ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd22j08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK121013.1| Oryza sativa (japonica cultivar-group) cDNA clon... 394 e-106
2dbj|AK064943.1| Oryza sativa (japonica cultivar-group) cDNA clon... 394 e-106
3dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 379 e-102
4dbj|AP001539.1| Oryza sativa (japonica cultivar-group) genomic D... 379 e-102
5ref|NM_188664.1| Oryza sativa (japonica cultivar-group), Ozsa826... 359 7e-96
6gb|DQ232587.1| Rhodobacter sphaeroides 2.4.1 plasmid E, partial ... 46 0.14
7gb|AC134459.4| Mus musculus BAC clone RP23-360L15 from chromosom... 44 0.54
8ref|XM_502148.1| Yarrowia lipolytica CLIB122, YALI0C22682g predi... 42 2.2
9emb|AJ004960.1|CAA004960 Cicer arietinum mRNA for elongation fac... 42 2.2
10emb|BX883043.1| Rattus norvegicus chromosome 20, major histocomp... 42 2.2
11emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 42 2.2
12gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, co... 40 8.5
13gb|AY431675.1| Aedes aegypti ASAP ID: 33963 cytosolic small ribo... 40 8.5
14gb|AY432215.1| Aedes aegypti ASAP ID: 43185 cytosolic small ribo... 40 8.5
15gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ... 40 8.5
16gb|DQ440051.1| Aedes aegypti clone AE-303 ribosomal protein S4 m... 40 8.5
17gb|AC116580.4| Mus musculus BAC clone RP23-293A11 from 18, compl... 40 8.5
18emb|AL445208.11| Human DNA sequence from clone RP11-104N3 on chr... 40 8.5
19gb|AC092519.2| Felis catus clone RP86-328F23, complete sequence 40 8.5
20emb|Y18134.1|SAC18134 Squalus acanthia complete mitochondrial ge... 40 8.5
21emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone ... 40 8.5
22emb|BX640415.1| Bordetella pertussis strain Tohama I, complete g... 40 8.5
23emb|CR938656.1| Single read from an extremity of a full-length c... 40 8.5
24emb|CR938484.1| Single read from an extremity of a full-length c... 40 8.5
25emb|CR938443.1| Single read from an extremity of a full-length c... 40 8.5
26emb|CR938092.1| Single read from an extremity of a full-length c... 40 8.5
27emb|CR937976.1| Single read from an extremity of a full-length c... 40 8.5
28gb|AC145821.16| Papio anubis clone rp41-103i16, complete sequence 40 8.5
29ref|NM_136030.1| Drosophila melanogaster CG15157-RA (CG15157), mRNA 40 8.5
30gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 40 8.5
31gb|AC093048.1| Drosophila melanogaster, chromosome 2L, region 36... 40 8.5
32gb|AC010708.10|AC010708 Drosophila melanogaster, chromosome X, r... 40 8.5
33gb|AC012098.9|AC012098 Drosophila melanogaster, chromosome X, re... 40 8.5
34gb|AC149589.2| Mus musculus BAC clone RP23-356I2 from 18, comple... 40 8.5
35gb|AE003658.3| Drosophila melanogaster chromosome 2L, section 67... 40 8.5
36gb|AC006471.1|AC006471 Drosophila melanogaster, chromosome 2L, r... 40 8.5
37gb|AE003508.4| Drosophila melanogaster chromosome X, section 60 ... 40 8.5
38emb|AL845480.12| Mouse DNA sequence from clone RP23-361N10 on ch... 40 8.5 
>dbj|AK121013.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023047M20, full
           insert sequence
          Length = 2356

 Score =  394 bits (199), Expect = e-106
 Identities = 406/475 (85%)
 Strand = Plus / Plus

                                                                       
Query: 148 gccgattcgggctcgggatccccggtccggtcttatggtaatgaagatggaggttgagga 207
           |||||||||||| ||||| |||| |  |||| ||||||| ||||||||||||| ||| ||
Sbjct: 104 gccgattcgggcgcgggagccccagcacggtattatggtgatgaagatggaggctgatga 163

