ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | basd22i23 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_463252.1| Oryza sativa (japonica cultivar-group), mRNA Length = 879 Score = 513 bits (259), Expect = e-142 Identities = 370/408 (90%), Gaps = 8/408 (1%) Strand = Plus / Plus Query: 225 atgaggatgattccagttgagaaccatggagtgcgatgtatgtccatcgggtttcttgta 284 |||||||||||||||||||| ||| ||||||| | ||| |||||||| ||||||||||| Sbjct: 274 atgaggatgattccagttgacaactatggagtacaatgcatgtccattgggtttcttgtt 333 Query: 285 gacaaagatgcaccaatcgtttggagaggt--------aatgagtgctcttgagaagatg 336 ||||||||||||||||| |||||||||||| ||||||||||||||||||||| Sbjct: 334 gacaaagatgcaccaattgtttggagaggtcctatggtaatgagtgctcttgagaagatt 393 Query: 337 acaaggggagtagcctggggtaatctggatgttcttgttgttgatatgccccccggcact 396 |||||||| ||||||||||||||||| ||| |||||||||||||||||||||| |||||| Sbjct: 394 acaaggggggtagcctggggtaatcttgatattcttgttgttgatatgcccccgggcact 453 Query: 397 ggtgatgctcaactatcaatgtcccaaaggcttcggttatctggtgctttaattgtttct 456 ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 454 ggtgatgctcagctatcaatgtcccaaaggcttcggttatctggtgctttaattgtttca 513 Query: 457 actcctcaagatattgctctaattgatgctagaagaggagcaaacatgtttcgtaaagtc 516 ||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 514 actccccaagatatcgctctaattgatgctagaagaggagcaaatatgtttcgtaaagtt 573 Query: 517 caagttcctattctaggcttagtagagaacatgagttgcttcaagtgcccaaagtgtggt 576 ||||| |||||||| || ||||| ||||| ||||| || ||||||||||| ||||||||| Sbjct: 574 caagtccctattctgggtttagtggagaatatgagctgtttcaagtgcccgaagtgtggt 633 Query: 577 gagaagtcttacatttttggagaaggtggagcccagagaactgcagaa 624 |||||||||||||||||||| |||||||||| ||||||||||||||| Sbjct: 634 gagaagtcttacatttttggggaaggtggaggtcagagaactgcagaa 681 Score = 212 bits (107), Expect = 1e-51 Identities = 194/222 (87%), Gaps = 1/222 (0%) Strand = Plus / Plus Query: 2 aggagatgctacagcgccgccgcgang-gcgggctctcaatcactggcgtcagtgacatc 60 ||||||||||||||||||||||| | | |||| | ||| ||| | || || || |||||| Sbjct: 40 aggagatgctacagcgccgccgccaagagcggcccctcgatcgccggggtaagcgacatc 99 Query: 61 attgctgtcgcctcggggaaaggcggcgtcggcaagtccaccactgcagttaacattgct 120 || || |||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 100 atcgccgtcgcctccgggaaaggcggcgtcggcaagtccaccactgcagttaacattgct 159 Query: 121 gtagcacttgcgaaggagtttaagctcaaggttggtttgctagatgctgatatatatggg 180 ||||||||||| ||| ||||| |||| ||||||||| || ||||||| || |||||||| Sbjct: 160 gtagcacttgccaagaagtttcagcttaaggttggtctgttagatgccgacatatatgga 219 Query: 181 ccatccattcccacaatgatgcatctgcatgaaaagcctgaa 222 |||||||| |||||||||||| |||| |||| ||| |||||| Sbjct: 220 ccatccatacccacaatgatgaatctccatgcaaaacctgaa 261
>gb|BT018024.1| Zea mays clone EL01N0529F02.c mRNA sequence Length = 907 Score = 480 bits (242), Expect = e-132 Identities = 435/502 (86%), Gaps = 18/502 (3%) Strand = Plus / Plus Query: 140 ttaagctcaaggttggtttgctagatgctgatatatatgggccatccattcccacaatga 199 ||||||| ||||||||||||||||||||| | ||||||||||||||||| ||||||| Sbjct: 14 ttaagcttcaggttggtttgctagatgctgccttttatgggccatccattcctacaatga 73 Query: 200 tgcatctgcatgaaaagcctgaa----------acatgaggatgattccagttgagaacc 249 || | || |||| ||||||||| |||||| ||| ||||||||||||||| Sbjct: 74 tgaacctccatgctaagcctgaagtaaatgaagacatgaagattcttccagttgagaacc 133 Query: 250 atggagtgcgatgtatgtccatcgggtttcttgtagacaaagatgcaccaatcgtttgga 309 |||| |||||||| |||||||| || |||||||||||||| ||||||||||| ||||||| Sbjct: 134 atggtgtgcgatgcatgtccattggttttcttgtagacaatgatgcaccaattgtttgga 193 Query: 310 gaggt--------aatgagtgctcttgagaagatgacaaggggagtagcctggggtaatc 361 ||||| ||||||||||||||||||||||||||||||||| || ||||| | | Sbjct: 194 gaggtcctatggtaatgagtgctcttgagaagatgacaaggggagttgcttggggggacc 253 Query: 362 tggatgttcttgttgttgatatgccccccggcactggtgatgctcaactatcaatgtccc 421 | ||| |||||||||||||||||||||| |||||||| |||||||||||||| ||||||| Sbjct: 254 ttgatattcttgttgttgatatgcccccaggcactggcgatgctcaactatcgatgtccc 313 Query: 422 aaaggcttcggttatctggtgctttaattgtttctactcctcaagatattgctctaattg 481 |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| Sbjct: 314 aaaggcttcggttatctggtgctttaattgtttcaactcctcaagatattgctcttattg 373 Query: 482 atgctagaagaggagcaaacatgtttcgtaaagtccaagttcctattctaggcttagtag 541 |||||||||||||||| |||||||| || ||||| |||||||||||||| || || |||| Sbjct: 374 atgctagaagaggagccaacatgttccgcaaagttcaagttcctattctgggattggtag 433 Query: 542 agaacatgagttgcttcaagtgcccaaagtgtggtgagaagtcttacatttttggagaag 601 |||| |||||||| || ||||||||||| ||||||||||| |||||||| || || |||| Sbjct: 434 agaatatgagttgttttaagtgcccaaaatgtggtgagaaatcttacatcttcggggaag 493 Query: 602 gtggagcccagagaactgcaga 623 ||||||| |||||||||||||| Sbjct: 494 gtggagcgcagagaactgcaga 515
>dbj|AK106686.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-114-C02, full insert sequence Length = 2347 Score = 448 bits (226), Expect = e-122 Identities = 292/314 (92%) Strand = Plus / Plus Query: 311 aggtaatgagtgctcttgagaagatgacaaggggagtagcctggggtaatctggatgttc 370 ||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||| ||| Sbjct: 1548 aggtaatgagtgctcttgagaagattacaaggggggtagcctggggtaatcttgatattc 1607 Query: 371 ttgttgttgatatgccccccggcactggtgatgctcaactatcaatgtcccaaaggcttc 430 ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| Sbjct: 1608 ttgttgttgatatgcccccgggcactggtgatgctcagctatcaatgtcccaaaggcttc 1667 Query: 431 ggttatctggtgctttaattgtttctactcctcaagatattgctctaattgatgctagaa 490 ||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||| Sbjct: 1668 ggttatctggtgctttaattgtttcaactccccaagatatcgctctaattgatgctagaa 1727 Query: 491 gaggagcaaacatgtttcgtaaagtccaagttcctattctaggcttagtagagaacatga 550 |||||||||| |||||||||||||| ||||| |||||||| || ||||| ||||| |||| Sbjct: 1728 gaggagcaaatatgtttcgtaaagttcaagtccctattctgggtttagtggagaatatga 1787 Query: 551 gttgcttcaagtgcccaaagtgtggtgagaagtcttacatttttggagaaggtggagccc 610 | || ||||||||||| ||||||||||||||||||||||||||||| |||||||||| | Sbjct: 1788 gctgtttcaagtgcccgaagtgtggtgagaagtcttacatttttggggaaggtggaggtc 1847 Query: 611 agagaactgcagaa 624 |||||||||||||| Sbjct: 1848 agagaactgcagaa 1861 Score = 212 bits (107), Expect = 1e-51 Identities = 194/222 (87%), Gaps = 1/222 (0%) Strand = Plus / Plus Query: 2 aggagatgctacagcgccgccgcgang-gcgggctctcaatcactggcgtcagtgacatc 60 ||||||||||||||||||||||| | | |||| | ||| ||| | || || || |||||| Sbjct: 263 aggagatgctacagcgccgccgccaagagcggcccctcgatcgccggggtaagcgacatc 322 Query: 61 attgctgtcgcctcggggaaaggcggcgtcggcaagtccaccactgcagttaacattgct 120 || || |||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 323 atcgccgtcgcctccgggaaaggcggcgtcggcaagtccaccactgcagttaacattgct 382 Query: 121 gtagcacttgcgaaggagtttaagctcaaggttggtttgctagatgctgatatatatggg 180 ||||||||||| ||| ||||| |||| ||||||||| || ||||||| || |||||||| Sbjct: 383 gtagcacttgccaagaagtttcagcttaaggttggtctgttagatgccgacatatatgga 442 Query: 181 ccatccattcccacaatgatgcatctgcatgaaaagcctgaa 222 |||||||| |||||||||||| |||| |||| ||| |||||| Sbjct: 443 ccatccatacccacaatgatgaatctccatgcaaaacctgaa 484 Score = 115 bits (58), Expect = 2e-22 Identities = 82/90 (91%) Strand = Plus / Plus Query: 225 atgaggatgattccagttgagaaccatggagtgcgatgtatgtccatcgggtttcttgta 284 |||||||||||||||||||| ||| ||||||| | ||| |||||||| ||||||||||| Sbjct: 497 atgaggatgattccagttgacaactatggagtacaatgcatgtccattgggtttcttgtt 556 Query: 285 gacaaagatgcaccaatcgtttggagaggt 314 ||||||||||||||||| |||||||||||| Sbjct: 557 gacaaagatgcaccaattgtttggagaggt 586
