ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | basd23d07 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 307 bits (155), Expect = 2e-80 Identities = 238/265 (89%), Gaps = 3/265 (1%) Strand = Plus / Minus Query: 228 aggagacttggagacaacatgtcaccggaggaaagcttcgggaaattactgaggaagcga 287 ||||||| ||||||||||| ||||| ||||||||||||||||||||||| |||||||| | Sbjct: 5996529 aggagacatggagacaacacgtcactggaggaaagcttcgggaaattaccgaggaagcca 5996470 Query: 288 aggcttttgcgattggaaacaaagccttagccgctctttttgttcacacacctgctggtg 347 |||||||||| ||||||||||| || ||||| ||||| |||||||| || || ||||||| Sbjct: 5996469 aggcttttgcaattggaaacaaggctttagctgctctctttgttcatacgccagctggtg 5996410 Query: 348 aattacaacgccaaattcgagcatggcttgcagagaactttgattttctatctgtaactg 407 |||| |||||||| || |||||||||||||||||||||||||| ||| |||||||||||| Sbjct: 5996409 aattgcaacgccagatccgagcatggcttgcagagaactttgagtttttatctgtaactg 5996350 Query: 408 gtggagatgttgctggaggaactactgggcaacttgaattgttatctaccgctatcatgg 467 |||||||||||||||||| || | |||||||||||||| ||||| || ||||| |||| Sbjct: 5996349 gtggagatgttgctggag---cttccgggcaacttgaattattatcaactgctattatgg 5996293 Query: 468 atggatggatggctggccttggtac 492 ||||||||||||||||||||||||| Sbjct: 5996292 atggatggatggctggccttggtac 5996268 Score = 224 bits (113), Expect = 2e-55 Identities = 201/229 (87%), Gaps = 6/229 (2%) Strand = Plus / Minus Query: 5 aaggtttctccaattgaacgttttctggagaaatcaaatagtactagtcggagcagaagt 64 |||||||||||| |||| |||||||||||||||||| ||| ||||||||||||||||| Sbjct: 5997153 aaggtttctccagttgagcgttttctggagaaatcacata---ctagtcggagcagaagt 5997097 Query: 65 tctagcaggggaagtagtcctggcaggtctccgggtta---ccaccatgatcatggttca 121 ||||||||||||||||||||||||||||| || | | | |||||| |||||||||||| Sbjct: 5997096 tctagcaggggaagtagtcctggcaggtcacctgttcatcaccaccacgatcatggttca 5997037 Query: 122 cgggttgccttaattgatgaaaatgtgcaaggtttcaaggttaacattaaacaggaaaag 181 || | ||||||| ||||| ||||||| |||||||| ||||||||||||| |||| | Sbjct: 5997036 cgaacttccttaatcgatgagcatgtgcatggtttcaaagttaacattaaaccagaaagg 5996977 Query: 182 aaatcaaaattctcctcgattgttctgaagcttcgtgggattgaggagg 230 |||||||| ||||||||||||||| |||||||||||||||||||||||| Sbjct: 5996976 aaatcaaagttctcctcgattgttttgaagcttcgtgggattgaggagg 5996928 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 2460279 atggatggatggatggctggc 2460259
>dbj|AP005425.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0644A02 Length = 144954 Score = 307 bits (155), Expect = 2e-80 Identities = 238/265 (89%), Gaps = 3/265 (1%) Strand = Plus / Minus Query: 228 aggagacttggagacaacatgtcaccggaggaaagcttcgggaaattactgaggaagcga 287 ||||||| ||||||||||| ||||| ||||||||||||||||||||||| |||||||| | Sbjct: 1028 aggagacatggagacaacacgtcactggaggaaagcttcgggaaattaccgaggaagcca 969 Query: 288 aggcttttgcgattggaaacaaagccttagccgctctttttgttcacacacctgctggtg 347 |||||||||| ||||||||||| || ||||| ||||| |||||||| || || ||||||| Sbjct: 968 aggcttttgcaattggaaacaaggctttagctgctctctttgttcatacgccagctggtg 909 Query: 348 aattacaacgccaaattcgagcatggcttgcagagaactttgattttctatctgtaactg 407 |||| |||||||| || |||||||||||||||||||||||||| ||| |||||||||||| Sbjct: 908 aattgcaacgccagatccgagcatggcttgcagagaactttgagtttttatctgtaactg 849 Query: 408 gtggagatgttgctggaggaactactgggcaacttgaattgttatctaccgctatcatgg 467 |||||||||||||||||| || | |||||||||||||| ||||| || ||||| |||| Sbjct: 848 gtggagatgttgctggag---cttccgggcaacttgaattattatcaactgctattatgg 792 Query: 468 atggatggatggctggccttggtac 492 ||||||||||||||||||||||||| Sbjct: 791 atggatggatggctggccttggtac 767 Score = 224 bits (113), Expect = 2e-55 Identities = 201/229 (87%), Gaps = 6/229 (2%) Strand = Plus / Minus Query: 5 aaggtttctccaattgaacgttttctggagaaatcaaatagtactagtcggagcagaagt 64 |||||||||||| |||| |||||||||||||||||| ||| ||||||||||||||||| Sbjct: 1652 aaggtttctccagttgagcgttttctggagaaatcacata---ctagtcggagcagaagt 1596 Query: 65 tctagcaggggaagtagtcctggcaggtctccgggtta---ccaccatgatcatggttca 121 ||||||||||||||||||||||||||||| || | | | |||||| |||||||||||| Sbjct: 1595 tctagcaggggaagtagtcctggcaggtcacctgttcatcaccaccacgatcatggttca 1536 Query: 122 cgggttgccttaattgatgaaaatgtgcaaggtttcaaggttaacattaaacaggaaaag 181 || | ||||||| ||||| ||||||| |||||||| ||||||||||||| |||| | Sbjct: 1535 cgaacttccttaatcgatgagcatgtgcatggtttcaaagttaacattaaaccagaaagg 1476 Query: 182 aaatcaaaattctcctcgattgttctgaagcttcgtgggattgaggagg 230 |||||||| ||||||||||||||| |||||||||||||||||||||||| Sbjct: 1475 aaatcaaagttctcctcgattgttttgaagcttcgtgggattgaggagg 1427
>dbj|AP004741.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBb0024N18 Length = 128739 Score = 307 bits (155), Expect = 2e-80 Identities = 238/265 (89%), Gaps = 3/265 (1%) Strand = Plus / Minus Query: 228 aggagacttggagacaacatgtcaccggaggaaagcttcgggaaattactgaggaagcga 287 ||||||| ||||||||||| ||||| ||||||||||||||||||||||| |||||||| | Sbjct: 118181 aggagacatggagacaacacgtcactggaggaaagcttcgggaaattaccgaggaagcca 118122 Query: 288 aggcttttgcgattggaaacaaagccttagccgctctttttgttcacacacctgctggtg 347 |||||||||| ||||||||||| || ||||| ||||| |||||||| || || ||||||| Sbjct: 118121 aggcttttgcaattggaaacaaggctttagctgctctctttgttcatacgccagctggtg 118062 Query: 348 aattacaacgccaaattcgagcatggcttgcagagaactttgattttctatctgtaactg 407 |||| |||||||| || |||||||||||||||||||||||||| ||| |||||||||||| Sbjct: 118061 aattgcaacgccagatccgagcatggcttgcagagaactttgagtttttatctgtaactg 118002 Query: 408 gtggagatgttgctggaggaactactgggcaacttgaattgttatctaccgctatcatgg 467 |||||||||||||||||| || | |||||||||||||| ||||| || ||||| |||| Sbjct: 118001 gtggagatgttgctggag---cttccgggcaacttgaattattatcaactgctattatgg 117945 Query: 468 atggatggatggctggccttggtac 492 ||||||||||||||||||||||||| Sbjct: 117944 atggatggatggctggccttggtac 117920 Score = 224 bits (113), Expect = 2e-55 Identities = 201/229 (87%), Gaps = 6/229 (2%) Strand = Plus / Minus Query: 5 aaggtttctccaattgaacgttttctggagaaatcaaatagtactagtcggagcagaagt 64 |||||||||||| |||| |||||||||||||||||| ||| ||||||||||||||||| Sbjct: 118805 aaggtttctccagttgagcgttttctggagaaatcacata---ctagtcggagcagaagt 118749 Query: 65 tctagcaggggaagtagtcctggcaggtctccgggtta---ccaccatgatcatggttca 121 ||||||||||||||||||||||||||||| || | | | |||||| |||||||||||| Sbjct: 118748 tctagcaggggaagtagtcctggcaggtcacctgttcatcaccaccacgatcatggttca 118689 Query: 122 cgggttgccttaattgatgaaaatgtgcaaggtttcaaggttaacattaaacaggaaaag 181 || | ||||||| ||||| ||||||| |||||||| ||||||||||||| |||| | Sbjct: 118688 cgaacttccttaatcgatgagcatgtgcatggtttcaaagttaacattaaaccagaaagg 118629 Query: 182 aaatcaaaattctcctcgattgttctgaagcttcgtgggattgaggagg 230 |||||||| ||||||||||||||| |||||||||||||||||||||||| Sbjct: 118628 aaatcaaagttctcctcgattgttttgaagcttcgtgggattgaggagg 118580
>gb|AY107883.1| Zea mays PCO131850 mRNA sequence Length = 1183 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Plus Query: 455 accgctatcatggatggatggatggctggccttggtacagcgcagcccccaagcaccgat 514 |||||||| |||||||| ||||||||||| |||||||||||||||||||| | ||| ||| Sbjct: 35 accgctattatggatggctggatggctggtcttggtacagcgcagccccctaccactgat 94 Query: 515 gct 517 ||| Sbjct: 95 gct 97
