ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd24l12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY754697.1| Zea mays immunophilin mRNA, complete cds 260 4e-66
2gb|AY103897.1| Zea mays PCO108516 mRNA sequence 260 4e-66
3ref|XM_467909.1| Oryza sativa (japonica cultivar-group), mRNA 218 1e-53
4ref|XM_506987.1| PREDICTED Oryza sativa (japonica cultivar-group... 218 1e-53
5dbj|AK121481.1| Oryza sativa (japonica cultivar-group) cDNA clon... 218 1e-53
6dbj|AK063850.1| Oryza sativa (japonica cultivar-group) cDNA clon... 218 1e-53
7gb|BT016383.1| Zea mays clone Contig216 mRNA sequence 214 2e-52
8dbj|AK100511.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 4e-20
9dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
10dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic D... 105 1e-19
11gb|DQ428233.1| Sorghum propinquum locus PRC0268 genomic sequence 103 6e-19
12gb|DQ428232.1| Sorghum bicolor voucher PI585454 locus PRC0268 ge... 103 6e-19
13gb|DQ428231.1| Sorghum bicolor voucher PI267539 locus PRC0268 ge... 103 6e-19
14gb|DQ428230.1| Sorghum bicolor voucher PI267408 locus PRC0268 ge... 103 6e-19
15gb|DQ428229.1| Sorghum bicolor voucher PI221607 locus PRC0268 ge... 103 6e-19
16gb|DQ428228.1| Sorghum bicolor voucher PI152702 locus PRC0268 ge... 103 6e-19
17gb|DQ428227.1| Sorghum bicolor voucher NSL92371 locus PRC0268 ge... 103 6e-19
18gb|DQ428226.1| Sorghum bicolor voucher NSL87902 locus PRC0268 ge... 103 6e-19
19gb|DQ428225.1| Sorghum bicolor voucher NSL87666 locus PRC0268 ge... 103 6e-19
20gb|DQ428224.1| Sorghum bicolor voucher NSL77217 locus PRC0268 ge... 103 6e-19
21gb|DQ428223.1| Sorghum bicolor voucher NSL77034 locus PRC0268 ge... 103 6e-19
22gb|DQ428222.1| Sorghum bicolor voucher NSL56174 locus PRC0268 ge... 103 6e-19
23gb|DQ428221.1| Sorghum bicolor voucher NSL56003 locus PRC0268 ge... 103 6e-19
24gb|DQ428220.1| Sorghum bicolor voucher NSL55243 locus PRC0268 ge... 103 6e-19
25gb|DQ428219.1| Sorghum bicolor voucher NSL51365 locus PRC0268 ge... 103 6e-19
26gb|DQ428218.1| Sorghum bicolor voucher NSL51030 locus PRC0268 ge... 103 6e-19
27gb|DQ428217.1| Sorghum bicolor voucher NSL50875 locus PRC0268 ge... 103 6e-19
28gb|U96925.1|VFU96925 Vicia faba immunophilin (FKBP12) mRNA, comp... 72 2e-09
29gb|AY490245.1| Lycopersicon esculentum CONSTANS interacting prot... 70 8e-09
30ref|NM_125831.2| Arabidopsis thaliana FKBP12; FK506 binding / pe... 54 5e-04
31gb|AY081564.1| Arabidopsis thaliana immunophilin (At5g64350) mRN... 54 5e-04
32gb|AY059928.1| Arabidopsis thaliana immunophilin (At5g64350; MSJ... 54 5e-04
33gb|U96924.1|ATU96924 Arabidopsis thaliana immunophilin (FKBP12) ... 54 5e-04
34gb|AY084289.1| Arabidopsis thaliana clone 10243 mRNA, complete s... 54 5e-04
35dbj|AP007284.1| Lotus japonicus genomic DNA, chromosome 6, clone... 48 0.028
36emb|AJ495769.1|HVU495769 Hordeum vulgare mRNA for putative immun... 42 1.8
37gb|DQ271487.1| Mustela vison clone IX2M19 microsatellite sequence 42 1.8
38gb|AF165999.1|AF165999 Drosophila melanogaster sodium-dependent ... 42 1.8
39gb|M92297.2|STMBMANASE Streptomyces lividans mannanase (manA) ge... 42 1.8
40dbj|AB027469.1| Drosophila melanogaster gene for glutamate trans... 42 1.8
41ref|XM_636926.1| Dictyostelium discoideum hypothetical protein (... 40 6.9
42gb|AC126538.1| Homo sapiens chromosome 16 clone CTD-3225F13, com... 40 6.9
43gb|AC133065.3| Homo sapiens chromosome 16 clone RP11-876N24, com... 40 6.9
44emb|AL670597.18| Mouse DNA sequence from clone RP23-235P16 on ch... 40 6.9
45emb|AL954741.9| Zebrafish DNA sequence from clone CH211-255F4 in... 40 6.9
46gb|AY105607.1| Zea mays PCO107138 mRNA sequence 40 6.9
47gb|AC007014.1|AC007014 Homo sapiens chromosome 16 clone 66H6, co... 40 6.9
48dbj|AP000781.6| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 6.9 
>gb|AY754697.1| Zea mays immunophilin mRNA, complete cds
          Length = 761