                                                                       
Query: 208 ggacggtgccaatggaggaaatggtggggcatggactgaggaggatcgagccctcagcac 267
           ||| ||||||||||| |||| ||||||| |||||||||| ||||| ||||| |||| | |
Sbjct: 164 ggatggtgccaatggcggaactggtgggacatggactgacgaggaccgagcgctcaccgc 223

                                                                       
Query: 268 aactgtgcttggaagagatgcatttgcatacttgacaaaagggggcggtaccatatctga 327
            | |||||||||||  ||||| ||||| |||||||||||||| || ||| ||||||| ||
Sbjct: 224 cagtgtgcttggaacggatgcttttgcttacttgacaaaaggaggtggtgccatatccga 283

                                                                       
Query: 328 gggtcttattgctgcatcgtcacctgtagacttgcaaaataaactgcaggagcttatcga 387
           ||| ||| |||||||||| |  || || ||||||||||||| ||| ||||||||| ||||
Sbjct: 284 gggccttgttgctgcatctttgccagtggacttgcaaaatagactccaggagcttgtcga 343

                                                                       
Query: 388 atcagagcatcctggtgctggttggaactatgccatcttctggcagctttcacgcacaaa 447
           |||||| | ||||||||||||||||||||||||||| ||||||||||| || ||||||||
Sbjct: 344 atcagatcgtcctggtgctggttggaactatgccatattctggcagctgtcgcgcacaaa 403

                                                                       
Query: 448 gtctggtgatcttgtccttggatggggcgatggctcttgccgtgaacccaatgatgctga 507
           ||| ||||| ||||||||||||||||| ||||||||||||||||| ||  |||||| |||
Sbjct: 404 gtccggtgaccttgtccttggatggggggatggctcttgccgtgagcctcatgatggtga 463

                                                                       
Query: 508 gttggcagccgctgtttctgcaggcaatgaggatgccaaacagcggatgcggaagcgtgt 567
           | ||| | | |||| ||||||||| | ||| || ||||||||| ||||||| ||||||||
Sbjct: 464 gatgggacctgctgcttctgcaggtagtgacgaggccaaacagaggatgcgcaagcgtgt 523

                                                                  
Query: 568 gctgcagcggctgcacaaagcatttggtggtgctgatgaggaggattatgcccca 622
           |||||||||  |||||  |||||| || |||| ||| ||||||||||||||||||
Sbjct: 524 gctgcagcgattgcactcagcattcggaggtgttgacgaggaggattatgcccca 578
to top
>dbj|AK064943.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000P13, full
           insert sequence
          Length = 2529

 Score =  394 bits (199), Expect = e-106
 Identities = 406/475 (85%)
 Strand = Plus / Plus

                                                                       
Query: 148 gccgattcgggctcgggatccccggtccggtcttatggtaatgaagatggaggttgagga 207
           |||||||||||| ||||| |||| |  |||| ||||||| ||||||||||||| ||| ||
Sbjct: 277 gccgattcgggcgcgggagccccagcacggtattatggtgatgaagatggaggctgatga 336

                                                                       
Query: 208 ggacggtgccaatggaggaaatggtggggcatggactgaggaggatcgagccctcagcac 267
           ||| ||||||||||| |||| ||||||| |||||||||| ||||| ||||| |||| | |
Sbjct: 337 ggatggtgccaatggcggaactggtgggacatggactgacgaggaccgagcgctcaccgc 396

                                                                       
Query: 268 aactgtgcttggaagagatgcatttgcatacttgacaaaagggggcggtaccatatctga 327
            | |||||||||||  ||||| ||||| |||||||||||||| || ||| ||||||| ||
Sbjct: 397 cagtgtgcttggaacggatgcttttgcttacttgacaaaaggaggtggtgccatatccga 456