>ref|NM_125944.2| Arabidopsis thaliana ATP binding / microtubule motor AT5G65460 mRNA, complete cds Length = 3846 Score = 61.9 bits (31), Expect = 2e-06 Identities = 91/111 (81%) Strand = Plus / Plus Query: 292 ttttgcgattggaaacaaagccttagccgctctttttgttcacacacctgctggtgaatt 351 |||||| |||||||||||| ||||||| ||| | ||||||||||| || ||||||||| | Sbjct: 2706 ttttgccattggaaacaaacccttagctgctttatttgttcacactccggctggtgaact 2765 Query: 352 acaacgccaaattcgagcatggcttgcagagaactttgattttctatctgt 402 ||| | || ||| | ||||||||||||| | ||||| ||||| ||||| Sbjct: 2766 gcaaagacagattaggtcatggcttgcagaaagttttgagtttctctctgt 2816
>dbj|AB011479.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5 Length = 88356 Score = 61.9 bits (31), Expect = 2e-06 Identities = 91/111 (81%) Strand = Plus / Minus Query: 292 ttttgcgattggaaacaaagccttagccgctctttttgttcacacacctgctggtgaatt 351 |||||| |||||||||||| ||||||| ||| | ||||||||||| || ||||||||| | Sbjct: 75364 ttttgccattggaaacaaacccttagctgctttatttgttcacactccggctggtgaact 75305 Query: 352 acaacgccaaattcgagcatggcttgcagagaactttgattttctatctgt 402 ||| | || ||| | ||||||||||||| | ||||| ||||| ||||| Sbjct: 75304 gcaaagacagattaggtcatggcttgcagaaagttttgagtttctctctgt 75254
>ref|NM_121085.1| Arabidopsis thaliana ATP binding / microtubule motor AT5G10470 mRNA, complete cds Length = 3822 Score = 50.1 bits (25), Expect = 0.007 Identities = 85/105 (80%) Strand = Plus / Plus Query: 292 ttttgcgattggaaacaaagccttagccgctctttttgttcacacacctgctggtgaatt 351 |||||| ||||| ||||||||||| || || | ||||||||||| || ||||||||| | Sbjct: 2706 ttttgctattgggaacaaagccttggctgcgttatttgttcacactccggctggtgaact 2765 Query: 352 acaacgccaaattcgagcatggcttgcagagaactttgattttct 396 || || || ||||| |||||||||||| || ||||| ||||| Sbjct: 2766 gcagcgacagattcggctatggcttgcagaaaattttgagtttct 2810
>emb|AL353995.1|ATF12B17 Arabidopsis thaliana DNA chromosome 5, BAC clone F12B17 (ESSA project) Length = 113053 Score = 50.1 bits (25), Expect = 0.007 Identities = 85/105 (80%) Strand = Plus / Plus Query: 292 ttttgcgattggaaacaaagccttagccgctctttttgttcacacacctgctggtgaatt 351 |||||| ||||| ||||||||||| || || | ||||||||||| || ||||||||| | Sbjct: 73101 ttttgctattgggaacaaagccttggctgcgttatttgttcacactccggctggtgaact 73160 Query: 352 acaacgccaaattcgagcatggcttgcagagaactttgattttct 396 || || || ||||| |||||||||||| || ||||| ||||| Sbjct: 73161 gcagcgacagattcggctatggcttgcagaaaattttgagtttct 73205
>gb|AY100691.1| Arabidopsis thaliana geminivirus replication protein-interacting protein (GRIMP) mRNA, complete cds Length = 3822 Score = 50.1 bits (25), Expect = 0.007 Identities = 85/105 (80%) Strand = Plus / Plus Query: 292 ttttgcgattggaaacaaagccttagccgctctttttgttcacacacctgctggtgaatt 351 |||||| ||||| ||||||||||| || || | ||||||||||| || ||||||||| | Sbjct: 2706 ttttgctattgggaacaaagccttggctgcgttatttgttcacactccggctggtgaact 2765 Query: 352 acaacgccaaattcgagcatggcttgcagagaactttgattttct 396 || || || ||||| |||||||||||| || ||||| ||||| Sbjct: 2766 gcagcgacagattcggctatggcttgcagaaaattttgagtttct 2810
>ref|XM_663516.1| Cryptosporidium hominis TU502 transmembrane protein (Chro.70161) partial mRNA Length = 3249 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 366 gagcatggcttgcagagaactttgat 391 ||||||| |||||||||||||||||| Sbjct: 44 gagcatgccttgcagagaactttgat 69
>ref|XM_628316.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd7_1340), partial mRNA Length = 3255 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 366 gagcatggcttgcagagaactttgat 391 ||||||| |||||||||||||||||| Sbjct: 44 gagcatgccttgcagagaactttgat 69
>gb|AC106772.3| Homo sapiens chromosome 5 clone RP11-310P5, complete sequence Length = 161984 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 167 attaaacaggaaaagaaatcaa 188 |||||||||||||||||||||| Sbjct: 33766 attaaacaggaaaagaaatcaa 33787
>gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, complete sequence Length = 175318 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 114702 atggatggatggatggctggc 114722
>gb|AC104272.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06, complete sequence Length = 143130 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 460 tatcatggatggatggatggc 480 ||||||||||||||||||||| Sbjct: 115385 tatcatggatggatggatggc 115365
>gb|AC118021.13| Mus musculus chromosome 7, clone RP23-459P15, complete sequence Length = 196441 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 459 ctatcatggatggatggatgg 479 ||||||||||||||||||||| Sbjct: 39151 ctatcatggatggatggatgg 39131
>gb|AC136999.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009L15, complete sequence Length = 137570 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 460 tatcatggatggatggatggc 480 ||||||||||||||||||||| Sbjct: 33936 tatcatggatggatggatggc 33916
>gb|AC164589.6| Mus musculus chromosome 8, clone RP24-363C11, complete sequence Length = 197883 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 49159 atggatggatggatggctggc 49139
>gb|DQ483396.1| Gymnogyps californianus clone 99H microsatellite sequence Length = 461 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 355 atggatggatggatggctggc 375
>gb|DQ483366.1| Gymnogyps californianus clone 69H microsatellite sequence Length = 457 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 351 atggatggatggatggctggc 371
>emb|AL928677.6| Zebrafish DNA sequence from clone BUSM1-70B1 in linkage group 7 Contains a novel gene similar to mouse and rodent CHRNA7 (cholinergic receptor, nicotinic, alpha polypeptide 7), a novel gene and two CpG islands, complete sequence Length = 144076 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 15781 atggatggatggatggctggc 15761
>emb|BX323084.9| Zebrafish DNA sequence from clone DKEYP-9G5 in linkage group 6, complete sequence Length = 54121 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 463 catggatggatggatggctgg 483 ||||||||||||||||||||| Sbjct: 47698 catggatggatggatggctgg 47718
>emb|BX322662.12| Zebrafish DNA sequence from clone CH211-222C18 in linkage group 23, complete sequence Length = 209409 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 173359 atggatggatggatggctggc 173379
>gb|AC011591.9| Homo sapiens, clone RP11-118B18, complete sequence Length = 124779 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 115998 atggatggatggatggctggc 116018
>gb|AC010063.7| Drosophila melanogaster 3L BAC RP98-16A3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 194006 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 50705 atggatggatggatggctggc 50725
>gb|AC011499.5| Homo sapiens chromosome 19 clone CTB-54O9, complete sequence Length = 199776 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 134806 atggatggatggatggctggc 134826
>emb|BX663526.8| Chicken DNA sequence from clone WAG-93H17, complete sequence Length = 50749 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 2282 atggatggatggatggctggc 2262
>gb|AC078983.17| Homo sapiens 12q BAC RP11-473M14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 163613 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 163 taacattaaacaggaaaagaa 183 ||||||||||||||||||||| Sbjct: 7463 taacattaaacaggaaaagaa 7483
>gb|AF469960.1| Oncorhynchus mykiss microsatellite OMM1172 sequence Length = 591 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 307 atggatggatggatggctggc 287
>gb|AC022919.8| Homo sapiens chromosome 18, clone RP11-46D1, complete sequence Length = 159749 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 6802 atggatggatggatggctggc 6822