 Score =  260 bits (131), Expect = 4e-66
 Identities = 253/291 (86%), Gaps = 2/291 (0%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||||||||| |||||||||||||||||||  | ||||||||| |||||||||
Sbjct: 123 agaagcagatcctgagatccggcaccggccccaagccgataaagggccag-aaggtcacc 181

                                                                       
Query: 79  gtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaag 138
           || ||||||||||||||||| |||||  |||||||||||||||| |||||||| ||||||
Sbjct: 182 gttcactgcaccggctacgggaaggatcgtgatctgtccaagaaattttggagcaccaag 241

                                                                       
Query: 139 gtatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatg 198
           | | ||||||||||||||||||  ||||| |||||| | |||||||||||||||||||||
Sbjct: 242 g-accctgggcagcagccattcagtttcagcattggtcagggttcagtgatcaaaggatg 300

                                                                       
Query: 199 ggatgagggagttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccaga 258
           ||| ||||||||||||  ||||||| |||||||||| || ||| |  ||||||| || ||
Sbjct: 301 ggacgagggagttatgaccatgcaagtgggtgaagttgctcgtatccagtgcacgcctga 360

                                                              
Query: 259 ctacgcttatggatctggtggctctccagcctggggaattcaaccaaactc 309
            || ||||||||| | || || |  ||||||||||||||||||||||||||
Sbjct: 361 ttatgcttatggagccggcgggttcccagcctggggaattcaaccaaactc 411
to top
>gb|AY103897.1| Zea mays PCO108516 mRNA sequence
          Length = 797

 Score =  260 bits (131), Expect = 4e-66
 Identities = 253/291 (86%), Gaps = 2/291 (0%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||||||||| |||||||||||||||||||  | ||||||||| |||||||||
Sbjct: 123 agaagcagatcctgagatccggcaccggccccaagccgataaagggccag-aaggtcacc 181

                                                                       
Query: 79  gtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaag 138
           || ||||||||||||||||| |||||  |||||||||||||||| |||||||| ||||||
Sbjct: 182 gttcactgcaccggctacgggaaggatcgtgatctgtccaagaaattttggagcaccaag 241

                                                                       
Query: 139 gtatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatg 198
           | | ||||||||||||||||||  ||||| |||||| | |||||||||||||||||||||
Sbjct: 242 g-accctgggcagcagccattcagtttcagcattggtcagggttcagtgatcaaaggatg 300

                                                                       
Query: 199 ggatgagggagttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccaga 258
           ||| ||||||||||||  ||||||| |||||||||| || ||| |  ||||||| || ||
Sbjct: 301 ggacgagggagttatgaccatgcaagtgggtgaagttgctcgtatccagtgcacgcctga 360

                                                              
Query: 259 ctacgcttatggatctggtggctctccagcctggggaattcaaccaaactc 309
            || ||||||||| | || || |  ||||||||||||||||||||||||||
Sbjct: 361 ttatgcttatggagccggcgggttcccagcctggggaattcaaccaaactc 411
to top
>ref|XM_467909.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 620