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 212 bits (107), Expect = 1e-51 Identities = 125/131 (95%) Strand = Plus / Plus Query: 311 aggtaatgagtgctcttgagaagatgacaaggggagtagcctggggtaatctggatgttc 370 ||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||| ||| Sbjct: 23718748 aggtaatgagtgctcttgagaagattacaaggggggtagcctggggtaatcttgatattc 23718807 Query: 371 ttgttgttgatatgccccccggcactggtgatgctcaactatcaatgtcccaaaggcttc 430 ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| Sbjct: 23718808 ttgttgttgatatgcccccgggcactggtgatgctcagctatcaatgtcccaaaggcttc 23718867 Query: 431 ggttatctggt 441 ||||||||||| Sbjct: 23718868 ggttatctggt 23718878 Score = 125 bits (63), Expect = 2e-25 Identities = 78/83 (93%) Strand = Plus / Plus Query: 439 ggtgctttaattgtttctactcctcaagatattgctctaattgatgctagaagaggagca 498 ||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||| Sbjct: 23718956 ggtgctttaattgtttcaactccccaagatatcgctctaattgatgctagaagaggagca 23719015 Query: 499 aacatgtttcgtaaagtccaagt 521 || |||||||||||||| ||||| Sbjct: 23719016 aatatgtttcgtaaagttcaagt 23719038 Score = 125 bits (63), Expect = 2e-25 Identities = 105/119 (88%) Strand = Plus / Plus Query: 104 ctgcagttaacattgctgtagcacttgcgaaggagtttaagctcaaggttggtttgctag 163 |||||||||||||||||||||||||||| ||| ||||| |||| ||||||||| || ||| Sbjct: 23716047 ctgcagttaacattgctgtagcacttgccaagaagtttcagcttaaggttggtctgttag 23716106 Query: 164 atgctgatatatatgggccatccattcccacaatgatgcatctgcatgaaaagcctgaa 222 |||| || |||||||| |||||||| |||||||||||| |||| |||| ||| |||||| Sbjct: 23716107 atgccgacatatatggaccatccatacccacaatgatgaatctccatgcaaaacctgaa 23716165 Score = 117 bits (59), Expect = 5e-23 Identities = 89/99 (89%) Strand = Plus / Plus Query: 526 attctaggcttagtagagaacatgagttgcttcaagtgcccaaagtgtggtgagaagtct 585 ||||| || ||||| ||||| ||||| || ||||||||||| |||||||||||||||||| Sbjct: 23719208 attctgggtttagtggagaatatgagctgtttcaagtgcccgaagtgtggtgagaagtct 23719267 Query: 586 tacatttttggagaaggtggagcccagagaactgcagaa 624 ||||||||||| |||||||||| ||||||||||||||| Sbjct: 23719268 tacatttttggggaaggtggaggtcagagaactgcagaa 23719306 Score = 115 bits (58), Expect = 2e-22 Identities = 82/90 (91%) Strand = Plus / Plus Query: 225 atgaggatgattccagttgagaaccatggagtgcgatgtatgtccatcgggtttcttgta 284 |||||||||||||||||||| ||| ||||||| | ||| |||||||| ||||||||||| Sbjct: 23717697 atgaggatgattccagttgacaactatggagtacaatgcatgtccattgggtttcttgtt 23717756 Query: 285 gacaaagatgcaccaatcgtttggagaggt 314 ||||||||||||||||| |||||||||||| Sbjct: 23717757 gacaaagatgcaccaattgtttggagaggt 23717786 Score = 99.6 bits (50), Expect = 1e-17 Identities = 95/109 (87%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 2 aggagatgctacagcgccgccgcgang-gcgggctctcaatcactggcgtcagtgacatc 60 ||||||||||||||||||||||| | | |||| | ||| ||| | || || || |||||| Sbjct: 23715603 aggagatgctacagcgccgccgccaagagcggcccctcgatcgccggggtaagcgacatc 23715662 Query: 61 attgctgtcgcctcggggaaaggcggcgtcggcaagtccaccactgcag 109 || || |||||||| |||||||||||||||||||||||||||||||||| Sbjct: 23715663 atcgccgtcgcctccgggaaaggcggcgtcggcaagtccaccactgcag 23715711
>gb|AC092390.3| Oryza sativa chromosome 3 BAC OSJNBb0013K08 genomic sequence, complete sequence Length = 120116 Score = 212 bits (107), Expect = 1e-51 Identities = 125/131 (95%) Strand = Plus / Plus Query: 311 aggtaatgagtgctcttgagaagatgacaaggggagtagcctggggtaatctggatgttc 370 ||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||| ||| Sbjct: 50802 aggtaatgagtgctcttgagaagattacaaggggggtagcctggggtaatcttgatattc 50861 Query: 371 ttgttgttgatatgccccccggcactggtgatgctcaactatcaatgtcccaaaggcttc 430 ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| Sbjct: 50862 ttgttgttgatatgcccccgggcactggtgatgctcagctatcaatgtcccaaaggcttc 50921 Query: 431 ggttatctggt 441 ||||||||||| Sbjct: 50922 ggttatctggt 50932 Score = 125 bits (63), Expect = 2e-25 Identities = 78/83 (93%) Strand = Plus / Plus Query: 439 ggtgctttaattgtttctactcctcaagatattgctctaattgatgctagaagaggagca 498 ||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||| Sbjct: 51010 ggtgctttaattgtttcaactccccaagatatcgctctaattgatgctagaagaggagca 51069 Query: 499 aacatgtttcgtaaagtccaagt 521 || |||||||||||||| ||||| Sbjct: 51070 aatatgtttcgtaaagttcaagt 51092 Score = 125 bits (63), Expect = 2e-25 Identities = 105/119 (88%) Strand = Plus / Plus Query: 104 ctgcagttaacattgctgtagcacttgcgaaggagtttaagctcaaggttggtttgctag 163 |||||||||||||||||||||||||||| ||| ||||| |||| ||||||||| || ||| Sbjct: 48101 ctgcagttaacattgctgtagcacttgccaagaagtttcagcttaaggttggtctgttag 48160 Query: 164 atgctgatatatatgggccatccattcccacaatgatgcatctgcatgaaaagcctgaa 222 |||| || |||||||| |||||||| |||||||||||| |||| |||| ||| |||||| Sbjct: 48161 atgccgacatatatggaccatccatacccacaatgatgaatctccatgcaaaacctgaa 48219 Score = 117 bits (59), Expect = 5e-23 Identities = 89/99 (89%) Strand = Plus / Plus Query: 526 attctaggcttagtagagaacatgagttgcttcaagtgcccaaagtgtggtgagaagtct 585 ||||| || ||||| ||||| ||||| || ||||||||||| |||||||||||||||||| Sbjct: 51262 attctgggtttagtggagaatatgagctgtttcaagtgcccgaagtgtggtgagaagtct 51321 Query: 586 tacatttttggagaaggtggagcccagagaactgcagaa 624 ||||||||||| |||||||||| ||||||||||||||| Sbjct: 51322 tacatttttggggaaggtggaggtcagagaactgcagaa 51360 Score = 115 bits (58), Expect = 2e-22 Identities = 82/90 (91%) Strand = Plus / Plus Query: 225 atgaggatgattccagttgagaaccatggagtgcgatgtatgtccatcgggtttcttgta 284 |||||||||||||||||||| ||| ||||||| | ||| |||||||| ||||||||||| Sbjct: 49751 atgaggatgattccagttgacaactatggagtacaatgcatgtccattgggtttcttgtt 49810 Query: 285 gacaaagatgcaccaatcgtttggagaggt 314 ||||||||||||||||| |||||||||||| Sbjct: 49811 gacaaagatgcaccaattgtttggagaggt 49840 Score = 99.6 bits (50), Expect = 1e-17 Identities = 95/109 (87%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 2 aggagatgctacagcgccgccgcgang-gcgggctctcaatcactggcgtcagtgacatc 60 ||||||||||||||||||||||| | | |||| | ||| ||| | || || || |||||| Sbjct: 47657 aggagatgctacagcgccgccgccaagagcggcccctcgatcgccggggtaagcgacatc 47716 Query: 61 attgctgtcgcctcggggaaaggcggcgtcggcaagtccaccactgcag 109 || || |||||||| |||||||||||||||||||||||||||||||||| Sbjct: 47717 atcgccgtcgcctccgggaaaggcggcgtcggcaagtccaccactgcag 47765
