||| |||||||||| | ||||
Sbjct: 5867927 tacatgccgggcatggatttgggggtgctcaaggacatgcccgggatccgcgagaaggcg 5867986

                   
Query: 415     agcg 418
               ||||
Sbjct: 5867987 agcg 5867990

to top

>gb|BT024025.1| Zea mays clone EL01N0417D02 mRNA sequence
          Length = 1565

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                       
Query: 325 gcgctcgtcaacgccaacctctcccgtggttacatgccagggatggatttgggagtgctc 384
           ||||||||||||| | |||||||| |  |  |||||||   |||||||||||| ||||||
Sbjct: 561 gcgctcgtcaacgtccacctctcctgcaggaacatgccgacgatggatttgggggtgctc 620

                                                       
Query: 385 aaggacatgcccaggatccgcgacagggcgagcgccaaattggc 428
           ||||| |||||  |||||||||| | ||||| | |||| |||||
Sbjct: 621 aaggatatgccggggatccgcgataaggcgaactccaagttggc 664

to top

>gb|AC137529.3| Carollia perspicillata clone 6M17, complete sequence
          Length = 118381

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 176   cctcctccccatccccaaccccg 198
             |||||||||||||||||||||||
Sbjct: 71013 cctcctccccatccccaaccccg 71035

to top

>gb|DP000018.1| Carollia perspicillata target 1 genomic scaffold
          Length = 1501503

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 176    cctcctccccatccccaaccccg 198
              |||||||||||||||||||||||
Sbjct: 518665 cctcctccccatccccaaccccg 518687

to top

>gb|AY656992.1| Porcine reproductive and respiratory syndrome virus isolate MN-184
           glycoprotein 5 (ORF5) gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|AY656991.1| Porcine reproductive and respiratory syndrome virus strain Ingelvac
           ATP glycoprotein 5 (ORF5) gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|AF396844.1| Porcine reproductive and respiratory syndrome virus isolate JA-142
            (252p) GP2 glycoprotein, GP3 glycoprotein, GP4
            glycoprotein, GP5 glycosylated envelope protein, membrane
            protein, and nucleocapsid protein mRNAs, complete cds
          Length = 3188

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 321  tgctgcgctcgtcaacgccaac 342
            ||||||||||||||||||||||
Sbjct: 1790 tgctgcgctcgtcaacgccaac 1811

to top

>gb|AF396843.1| Porcine reproductive and respiratory syndrome virus isolate JA-142
            (251) GP2 glycoprotein, GP3 glycoprotein, GP4
            glycoprotein, GP5 glycosylated envelope protein, membrane
            protein, and nucleocapsid protein mRNAs, complete cds
          Length = 3188

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 321  tgctgcgctcgtcaacgccaac 342
            ||||||||||||||||||||||
Sbjct: 1790 tgctgcgctcgtcaacgccaac 1811

to top

>gb|AF396842.1| Porcine reproductive and respiratory syndrome virus isolate JA-142
            (E) GP2 glycoprotein, GP3 glycoprotein, GP4 glycoprotein,
            GP5 glycosylated envelope protein, membrane protein, and
            nucleocapsid protein mRNAs, complete cds
          Length = 3188

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 321  tgctgcgctcgtcaacgccaac 342
            ||||||||||||||||||||||
Sbjct: 1790 tgctgcgctcgtcaacgccaac 1811

to top

>gb|AY545985.1| Porcine reproductive and respiratory syndrome virus strain NVSL
             97-7895, complete genome
          Length = 15414

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 321   tgctgcgctcgtcaacgccaac 342
             ||||||||||||||||||||||
Sbjct: 13864 tgctgcgctcgtcaacgccaac 13885

to top

>ref|NM_013385.2| Homo sapiens pleckstrin homology, Sec7 and coiled-coil domains 4
            (PSCD4), mRNA
          Length = 3221

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   tttctggctcagccactgcctc 85
            ||||||||||||||||||||||
Sbjct: 2361 tttctggctcagccactgcctc 2340

to top

>gb|DQ494267.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004571 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|AY424271.1| Porcine reproductive and respiratory syndrome virus strain JA142,
             complete genome
          Length = 15413