 Score =  218 bits (110), Expect = 1e-53
 Identities = 268/318 (84%), Gaps = 2/318 (0%)
 Strand = Plus / Plus

                                                                       
Query: 26  gatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcaccgtccact 85
           |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 119 gatcctgaaagccggcaccggtcccaagcccgtcaagggccag-aaggtcaccgtccact 177

                                                                       
Query: 86  gcaccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaaggtatcct 145
           ||||||||| ||| || ||   ||||||  | |||||||||||||| || |||| |  | 
Sbjct: 178 gcaccggcttcgggaaagataatgatctcgctaagaagttttggagcacaaagg-acgca 236

                                                                       
Query: 146 gggcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatgggatgag 205
           || ||| ||||||||  |||||| || |||| |||||| ||||||||||||||||| |||
Sbjct: 237 ggccaggagccattcagtttcaatataggccagggttcggtgatcaaaggatgggacgag 296

                                                                       
Query: 206 ggagttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccagactacgct 265
           |||||||||  ||||||| |||||||||| || ||| || |||||||||| || || || 
Sbjct: 297 ggagttatgaccatgcaagtgggtgaagttgctcgtattcagtgcaccccggattatgcg 356

                                                                       
Query: 266 tatggatctggtggctctccagcctggggaattcaaccaaactccgagctgatattcgag 325
           |||||| || |||| | ||| ||||||||||||| ||||||||| | |||| | ||||||
Sbjct: 357 tatggagctagtgggtttccggcctggggaattcgaccaaactcagtgctggtgttcgag 416

                             
Query: 326 atcgaagttcttagcgcc 343
           || || ||||||||||||
Sbjct: 417 attgaggttcttagcgcc 434
to top
>ref|XM_506987.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1175_B01.15
           mRNA
          Length = 630

 Score =  218 bits (110), Expect = 1e-53
 Identities = 268/318 (84%), Gaps = 2/318 (0%)
 Strand = Plus / Plus

                                                                       
Query: 26  gatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcaccgtccact 85
           |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 118 gatcctgaaagccggcaccggtcccaagcccgtcaagggccag-aaggtcaccgtccact 176

                                                                       
Query: 86  gcaccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaaggtatcct 145
           ||||||||| ||| || ||   ||||||  | |||||||||||||| || |||| |  | 
Sbjct: 177 gcaccggcttcgggaaagataatgatctcgctaagaagttttggagcacaaagg-acgca 235

                                                                       
Query: 146 gggcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatgggatgag 205
           || ||| ||||||||  |||||| || |||| |||||| ||||||||||||||||| |||
Sbjct: 236 ggccaggagccattcagtttcaatataggccagggttcggtgatcaaaggatgggacgag 295

                                                                       
Query: 206 ggagttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccagactacgct 265
           |||||||||  ||||||| |||||||||| || ||| || |||||||||| || || || 
Sbjct: 296 ggagttatgaccatgcaagtgggtgaagttgctcgtattcagtgcaccccggattatgcg 355

                                                                       
Query: 266 tatggatctggtggctctccagcctggggaattcaaccaaactccgagctgatattcgag 325
           |||||| || |||| | ||| ||||||||||||| ||||||||| | |||| | ||||||
Sbjct: 356 tatggagctagtgggtttccggcctggggaattcgaccaaactcagtgctggtgttcgag 415

                             
Query: 326 atcgaagttcttagcgcc 343
           || || ||||||||||||
Sbjct: 416 attgaggttcttagcgcc 433
to top
>dbj|AK121481.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023149K16, full
           insert sequence
          Length = 620

 Score =  218 bits (110), Expect = 1e-53
 Identities = 268/318 (84%), Gaps = 2/318 (0%)
 Strand = Plus / Plus

                                                                       
Query: 26  gatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcaccgtccact 85
           |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 119 gatcctgaaagccggcaccggtcccaagcccgtcaagggccag-aaggtcaccgtccact 177

                                                                       
Query: 86  gcaccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaaggtatcct 145
           ||||||||| ||| || ||   ||||||  | |||||||||||||| || |||| |  | 
Sbjct: 178 gcaccggcttcgggaaagataatgatctcgctaagaagttttggagcacaaagg-acgca 236