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 212 bits (107), Expect = 1e-51 Identities = 125/131 (95%) Strand = Plus / Plus Query: 311 aggtaatgagtgctcttgagaagatgacaaggggagtagcctggggtaatctggatgttc 370 ||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||| ||| Sbjct: 23711776 aggtaatgagtgctcttgagaagattacaaggggggtagcctggggtaatcttgatattc 23711835 Query: 371 ttgttgttgatatgccccccggcactggtgatgctcaactatcaatgtcccaaaggcttc 430 ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| Sbjct: 23711836 ttgttgttgatatgcccccgggcactggtgatgctcagctatcaatgtcccaaaggcttc 23711895 Query: 431 ggttatctggt 441 ||||||||||| Sbjct: 23711896 ggttatctggt 23711906 Score = 125 bits (63), Expect = 2e-25 Identities = 78/83 (93%) Strand = Plus / Plus Query: 439 ggtgctttaattgtttctactcctcaagatattgctctaattgatgctagaagaggagca 498 ||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||| Sbjct: 23711984 ggtgctttaattgtttcaactccccaagatatcgctctaattgatgctagaagaggagca 23712043 Query: 499 aacatgtttcgtaaagtccaagt 521 || |||||||||||||| ||||| Sbjct: 23712044 aatatgtttcgtaaagttcaagt 23712066 Score = 125 bits (63), Expect = 2e-25 Identities = 105/119 (88%) Strand = Plus / Plus Query: 104 ctgcagttaacattgctgtagcacttgcgaaggagtttaagctcaaggttggtttgctag 163 |||||||||||||||||||||||||||| ||| ||||| |||| ||||||||| || ||| Sbjct: 23709075 ctgcagttaacattgctgtagcacttgccaagaagtttcagcttaaggttggtctgttag 23709134 Query: 164 atgctgatatatatgggccatccattcccacaatgatgcatctgcatgaaaagcctgaa 222 |||| || |||||||| |||||||| |||||||||||| |||| |||| ||| |||||| Sbjct: 23709135 atgccgacatatatggaccatccatacccacaatgatgaatctccatgcaaaacctgaa 23709193 Score = 117 bits (59), Expect = 5e-23 Identities = 89/99 (89%) Strand = Plus / Plus Query: 526 attctaggcttagtagagaacatgagttgcttcaagtgcccaaagtgtggtgagaagtct 585 ||||| || ||||| ||||| ||||| || ||||||||||| |||||||||||||||||| Sbjct: 23712236 attctgggtttagtggagaatatgagctgtttcaagtgcccgaagtgtggtgagaagtct 23712295 Query: 586 tacatttttggagaaggtggagcccagagaactgcagaa 624 ||||||||||| |||||||||| ||||||||||||||| Sbjct: 23712296 tacatttttggggaaggtggaggtcagagaactgcagaa 23712334 Score = 115 bits (58), Expect = 2e-22 Identities = 82/90 (91%) Strand = Plus / Plus Query: 225 atgaggatgattccagttgagaaccatggagtgcgatgtatgtccatcgggtttcttgta 284 |||||||||||||||||||| ||| ||||||| | ||| |||||||| ||||||||||| Sbjct: 23710725 atgaggatgattccagttgacaactatggagtacaatgcatgtccattgggtttcttgtt 23710784 Query: 285 gacaaagatgcaccaatcgtttggagaggt 314 ||||||||||||||||| |||||||||||| Sbjct: 23710785 gacaaagatgcaccaattgtttggagaggt 23710814 Score = 99.6 bits (50), Expect = 1e-17 Identities = 95/109 (87%), Gaps = 1/109 (0%) Strand = Plus / Plus Query: 2 aggagatgctacagcgccgccgcgang-gcgggctctcaatcactggcgtcagtgacatc 60 ||||||||||||||||||||||| | | |||| | ||| ||| | || || || |||||| Sbjct: 23708631 aggagatgctacagcgccgccgccaagagcggcccctcgatcgccggggtaagcgacatc 23708690 Query: 61 attgctgtcgcctcggggaaaggcggcgtcggcaagtccaccactgcag 109 || || |||||||| |||||||||||||||||||||||||||||||||| Sbjct: 23708691 atcgccgtcgcctccgggaaaggcggcgtcggcaagtccaccactgcag 23708739
>ref|NM_118074.1| Arabidopsis thaliana unknown protein AT4G19540 mRNA, complete cds Length = 1215 Score = 77.8 bits (39), Expect = 4e-11 Identities = 153/192 (79%), Gaps = 8/192 (4%) Strand = Plus / Plus Query: 225 atgaggatgattccagttgagaaccatggagtgcgatgtatgtccatcgggtttcttgta 284 |||| ||||||||||||||||||| ||||||| ||| ||||| || || ||||||| Sbjct: 444 atgaagatgattccagttgagaactatggagttaaatgcatgtcaatgggacttcttgtt 503 Query: 285 gacaaagatgcaccaatcgtttggagaggt--------aatgagtgctcttgagaagatg 336 || |||||||||||| | || ||||||||| |||||||||||||| |||||| Sbjct: 504 gaaaaagatgcaccacttgtctggagaggtcctatggtaatgagtgctcttgctaagatg 563 Query: 337 acaaggggagtagcctggggtaatctggatgttcttgttgttgatatgccccccggcact 396 |||| ||||| | ||||| |||| ||| |||| |||||||||||||| || || || Sbjct: 564 acaaaaggagttgattggggagatcttgatattctcgttgttgatatgccacctggaacc 623 Query: 397 ggtgatgctcaa 408 |||||||||||| Sbjct: 624 ggtgatgctcaa 635 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 538 gtagagaacatgagttgcttc 558 ||||||||||||||||||||| Sbjct: 765 gtagagaacatgagttgcttc 785
>gb|AY085137.1| Arabidopsis thaliana clone 13295 mRNA, complete sequence Length = 1216 Score = 77.8 bits (39), Expect = 4e-11 Identities = 153/192 (79%), Gaps = 8/192 (4%) Strand = Plus / Plus Query: 225 atgaggatgattccagttgagaaccatggagtgcgatgtatgtccatcgggtttcttgta 284 |||| ||||||||||||||||||| ||||||| ||| ||||| || || ||||||| Sbjct: 444 atgaagatgattccagttgagaactatggagttaaatgcatgtcaatgggacttcttgtt 503 Query: 285 gacaaagatgcaccaatcgtttggagaggt--------aatgagtgctcttgagaagatg 336 || |||||||||||| | || ||||||||| |||||||||||||| |||||| Sbjct: 504 gaaaaagatgcaccacttgtctggagaggtcctatggtaatgagtgctcttgctaagatg 563 Query: 337 acaaggggagtagcctggggtaatctggatgttcttgttgttgatatgccccccggcact 396 |||| ||||| | ||||| |||| ||| |||| |||||||||||||| || || || Sbjct: 564 acaaaaggagttgattggggagatcttgatattctcgttgttgatatgccacctggaacc 623 Query: 397 ggtgatgctcaa 408 |||||||||||| Sbjct: 624 ggtgatgctcaa 635 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 538 gtagagaacatgagttgcttc 558 ||||||||||||||||||||| Sbjct: 765 gtagagaacatgagttgcttc 785
>emb|AL161551.2|ATCHRIV51 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 51 Length = 197114 Score = 67.9 bits (34), Expect = 4e-08 Identities = 82/98 (83%) Strand = Plus / Plus Query: 311 aggtaatgagtgctcttgagaagatgacaaggggagtagcctggggtaatctggatgttc 370 |||||||||||||||||| |||||||||| ||||| | ||||| |||| ||| ||| Sbjct: 47974 aggtaatgagtgctcttgctaagatgacaaaaggagttgattggggagatcttgatattc 48033 Query: 371 ttgttgttgatatgccccccggcactggtgatgctcaa 408 | |||||||||||||| || || || |||||||||||| Sbjct: 48034 tcgttgttgatatgccacctggaaccggtgatgctcaa 48071 Score = 60.0 bits (30), Expect = 9e-06 Identities = 75/90 (83%) Strand = Plus / Plus Query: 225 atgaggatgattccagttgagaaccatggagtgcgatgtatgtccatcgggtttcttgta 284 |||| ||||||||||||||||||| ||||||| ||| ||||| || || ||||||| Sbjct: 47790 atgaagatgattccagttgagaactatggagttaaatgcatgtcaatgggacttcttgtt 47849 Query: 285 gacaaagatgcaccaatcgtttggagaggt 314 || |||||||||||| | || ||||||||| Sbjct: 47850 gaaaaagatgcaccacttgtctggagaggt 47879 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 538 gtagagaacatgagttgcttc 558 ||||||||||||||||||||| Sbjct: 48366 gtagagaacatgagttgcttc 48386