>gb|AC069158.6| Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0049O12, from chromosome 2, complete sequence Length = 155154 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 82887 atggatggatggatggctggc 82867
>dbj|AK037568.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A130026P12 product:unclassifiable, full insert sequence Length = 1026 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 728 atggatggatggatggctggc 748
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 460 tatcatggatggatggatggc 480 ||||||||||||||||||||| Sbjct: 16902899 tatcatggatggatggatggc 16902879
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 34422312 atggatggatggatggctggc 34422332
>emb|BX663529.7| Chicken DNA sequence from clone WAG-19H9, complete sequence Length = 133037 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 78455 atggatggatggatggctggc 78475 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 60959 atggatggatggatggctgg 60978
>emb|AL929396.18| Zebrafish DNA sequence from clone CH211-93G23 in linkage group 1, complete sequence Length = 169067 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 140073 atggatggatggatggctggc 140053 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 140017 atggatggatggatggctggc 139997 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 139965 atggatggatggatggctggc 139945 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 139917 atggatggatggatggctggc 139897
>emb|BX663527.6| Chicken DNA sequence from clone WAG-112A23, complete sequence Length = 111067 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 46037 atggatggatggatggctggc 46017
>gb|AC008153.5|AC008153 Arabidopsis thaliana chromosome 3 BAC F24K9 genomic sequence, complete sequence Length = 117296 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 237 ggagacaacatgtcaccggaggaaagctt 265 |||||||||||||||| |||| ||||||| Sbjct: 21936 ggagacaacatgtcacaggagaaaagctt 21908
>gb|AC078824.13| Homo sapiens 12 BAC RP11-542B15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 173697 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 163 taacattaaacaggaaaagaa 183 ||||||||||||||||||||| Sbjct: 119593 taacattaaacaggaaaagaa 119613
>gb|AC048380.12| Homo sapiens chromosome 18, clone RP11-426J5, complete sequence Length = 224670 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 60849 atggatggatggatggctggc 60829
>emb|BX119315.5| Zebrafish DNA sequence from clone CH211-215F22 in linkage group 9, complete sequence Length = 210930 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 29118 atggatggatggatggctggc 29138
>emb|BX323067.11| Zebrafish DNA sequence from clone CH211-277B21 in linkage group 24, complete sequence Length = 152092 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 463 catggatggatggatggctgg 483 ||||||||||||||||||||| Sbjct: 10671 catggatggatggatggctgg 10691
>dbj|AP003767.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0036F10 Length = 149415 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 91737 atggatggatggatggctggc 91717
>dbj|AP004153.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1111_C07 Length = 115190 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 38554 atggatggatggatggctggc 38574
>dbj|AK070059.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042A02, full insert sequence Length = 1896 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 225 atggatggatggatggctggc 205
>dbj|AK064042.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-D02, full insert sequence Length = 615 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 230 atggatggatggatggctggc 210
>emb|BX276180.5| Zebrafish DNA sequence from clone CH211-284K10 in linkage group 20, complete sequence Length = 107893 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 69162 atggatggatggatggctggc 69142
>emb|CR383669.17| Zebrafish DNA sequence from clone DKEY-25O1 in linkage group 24, complete sequence Length = 185252 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 137014 atggatggatggatggctggc 137034
>gb|AF139813.1|AF139813 Homo sapiens clone pDJ759j12 chromosome 11 map 11q13, complete sequence Length = 142092 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 167 attaaacaggaaaagaaatca 187 ||||||||||||||||||||| Sbjct: 127695 attaaacaggaaaagaaatca 127675
>gb|AC004228.2|AC004228 Homo sapiens Chromosome 11q12.2 PAC clone pDJ519o13 containing human gene for ferritin heavy chain (FTH), complete sequence Length = 196080 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 167 attaaacaggaaaagaaatca 187 ||||||||||||||||||||| Sbjct: 89103 attaaacaggaaaagaaatca 89123
>gb|AE003473.3| Drosophila melanogaster chromosome 3L, section 7 of 83 of the complete sequence Length = 315108 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 181190 atggatggatggatggctggc 181170
>dbj|AP006260.2| Homo sapiens genomic DNA, chromosome 11 clone:RP11-61G16, complete sequence Length = 163024 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 167 attaaacaggaaaagaaatca 187 ||||||||||||||||||||| Sbjct: 22166 attaaacaggaaaagaaatca 22186
>emb|CR790380.7| Zebrafish DNA sequence from clone DKEY-238N5 in linkage group 6, complete sequence Length = 170914 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 463 catggatggatggatggctgg 483 ||||||||||||||||||||| Sbjct: 150128 catggatggatggatggctgg 150108
>dbj|AP002380.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-467L20, complete sequence Length = 188788 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 167 attaaacaggaaaagaaatca 187 ||||||||||||||||||||| Sbjct: 180991 attaaacaggaaaagaaatca 181011
>emb|BX470255.18| Zebrafish DNA sequence from clone DKEY-76A14 in linkage group 1, complete sequence Length = 203708 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 111108 atggatggatggatggctggc 111128 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 111003 atggatggatggatggctgg 111022 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 4100 atggatggatggatggctgg 4119
>gb|AC004770.1|AC004770 Homo sapiens chromosome 11, BAC CIT-HSP-311e8 (BC269730) containing the hFEN1 gene, complete sequence Length = 185035 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 167 attaaacaggaaaagaaatca 187 ||||||||||||||||||||| Sbjct: 20378 attaaacaggaaaagaaatca 20358
>emb|AL929513.8| Mouse DNA sequence from clone RP23-370C15 on chromosome 2, complete sequence Length = 47181 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 9292 atggatggatggatggctggc 9272
>emb|CR847947.14| Zebrafish DNA sequence from clone DKEY-56M16 in linkage group 7, complete sequence Length = 205682 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 72114 atggatggatggatggctggc 72094
>gb|AC099723.16| Mus musculus chromosome 8, clone RP23-369P21, complete sequence Length = 184770 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctggc 484 ||||||||||||||||||||| Sbjct: 33620 atggatggatggatggctggc 33600
>gb|AC118642.11| Mus musculus chromosome 18, clone RP24-112L21, complete sequence Length = 193995 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 15072 atggatggatggatggctgg 15091