                                                                       
Query: 146 gggcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatgggatgag 205
           || ||| ||||||||  |||||| || |||| |||||| ||||||||||||||||| |||
Sbjct: 237 ggccaggagccattcagtttcaatataggccagggttcggtgatcaaaggatgggacgag 296

                                                                       
Query: 206 ggagttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccagactacgct 265
           |||||||||  ||||||| |||||||||| || ||| || |||||||||| || || || 
Sbjct: 297 ggagttatgaccatgcaagtgggtgaagttgctcgtattcagtgcaccccggattatgcg 356

                                                                       
Query: 266 tatggatctggtggctctccagcctggggaattcaaccaaactccgagctgatattcgag 325
           |||||| || |||| | ||| ||||||||||||| ||||||||| | |||| | ||||||
Sbjct: 357 tatggagctagtgggtttccggcctggggaattcgaccaaactcagtgctggtgttcgag 416

                             
Query: 326 atcgaagttcttagcgcc 343
           || || ||||||||||||
Sbjct: 417 attgaggttcttagcgcc 434
to top
>dbj|AK063850.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-122-C11, full
           insert sequence
          Length = 630

 Score =  218 bits (110), Expect = 1e-53
 Identities = 268/318 (84%), Gaps = 2/318 (0%)
 Strand = Plus / Plus

                                                                       
Query: 26  gatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcaccgtccact 85
           |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 118 gatcctgaaagccggcaccggtcccaagcccgtcaagggccag-aaggtcaccgtccact 176

                                                                       
Query: 86  gcaccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaaggtatcct 145
           ||||||||| ||| || ||   ||||||  | |||||||||||||| || |||| |  | 
Sbjct: 177 gcaccggcttcgggaaagataatgatctcgctaagaagttttggagcacaaagg-acgca 235

                                                                       
Query: 146 gggcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatgggatgag 205
           || ||| ||||||||  |||||| || |||| |||||| ||||||||||||||||| |||
Sbjct: 236 ggccaggagccattcagtttcaatataggccagggttcggtgatcaaaggatgggacgag 295

                                                                       
Query: 206 ggagttatggacatgcaattgggtgaagtcgcccgtcttaagtgcaccccagactacgct 265
           |||||||||  ||||||| |||||||||| || ||| || |||||||||| || || || 
Sbjct: 296 ggagttatgaccatgcaagtgggtgaagttgctcgtattcagtgcaccccggattatgcg 355

                                                                       
Query: 266 tatggatctggtggctctccagcctggggaattcaaccaaactccgagctgatattcgag 325
           |||||| || |||| | ||| ||||||||||||| ||||||||| | |||| | ||||||
Sbjct: 356 tatggagctagtgggtttccggcctggggaattcgaccaaactcagtgctggtgttcgag 415

                             
Query: 326 atcgaagttcttagcgcc 343
           || || ||||||||||||
Sbjct: 416 attgaggttcttagcgcc 433
to top
>gb|BT016383.1| Zea mays clone Contig216 mRNA sequence
          Length = 995

 Score =  214 bits (108), Expect = 2e-52
 Identities = 191/216 (88%), Gaps = 2/216 (0%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||||||||| |||||||||||||||||||  | ||||| | | |||||||||
Sbjct: 125 agaagcagatcctgagatccggcaccggccccaagccgataaaggggcgg-aaggtcacc 183

                                                                       
Query: 79  gtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagtaccaag 138
           || ||||||||||||||||| |||||  |||||||||||||||| |||||||| ||||||
Sbjct: 184 gttcactgcaccggctacgggaaggatcgtgatctgtccaagaaattttggagcaccaag 243

                                                                       
Query: 139 gtatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaaggatg 198
           | | ||||||||||||||||||  ||||| |||||| | |||||||||||||||||||||
Sbjct: 244 g-accctgggcagcagccattcagtttcagcattggtcagggttcagtgatcaaaggatg 302

                                               
Query: 199 ggatgagggagttatggacatgcaattgggtgaagt 234
           ||| ||||||||||||  ||||||| ||||||||||
Sbjct: 303 ggacgagggagttatgaccatgcaagtgggtgaagt 338