                                                                       
Query: 328 gggtcttattgctgcatcgtcacctgtagacttgcaaaataaactgcaggagcttatcga 387
           ||| ||| |||||||||| |  || || ||||||||||||| ||| ||||||||| ||||
Sbjct: 457 gggccttgttgctgcatctttgccagtggacttgcaaaatagactccaggagcttgtcga 516

                                                                       
Query: 388 atcagagcatcctggtgctggttggaactatgccatcttctggcagctttcacgcacaaa 447
           |||||| | ||||||||||||||||||||||||||| ||||||||||| || ||||||||
Sbjct: 517 atcagatcgtcctggtgctggttggaactatgccatattctggcagctgtcgcgcacaaa 576

                                                                       
Query: 448 gtctggtgatcttgtccttggatggggcgatggctcttgccgtgaacccaatgatgctga 507
           ||| ||||| ||||||||||||||||| ||||||||||||||||| ||  |||||| |||
Sbjct: 577 gtccggtgaccttgtccttggatggggggatggctcttgccgtgagcctcatgatggtga 636

                                                                       
Query: 508 gttggcagccgctgtttctgcaggcaatgaggatgccaaacagcggatgcggaagcgtgt 567
           | ||| | | |||| ||||||||| | ||| || ||||||||| ||||||| ||||||||
Sbjct: 637 gatgggacctgctgcttctgcaggtagtgacgaggccaaacagaggatgcgcaagcgtgt 696

                                                                  
Query: 568 gctgcagcggctgcacaaagcatttggtggtgctgatgaggaggattatgcccca 622
           |||||||||  |||||  |||||| || |||| ||| ||||||||||||||||||
Sbjct: 697 gctgcagcgattgcactcagcattcggaggtgttgacgaggaggattatgcccca 751
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  379 bits (191), Expect = e-102
 Identities = 380/443 (85%)
 Strand = Plus / Minus

                                                                           
Query: 180     ttatggtaatgaagatggaggttgaggaggacggtgccaatggaggaaatggtggggcat 239
               ||||||| ||||||||||||| ||| ||||| ||||||||||| |||| ||||||| |||
Sbjct: 7496341 ttatggtgatgaagatggaggctgatgaggatggtgccaatggcggaactggtgggacat 7496282

                                                                           
Query: 240     ggactgaggaggatcgagccctcagcacaactgtgcttggaagagatgcatttgcatact 299
               ||||||| ||||| ||||| |||| | | | |||||||||||  ||||| ||||| ||||
Sbjct: 7496281 ggactgacgaggaccgagcgctcaccgccagtgtgcttggaacggatgcttttgcttact 7496222

                                                                           
Query: 300     tgacaaaagggggcggtaccatatctgagggtcttattgctgcatcgtcacctgtagact 359
               |||||||||| || ||| ||||||| ||||| ||| |||||||||| |  || || ||||
Sbjct: 7496221 tgacaaaaggaggtggtgccatatccgagggccttgttgctgcatctttgccagtggact 7496162

                                                                           
Query: 360     tgcaaaataaactgcaggagcttatcgaatcagagcatcctggtgctggttggaactatg 419
               ||||||||| ||| ||||||||| |||||||||| | |||||||||||||||||||||||
Sbjct: 7496161 tgcaaaatagactccaggagcttgtcgaatcagatcgtcctggtgctggttggaactatg 7496102

                                                                           
Query: 420     ccatcttctggcagctttcacgcacaaagtctggtgatcttgtccttggatggggcgatg 479
               |||| ||||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 7496101 ccatattctggcagctgtcgcgcacaaagtccggtgaccttgtccttggatggggggatg 7496042

                                                                           
Query: 480     gctcttgccgtgaacccaatgatgctgagttggcagccgctgtttctgcaggcaatgagg 539
               ||||||||||||| ||  |||||| |||| ||| | | |||| ||||||||| | ||| |
Sbjct: 7496041 gctcttgccgtgagcctcatgatggtgagatgggacctgctgcttctgcaggtagtgacg 7495982