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 321   tgctgcgctcgtcaacgccaac 342
             ||||||||||||||||||||||
Sbjct: 13864 tgctgcgctcgtcaacgccaac 13885

to top

>gb|AY318772.1| Porcine reproductive and respiratory syndrome virus A7 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|AY318771.1| Porcine reproductive and respiratory syndrome virus A6 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|AY318770.1| Porcine reproductive and respiratory syndrome virus A5 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|AY318769.1| Porcine reproductive and respiratory syndrome virus A4 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|AY318768.1| Porcine reproductive and respiratory syndrome virus A3 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|AY318767.1| Porcine reproductive and respiratory syndrome virus A2 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|AY318766.1| Porcine reproductive and respiratory syndrome virus A1 envelope
           glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478397.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004550 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478390.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004541 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478349.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004488 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478330.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004464 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478297.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004424 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478288.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004415 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478285.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004411 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478255.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004380 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478241.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004358 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478199.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004312 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478173.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004277 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478153.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004253 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478152.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004252 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478145.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004245 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478133.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004229 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478123.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004219 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478098.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004182 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478097.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004181 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478074.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004154 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478037.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004108 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ478018.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004077 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477997.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004047 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477977.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004022 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477961.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003994 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477952.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003983 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477950.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003981 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477948.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003978 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477940.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003970 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477937.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003966 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477930.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003954 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477922.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003940 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477898.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003905 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477806.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003793 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477796.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003782 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477625.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003583 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477613.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003568 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477442.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003357 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477317.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003193 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477272.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003143 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477246.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003112 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477239.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003105 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477197.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003055 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477189.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003043 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477184.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003032 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477165.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0003007 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477157.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002995 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477146.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002983 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477132.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002961 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477128.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002957 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477121.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002950 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477109.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002938 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477091.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002919 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477082.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002910 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477067.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002893 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477024.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002839 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ477018.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002831 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476905.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002686 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476887.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002665 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476867.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002644 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476845.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002620 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476840.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002614 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476839.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002613 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476809.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002580 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476766.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002525 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476763.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002521 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476760.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002516 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476722.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002464 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476720.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002462 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476699.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002436 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476683.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002413 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476678.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002408 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476669.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002398 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476642.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002367 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476641.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002366 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476634.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002359 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476621.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002344 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476611.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002332 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476603.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002320 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476594.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002309 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476581.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002295 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476563.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002273 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476541.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002244 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476533.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002236 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476529.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002232 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476518.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002218 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476512.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002212 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476496.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002196 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476487.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002186 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476460.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002153 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476456.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002149 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476452.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002145 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476448.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002141 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476439.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002132 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476437.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002129 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476416.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002103 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476412.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002099 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476394.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002081 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476387.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002074 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476376.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002062 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476375.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002061 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476371.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002057 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476369.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002055 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476350.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002029 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476338.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002014 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476329.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001997 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476322.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001987 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476314.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001976 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476296.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001951 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476285.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001929 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476257.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001869 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476247.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001857 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476245.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001855 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476238.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001848 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476236.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001846 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476196.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001798 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476185.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001783 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476168.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001759 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476158.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001743 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476138.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001717 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476124.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001702 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476114.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001686 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476106.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001676 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476101.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001670 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476086.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001652 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ476037.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001594 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475972.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001517 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475959.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001499 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475942.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001476 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475941.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001475 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475937.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001468 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475922.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001451 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475913.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001440 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475912.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001439 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475908.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001435 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475904.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001431 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475890.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001413 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475887.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001410 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475882.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001405 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475847.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001359 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475841.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001352 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475840.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001350 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475839.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001348 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475834.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001342 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475827.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001334 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475820.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001325 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475810.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001314 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475800.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001299 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475798.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001297 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475748.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001229 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475745.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001226 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475731.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001210 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475714.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001192 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475700.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001176 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475689.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001164 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475687.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001161 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475548.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0001001 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475519.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000965 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475513.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000958 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475507.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000949 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475504.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000945 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475499.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000940 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475448.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000872 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475436.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000853 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475390.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000800 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475353.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000750 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475342.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000735 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475208.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000575 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475173.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000528 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475103.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000441 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475100.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000434 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475060.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000380 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475058.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000378 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475056.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000376 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475050.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000366 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ475049.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000364 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474989.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000286 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474977.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000274 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474975.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000272 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474939.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000224 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474931.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000213 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474916.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000186 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474914.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000184 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474910.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000179 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474908.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000176 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474903.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000170 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474853.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000116 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474804.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000047 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|DQ474762.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000002 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>gb|AC122726.21| Medicago truncatula clone mth2-23o24, complete sequence
          Length = 130999