>emb|AL021768.1|ATF24J7 Arabidopsis thaliana DNA chromosome 4, BAC clone F24J7 (ESSA project) Length = 86554 Score = 67.9 bits (34), Expect = 4e-08 Identities = 82/98 (83%) Strand = Plus / Plus Query: 311 aggtaatgagtgctcttgagaagatgacaaggggagtagcctggggtaatctggatgttc 370 |||||||||||||||||| |||||||||| ||||| | ||||| |||| ||| ||| Sbjct: 50614 aggtaatgagtgctcttgctaagatgacaaaaggagttgattggggagatcttgatattc 50673 Query: 371 ttgttgttgatatgccccccggcactggtgatgctcaa 408 | |||||||||||||| || || || |||||||||||| Sbjct: 50674 tcgttgttgatatgccacctggaaccggtgatgctcaa 50711 Score = 60.0 bits (30), Expect = 9e-06 Identities = 75/90 (83%) Strand = Plus / Plus Query: 225 atgaggatgattccagttgagaaccatggagtgcgatgtatgtccatcgggtttcttgta 284 |||| ||||||||||||||||||| ||||||| ||| ||||| || || ||||||| Sbjct: 50430 atgaagatgattccagttgagaactatggagttaaatgcatgtcaatgggacttcttgtt 50489 Query: 285 gacaaagatgcaccaatcgtttggagaggt 314 || |||||||||||| | || ||||||||| Sbjct: 50490 gaaaaagatgcaccacttgtctggagaggt 50519 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 538 gtagagaacatgagttgcttc 558 ||||||||||||||||||||| Sbjct: 51006 gtagagaacatgagttgcttc 51026
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 67 gtcgcctcggggaaaggcggcgtcggcaagtccaccac 104 ||||||||||| || ||||||||||||||||||||||| Sbjct: 4151096 gtcgcctcgggcaagggcggcgtcggcaagtccaccac 4151133
>emb|CR685323.2|CNS0FRQV Tetraodon nigroviridis full-length cDNA Length = 1390 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 70 gcctcggggaaaggcggcgtcggcaagtccaccactgcagt 110 |||||||||||||| || ||||| ||||||||||||||||| Sbjct: 238 gcctcggggaaaggtggtgtcggaaagtccaccactgcagt 278
>emb|CR681871.2|CNS0FP2Z Tetraodon nigroviridis full-length cDNA Length = 1400 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 70 gcctcggggaaaggcggcgtcggcaagtccaccactgcagt 110 |||||||||||||| || ||||| ||||||||||||||||| Sbjct: 238 gcctcggggaaaggtggtgtcggaaagtccaccactgcagt 278
>emb|CR647266.2|CNS0EYEG Tetraodon nigroviridis full-length cDNA Length = 1399 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 70 gcctcggggaaaggcggcgtcggcaagtccaccactgcagt 110 |||||||||||||| || ||||| ||||||||||||||||| Sbjct: 228 gcctcggggaaaggtggtgtcggaaagtccaccactgcagt 268
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 67 gtcgcctcggggaaaggcggcgtcggcaagtccaccactgc 107 |||||||| || || |||||||||||||||||||||||||| Sbjct: 1267741 gtcgcctccggcaagggcggcgtcggcaagtccaccactgc 1267701
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 57 catcattgctgtcgcctcggggaaaggcggcgtcggcaagtccaccac 104 ||||||||| |||||||| || || ||||| ||||||||||||||||| Sbjct: 900250 catcattgccgtcgcctccggcaagggcggggtcggcaagtccaccac 900297
>gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome Length = 2153922 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 56 acatcattgctgtcgcctcggggaaaggcggcgtcggcaa 95 |||||||||| ||||||||||| ||||||||||| ||||| Sbjct: 57912 acatcattgccgtcgcctcgggaaaaggcggcgtgggcaa 57873
>gb|DQ118108.1| Sorghum bicolor plastid division regulator MinD mRNA, complete cds; nuclear gene for plastid product Length = 1121 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 71 cctcggggaaaggcggcgtcggcaagtccaccact 105 |||| ||||||||||||||||||||| |||||||| Sbjct: 278 cctccgggaaaggcggcgtcggcaagaccaccact 312
>emb|AL591785.1|SME591785 Sinorhizobium meliloti 1021 complete chromosome; segment 4/12 Length = 286550 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 67 gtcgcctcggggaaaggcggcgtcggcaagtccaccac 104 |||||||| || |||||||||||||||||||| ||||| Sbjct: 44256 gtcgcctccggtaaaggcggcgtcggcaagtcgaccac 44293
>emb|BX572599.1| Rhodopseudomonas palustris CGA009 complete genome; segment 7/16 Length = 349142 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 58 atcattgctgtcgcctcggggaaaggcggcgtcggcaagtccaccactgc 107 |||||||| || || ||||| ||||||||||||||||| || |||||||| Sbjct: 130678 atcattgcggtggcgtcgggcaaaggcggcgtcggcaaatcgaccactgc 130727
>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome Length = 2702173 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 59 tcattgctgtcgcctcggggaaaggcggcgtcggcaagtccaccac 104 ||||||| ||||| ||||| || ||||||||||| ||||||||||| Sbjct: 1562147 tcattgcggtcgcatcgggcaagggcggcgtcgggaagtccaccac 1562102
>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome Length = 2971517 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 56 acatcattgctgtcgcctcggggaaaggcggcgtcggcaagtccaccac 104 |||||||||| ||||| || || |||||||| ||||| ||||||||||| Sbjct: 1111965 acatcattgccgtcgcttccggcaaaggcggggtcgggaagtccaccac 1111917 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 56 acatcattgctgtcgcctcggggaaaggcggcgtcggcaagtccaccac 104 |||||||||| ||||| || || |||||||| ||||| ||||||||||| Sbjct: 968933 acatcattgccgtcgcttccggcaaaggcggggtcgggaagtccaccac 968885
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome Length = 2595221 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 56 acatcattgctgtcgcctcggggaaaggcggcgtcgg 92 ||||||| || |||||||| ||||||||||||||||| Sbjct: 1363063 acatcatcgcggtcgcctccgggaaaggcggcgtcgg 1363099
>gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome Length = 1842899 Score = 48.1 bits (24), Expect = 0.035 Identities = 33/36 (91%) Strand = Plus / Minus Query: 148 aaggttggtttgctagatgctgatatatatgggcca 183 |||||||| ||||| ||||||||||| ||||||||| Sbjct: 1092523 aaggttggcttgcttgatgctgatatttatgggcca 1092488
>gb|AE009786.1|AE009786 Pyrobaculum aerophilum strain IM2 section 41 of 201 of the complete genome Length = 10664 Score = 48.1 bits (24), Expect = 0.035 Identities = 27/28 (96%) Strand = Plus / Plus Query: 72 ctcggggaaaggcggcgtcggcaagtcc 99 |||||||||||| ||||||||||||||| Sbjct: 847 ctcggggaaaggaggcgtcggcaagtcc 874
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 48.1 bits (24), Expect = 0.035 Identities = 39/44 (88%) Strand = Plus / Plus Query: 70 gcctcggggaaaggcggcgtcggcaagtccaccactgcagttaa 113 |||||||| |||||||| ||||||||||| ||||| || ||||| Sbjct: 4317717 gcctcgggcaaaggcggtgtcggcaagtcgaccaccgccgttaa 4317760