                                                                           
Query: 540     atgccaaacagcggatgcggaagcgtgtgctgcagcggctgcacaaagcatttggtggtg 599
               | ||||||||| ||||||| |||||||||||||||||  |||||  |||||| || ||||
Sbjct: 7495981 aggccaaacagaggatgcgcaagcgtgtgctgcagcgattgcactcagcattcggaggtg 7495922

                                      
Query: 600     ctgatgaggaggattatgcccca 622
                ||| ||||||||||||||||||
Sbjct: 7495921 ttgacgaggaggattatgcccca 7495899
to top
>dbj|AP001539.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0708G02
          Length = 168976

 Score =  379 bits (191), Expect = e-102
 Identities = 380/443 (85%)
 Strand = Plus / Minus

                                                                         
Query: 180   ttatggtaatgaagatggaggttgaggaggacggtgccaatggaggaaatggtggggcat 239
             ||||||| ||||||||||||| ||| ||||| ||||||||||| |||| ||||||| |||
Sbjct: 45133 ttatggtgatgaagatggaggctgatgaggatggtgccaatggcggaactggtgggacat 45074

                                                                         
Query: 240   ggactgaggaggatcgagccctcagcacaactgtgcttggaagagatgcatttgcatact 299
             ||||||| ||||| ||||| |||| | | | |||||||||||  ||||| ||||| ||||
Sbjct: 45073 ggactgacgaggaccgagcgctcaccgccagtgtgcttggaacggatgcttttgcttact 45014

                                                                         
Query: 300   tgacaaaagggggcggtaccatatctgagggtcttattgctgcatcgtcacctgtagact 359
             |||||||||| || ||| ||||||| ||||| ||| |||||||||| |  || || ||||
Sbjct: 45013 tgacaaaaggaggtggtgccatatccgagggccttgttgctgcatctttgccagtggact 44954

                                                                         
Query: 360   tgcaaaataaactgcaggagcttatcgaatcagagcatcctggtgctggttggaactatg 419
             ||||||||| ||| ||||||||| |||||||||| | |||||||||||||||||||||||
Sbjct: 44953 tgcaaaatagactccaggagcttgtcgaatcagatcgtcctggtgctggttggaactatg 44894

                                                                         
Query: 420   ccatcttctggcagctttcacgcacaaagtctggtgatcttgtccttggatggggcgatg 479
             |||| ||||||||||| || ||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 44893 ccatattctggcagctgtcgcgcacaaagtccggtgaccttgtccttggatggggggatg 44834

                                                                         
Query: 480   gctcttgccgtgaacccaatgatgctgagttggcagccgctgtttctgcaggcaatgagg 539
             ||||||||||||| ||  |||||| |||| ||| | | |||| ||||||||| | ||| |
Sbjct: 44833 gctcttgccgtgagcctcatgatggtgagatgggacctgctgcttctgcaggtagtgacg 44774

                                                                         
Query: 540   atgccaaacagcggatgcggaagcgtgtgctgcagcggctgcacaaagcatttggtggtg 599
             | ||||||||| ||||||| |||||||||||||||||  |||||  |||||| || ||||
Sbjct: 44773 aggccaaacagaggatgcgcaagcgtgtgctgcagcgattgcactcagcattcggaggtg 44714

                                    
Query: 600   ctgatgaggaggattatgcccca 622
              ||| ||||||||||||||||||
Sbjct: 44713 ttgacgaggaggattatgcccca 44691
to top
>ref|NM_188664.1| Oryza sativa (japonica cultivar-group), Ozsa8267 predicted mRNA
          Length = 1821

 Score =  359 bits (181), Expect = 7e-96
 Identities = 367/429 (85%)
 Strand = Plus / Plus