>gb|AC115006.12| Mus musculus chromosome 8, clone RP24-184D21, complete sequence Length = 163874 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 464 atggatggatggatggctggcctt 487 |||||||||||||||| ||||||| Sbjct: 113694 atggatggatggatgggtggcctt 113717
>ref|NM_193442.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 666 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 1 atggatggatggatggctgg 20
>gb|AC002330.1| Arabidopsis thaliana BAC T10P11 from chromosome IV, near 15 cM, complete sequence Length = 113566 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 25 ttttctggagaaatcaaata 44 |||||||||||||||||||| Sbjct: 94108 ttttctggagaaatcaaata 94127
>gb|AY771996.1| Homo sapiens interleukin 12 receptor, beta 1 (IL12RB1) gene, complete cds Length = 30584 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 4053 atggatggatggatggctgg 4072
>gb|U40938.1| Caenorhabditis elegans cosmid D1009, complete sequence Length = 40475 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 25 ttttctggagaaatcaaata 44 |||||||||||||||||||| Sbjct: 16158 ttttctggagaaatcaaata 16177
>gb|AC119210.11| Mus musculus chromosome 18, clone RP24-190H7, complete sequence Length = 198006 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 169622 atggatggatggatggctgg 169641
>ref|NM_001017980.1| Homo sapiens hypothetical protein LOC203547 (LOC203547), mRNA Length = 4718 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 170 aaacaggaaaagaaatcaaaattc 193 ||||||||||| |||||||||||| Sbjct: 1477 aaacaggaaaaaaaatcaaaattc 1500
>emb|CR936405.6| Zebrafish DNA sequence from clone DKEYP-111C12 in linkage group 2, complete sequence Length = 36213 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 3120 atggatggatggatggctgg 3101
>emb|BX890591.12| Zebrafish DNA sequence from clone DKEY-184J23 in linkage group 19, complete sequence Length = 171079 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 159213 atggatggatggatggctgg 159232
>emb|CR769785.19| Zebrafish DNA sequence from clone DKEY-1N3 in linkage group 13, complete sequence Length = 232168 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 211515 atggatggatggatggctgg 211496
>emb|CR457456.7| Zebrafish DNA sequence from clone CH211-235F6 in linkage group 23, complete sequence Length = 146468 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 34869 atggatggatggatggctgg 34850
>emb|CR545479.12| Zebrafish DNA sequence from clone CH211-219M24 in linkage group 17, complete sequence Length = 188250 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 142059 atggatggatggatggctgg 142078
>emb|BX897684.8| Zebrafish DNA sequence from clone CH211-107A4 in linkage group 7, complete sequence Length = 147920 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 145724 atggatggatggatggctgg 145743
>emb|CR974468.5| Pig DNA sequence from clone PigE-178B21 on chromosome 7, complete sequence Length = 120695 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 405 ctggtggagatgttgctgga 424 |||||||||||||||||||| Sbjct: 41733 ctggtggagatgttgctgga 41752
>gb|AC004946.1| Homo sapiens PAC clone RP5-1006K12 from 7, complete sequence Length = 107102 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 gttttctggagaaatcaaat 43 |||||||||||||||||||| Sbjct: 74352 gttttctggagaaatcaaat 74371
>gb|AC102441.6| Mus musculus chromosome 18, clone RP24-160I12, complete sequence Length = 224556 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 460 tatcatggatggatggatgg 479 |||||||||||||||||||| Sbjct: 60151 tatcatggatggatggatgg 60132
>emb|AL163283.2|HS21C083 Homo sapiens chromosome 21 segment HS21C083 Length = 340000 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 19767 atggatggatggatggctgg 19748
>emb|CR589944.10| Zebrafish DNA sequence from clone CH211-14I3 in linkage group 11, complete sequence Length = 157142 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 112945 atggatggatggatggctgg 112926 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 101510 atggatggatggatggctgg 101491
>emb|Z93018.1|HS433B8 Human DNA sequence from clone RP3-433B8 on chromosome X, complete sequence Length = 74560 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 8539 atggatggatggatggctgg 8558
>emb|Z83846.1|HS415G2 Human DNA sequence from clone CTA-415G2 on chromosome 22 Contains the 5' end of the SYN3 gene for Synapsin III, a novel pseudogene and a CpG island, complete sequence Length = 129957 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 20471 atggatggatggatggctgg 20452
>emb|BX927085.4| Human DNA sequence from clone CITF22-37A6 on chromosome 22, complete sequence Length = 38134 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 8309 atggatggatggatggctgg 8290
>emb|AL596452.2| Human DNA sequence from clone RP11-776J12 on chromosome 6 Contains part of the MAP3K4 gene for mitogen-activated protein kinase kinase kinase 4 (MTK1, MEKK4, MAPKKK4, KIAA0213, homolog of yeast SSK2/SSK22 MAP kinase kinase kinase), complete sequence Length = 69682 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 8549 atggatggatggatggctgg 8530
>emb|AL451042.10| Human DNA sequence from clone RP11-276H7 on chromosome 1 Contains the EPHA2 gene for EphA2, two novel genes and two CpG islands, complete sequence Length = 88098 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 56472 atggatggatggatggctgg 56453 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 56452 atggatggatggatggctgg 56433 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 56412 atggatggatggatggctgg 56393
>emb|AL445235.30| Human DNA sequence from clone RP1-65J11 on chromosome 1 Contains the 5' end of the PUM1 gene for pumilio homolog 1 (Drosophila), the SDC3 gene for syndecan 3 (N-syndecan), two novel genes and a CpG island, complete sequence Length = 167478 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 8655 atggatggatggatggctgg 8674
>emb|AL445931.29| Human DNA sequence from clone RP11-374P20 on chromosome 9 Contains the 5' end of the VAV2 gene for vav 2 oncogene, a novel gene (FLJ35348), the 3' end of the BRD3 gene for bromodomain containing 3, a novel gene and five CpG islands, complete sequence Length = 175033 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 116731 atggatggatggatggctgg 116712
>emb|AL365223.19| Human DNA sequence from clone RP11-55K22 on chromosome 6 Contains the 3' end of the PEX7 gene for peroxisomal biogenesis factor 7 (PTS2R, RCDP1), a ribosomal protein L7a (RPL7A) pseudogene, a novel gene, the gene for a novel protein similar to 60s ribosomal protein L35a (RPL35A) (possible pseudogene), the 3' end of a novel gene and a CpG island, complete sequence Length = 116855 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 94198 atggatggatggatggctgg 94179
>emb|AL356747.18| Human DNA sequence from clone RP11-620A17 on chromosome 6 Contains the 5' end of the CDYL gene for Y chromosome-like chromodomain protein, a 26S protease regulatory subunit 4 (PSMC1) (P26S4) pseudogene and a CpG island, complete sequence Length = 82921 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 67794 atggatggatggatggctgg 67813