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 48.1 bits (24), Expect = 0.035 Identities = 30/32 (93%) Strand = Plus / Minus Query: 67 gtcgcctcggggaaaggcggcgtcggcaagtc 98 ||||| |||||||||||||| ||||||||||| Sbjct: 48405 gtcgcttcggggaaaggcggggtcggcaagtc 48374
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 73 tcggggaaaggcggcgtcggcaagtccaccactgc 107 ||||| || |||||||| ||||||||||||||||| Sbjct: 3287479 tcgggcaagggcggcgtgggcaagtccaccactgc 3287445 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 78 gaaaggcggcgtcggcaagtccac 101 ||||||||||||||||||| |||| Sbjct: 4615505 gaaaggcggcgtcggcaagaccac 4615528
>ref|XM_723566.1| Plasmodium yoelii yoelii str. 17XNL polysaccharide export protein (PY07707) partial mRNA Length = 599 Score = 46.1 bits (23), Expect = 0.14 Identities = 41/47 (87%) Strand = Plus / Plus Query: 58 atcattgctgtcgcctcggggaaaggcggcgtcggcaagtccaccac 104 |||||||| ||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 127 atcattgccgtcgcttcgggcaaaggaggggtcggcaagtcgaccac 173
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 70 gcctcggggaaaggcggcgtcggcaagtccaccac 104 ||||| || |||||||||||||||||||| ||||| Sbjct: 2262057 gcctccggcaaaggcggcgtcggcaagtcgaccac 2262091 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 79 aaaggcggcgtcggcaagtccacca 103 ||||||||||||||||| ||||||| Sbjct: 5009254 aaaggcggcgtcggcaaatccacca 5009230 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 82 ggcggcgtcggcaagtccaccact 105 |||||| ||||||||||||||||| Sbjct: 4970050 ggcggcatcggcaagtccaccact 4970027
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome Length = 3304561 Score = 46.1 bits (23), Expect = 0.14 Identities = 41/47 (87%) Strand = Plus / Plus Query: 58 atcattgctgtcgcctcggggaaaggcggcgtcggcaagtccaccac 104 |||||||| ||||| ||||| ||||| || ||||||||||| ||||| Sbjct: 52733 atcattgccgtcgcttcgggcaaaggaggggtcggcaagtcgaccac 52779 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 79 aaaggcggcgtcggcaagtccaccac 104 ||||||||| |||||||||||||||| Sbjct: 226275 aaaggcggcatcggcaagtccaccac 226300 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 78 gaaaggcggcgtcggcaagtccacc 102 ||||||||||||||||||| ||||| Sbjct: 2533579 gaaaggcggcgtcggcaagaccacc 2533603
>gb|AE004769.1| Pseudomonas aeruginosa PAO1, section 330 of 529 of the complete genome Length = 13017 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 82 ggcggcgtcggcaagtccaccac 104 ||||||||||||||||||||||| Sbjct: 1680 ggcggcgtcggcaagtccaccac 1658
>ref|XM_781927.1| PREDICTED: Strongylocentrotus purpuratus similar to Protein C14orf127 (LOC581950), partial mRNA Length = 748 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 448 attgtttctactcctcaagatattgc 473 ||||||||||| |||||||||||||| Sbjct: 550 attgtttctacacctcaagatattgc 575
>emb|Z54207.1|HSNIFHDK H.seropedicae nifD, nifH and nifK genes Length = 4241 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 79 aaaggcggcgtcggcaagtccaccac 104 ||||||||| |||||||||||||||| Sbjct: 598 aaaggcggcatcggcaagtccaccac 623
>gb|AE011913.1| Xanthomonas axonopodis pv. citri str. 306, section 291 of 469 of the complete genome Length = 11331 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Minus Query: 82 ggcggcgtcggcaagtccaccactgc 107 |||||||| ||||||||||||||||| Sbjct: 7697 ggcggcgtgggcaagtccaccactgc 7672
>dbj|AB196476.1| Herbaspirillum sp. B501 nifH, nifD genes for nitrogenase iron protein, nitrogenase Mo-Fe protein alpha chain, complete and partial cds Length = 2855 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Plus Query: 79 aaaggcggcgtcggcaagtccaccac 104 ||||||||| |||||||||||||||| Sbjct: 688 aaaggcggcatcggcaagtccaccac 713
>gb|DQ073946.1| Herbaspirillum seropedicae strain S23 nitrogenase iron protein (nifH) gene, partial cds Length = 1027 Score = 44.1 bits (22), Expect = 0.54 Identities = 25/26 (96%) Strand = Plus / Minus Query: 79 aaaggcggcgtcggcaagtccaccac 104 ||||||||| |||||||||||||||| Sbjct: 441 aaaggcggcatcggcaagtccaccac 416
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 44.1 bits (22), Expect = 0.54 Identities = 34/38 (89%) Strand = Plus / Plus Query: 67 gtcgcctcggggaaaggcggcgtcggcaagtccaccac 104 ||||| ||||| || ||||||||||| ||||||||||| Sbjct: 948347 gtcgcgtcgggcaagggcggcgtcgggaagtccaccac 948384
>emb|AL672266.9| Mouse DNA sequence from clone RP23-342A10 on chromosome X, complete sequence Length = 216754 Score = 44.1 bits (22), Expect = 0.54 Identities = 22/22 (100%) Strand = Plus / Minus Query: 550 agttgcttcaagtgcccaaagt 571 |||||||||||||||||||||| Sbjct: 52258 agttgcttcaagtgcccaaagt 52237
>gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome Length = 3184243 Score = 44.1 bits (22), Expect = 0.54 Identities = 52/62 (83%) Strand = Plus / Minus Query: 58 atcattgctgtcgcctcggggaaaggcggcgtcggcaagtccaccactgcagttaacatt 117 |||||||| || ||||||||||| ||||| || ||||| ||| |||| ||||| ||| || Sbjct: 2261258 atcattgccgtggcctcggggaagggcggggtgggcaaatccgccacggcagtcaacctt 2261199 Query: 118 gc 119 || Sbjct: 2261198 gc 2261197
>ref|XM_527525.1| PREDICTED: Pan troglodytes similar to SNF2 histone linker PHD RING helicase (LOC472146), mRNA Length = 5052 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 540 agagaacatgagttgcttcaa 560 ||||||||||||||||||||| Sbjct: 4630 agagaacatgagttgcttcaa 4610
>ref|NM_001030326.2| Xenopus tropicalis ELAVL3 protein (ELAVL3), mRNA Length = 1786 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcaccaa 300 ||||||||||||||||||||| Sbjct: 956 ttgtagacaaagatgcaccaa 936
>ref|NM_173082.1| Homo sapiens SNF2 histone linker PHD RING helicase (SHPRH), mRNA Length = 7011 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 540 agagaacatgagttgcttcaa 560 ||||||||||||||||||||| Sbjct: 5211 agagaacatgagttgcttcaa 5191
>gb|AY098590.1| Burkholderia kururiensis strain KP23 NifH gene, partial cds Length = 392 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gggaaaggcggcgtcggcaagtccaccac 104 |||||||| ||| |||||||||||||||| Sbjct: 18 gggaaagggggcatcggcaagtccaccac 46
>gb|BC080177.1| Xenopus tropicalis cDNA clone IMAGE:7030070 Length = 2248 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcaccaa 300 ||||||||||||||||||||| Sbjct: 1277 ttgtagacaaagatgcaccaa 1257
>ref|XM_421229.1| PREDICTED: Gallus gallus similar to chromosome 14 open reading frame 127 (LOC423312), mRNA Length = 2053 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Plus Query: 151 gttggtttgctagatgctgatatatatgggccatccattcc 191 ||||||||||| ||||| || ||||||||||| || ||||| Sbjct: 322 gttggtttgcttgatgcagacatatatgggccttcaattcc 362