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 284 ccagcctggggaattcaaccaaactc 309
           ||||||||||||||||||||||||||
Sbjct: 652 ccagcctggggaattcaaccaaactc 677
to top
>dbj|AK100511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023099N19, full
           insert sequence
          Length = 1896

 Score =  107 bits (54), Expect = 4e-20
 Identities = 94/106 (88%), Gaps = 1/106 (0%)
 Strand = Plus / Plus

                                                                       
Query: 26  gatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcaccgtccact 85
           |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 116 gatcctgaaagccggcaccggtcccaagcccgtcaagggccag-aaggtcaccgtccact 174

                                                         
Query: 86  gcaccggctacggcaaggacggtgatctgtccaagaagttttggag 131
           ||||||||| ||| || ||   ||||||  | ||||||||||||||
Sbjct: 175 gcaccggcttcgggaaagataatgatctcgctaagaagttttggag 220
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  105 bits (53), Expect = 1e-19
 Identities = 66/69 (95%), Gaps = 1/69 (1%)
 Strand = Plus / Minus

                                                                            
Query: 26       gatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcaccgtccact 85
                |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 32038214 gatcctgaaagccggcaccggtcccaagcccgtcaagggccag-aaggtcaccgtccact 32038156

                         
Query: 86       gcaccggct 94
                |||||||||
Sbjct: 32038155 gcaccggct 32038147



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                            
Query: 246      agtgcaccccagactacgcttatggatctggtggctctccagcctggggaattcaaccaa 305
                |||||||||| || || || |||||| || |||| | ||| ||||||||||||| |||||
Sbjct: 32036548 agtgcaccccggattatgcgtatggagctagtgggtttccggcctggggaattcgaccaa 32036489

                                                      
Query: 306      actccgagctgatattcgagatcgaagttcttagcgcc 343
                |||| | |||| | |||||||| || ||||||||||||
Sbjct: 32036488 actcagtgctggtgttcgagattgaggttcttagcgcc 32036451



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 193      aggatgggatgagggagttatggacatgcaattgggtgaagt 234
                ||||||||| ||||||||||||  ||||||| ||||||||||
Sbjct: 32036921 aggatgggacgagggagttatgaccatgcaagtgggtgaagt 32036880
to top
>dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1175_B01
          Length = 96191

 Score =  105 bits (53), Expect = 1e-19
 Identities = 66/69 (95%), Gaps = 1/69 (1%)
 Strand = Plus / Minus

                                                                         
Query: 26    gatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcaccgtccact 85
             |||||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||
Sbjct: 58589 gatcctgaaagccggcaccggtcccaagcccgtcaagggccag-aaggtcaccgtccact 58531

                      
Query: 86    gcaccggct 94
             |||||||||
Sbjct: 58530 gcaccggct 58522



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                         
Query: 246   agtgcaccccagactacgcttatggatctggtggctctccagcctggggaattcaaccaa 305
             |||||||||| || || || |||||| || |||| | ||| ||||||||||||| |||||
Sbjct: 56923 agtgcaccccggattatgcgtatggagctagtgggtttccggcctggggaattcgaccaa 56864

                                                   
Query: 306   actccgagctgatattcgagatcgaagttcttagcgcc 343
             |||| | |||| | |||||||| || ||||||||||||
Sbjct: 56863 actcagtgctggtgttcgagattgaggttcttagcgcc 56826



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                       
Query: 193   aggatgggatgagggagttatggacatgcaattgggtgaagt 234
             ||||||||| ||||||||||||  ||||||| ||||||||||
Sbjct: 57296 aggatgggacgagggagttatgaccatgcaagtgggtgaagt 57255
to top
>gb|DQ428233.1| Sorghum propinquum locus PRC0268 genomic sequence
          Length = 798

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 32  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 90

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 91  gtccactgcaccggctacgg 110