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 44     gtggcccactctattatttgtttctggctcagccactg 81
              |||||||||||||  |||| |||||||||| |||||||
Sbjct: 117387 gtggcccactctaacatttttttctggctccgccactg 117350

to top

>emb|Z94160.1|HS63G5 Human DNA sequence from clone RP1-63G5 on chromosome 22q12.3-13.1,
             complete sequence
          Length = 97585

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 64    tttctggctcagccactgcctc 85
             ||||||||||||||||||||||
Sbjct: 34091 tttctggctcagccactgcctc 34070

to top

>gb|BC033693.1| Homo sapiens pleckstrin homology, Sec7 and coiled-coil domains 4,
            mRNA (cDNA clone IMAGE:5213325), with apparent retained
            intron
          Length = 3695

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   tttctggctcagccactgcctc 85
            ||||||||||||||||||||||
Sbjct: 2824 tttctggctcagccactgcctc 2803

to top

>gb|AF537950.1| Porcine reproductive and respiratory syndrome virus isolate ATP
           envelope glycoprotein gene, partial cds
          Length = 556

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 54  tgctgcgctcgtcaacgccaac 75

to top

>gb|AF537949.1| Porcine reproductive and respiratory syndrome virus isolate JA142
           envelope glycoprotein gene, partial cds
          Length = 556

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 54  tgctgcgctcgtcaacgccaac 75

to top

>emb|CR626739.1| full-length cDNA clone CS0DI044YH21 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 3011

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   tttctggctcagccactgcctc 85
            ||||||||||||||||||||||
Sbjct: 2200 tttctggctcagccactgcctc 2179

to top

>emb|CR610000.1| full-length cDNA clone CS0DL005YC05 of B cells (Ramos cell line) Cot
            25-normalized of Homo sapiens (human)
          Length = 3052

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   tttctggctcagccactgcctc 85
            ||||||||||||||||||||||
Sbjct: 2245 tttctggctcagccactgcctc 2224

to top

>emb|CR604959.1| full-length cDNA clone CS0DI071YO15 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1339

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 64  tttctggctcagccactgcctc 85
           ||||||||||||||||||||||
Sbjct: 528 tttctggctcagccactgcctc 507

to top

>emb|CR597077.1| full-length cDNA clone CS0DJ002YI06 of T cells (Jurkat cell line) Cot
            10-normalized of Homo sapiens (human)
          Length = 2043

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   tttctggctcagccactgcctc 85
            ||||||||||||||||||||||
Sbjct: 1221 tttctggctcagccactgcctc 1200

to top

>dbj|AK002145.1| Homo sapiens cDNA FLJ11283 fis, clone PLACE1009524, moderately
            similar to ARF NUCLEOTIDE-BINDING SITE OPENER
          Length = 2516

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   tttctggctcagccactgcctc 85
            ||||||||||||||||||||||
Sbjct: 1677 tttctggctcagccactgcctc 1656

to top

>dbj|AB175717.1| Porcine respiratory and reproductive syndrome virus gene for
           envelope glycoprotein GP5, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>dbj|AB175714.1| Porcine respiratory and reproductive syndrome virus gene for
           envelope glycoprotein GP5, complete cds
          Length = 603

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 321 tgctgcgctcgtcaacgccaac 342
           ||||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaac 96

to top

>dbj|AK024428.1| Homo sapiens mRNA for FLJ00017 protein, partial cds
          Length = 4459

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   tttctggctcagccactgcctc 85
            ||||||||||||||||||||||
Sbjct: 3620 tttctggctcagccactgcctc 3599

to top

>gb|AF075458.1|AF075458 Homo sapiens cytohesin-4 (CYT4) mRNA, complete cds
          Length = 3150

