ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd24a19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complet... 40 2.3
2gb|AC163646.2| Mus musculus BAC clone RP23-207D1 from chromosome... 40 2.3
3gb|AC005773.1|AC005773 Homo sapiens chromosome 17, clone hRPK.53... 40 2.3
4emb|CR848026.11| Zebrafish DNA sequence from clone CH211-188C16 ... 38 9.3
5gb|AC106753.3| Homo sapiens chromosome 5 clone RP11-174H5, compl... 38 9.3
6gb|AC006084.1|AC006084 Homo sapiens chromosome 5, Pac clone 9c13... 38 9.3
7gb|AY830090.1| Phytophthora infestans clone PI-BAC-11A5 INF1 (in... 38 9.3
8gb|AC165235.11| Mus musculus chromosome 8, clone RP23-332G19, co... 38 9.3

>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence
          Length = 240151

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 14     gggtagtagtgttttgcctg 33
              ||||||||||||||||||||
Sbjct: 204893 gggtagtagtgttttgcctg 204912



to top

>gb|AC163646.2| Mus musculus BAC clone RP23-207D1 from chromosome 14, complete sequence
          Length = 185289

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     gggtagtagtgttttgcctg 33
              ||||||||||||||||||||
Sbjct: 175839 gggtagtagtgttttgcctg 175820



to top

>gb|AC005773.1|AC005773 Homo sapiens chromosome 17, clone hRPK.534_P_15, complete sequence
          Length = 99036

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 82   tatagagctgtttatttggt 101
            ||||||||||||||||||||
Sbjct: 5981 tatagagctgtttatttggt 6000



to top

>emb|CR848026.11| Zebrafish DNA sequence from clone CH211-188C16 in linkage group 2,
             complete sequence
          Length = 138968

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 79    atgtatagagctgtttatttggt 101
             |||||||| ||||||||||||||
Sbjct: 54482 atgtatagtgctgtttatttggt 54460



to top

>gb|AC106753.3| Homo sapiens chromosome 5 clone RP11-174H5, complete sequence
          Length = 95620

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 83    atagagctgtttatttggt 101
             |||||||||||||||||||
Sbjct: 47432 atagagctgtttatttggt 47414



to top

>gb|AC006084.1|AC006084 Homo sapiens chromosome 5, Pac clone 9c13 (LBNL H127), complete sequence
          Length = 121739

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 83     atagagctgtttatttggt 101
              |||||||||||||||||||
Sbjct: 100887 atagagctgtttatttggt 100869



to top

>gb|AY830090.1| Phytophthora infestans clone PI-BAC-11A5 INF1 (inf1) and INF4 (inf4)
             genes, complete cds; Kre6-like (kre6-like) pseudogene,
             complete sequence; ORF457 gene, complete cds; INF3 (inf3)
             pseudogene, complete sequence; and INF6 (inf6) gene,
             complete cds
          Length = 112098

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 113   gtatgtatccctcccccct 131
             |||||||||||||||||||
Sbjct: 53687 gtatgtatccctcccccct 53669



to top

>gb|AC165235.11| Mus musculus chromosome 8, clone RP23-332G19, complete sequence
          Length = 220008

 Score = 38.2 bits (19), Expect = 9.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 18    agtagtgttttgcctgtta 36
             |||||||||||||||||||
Sbjct: 87255 agtagtgttttgcctgtta 87237


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,078,688
Number of Sequences: 3902068
Number of extensions: 1078688
Number of successful extensions: 93931
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93915
Number of HSP's gapped (non-prelim): 16
length of query: 188
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 166
effective length of database: 17,147,199,772
effective search space: 2846435162152
effective search space used: 2846435162152
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top