>ref|XM_856123.1| PREDICTED: Canis familiaris similar to SNF2 histone linker PHD RING helicase, transcript variant 3 (LOC476233), mRNA Length = 4728 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 540 agagaacatgagttgcttcaa 560 ||||||||||||||||||||| Sbjct: 4477 agagaacatgagttgcttcaa 4457
>ref|XM_533438.2| PREDICTED: Canis familiaris similar to SNF2 histone linker PHD RING helicase, transcript variant 1 (LOC476233), mRNA Length = 5058 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 540 agagaacatgagttgcttcaa 560 ||||||||||||||||||||| Sbjct: 4807 agagaacatgagttgcttcaa 4787
>gb|DQ127554.1| Emiliania huxleyi virus 163 clone combi46+47.seq partial sequence Length = 7421 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 364 gatgttcttgttgttgatatg 384 ||||||||||||||||||||| Sbjct: 2032 gatgttcttgttgttgatatg 2052
>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome Length = 4406967 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 84 cggcgtcggcaagtccaccac 104 ||||||||||||||||||||| Sbjct: 2901837 cggcgtcggcaagtccaccac 2901857
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 83 gcggcgtcggcaagtccaccactgc 107 |||||||||||||| |||||||||| Sbjct: 103305 gcggcgtcggcaagaccaccactgc 103281
>emb|AL356599.19| Human DNA sequence from clone RP11-545I5 on chromosome 6 Contains the gene for a novel protein similar to KIAA1195, a novel gene, the 3' end of the gene for a novel protein similar to S. pombe Rad8 and a CpG island, complete sequence Length = 108299 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 540 agagaacatgagttgcttcaa 560 ||||||||||||||||||||| Sbjct: 98222 agagaacatgagttgcttcaa 98242
>gb|AY161136.1| Homo sapiens SNF2 histone linker PHD RING helicase (SHPRH) gene, complete cds Length = 6018 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 540 agagaacatgagttgcttcaa 560 ||||||||||||||||||||| Sbjct: 5152 agagaacatgagttgcttcaa 5132
>ref|XM_777941.1| PREDICTED: Strongylocentrotus purpuratus similar to translocase of outer mitochondrial membrane 34 (LOC577729), mRNA Length = 1809 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 554 gcttcaagtgcccaaagtgtg 574 ||||||||||||||||||||| Sbjct: 1154 gcttcaagtgcccaaagtgtg 1174
>emb|BX572600.1| Rhodopseudomonas palustris CGA009 complete genome; segment 8/16 Length = 349640 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 76 gggaaaggcggcgtcggcaagtccaccac 104 ||||||||||| |||||||||||||||| Sbjct: 225829 gggaaaggcgggatcggcaagtccaccac 225801
>emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segment 6/7 Length = 349122 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 72 ctcggggaaaggcggcgtcggcaagtccaccac 104 |||||| || ||||||||||||||| ||||||| Sbjct: 142104 ctcgggcaagggcggcgtcggcaagaccaccac 142136
>emb|CR860833.1| Pongo pygmaeus mRNA; cDNA DKFZp469J2414 (from clone DKFZp469J2414) Length = 3921 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 596 gagaaggtggagcccagagaa 616 ||||||||||||||||||||| Sbjct: 25 gagaaggtggagcccagagaa 45
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 78 gaaaggcggcgtcggcaagtccaccactgcagt 110 ||||||||||||||||||| |||| || ||||| Sbjct: 511469 gaaaggcggcgtcggcaagaccacgaccgcagt 511437 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 61 attgctgtcgcctcggggaaaggcggcgtcggcaagtccaccac 104 ||||| || |||||||| || ||||| || |||||||||||||| Sbjct: 3517752 attgcggtggcctcgggcaagggcggggtgggcaagtccaccac 3517709
>dbj|AK126959.1| Homo sapiens cDNA FLJ45012 fis, clone BRAWH3013264 Length = 4592 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 540 agagaacatgagttgcttcaa 560 ||||||||||||||||||||| Sbjct: 2465 agagaacatgagttgcttcaa 2445
>dbj|AK094944.1| Homo sapiens cDNA FLJ37625 fis, clone BRCOC2014400, weakly similar to DNA REPAIR PROTEIN RAD8 Length = 2335 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 540 agagaacatgagttgcttcaa 560 ||||||||||||||||||||| Sbjct: 208 agagaacatgagttgcttcaa 188
>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 Length = 1824958 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 466 gatattgctctaattgatgct 486 ||||||||||||||||||||| Sbjct: 1154851 gatattgctctaattgatgct 1154871
>gb|DQ284983.1| Rhizobium sp. NCHA22 NifH (nifH) gene, partial cds Length = 800 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 76 gggaaaggcggcgtcggcaagtccaccac 104 ||||||||||| |||||||||||||||| Sbjct: 16 gggaaaggcggtatcggcaagtccaccac 44
>emb|BX950795.2| Gallus gallus finished cDNA, clone ChEST716l24 Length = 1601 Score = 42.1 bits (21), Expect = 2.2 Identities = 36/41 (87%) Strand = Plus / Plus Query: 151 gttggtttgctagatgctgatatatatgggccatccattcc 191 ||||||||||| ||||| || ||||||||||| || ||||| Sbjct: 611 gttggtttgcttgatgcagacatatatgggccttcaattcc 651
>gb|AY163808.1| Homo sapiens helicase-like protein mRNA, complete cds Length = 7011 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 540 agagaacatgagttgcttcaa 560 ||||||||||||||||||||| Sbjct: 5211 agagaacatgagttgcttcaa 5191
>emb|BX648322.1|HSM808470 Homo sapiens mRNA; cDNA DKFZp686E02163 (from clone DKFZp686E02163) Length = 6529 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 540 agagaacatgagttgcttcaa 560 ||||||||||||||||||||| Sbjct: 4332 agagaacatgagttgcttcaa 4312
>emb|CR761704.2| Xenopus tropicalis finished cDNA, clone TGas116i13 Length = 1786 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcaccaa 300 ||||||||||||||||||||| Sbjct: 956 ttgtagacaaagatgcaccaa 936
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Minus Query: 78 gaaaggcggcgtcggcaagtccaccactgcagt 110 ||||||||||||||||||| |||| || ||||| Sbjct: 523613 gaaaggcggcgtcggcaagaccacgaccgcagt 523581 Score = 40.1 bits (20), Expect = 8.5 Identities = 38/44 (86%) Strand = Plus / Minus Query: 61 attgctgtcgcctcggggaaaggcggcgtcggcaagtccaccac 104 ||||| || |||||||| || ||||| || |||||||||||||| Sbjct: 3513271 attgcggtggcctcgggcaagggcggggtgggcaagtccaccac 3513228
>emb|AJ890364.1| Emiliania huxleyi virus 86 isolate EhV86 Length = 407339 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 364 gatgttcttgttgttgatatg 384 ||||||||||||||||||||| Sbjct: 76962 gatgttcttgttgttgatatg 76982
>emb|AL833521.1|HSM804834 Homo sapiens mRNA; cDNA DKFZp686G0637 (from clone DKFZp686G0637) Length = 2973 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 540 agagaacatgagttgcttcaa 560 ||||||||||||||||||||| Sbjct: 1175 agagaacatgagttgcttcaa 1155
>gb|U17598.1|XLU17598 Xenopus laevis ribonucleoprotein (elrC) mRNA, complete cds Length = 1783 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcaccaa 300 ||||||||||||||||||||| Sbjct: 1289 ttgtagacaaagatgcaccaa 1269