>emb|AL162379.14| Human DNA sequence from clone RP11-426K7 on chromosome 13 Contains part of a novel gene, complete sequence Length = 109757 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 465 tggatggatggatggctggc 484 |||||||||||||||||||| Sbjct: 85322 tggatggatggatggctggc 85341
>emb|AL139034.20| Human DNA sequence from clone RP11-107B1 on chromosome 13 Contains a novel gene and two CpG islands, complete sequence Length = 148897 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 131697 atggatggatggatggctgg 131678
>gb|AY055383.1| Homo sapiens type II transmembrane serine protease 6 (TMPRSS6) gene, complete cds Length = 38345 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 463 catggatggatggatggctg 482 |||||||||||||||||||| Sbjct: 31777 catggatggatggatggctg 31758
>emb|AL121929.17|HSBA416N2 Human DNA sequence from clone RP11-416N2 on chromosome 10 Contains the 3' end of the NEURL gene for neuralized-like (Drosophila), the 3' end of the SH3MD1 gene for SH3 multiple domains 1 and seven CpG islands, complete sequence Length = 203262 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 175449 atggatggatggatggctgg 175430
>emb|AL022334.1|HS569D19 Human DNA sequence from clone RP4-569D19 on chromosome 22q13.1, complete sequence Length = 114771 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 465 tggatggatggatggctggc 484 |||||||||||||||||||| Sbjct: 84800 tggatggatggatggctggc 84819 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 465 tggatggatggatggctggc 484 |||||||||||||||||||| Sbjct: 84641 tggatggatggatggctggc 84660
>emb|AL022314.1|HS1170K4 Human DNA sequence from clone RP5-1170K4 on chromosome 22q12.2-13.1, complete sequence Length = 104353 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 463 catggatggatggatggctg 482 |||||||||||||||||||| Sbjct: 24684 catggatggatggatggctg 24703
>emb|BX547932.17| Zebrafish DNA sequence from clone DKEY-269E10 in linkage group 7, complete sequence Length = 82464 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 465 tggatggatggatggctggc 484 |||||||||||||||||||| Sbjct: 66342 tggatggatggatggctggc 66361
>emb|CR855309.15| Zebrafish DNA sequence from clone DKEY-35B7 in linkage group 4, complete sequence Length = 184943 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 28253 atggatggatggatggctgg 28272
>emb|BX914201.6| Zebrafish DNA sequence from clone DKEYP-108B3 in linkage group 21, complete sequence Length = 162420 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 145177 atggatggatggatggctgg 145196
>emb|BX284751.1|NCB24N11 Neurospora crassa DNA linkage group II BAC contig B24N11 Length = 129306 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 465 tggatggatggatggctggc 484 |||||||||||||||||||| Sbjct: 29428 tggatggatggatggctggc 29447
>emb|CR524821.5| Zebrafish DNA sequence from clone CH211-192F15 in linkage group 16, complete sequence Length = 152728 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 135588 atggatggatggatggctgg 135607
>emb|AL596382.12| Mouse DNA sequence from clone RP23-337J7 on chromosome 11, complete sequence Length = 225083 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 87247 atggatggatggatggctgg 87266
>emb|AL356173.2|NCB14D6 Neurospora crassa DNA linkage group II BAC contig B14D6 Length = 199386 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 465 tggatggatggatggctggc 484 |||||||||||||||||||| Sbjct: 188987 tggatggatggatggctggc 189006
>emb|AL161494.2|ATCHRIV6 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 6 Length = 194892 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 ttttctggagaaatcaaata 44 |||||||||||||||||||| Sbjct: 152637 ttttctggagaaatcaaata 152618
>emb|AJ519840.1|CAR519840 Coffea arabica sui1 gene, exons 1-5 Length = 2677 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 134 atggatggatggatggctgg 153
>emb|CR352218.7| Zebrafish DNA sequence from clone DKEYP-118G5 in linkage group 23, complete sequence Length = 124382 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 93003 atggatggatggatggctgg 92984
>emb|BX901927.7| Zebrafish DNA sequence from clone CH211-243A20 in linkage group 1, complete sequence Length = 152042 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 135266 atggatggatggatggctgg 135285
>emb|CR318652.16| Zebrafish DNA sequence from clone CH211-128O18 in linkage group 11, complete sequence Length = 179522 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 460 tatcatggatggatggatgg 479 |||||||||||||||||||| Sbjct: 99500 tatcatggatggatggatgg 99481
>emb|AL645760.15| Mouse DNA sequence from clone DN-262D11 on chromosome 3 Contains the 5' end of the Man1b gene for mannosidase 1 beta, a pseudogene similar to arylsulfatase A (Arsa) and a CpG island, complete sequence Length = 135825 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 31945 atggatggatggatggctgg 31926
>emb|AL929460.13| Zebrafish DNA sequence from clone CH211-148J1 in linkage group 9, complete sequence Length = 161013 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 110555 atggatggatggatggctgg 110536
>emb|CR456624.7| Zebrafish DNA sequence from clone CH211-69E5 in linkage group 13, complete sequence Length = 172195 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 79491 atggatggatggatggctgg 79472
>emb|BX276111.12| Zebrafish DNA sequence from clone CH211-258H7 in linkage group 13, complete sequence Length = 195980 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 133277 atggatggatggatggctgg 133258
>emb|BX572081.6| Zebrafish DNA sequence from clone DKEYP-86G5 in linkage group 11, complete sequence Length = 152148 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 53124 atggatggatggatggctgg 53143
>emb|BX957346.14| Zebrafish DNA sequence from clone CH211-117K16 in linkage group 25, complete sequence Length = 149598 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 74472 atggatggatggatggctgg 74491 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 74442 atggatggatggatggctgg 74461 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 74408 atggatggatggatggctgg 74427
>emb|BX548005.11| Zebrafish DNA sequence from clone DKEY-105A17 in linkage group 6, complete sequence Length = 218236 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 43752 atggatggatggatggctgg 43771
>emb|BX546480.9| Zebrafish DNA sequence from clone DKEY-175C11, complete sequence Length = 203056 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 141835 atggatggatggatggctgg 141854
>emb|AL929566.30| Zebrafish DNA sequence from clone CH211-159C13 in linkage group 8, complete sequence Length = 137166 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 61344 atggatggatggatggctgg 61363
>gb|AC127891.2| Homo sapiens 12 BAC RP11-91I24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 113065 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 ggaaaagaaatcaaaattct 194 |||||||||||||||||||| Sbjct: 54284 ggaaaagaaatcaaaattct 54265
>gb|AC129031.1| Homo sapiens 12 BAC RP11-106H17 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 88645 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 ggaaaagaaatcaaaattct 194 |||||||||||||||||||| Sbjct: 27864 ggaaaagaaatcaaaattct 27845
>gb|AC104610.13| Drosophila melanogaster 3L BAC RP98-35J16 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 138534 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 181 atggatggatggatggctgg 200