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 600 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 652
to top
>gb|DQ428232.1| Sorghum bicolor voucher PI585454 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428231.1| Sorghum bicolor voucher PI267539 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428230.1| Sorghum bicolor voucher PI267408 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428229.1| Sorghum bicolor voucher PI221607 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428228.1| Sorghum bicolor voucher PI152702 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428227.1| Sorghum bicolor voucher NSL92371 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428226.1| Sorghum bicolor voucher NSL87902 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428225.1| Sorghum bicolor voucher NSL87666 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428224.1| Sorghum bicolor voucher NSL77217 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428223.1| Sorghum bicolor voucher NSL77034 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428222.1| Sorghum bicolor voucher NSL56174 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428221.1| Sorghum bicolor voucher NSL56003 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428220.1| Sorghum bicolor voucher NSL55243 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428219.1| Sorghum bicolor voucher NSL51365 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428218.1| Sorghum bicolor voucher NSL51030 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|DQ428217.1| Sorghum bicolor voucher NSL50875 locus PRC0268 genomic sequence
          Length = 801

 Score =  103 bits (52), Expect = 6e-19
 Identities = 74/80 (92%), Gaps = 1/80 (1%)
 Strand = Plus / Plus

                                                                       
Query: 19  agaaggagatcctgagagccggcaccggccccaagcccgtcaagggccagcaaggtcacc 78
           ||||| ||||| |||||||||| |||||||||||||| || ||||||||| |||||||||
Sbjct: 35  agaagcagatcttgagagccgggaccggccccaagccggtaaagggccag-aaggtcacc 93

                               
Query: 79  gtccactgcaccggctacgg 98
           ||||||||||||||||||||
Sbjct: 94  gtccactgcaccggctacgg 113



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 50/53 (94%)
 Strand = Plus / Plus

                                                                
Query: 143 cctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaaagg 195
           ||||||||||||||||||  |||||||||||| ||||||||||||||||||||
Sbjct: 603 cctgggcagcagccattcagtttcaacattggtctgggttcagtgatcaaagg 655
to top
>gb|U96925.1|VFU96925 Vicia faba immunophilin (FKBP12) mRNA, complete cds
          Length = 574

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 109/132 (82%), Gaps = 1/132 (0%)
 Strand = Plus / Plus

                                                                       
Query: 73  gtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagt 132
           |||||||| ||||||||||| ||||| ||  ||||||| || ||  ||||||| ||||| 
Sbjct: 91  gtcaccgttcactgcaccggttacggtaaaaacggtgacctttctcagaagttctggagc 150

                                                                       
Query: 133 accaaggtatcctgggcagcagccattcgctttcaacattggcctgggttcagtgatcaa 192
           || |||| ||||||| ||| | |||||| ||||||| || ||||  ||||| || |||||
Sbjct: 151 acgaagg-atcctggccagaatccattcactttcaaaatcggccaaggttctgtcatcaa 209

                       
Query: 193 aggatgggatga 204
           ||||||||||||
Sbjct: 210 aggatgggatga 221
to top
>gb|AY490245.1| Lycopersicon esculentum CONSTANS interacting protein 3 (CIP3) mRNA,
           complete cds
          Length = 617

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 153/191 (80%), Gaps = 1/191 (0%)
 Strand = Plus / Plus

                                                                       
Query: 119 agaagttttggagtaccaaggtatcctgggcagcagccattcgctttcaacattggcctg 178
           ||||||| ||||| || |||| |||| || |||||||| ||| ||||||| || ||||  
Sbjct: 125 agaagttctggagcactaagg-atccaggccagcagcctttctctttcaagatcggccaa 183

                                                                       
Query: 179 ggttcagtgatcaaaggatgggatgagggagttatggacatgcaattgggtgaagtcgcc 238
           ||   ||| ||||||||||||||||| |||||  ||| |||||||||||| ||||| || 
Sbjct: 184 ggcaaagttatcaaaggatgggatgaaggagtactgggcatgcaattgggagaagttgct 243

                                                                       
Query: 239 cgtcttaagtgcaccccagactacgcttatggatctggtggctctccagcctggggaatt 298
           ||  | | ||||||||| || || ||||||||  ||||||| | |||||| ||||| |||
Sbjct: 244 cgattaacgtgcacccctgattatgcttatggtgctggtggatttccagcatggggtatt 303

                      
Query: 299 caaccaaactc 309
           || || |||||
Sbjct: 304 cagcccaactc 314
to top
>ref|NM_125831.2| Arabidopsis thaliana FKBP12; FK506 binding / peptidyl-prolyl
           cis-trans isomerase AT5G64350 (FKBP12) mRNA, complete
           cds
          Length = 632