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   tttctggctcagccactgcctc 85
            ||||||||||||||||||||||
Sbjct: 2290 tttctggctcagccactgcctc 2269

to top

>gb|BC041161.1| Homo sapiens pleckstrin homology, Sec7 and coiled-coil domains 4,
            mRNA (cDNA clone MGC:48780 IMAGE:5745783), complete cds
          Length = 3164

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 64   tttctggctcagccactgcctc 85
            ||||||||||||||||||||||
Sbjct: 2219 tttctggctcagccactgcctc 2198

to top

>gb|AY109950.1| Zea mays CL27393_1 mRNA sequence
          Length = 996

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 454 atgcttctatcagcctacaaggagatggtc 483
           |||||||| || ||||||||||||||||||
Sbjct: 943 atgcttctgtcggcctacaaggagatggtc 914

to top

>dbj|AB023782.1| Porcine reproductive and respiratory syndrome virus ORF 2 to 7 genes,
            partial and complete cds, strain:Kitasato 93-1
          Length = 3065

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 321  tgctgcgctcgtcaacgccaac 342
            ||||||||||||||||||||||
Sbjct: 1502 tgctgcgctcgtcaacgccaac 1523

to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 282    ccggtggctggccgccaccgc 302
              |||||||||||||||||||||
Sbjct: 964124 ccggtggctggccgccaccgc 964104

to top

>gb|DQ478130.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004226 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 321 tgctgcgctcgtcaacgccaa 341
           |||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaa 95

to top

>gb|DQ478036.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0004107 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 321 tgctgcgctcgtcaacgccaa 341
           |||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaa 95

to top

>gb|DQ476979.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0002781 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 321 tgctgcgctcgtcaacgccaa 341
           |||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaa 95

to top

>gb|DQ475323.1| Porcine respiratory and reproductive syndrome virus isolate
           PRRSV0000714 envelope glycoprotein gene, complete cds
          Length = 603

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 321 tgctgcgctcgtcaacgccaa 341
           |||||||||||||||||||||
Sbjct: 75  tgctgcgctcgtcaacgccaa 95

to top

>emb|AL513366.11| Human DNA sequence from clone CTD-2522E6 on chromosome X Contains the
             RGN gene for regucalcin (senescence marker protein-30)
             (RC, SMP30), the gene for neuronal protein 17.3 (P17.3),
             the RBM10 gene for RNA binding motif protein 10 (MGC997,
             MGC1132, DXS8237E, KIAA0122), an inositol
             1,3,4-triphosphate 5/6 kinase (ITPK1) pseudogene, the UBE1
             gene for ubiquitin-activating enzyme E1 (A1S9T and BN75
             temperature sensitivity complementing) (A1S9, A1ST, GXP1,
             A1S9T, UBE1X, MGC4781), the 5' UTR of the PCTK1 gene for
             PCTAIRE protein kinase 1 and five CpG islands, complete
             sequence
          Length = 145456

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 176   cctcctccccatccccaaccc 196
             |||||||||||||||||||||
Sbjct: 24033 cctcctccccatccccaaccc 24053

to top

>emb|AL031587.3|HS1039K5 Human DNA sequence from clone RP5-1039K5 on chromosome 22q12.3-13.2,
             complete sequence
          Length = 142723

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 174   cccctcctccccatccccaaccccgtctccctt 206
             ||||||||||||| ||| |||||| ||||||||
Sbjct: 26424 cccctcctccccagcccaaaccccatctccctt 26392

to top

>emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome; segment 3/13
          Length = 349564

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 282    ccggtggctggccgccaccgc 302
              |||||||||||||||||||||
Sbjct: 279847 ccggtggctggccgccaccgc 279827

to top

>emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 3/14
          Length = 320050

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 282    ccggtggctggccgccaccgc 302
              |||||||||||||||||||||
Sbjct: 297820 ccggtggctggccgccaccgc 297800

to top

>emb|CR860972.1| Pongo pygmaeus mRNA; cDNA DKFZp459P0527 (from clone DKFZp459P0527)
          Length = 2099