                                                                       
Query: 194 atggaggttgaggaggacggtgccaatggaggaaatggtggggcatggactgaggaggat 253
           ||||||| ||| ||||| ||||||||||| |||| ||||||| |||||||||| ||||| 
Sbjct: 1   atggaggctgatgaggatggtgccaatggcggaactggtgggacatggactgacgaggac 60

                                                                       
Query: 254 cgagccctcagcacaactgtgcttggaagagatgcatttgcatacttgacaaaagggggc 313
           ||||| |||| | | | |||||||||||  ||||| ||||| |||||||||||||| || 
Sbjct: 61  cgagcgctcaccgccagtgtgcttggaacggatgcttttgcttacttgacaaaaggaggt 120

                                                                       
Query: 314 ggtaccatatctgagggtcttattgctgcatcgtcacctgtagacttgcaaaataaactg 373
           ||| ||||||| ||||| ||| |||||||||| |  || || ||||||||||||| ||| 
Sbjct: 121 ggtgccatatccgagggccttgttgctgcatctttgccagtggacttgcaaaatagactc 180

                                                                       
Query: 374 caggagcttatcgaatcagagcatcctggtgctggttggaactatgccatcttctggcag 433
           ||||||||| |||||||||| | ||||||||||||||||||||||||||| |||||||||
Sbjct: 181 caggagcttgtcgaatcagatcgtcctggtgctggttggaactatgccatattctggcag 240

                                                                       
Query: 434 ctttcacgcacaaagtctggtgatcttgtccttggatggggcgatggctcttgccgtgaa 493
           || || ||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| 
Sbjct: 241 ctgtcgcgcacaaagtccggtgaccttgtccttggatggggggatggctcttgccgtgag 300

                                                                       
Query: 494 cccaatgatgctgagttggcagccgctgtttctgcaggcaatgaggatgccaaacagcgg 553
           ||  |||||| |||| ||| | | |||| ||||||||| | ||| || ||||||||| ||
Sbjct: 301 cctcatgatggtgagatgggacctgctgcttctgcaggtagtgacgaggccaaacagagg 360

                                                                       
Query: 554 atgcggaagcgtgtgctgcagcggctgcacaaagcatttggtggtgctgatgaggaggat 613
           ||||| |||||||||||||||||  |||||  |||||| || |||| ||| |||||||||
Sbjct: 361 atgcgcaagcgtgtgctgcagcgattgcactcagcattcggaggtgttgacgaggaggat 420

                    
Query: 614 tatgcccca 622
           |||||||||
Sbjct: 421 tatgcccca 429
to top
>gb|DQ232587.1| Rhodobacter sphaeroides 2.4.1 plasmid E, partial sequence
          Length = 37100

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 46    gcgcgcgggaagatccgggcttc 68
             |||||||||||||||||||||||
Sbjct: 15026 gcgcgcgggaagatccgggcttc 15048
to top
>gb|AC134459.4| Mus musculus BAC clone RP23-360L15 from chromosome 8, complete sequence
          Length = 211773

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 592   tggtggtgctgatgaggaggat 613
             ||||||||||||||||||||||
Sbjct: 96657 tggtggtgctgatgaggaggat 96678
to top
>ref|XM_502148.1| Yarrowia lipolytica CLIB122, YALI0C22682g predicted mRNA
          Length = 1905

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 458 cttgtccttggatggggcgat 478
           |||||||||||||||||||||
Sbjct: 453 cttgtccttggatggggcgat 433
to top
>emb|AJ004960.1|CAA004960 Cicer arietinum mRNA for elongation factor 1-alpha (EF1-a)
          Length = 1304

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 355  agacttgcaaaataaactgca 375
            |||||||||||||||||||||
Sbjct: 1086 agacttgcaaaataaactgca 1066
to top
>emb|BX883043.1| Rattus norvegicus chromosome 20, major histocompatibility complex,
              assembled from 40 BACs, strain Brown Norway (BN/ssNHsd),
              RT1n haplotype; segment 2/11
          Length = 347664