>dbj|AK096835.1| Homo sapiens cDNA FLJ39516 fis, clone PUAEN2000374 Length = 2787 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 170 aaacaggaaaagaaatcaaaattc 193 ||||||||||| |||||||||||| Sbjct: 1508 aaacaggaaaaaaaatcaaaattc 1531
>dbj|AK091301.1| Homo sapiens cDNA FLJ33982 fis, clone DFNES2004676, weakly similar to ZINC FINGER PROTEIN 195 Length = 3443 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 170 aaacaggaaaagaaatcaaaattc 193 ||||||||||| |||||||||||| Sbjct: 232 aaacaggaaaaaaaatcaaaattc 255
>gb|AC023728.5| Drosophila melanogaster X BAC RP98-6J12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 175674 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 166200 atggatggatggatggctgg 166219
>gb|AC087891.12| Mus musculus Strain C57BL6/J Chromosome 10 RP23-440N1, complete sequence Length = 195052 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 275 actgaggaagcgaaggcttt 294 |||||||||||||||||||| Sbjct: 44326 actgaggaagcgaaggcttt 44345
>gb|AC010054.7| Drosophila melanogaster 3L BAC RP98-15E10 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 173109 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 148177 atggatggatggatggctgg 148196
>gb|AC009375.8| Drosophila melanogaster 3L BAC RP98-44L18 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 180787 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 62824 atggatggatggatggctgg 62843
>gb|AC021755.9| Homo sapiens chromosome 15 clone RP11-521C20 map 15q15, complete sequence Length = 161794 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 10938 atggatggatggatggctgg 10919
>gb|AC099780.2| Homo sapiens chromosome 3 clone RP11-769M23, complete sequence Length = 193793 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 139310 atggatggatggatggctgg 139329
>gb|AC007937.18| Mus musculus chromosome 10, clone RP21-536F4, complete sequence Length = 205015 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 120808 atggatggatggatggctgg 120789
>gb|AC171140.2| Helobdella robusta clone CH306-1B2, complete sequence Length = 105143 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 92284 atggatggatggatggctgg 92303
>emb|AL606744.30| Mouse DNA sequence from clone RP23-267O21 on chromosome 3, complete sequence Length = 185867 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 1523 atggatggatggatggctgg 1504
>emb|BX649412.8| Zebrafish DNA sequence from clone DKEY-116G10 in linkage group 1, complete sequence Length = 78932 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 43348 atggatggatggatggctgg 43329
>emb|BX294178.13| Zebrafish DNA sequence from clone CH211-271C18 in linkage group 7, complete sequence Length = 131441 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 41870 atggatggatggatggctgg 41851
>gb|AC158618.5| Mus musculus 10 BAC RP23-280M4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 235639 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 95346 atggatggatggatggctgg 95327
>emb|BX119916.10| Zebrafish DNA sequence from clone CH211-202I5 in linkage group 11, complete sequence Length = 196164 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 59217 atggatggatggatggctgg 59198
>emb|BX511211.6| Zebrafish DNA sequence from clone DKEY-41G3 in linkage group 1, complete sequence Length = 191183 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 91825 atggatggatggatggctgg 91844
>emb|BX897656.9| Zebrafish DNA sequence from clone CH211-271K12, complete sequence Length = 141840 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 75737 atggatggatggatggctgg 75718
>gb|AC020904.7| Homo sapiens chromosome 19 clone CTB-52I2, complete sequence Length = 148824 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 130545 atggatggatggatggctgg 130526
>emb|BX548163.15| Zebrafish DNA sequence from clone CH211-135J7 in linkage group 10, complete sequence Length = 132400 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 118593 atggatggatggatggctgg 118574
>gb|AC156568.3| Mus musculus BAC clone RP23-291D3 from chromosome 12, complete sequence Length = 224350 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 412 agatgttgctggaggaacta 431 |||||||||||||||||||| Sbjct: 105676 agatgttgctggaggaacta 105695
>gb|AC025168.7|AC025168 Homo sapiens chromosome 15 clone RP11-43D14 map 15q14, complete sequence Length = 173336 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 126272 atggatggatggatggctgg 126253
>emb|BX120001.10| Zebrafish DNA sequence from clone CH211-217J8 in linkage group 16, complete sequence Length = 211279 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 48011 atggatggatggatggctgg 48030
>emb|BX005368.11| Zebrafish DNA sequence from clone CH211-64C10 in linkage group 6, complete sequence Length = 187621 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 11850 atggatggatggatggctgg 11831
>gb|AF022141.2|AF022141 Homo sapiens chromosome 21 clone cosmid Q13F10 map 21q22.2, complete sequence Length = 43473 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 21568 atggatggatggatggctgg 21587
>gb|AC008362.5|AC008362 Drosophila melanogaster, chromosome 3R, region 90D-90E, BAC clone BACR01C15, complete sequence Length = 153048 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 73753 atggatggatggatggctgg 73734
>gb|AC008361.8|AC008361 Drosophila melanogaster, chromosome 3R, region 90D-90D, BAC clone BACR35E22, complete sequence Length = 177471 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 134308 atggatggatggatggctgg 134289
>gb|AC007144.13|AC007144 Drosophila melanogaster, chromosome 2L, region 38F-39A, BAC clone BACR06G10, complete sequence Length = 176082 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 147333 atggatggatggatggctgg 147352
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 20922888 atggatggatggatggctgg 20922907
>emb|BX663523.7| Chicken DNA sequence from clone WAG-4C11, complete sequence Length = 86004 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 77461 atggatggatggatggctgg 77442
>gb|AC138466.12| Homo sapiens 12 BAC RP13-977J11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 129492 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 126668 atggatggatggatggctgg 126649
>dbj|AP001724.1| Homo sapiens genomic DNA, chromosome 21q, section 68/105 Length = 340000 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 79405 atggatggatggatggctgg 79424
>dbj|AP003902.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1110C07 Length = 173859 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 141330 atggatggatggatggctgg 141349
>gb|AF463765.1| Mus musculus strain C57BL/6J cytokine gene cluster, partial sequence Length = 24139 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 3326 atggatggatggatggctgg 3307
>gb|AF003627.3| Homo sapiens chromosome X multiple clones map q28, complete sequence Length = 184788 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 170 aaacaggaaaagaaatcaaaattc 193 ||||||||||| |||||||||||| Sbjct: 37686 aaacaggaaaaaaaatcaaaattc 37709