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 40.1 bits (20), Expect = 8.5 Identities = 32/36 (88%) Strand = Plus / Plus Query: 67 gtcgcctcggggaaaggcggcgtcggcaagtccacc 102 ||||||||||| || |||||||| ||||| |||||| Sbjct: 1920807 gtcgcctcgggcaagggcggcgtgggcaaatccacc 1920842
>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome Length = 4222334 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 aaaggcggcgtcggcaagtc 98 |||||||||||||||||||| Sbjct: 155116 aaaggcggcgtcggcaagtc 155135
>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence Length = 2107794 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 ggcggcgtcggcaagtccac 101 |||||||||||||||||||| Sbjct: 63861 ggcggcgtcggcaagtccac 63880
>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome Length = 4222645 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 aaaggcggcgtcggcaagtc 98 |||||||||||||||||||| Sbjct: 154924 aaaggcggcgtcggcaagtc 154943
>ref|XM_956943.1| Neurospora crassa OR74A hypothetical protein (NCU08825.1) partial mRNA Length = 1035 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 ggcggcgtcggcaagtccac 101 |||||||||||||||||||| Sbjct: 259 ggcggcgtcggcaagtccac 278
>ref|XM_330941.1| Neurospora crassa OR74A hypothetical protein (NCU08825.1) partial mRNA Length = 1035 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 ggcggcgtcggcaagtccac 101 |||||||||||||||||||| Sbjct: 259 ggcggcgtcggcaagtccac 278
>ref|XM_875359.1| PREDICTED: Bos taurus similar to ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD) (Hu-antigen D), transcript variant 13 (LOC535408), mRNA Length = 3962 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1115 ttgtagacaaagatgcacca 1096
>ref|XM_875285.1| PREDICTED: Bos taurus similar to ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD) (Hu-antigen D), transcript variant 12 (LOC535408), mRNA Length = 3775 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 942 ttgtagacaaagatgcacca 923
>ref|XM_875214.1| PREDICTED: Bos taurus similar to ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD) (Hu-antigen D), transcript variant 11 (LOC535408), mRNA Length = 3947 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1114 ttgtagacaaagatgcacca 1095
>ref|XM_865099.1| PREDICTED: Bos taurus similar to ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD) (Hu-antigen D), transcript variant 2 (LOC535408), mRNA Length = 4028 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1195 ttgtagacaaagatgcacca 1176
>ref|XM_875075.1| PREDICTED: Bos taurus similar to ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD) (Hu-antigen D), transcript variant 10 (LOC535408), mRNA Length = 4019 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1186 ttgtagacaaagatgcacca 1167
>ref|XM_874989.1| PREDICTED: Bos taurus similar to ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD) (Hu-antigen D), transcript variant 9 (LOC535408), mRNA Length = 4058 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1225 ttgtagacaaagatgcacca 1206
>ref|XM_615488.2| PREDICTED: Bos taurus similar to ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD) (Hu-antigen D), transcript variant 1 (LOC535408), mRNA Length = 3961 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1128 ttgtagacaaagatgcacca 1109
>ref|XM_874833.1| PREDICTED: Bos taurus similar to ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD) (Hu-antigen D), transcript variant 8 (LOC535408), mRNA Length = 3950 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1117 ttgtagacaaagatgcacca 1098
>ref|XM_874743.1| PREDICTED: Bos taurus similar to ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD) (Hu-antigen D), transcript variant 7 (LOC535408), mRNA Length = 3959 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1126 ttgtagacaaagatgcacca 1107
>ref|XM_874658.1| PREDICTED: Bos taurus similar to ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD) (Hu-antigen D), transcript variant 6 (LOC535408), mRNA Length = 3986 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1153 ttgtagacaaagatgcacca 1134
>ref|XM_874412.1| PREDICTED: Bos taurus similar to ELAV-like protein 4 (Paraneoplastic encephalomyelitis antigen HuD) (Hu-antigen D), transcript variant 3 (LOC535408), mRNA Length = 3813 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 980 ttgtagacaaagatgcacca 961
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome Length = 5928787 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 73 tcggggaaaggcggcgtcggcaagtccaccac 104 ||||| || ||||| ||||||||||||||||| Sbjct: 1601105 tcgggcaagggcggtgtcggcaagtccaccac 1601136
>gb|AC117610.7| Mus musculus chromosome 1, clone RP23-102B12, complete sequence Length = 191587 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 488 gaagaggagcaaacatgttt 507 |||||||||||||||||||| Sbjct: 26421 gaagaggagcaaacatgttt 26440
>gb|AC147066.2| Pan troglodytes BAC clone RP43-164F2 from 7, complete sequence Length = 149431 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 397 ggtgatgctcaactatcaat 416 |||||||||||||||||||| Sbjct: 10303 ggtgatgctcaactatcaat 10284
>gb|AC146512.2| Pan troglodytes BAC clone RP43-16E21 from 7, complete sequence Length = 178648 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 397 ggtgatgctcaactatcaat 416 |||||||||||||||||||| Sbjct: 174197 ggtgatgctcaactatcaat 174216
>ref|XM_855320.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 17 (LOC475361), mRNA Length = 4020 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1153 ttgtagacaaagatgcacca 1134
>ref|XM_855281.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 16 (LOC475361), mRNA Length = 3981 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1114 ttgtagacaaagatgcacca 1095
>ref|XM_532585.2| PREDICTED: Canis familiaris similar to HUD3, transcript variant 1 (LOC475361), mRNA Length = 3809 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 942 ttgtagacaaagatgcacca 923
>ref|XM_844876.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 3 (LOC475361), mRNA Length = 4062 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1195 ttgtagacaaagatgcacca 1176
>ref|XM_855179.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 15 (LOC475361), mRNA Length = 4004 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1137 ttgtagacaaagatgcacca 1118
>ref|XM_855143.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 14 (LOC475361), mRNA Length = 4029 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1162 ttgtagacaaagatgcacca 1143