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 323    tctgagggtcttattgctgca 343
              |||||||||||||||||||||
Sbjct: 180631 tctgagggtcttattgctgca 180651
to top
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 458     cttgtccttggatggggcgat 478
               |||||||||||||||||||||
Sbjct: 3033802 cttgtccttggatggggcgat 3033822
to top
>gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, complete sequence
          Length = 384518

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     ccgggcttctcgccgtcgcg 79
              ||||||||||||||||||||
Sbjct: 164746 ccgggcttctcgccgtcgcg 164727
to top
>gb|AY431675.1| Aedes aegypti ASAP ID: 33963 cytosolic small ribosomal subunit S9
           mRNA sequence
          Length = 884

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 593 ggtggtgctgatgaggagga 612
           ||||||||||||||||||||
Sbjct: 650 ggtggtgctgatgaggagga 669
to top
>gb|AY432215.1| Aedes aegypti ASAP ID: 43185 cytosolic small ribosomal subunit S9
           mRNA sequence
          Length = 716

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 593 ggtggtgctgatgaggagga 612
           ||||||||||||||||||||
Sbjct: 614 ggtggtgctgatgaggagga 633
to top
>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 218    aatggaggaaatggtggggc 237
              ||||||||||||||||||||
Sbjct: 469647 aatggaggaaatggtggggc 469628
to top
>gb|DQ440051.1| Aedes aegypti clone AE-303 ribosomal protein S4 mRNA, complete cds
          Length = 588

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 593 ggtggtgctgatgaggagga 612
           ||||||||||||||||||||
Sbjct: 559 ggtggtgctgatgaggagga 578
to top
>gb|AC116580.4| Mus musculus BAC clone RP23-293A11 from 18, complete sequence
          Length = 197810

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 411   ggaactatgccatcttctgg 430
             ||||||||||||||||||||
Sbjct: 12084 ggaactatgccatcttctgg 12065
to top
>emb|AL445208.11| Human DNA sequence from clone RP11-104N3 on chromosome 6, complete
            sequence
          Length = 60742

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 325  tgagggtcttattgctgcat 344
            ||||||||||||||||||||
Sbjct: 3745 tgagggtcttattgctgcat 3764
to top
>gb|AC092519.2| Felis catus clone RP86-328F23, complete sequence
          Length = 178238

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    ctgggtgttgccggccttgc 122
              ||||||||||||||||||||
Sbjct: 113077 ctgggtgttgccggccttgc 113096
to top
>emb|Y18134.1|SAC18134 Squalus acanthia complete mitochondrial genome
          Length = 16738

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 191   aagatggaggttgaggagga 210
             ||||||||||||||||||||
Sbjct: 11679 aagatggaggttgaggagga 11660
to top
>emb|BX842627.1| Neurospora crassa DNA linkage group I BAC clone B8J22
          Length = 75335

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 499   tgatgctgagttggcagccg 518
             ||||||||||||||||||||
Sbjct: 11552 tgatgctgagttggcagccg 11533
to top
>emb|BX640415.1| Bordetella pertussis strain Tohama I, complete genome; segment 5/12
          Length = 347071

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    ccgcgcgcgggaagatccgg 63
             ||||||||||||||||||||
Sbjct: 97743 ccgcgcgcgggaagatccgg 97724
to top
>emb|CR938656.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YC10AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 760

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 593 ggtggtgctgatgaggagga 612
           ||||||||||||||||||||
Sbjct: 637 ggtggtgctgatgaggagga 656
to top
>emb|CR938484.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YL17AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 669

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 593 ggtggtgctgatgaggagga 612
           ||||||||||||||||||||
Sbjct: 621 ggtggtgctgatgaggagga 640
to top
>emb|CR938443.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA1YO01BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 559

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 593 ggtggtgctgatgaggagga 612
           ||||||||||||||||||||
Sbjct: 214 ggtggtgctgatgaggagga 195
to top
>emb|CR938092.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YK19AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 850