>emb|BX088591.11| Zebrafish DNA sequence from clone CH211-205N20, complete sequence Length = 181336 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 127972 atggatggatggatggctgg 127991
>gb|AF222981.1|AF222981 Homo sapiens 1 DISC2 gene, complete sequence Length = 15002 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 32 atggatggatggatggctgg 51
>gb|AF222987.1|AF222987 Homo sapiens DISC1 protein (DISC1) gene, partial cds and DISC2 gene, partial sequence Length = 33376 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 33169 atggatggatggatggctgg 33150
>dbj|AB083077.1| Oryzias latipes DNA, globin gene cluster region Length = 47119 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 16730 atggatggatggatggctgg 16749
>emb|BX571825.6| Zebrafish DNA sequence from clone DKEY-158E13 in linkage group 18, complete sequence Length = 200814 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 39712 atggatggatggatggctgg 39693
>emb|BX537113.8| Zebrafish DNA sequence from clone CH211-207G17 in linkage group 16, complete sequence Length = 218597 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 55652 atggatggatggatggctgg 55633
>emb|CT967325.1| Zebrafish DNA sequence from clone DKEY-25K11, complete sequence Length = 267826 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 89676 atggatggatggatggctgg 89695
>emb|BX284684.8| Zebrafish DNA sequence from clone DKEY-14I10 in linkage group 8, complete sequence Length = 163766 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 99554 atggatggatggatggctgg 99573
>emb|AJ229041.1|HS229041 Homo sapiens 959 kb contig between AML1 and CBR1 on chromosome 21q22; segment 1/3 Length = 323000 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 103622 atggatggatggatggctgg 103603
>gb|AC008000.7|AC008000 Homo sapiens 3q25-26 BAC CITB-371O18 (California Institute of Technology BAC Library) complete sequence Length = 131105 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 10590 atggatggatggatggctgg 10609
>emb|BX842609.12| Zebrafish DNA sequence from clone CH211-285P6 in linkage group 19, complete sequence Length = 177481 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 44645 atggatggatggatggctgg 44626
>emb|BX649292.16| Zebrafish DNA sequence from clone DKEY-39E8 in linkage group 22, complete sequence Length = 181688 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 171169 atggatggatggatggctgg 171150
>emb|CR391908.15| Zebrafish DNA sequence from clone DKEY-225E11 in linkage group 19, complete sequence Length = 171679 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 45167 atggatggatggatggctgg 45186
>emb|BX571837.10| Zebrafish DNA sequence from clone CH211-261O1 in linkage group 19, complete sequence Length = 190521 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 460 tatcatggatggatggatgg 479 |||||||||||||||||||| Sbjct: 164531 tatcatggatggatggatgg 164512
>emb|BX890568.8| Zebrafish DNA sequence from clone DKEY-208J2 in linkage group 20, complete sequence Length = 188167 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 176897 atggatggatggatggctgg 176916
>emb|AL935332.12| Zebrafish DNA sequence from clone DKEY-77F17 in linkage group 18, complete sequence Length = 139084 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 25153 atggatggatggatggctgg 25172
>emb|BX548023.3| Zebrafish DNA sequence from clone DKEY-265O13 in linkage group 18, complete sequence Length = 151449 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 460 tatcatggatggatggatgg 479 |||||||||||||||||||| Sbjct: 22434 tatcatggatggatggatgg 22415
>emb|BX005202.14| Zebrafish DNA sequence from clone DKEY-224N5 in linkage group 13, complete sequence Length = 220733 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 53181 atggatggatggatggctgg 53162
>emb|AL713996.11| Zebrafish DNA sequence from clone BUSM1-201C3 in linkage group 9, complete sequence Length = 58037 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 467 gatggatggatggctggcct 486 |||||||||||||||||||| Sbjct: 2713 gatggatggatggctggcct 2694
>emb|AL831726.11| Zebrafish DNA sequence from clone DKEY-49N23 in linkage group 22, complete sequence Length = 245697 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 72027 atggatggatggatggctgg 72046
>emb|AL590145.3| Zebrafish DNA sequence from clone RP71-18K17 in linkage group 3, complete sequence Length = 135675 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 460 tatcatggatggatggatgg 479 |||||||||||||||||||| Sbjct: 46343 tatcatggatggatggatgg 46324
>emb|CR855387.11| Zebrafish DNA sequence from clone DKEY-282H22 in linkage group 3, complete sequence Length = 106466 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 67410 atggatggatggatggctgg 67391
>emb|BX004978.10| Zebrafish DNA sequence from clone DKEY-15P13 in linkage group 2, complete sequence Length = 184244 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 42166 atggatggatggatggctgg 42185
>emb|CT797314.2| Pan troglodytes chromosome X clone CH251-171B18 map Xq28, complete sequence Length = 178731 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 170 aaacaggaaaagaaatcaaaattc 193 ||||||||||| |||||||||||| Sbjct: 131844 aaacaggaaaaaaaatcaaaattc 131867
>gb|AF152364.1|AF152364 Homo sapiens constitutive fragile region FRA3B sequence Length = 170452 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 55826 atggatggatggatggctgg 55845
>gb|AE003720.3| Drosophila melanogaster chromosome 3R, section 58 of 118 of the complete sequence Length = 228842 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 119184 atggatggatggatggctgg 119165
>gb|AE003668.5| Drosophila melanogaster chromosome 2L, section 77 of 83 of the complete sequence Length = 270158 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 246151 atggatggatggatggctgg 246170
>gb|AE003523.3| Drosophila melanogaster chromosome 3L, section 62 of 83 of the complete sequence Length = 290640 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 227071 atggatggatggatggctgg 227090
>gb|AE003440.3| Drosophila melanogaster chromosome X, section 24 of 74 of the complete sequence Length = 342195 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 31568 atggatggatggatggctgg 31587
>emb|AL935204.10| Zebrafish DNA sequence from clone CH211-230K10, complete sequence Length = 204217 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 177842 atggatggatggatggctgg 177823
>emb|CR450781.12| Zebrafish DNA sequence from clone DKEY-20O6 in linkage group 24, complete sequence Length = 215010 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 198545 atggatggatggatggctgg 198564
>emb|CR753900.9| Zebrafish DNA sequence from clone CH211-167B13 in linkage group 10, complete sequence Length = 113731 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 6960 atggatggatggatggctgg 6979
>emb|CR854915.21| Zebrafish DNA sequence from clone DKEY-4G13 in linkage group 13, complete sequence Length = 158798 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 114199 atggatggatggatggctgg 114218
>gb|BC110800.1| Homo sapiens hypothetical protein LOC203547, mRNA (cDNA clone MGC:131652 IMAGE:6044374), complete cds Length = 4674 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 170 aaacaggaaaagaaatcaaaattc 193 ||||||||||| |||||||||||| Sbjct: 1437 aaacaggaaaaaaaatcaaaattc 1460