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 174  cccctcctccccatccccaaccccgtctccctt 206
            ||||||||||||| ||| |||||| ||||||||
Sbjct: 1914 cccctcctccccagcccaaaccccatctccctt 1882

to top

>gb|AF006501.4| Homo sapiens chromosome 22q13.1 Cosmid Clone c1155, complete sequence
          Length = 40129

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 174   cccctcctccccatccccaaccccgtctccctt 206
             ||||||||||||| ||| |||||| ||||||||
Sbjct: 22477 cccctcctccccagcccaaaccccatctccctt 22445

to top

>emb|BX842567.2| Mouse DNA sequence from clone RP23-340H9 on chromosome 4, complete
             sequence
          Length = 18979

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 172   gacccctcctccccatcccca 192
             |||||||||||||||||||||
Sbjct: 12735 gacccctcctccccatcccca 12715

to top

>dbj|AK110353.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-H09, full
           insert sequence
          Length = 3907

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 67  ctggctcagccactgcctcag 87
           |||||||||||||||||||||
Sbjct: 164 ctggctcagccactgcctcag 144

to top

>dbj|AP003040.2| Homo sapiens genomic DNA, chromosome 11q clone:RP11-335F8, complete
             sequence
          Length = 80198

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 175   ccctcctccccatccccaacc 195
             |||||||||||||||||||||
Sbjct: 72429 ccctcctccccatccccaacc 72449

to top

>gb|DQ246451.1| Porcine respiratory and reproductive syndrome virus strain FJ04A GP2
            glycoprotein, GP3 glycoprotein, GP4 glycoprotein, GP5
            glycosylated envelope protein, membrane protein M, and
            nucleocapsid protein N genes, complete cds
          Length = 3188

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 321  tgctgcgctcgtcaacgcca 340
            ||||||||||||||||||||
Sbjct: 1790 tgctgcgctcgtcaacgcca 1809

to top

>gb|AC102039.8| Mus musculus chromosome 5, clone RP23-262L7, complete sequence
          Length = 168142

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   tcctccccatccccaacccc 197
             ||||||||||||||||||||
Sbjct: 84574 tcctccccatccccaacccc 84593

to top

>gb|AC168117.2| Mus musculus BAC clone RP23-461G13 from chromosome 17, complete
             sequence
          Length = 169205

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 9     aggcagtcctccactacatc 28
             ||||||||||||||||||||
Sbjct: 68413 aggcagtcctccactacatc 68394

to top

>gb|AC135417.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1314_A05,
             complete sequence
          Length = 109853

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 274   gccaagacccggtggctggccgcc 297
             |||||||||||||||| |||||||
Sbjct: 23248 gccaagacccggtggccggccgcc 23271

to top

>ref|XM_960617.1| Neurospora crassa OR74A hypothetical protein (NCU02579.1) partial
           mRNA
          Length = 738

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 231 agcgcagcgcaacctgcgca 250
           ||||||||||||||||||||
Sbjct: 462 agcgcagcgcaacctgcgca 481

to top

>gb|AC148991.2| Mus musculus BAC clone RP23-52N2 from chromosome 19, complete sequence
          Length = 221043

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 386    aggacatgcccaggatccgc 405
              ||||||||||||||||||||
Sbjct: 158629 aggacatgcccaggatccgc 158610

to top

>ref|XM_331777.1| Neurospora crassa OR74A hypothetical protein (NCU02579.1) partial
           mRNA
          Length = 738

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 231 agcgcagcgcaacctgcgca 250
           ||||||||||||||||||||
Sbjct: 462 agcgcagcgcaacctgcgca 481

to top

>gb|DQ181609.1| Porcine respiratory and reproductive syndrome virus isolate Col 928
           Ant-00 envelope protein gene, partial cds
          Length = 537

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 321 tgctgcgctcgtcaacgcca 340
           ||||||||||||||||||||
Sbjct: 59  tgctgcgctcgtcaacgcca 78


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,020,480
Number of Sequences: 3902068
Number of extensions: 4020480
Number of successful extensions: 84086
Number of sequences better than 10.0: 593
Number of HSP's better than 10.0 without gapping: 593
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83197
Number of HSP's gapped (non-prelim): 888
length of query: 502
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 480
effective length of database: 17,147,199,772
effective search space: 8230655890560
effective search space used: 8230655890560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result