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 593 ggtggtgctgatgaggagga 612
           ||||||||||||||||||||
Sbjct: 632 ggtggtgctgatgaggagga 651
to top
>emb|CR937976.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA2YO13BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 785

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 593 ggtggtgctgatgaggagga 612
           ||||||||||||||||||||
Sbjct: 187 ggtggtgctgatgaggagga 168
to top
>gb|AC145821.16| Papio anubis clone rp41-103i16, complete sequence
          Length = 169553

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 480    gctcttgccgtgaacccaat 499
              ||||||||||||||||||||
Sbjct: 154801 gctcttgccgtgaacccaat 154820
to top
>ref|NM_136030.1| Drosophila melanogaster CG15157-RA (CG15157), mRNA
          Length = 1341

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 550  gcggatgcggaagcgtgtgc 569
            ||||||||||||||||||||
Sbjct: 1117 gcggatgcggaagcgtgtgc 1098
to top
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 61      cgggcttctcgccgtcgcgg 80
               ||||||||||||||||||||
Sbjct: 2645579 cgggcttctcgccgtcgcgg 2645598
to top
>gb|AC093048.1| Drosophila melanogaster, chromosome 2L, region 36D-36E, BAC clone
              BACR39D12, complete sequence
          Length = 184021

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 550    gcggatgcggaagcgtgtgc 569
              ||||||||||||||||||||
Sbjct: 141502 gcggatgcggaagcgtgtgc 141521
to top
>gb|AC010708.10|AC010708 Drosophila melanogaster, chromosome X, region 17A-17B, BAC clone
              BACR10E05, complete sequence
          Length = 188766

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 82     ttcggcggcagaggtcgtgg 101
              ||||||||||||||||||||
Sbjct: 131291 ttcggcggcagaggtcgtgg 131272
to top
>gb|AC012098.9|AC012098 Drosophila melanogaster, chromosome X, region 17A-17B, BAC clone
             BACR03K10, complete sequence
          Length = 188489

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    ttcggcggcagaggtcgtgg 101
             ||||||||||||||||||||
Sbjct: 46668 ttcggcggcagaggtcgtgg 46649
to top
>gb|AC149589.2| Mus musculus BAC clone RP23-356I2 from 18, complete sequence
          Length = 225803

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 411    ggaactatgccatcttctgg 430
              ||||||||||||||||||||
Sbjct: 143502 ggaactatgccatcttctgg 143483
to top
>gb|AE003658.3| Drosophila melanogaster chromosome 2L, section 67 of 83 of the complete
             sequence
          Length = 262745

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 550   gcggatgcggaagcgtgtgc 569
             ||||||||||||||||||||
Sbjct: 49420 gcggatgcggaagcgtgtgc 49439
to top
>gb|AC006471.1|AC006471 Drosophila melanogaster, chromosome 2L, region 36D2-36E2, P1 clones
             DS00554 and DS04489, complete sequence
          Length = 134019

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 550   gcggatgcggaagcgtgtgc 569
             ||||||||||||||||||||
Sbjct: 61048 gcggatgcggaagcgtgtgc 61029
to top
>gb|AE003508.4| Drosophila melanogaster chromosome X, section 60 of 74 of the complete
              sequence
          Length = 290619

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 82     ttcggcggcagaggtcgtgg 101
              ||||||||||||||||||||
Sbjct: 261239 ttcggcggcagaggtcgtgg 261220
to top
>emb|AL845480.12| Mouse DNA sequence from clone RP23-361N10 on chromosome 2, complete
             sequence
          Length = 147686

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 187   aatgaagatggaggttgagg 206
             ||||||||||||||||||||
Sbjct: 81706 aatgaagatggaggttgagg 81725


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,799,810
Number of Sequences: 3902068
Number of extensions: 4799810
Number of successful extensions: 96168
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95990
Number of HSP's gapped (non-prelim): 178
length of query: 624
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 601
effective length of database: 17,143,297,704
effective search space: 10303121920104
effective search space used: 10303121920104
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top