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 73  gtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagt 132
           ||||||||||| |||||||| | ||| || || |||||||| ||| ||||||| ||||||
Sbjct: 145 gtcaccgtccattgcaccggattcgggaaagatggtgatctatcccagaagttctggagt 204

                  
Query: 133 accaagg 139
           || ||||
Sbjct: 205 acaaagg 211



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 185 gtgatcaaaggatgggatgagggagttat 213
           |||||||||||||||||||| || |||||
Sbjct: 256 gtgatcaaaggatgggatgaaggcgttat 284
to top
>gb|AY081564.1| Arabidopsis thaliana immunophilin (At5g64350) mRNA, complete cds
          Length = 510

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 73  gtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagt 132
           ||||||||||| |||||||| | ||| || || |||||||| ||| ||||||| ||||||
Sbjct: 64  gtcaccgtccattgcaccggattcgggaaagatggtgatctatcccagaagttctggagt 123

                  
Query: 133 accaagg 139
           || ||||
Sbjct: 124 acaaagg 130



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 185 gtgatcaaaggatgggatgagggagttat 213
           |||||||||||||||||||| || |||||
Sbjct: 175 gtgatcaaaggatgggatgaaggcgttat 203
to top
>gb|AY059928.1| Arabidopsis thaliana immunophilin (At5g64350; MSJ1.19) mRNA,
           complete cds
          Length = 590

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 73  gtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagt 132
           ||||||||||| |||||||| | ||| || || |||||||| ||| ||||||| ||||||
Sbjct: 122 gtcaccgtccattgcaccggattcgggaaagatggtgatctatcccagaagttctggagt 181

                  
Query: 133 accaagg 139
           || ||||
Sbjct: 182 acaaagg 188



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 185 gtgatcaaaggatgggatgagggagttat 213
           |||||||||||||||||||| || |||||
Sbjct: 233 gtgatcaaaggatgggatgaaggcgttat 261
to top
>gb|U96924.1|ATU96924 Arabidopsis thaliana immunophilin (FKBP12) mRNA, complete cds
          Length = 617

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 73  gtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagt 132
           ||||||||||| |||||||| | ||| || || |||||||| ||| ||||||| ||||||
Sbjct: 99  gtcaccgtccattgcaccggattcgggaaagatggtgatctatcccagaagttctggagt 158

                  
Query: 133 accaagg 139
           || ||||
Sbjct: 159 acaaagg 165



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 185 gtgatcaaaggatgggatgagggagttat 213
           |||||||||||||||||||| || |||||
Sbjct: 210 gtgatcaaaggatgggatgaaggcgttat 238
to top
>gb|AY084289.1| Arabidopsis thaliana clone 10243 mRNA, complete sequence
          Length = 582

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                       
Query: 73  gtcaccgtccactgcaccggctacggcaaggacggtgatctgtccaagaagttttggagt 132
           ||||||||||| |||||||| | ||| || || |||||||| ||| ||||||| ||||||
Sbjct: 145 gtcaccgtccattgcaccggattcgggaaagatggtgatctatcccagaagttctggagt 204

                  
Query: 133 accaagg 139
           || ||||
Sbjct: 205 acaaagg 211



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 185 gtgatcaaaggatgggatgagggagttat 213
           |||||||||||||||||||| || |||||
Sbjct: 256 gtgatcaaaggatgggatgaaggcgttat 284
to top
>dbj|AP007284.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT23F02, TM0183,
             complete sequence
          Length = 70173

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                         
Query: 246   agtgcaccccagactacgcttatggatctggtggctctccagcctggggaattcaaccaa 305
             ||||| |||| || || ||||||||  ||||||||| ||| || |||||||| |||||||
Sbjct: 48382 agtgctcccctgattatgcttatggtgctggtggctttcctgcttggggaatacaaccaa 48441

                 
Query: 306   actc 309
             ||||
Sbjct: 48442 actc 48445
to top
>emb|AJ495769.1|HVU495769 Hordeum vulgare mRNA for putative immunophilin
          Length = 835