>emb|BX927414.24| Zebrafish DNA sequence from clone DKEYP-5A5 in linkage group 10, complete sequence Length = 126112 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 490 tacagcgcagcccccaagca 509 |||||||||||||||||||| Sbjct: 48913 tacagcgcagcccccaagca 48932
>emb|AL935203.12| Zebrafish DNA sequence from clone CH211-256A21 in linkage group 25, complete sequence Length = 163572 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 61100 atggatggatggatggctgg 61119
>emb|AL935293.11| Zebrafish DNA sequence from clone CH211-251D10 in linkage group 10, complete sequence Length = 188908 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 16471 atggatggatggatggctgg 16452
>gb|AC005932.1|AC005932 Homo sapiens chromosome 19, cosmid R31317, complete sequence Length = 41696 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 11376 atggatggatggatggctgg 11357
>emb|BX005014.5| Zebrafish DNA sequence from clone CH211-103E2 in linkage group 10, complete sequence Length = 160621 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 143829 atggatggatggatggctgg 143848
>emb|CR855277.16| Zebrafish DNA sequence from clone DKEY-71B5 in linkage group 16, complete sequence Length = 245559 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 198864 atggatggatggatggctgg 198845
>emb|AL844197.6| Zebrafish DNA sequence from clone DKEY-156L9 in linkage group 10, complete sequence Length = 184895 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 47845 atggatggatggatggctgg 47826
>emb|AL833596.1|HSM804909 Homo sapiens mRNA; cDNA DKFZp686B0267 (from clone DKFZp686B0267) Length = 4718 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 170 aaacaggaaaagaaatcaaaattc 193 ||||||||||| |||||||||||| Sbjct: 1477 aaacaggaaaaaaaatcaaaattc 1500
>emb|AL732610.16| Zebrafish DNA sequence from clone CH211-12N8, complete sequence Length = 176982 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 167789 atggatggatggatggctgg 167770
>emb|CR847961.12| Zebrafish DNA sequence from clone DKEY-154B7 in linkage group 5, complete sequence Length = 237051 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 218259 atggatggatggatggctgg 218278
>emb|BX000434.11| Zebrafish DNA sequence from clone CH211-2E18, complete sequence Length = 179109 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 57456 atggatggatggatggctgg 57475
>emb|AL935307.9| Zebrafish DNA sequence from clone DKEY-63P22, complete sequence Length = 234744 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 467 gatggatggatggctggcct 486 |||||||||||||||||||| Sbjct: 19166 gatggatggatggctggcct 19185
>gb|AC004063.1|AC004063 Homo sapiens chromosome 4 clone B32I8, complete sequence Length = 177014 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 168 ttaaacaggaaaagaaatca 187 |||||||||||||||||||| Sbjct: 119919 ttaaacaggaaaagaaatca 119900
>gb|AC133655.4| Mus musculus BAC clone RP24-364H7 from 8, complete sequence Length = 177145 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 464 atggatggatggatggctggcctt 487 |||||||||||||||| ||||||| Sbjct: 143267 atggatggatggatgggtggcctt 143244
>emb|CR933780.12| Zebrafish DNA sequence from clone DKEY-60F6 in linkage group 5, complete sequence Length = 227454 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 162176 atggatggatggatggctgg 162195
>emb|CR352286.6| Zebrafish DNA sequence from clone CH211-93A20 in linkage group 19, complete sequence Length = 147941 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 110594 atggatggatggatggctgg 110613
>emb|AL929048.9| Zebrafish DNA sequence from clone CH211-161N1 in linkage group 20, complete sequence Length = 149801 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 35076 atggatggatggatggctgg 35057
>emb|AL929494.8| Zebrafish DNA sequence from clone CH211-127N19 in linkage group 20, complete sequence Length = 98841 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 48667 atggatggatggatggctgg 48686
>emb|BX897750.11| Zebrafish DNA sequence from clone DKEY-278N18, complete sequence Length = 182033 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 130860 atggatggatggatggctgg 130841
>gb|AC002110.1|AC002110 Genomic sequence from Human 9q34, complete sequence Length = 30900 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 14345 atggatggatggatggctgg 14326
>gb|AC002104.1|AC002104 Genomic sequence from Human 9q34, complete sequence Length = 47036 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 40207 atggatggatggatggctgg 40188
>gb|AC000405.1|AC000405 Genomic sequence from Human 9q34, complete sequence Length = 38250 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 1469 atggatggatggatggctgg 1488
>emb|AL929082.7| Zebrafish DNA sequence from clone CH211-113P18, complete sequence Length = 195316 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 17011 atggatggatggatggctgg 17030
>emb|AL844150.6| Zebrafish DNA sequence from clone DKEY-246K2, complete sequence Length = 203058 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 136640 atggatggatggatggctgg 136659
>emb|AL772249.6| Mouse DNA sequence from clone RP23-430H1 on chromosome 2, complete sequence Length = 204907 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 52291 atggatggatggatggctgg 52310
>emb|AL356015.3|CNS05TD5 Human chromosome 14 DNA sequence BAC C-3006G17 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 146602 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 87452 atggatggatggatggctgg 87471
>emb|AL928593.4| Mouse DNA sequence from clone RP23-100E9 on chromosome 2, complete sequence Length = 195840 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 31273 atggatggatggatggctgg 31254
>gb|AF064863.3| Homo sapiens chromosome 21 clone RP1-111A18 map 21q22.2, complete sequence Length = 135332 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 73564 atggatggatggatggctgg 73545
>gb|AC018839.5| Homo sapiens chromosome 3 clone RP11-593J10 map 3p, complete sequence Length = 182288 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 74384 atggatggatggatggctgg 74365
>gb|AC090841.2| Homo sapiens chromosome 3 clone RP11-1082A18 map 3p, complete sequence Length = 217778 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 206112 atggatggatggatggctgg 206093
>emb|AL606757.11| Mouse DNA sequence from clone RP23-356K2 on chromosome 3, complete sequence Length = 127113 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 464 atggatggatggatggctgg 483 |||||||||||||||||||| Sbjct: 126636 atggatggatggatggctgg 126617 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,635,163 Number of Sequences: 3902068 Number of extensions: 5635163 Number of successful extensions: 346189 Number of sequences better than 10.0: 215 Number of HSP's better than 10.0 without gapping: 216 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 338958 Number of HSP's gapped (non-prelim): 7219 length of query: 518 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 495 effective length of database: 17,143,297,704 effective search space: 8485932363480 effective search space used: 8485932363480 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