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 184 agtgatcaaaggatgggatgaggga 208
           ||||||||||||||||||| |||||
Sbjct: 343 agtgatcaaaggatgggatcaggga 367
to top
>gb|DQ271487.1| Mustela vison clone IX2M19 microsatellite sequence
          Length = 852

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 203 gagggagttatggacatgcaa 223
           |||||||||||||||||||||
Sbjct: 319 gagggagttatggacatgcaa 299
to top
>gb|AF165999.1|AF165999 Drosophila melanogaster sodium-dependent excitatory amino acid
           transporter 1 mRNA, complete cds
          Length = 2704

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                        
Query: 250 caccccagactacgcttatggatctggtg 278
           |||||||||| ||||||||||||||||||
Sbjct: 537 caccccagac-acgcttatggatctggtg 564
to top
>gb|M92297.2|STMBMANASE Streptomyces lividans mannanase (manA) gene, complete cds
          Length = 1881

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 87  caccggctacggcaaggacgg 107
           |||||||||||||||||||||
Sbjct: 597 caccggctacggcaaggacgg 617
to top
>dbj|AB027469.1| Drosophila melanogaster gene for glutamate transporter DGLT-1,
            complete cds
          Length = 8035

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                         
Query: 250  caccccagactacgcttatggatctggtg 278
            |||||||||| ||||||||||||||||||
Sbjct: 5137 caccccagac-acgcttatggatctggtg 5164
to top
>ref|XM_636926.1| Dictyostelium discoideum hypothetical protein (DDB0204309), partial
           mRNA
          Length = 483

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 188 atcaaaggatgggatgaggg 207
           ||||||||||||||||||||
Sbjct: 322 atcaaaggatgggatgaggg 341
to top
>gb|AC126538.1| Homo sapiens chromosome 16 clone CTD-3225F13, complete sequence
          Length = 188015

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     tccagaaggagatcctgaga 35
              ||||||||||||||||||||
Sbjct: 106397 tccagaaggagatcctgaga 106378
to top
>gb|AC133065.3| Homo sapiens chromosome 16 clone RP11-876N24, complete sequence
          Length = 142215

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 16     tccagaaggagatcctgaga 35
              ||||||||||||||||||||
Sbjct: 126079 tccagaaggagatcctgaga 126098
to top
>emb|AL670597.18| Mouse DNA sequence from clone RP23-235P16 on chromosome X, complete
              sequence
          Length = 186284

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 176    ctgggttcagtgatcaaaggatgggatg 203
              ||||||||||||||| ||||| ||||||
Sbjct: 100620 ctgggttcagtgatccaaggaggggatg 100593
to top
>emb|AL954741.9| Zebrafish DNA sequence from clone CH211-255F4 in linkage group 22,
            complete sequence
          Length = 166560

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 204  agggagttatggacatgcaa 223
            ||||||||||||||||||||
Sbjct: 5592 agggagttatggacatgcaa 5573
to top
>gb|AY105607.1| Zea mays PCO107138 mRNA sequence
          Length = 808

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 184 agtgatcaaaggatgggatgaggg 207
           ||||||||||||||||||| ||||
Sbjct: 347 agtgatcaaaggatgggatcaggg 370
to top
>gb|AC007014.1|AC007014 Homo sapiens chromosome 16 clone 66H6, complete sequence
          Length = 167080

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     tccagaaggagatcctgaga 35
              ||||||||||||||||||||
Sbjct: 163579 tccagaaggagatcctgaga 163560
to top
>dbj|AP000781.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-872D17, complete
              sequence
          Length = 190251

 Score = 40.1 bits (20), Expect = 6.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 17     ccagaaggagatcctgagag 36
              ||||||||||||||||||||
Sbjct: 142070 ccagaaggagatcctgagag 142089


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,310,650
Number of Sequences: 3902068
Number of extensions: 4310650
Number of successful extensions: 72753
Number of sequences better than 10.0: 48
Number of HSP's better than 10.0 without gapping: 46
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 72604
Number of HSP's gapped (non-prelim): 109
length of query: 513
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 490
effective length of database: 17,143,297,704
effective search space: 8400215874960
effective search space used: 8400215874960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top