>ref|XM_855114.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 13 (LOC475361), mRNA Length = 3889 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1022 ttgtagacaaagatgcacca 1003
>ref|XM_855083.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 12 (LOC475361), mRNA Length = 3993 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1126 ttgtagacaaagatgcacca 1107
>ref|XM_855040.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 11 (LOC475361), mRNA Length = 3984 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1117 ttgtagacaaagatgcacca 1098
>ref|XM_855005.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 10 (LOC475361), mRNA Length = 4002 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1135 ttgtagacaaagatgcacca 1116
>ref|XM_854972.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 9 (LOC475361), mRNA Length = 3850 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 983 ttgtagacaaagatgcacca 964
>ref|XM_854932.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 8 (LOC475361), mRNA Length = 3853 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 986 ttgtagacaaagatgcacca 967
>ref|XM_854894.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 7 (LOC475361), mRNA Length = 3859 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 992 ttgtagacaaagatgcacca 973
>ref|XM_854856.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 6 (LOC475361), mRNA Length = 3950 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1083 ttgtagacaaagatgcacca 1064
>ref|XM_854825.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 5 (LOC475361), mRNA Length = 4006 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1124 ttgtagacaaagatgcacca 1105
>ref|XM_854786.1| PREDICTED: Canis familiaris similar to HUD3, transcript variant 4 (LOC475361), mRNA Length = 3847 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 980 ttgtagacaaagatgcacca 961
>gb|AC006332.3| Homo sapiens BAC clone RP11-376O14 from 7, complete sequence Length = 153477 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 397 ggtgatgctcaactatcaat 416 |||||||||||||||||||| Sbjct: 144522 ggtgatgctcaactatcaat 144541
>gb|AC146185.2| Pan troglodytes BAC clone RP43-35O6 from 7, complete sequence Length = 156598 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 397 ggtgatgctcaactatcaat 416 |||||||||||||||||||| Sbjct: 141542 ggtgatgctcaactatcaat 141523
>emb|AL592182.6| Human DNA sequence from clone RP11-567C20 on chromosome 1 Contains the 3' end of the ELAVL4 gene for ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 ((Hu antigen D) and two novel genes, complete sequence Length = 112873 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 38692 ttgtagacaaagatgcacca 38673
>ref|NM_021952.2| Homo sapiens ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), mRNA Length = 1591 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1132 ttgtagacaaagatgcacca 1113
>emb|CR555308.1| Azoarcus sp. EbN1 plasmid 2 Length = 223670 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 gggaaaggcggcgtcggcaa 95 |||||||||||||||||||| Sbjct: 59202 gggaaaggcggcgtcggcaa 59221
>gb|BC036071.1| Homo sapiens ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D), mRNA (cDNA clone MGC:33705 IMAGE:5286347), complete cds Length = 3951 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1094 ttgtagacaaagatgcacca 1075
>emb|AL162753.2|NMA2Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment 2/7 Length = 349061 Score = 40.1 bits (20), Expect = 8.5 Identities = 35/40 (87%) Strand = Plus / Minus Query: 56 acatcattgctgtcgcctcggggaaaggcggcgtcggcaa 95 ||||||| || |||||||| || ||||||||||| ||||| Sbjct: 248150 acatcatcgccgtcgcctctggcaaaggcggcgtgggcaa 248111
>emb|AJ297913.2|PPI297913 Plasmid pIPO2T, complete sequence Length = 45319 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 79 aaaggcggcgtcggcaagtc 98 |||||||||||||||||||| Sbjct: 8525 aaaggcggcgtcggcaagtc 8544
>gb|AY033998.1| Homo sapiens HUDPRO1 mRNA, complete cds Length = 1591 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1132 ttgtagacaaagatgcacca 1113
>gb|AY033997.1| Homo sapiens HUD1 mRNA, complete cds Length = 1582 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1123 ttgtagacaaagatgcacca 1104
>gb|AY033996.1| Homo sapiens HUD4 mRNA, complete cds Length = 1415 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 959 ttgtagacaaagatgcacca 940
>gb|AY033995.1| Homo sapiens HUD3 mRNA, complete cds Length = 1406 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 948 ttgtagacaaagatgcacca 929
>emb|CR625475.1| full-length cDNA clone CS0DD001YC24 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 907 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 514 ttgtagacaaagatgcacca 495
>emb|CR613627.1| full-length cDNA clone CS0DD003YD17 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 1467 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1093 ttgtagacaaagatgcacca 1074
>emb|CR595508.1| full-length cDNA clone CS0DC005YB08 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 1326 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 923 ttgtagacaaagatgcacca 904
>gb|AE012506.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 414 of 460 of the complete genome Length = 10939 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 78 gaaaggcggcgtcggcaagtccac 101 ||||||||||||||||||| |||| Sbjct: 824 gaaaggcggcgtcggcaagaccac 847
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 78 gaaaggcggcgtcggcaagtccac 101 ||||||||||||||||||| |||| Sbjct: 4646917 gaaaggcggcgtcggcaagaccac 4646940
>gb|AE002098.2| Neisseria meningitidis MC58, complete genome Length = 2272360 Score = 40.1 bits (20), Expect = 8.5 Identities = 35/40 (87%) Strand = Plus / Plus Query: 56 acatcattgctgtcgcctcggggaaaggcggcgtcggcaa 95 ||||||| || ||||| ||||| ||||||||||| ||||| Sbjct: 1945362 acatcatcgccgtcgcatcgggaaaaggcggcgtgggcaa 1945401
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 83 gcggcgtcggcaagtccacc 102 |||||||||||||||||||| Sbjct: 7112592 gcggcgtcggcaagtccacc 7112611
>dbj|AB201192.1| Microhyla rubra mitochondrial gene for 16S rRNA, partial sequence Length = 863 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 584 cttacatttttggagaaggt 603 |||||||||||||||||||| Sbjct: 140 cttacatttttggagaaggt 121
>gb|AE009622.1| Brucella melitensis 16M chromosome I, section 179 of 195 of the complete sequence Length = 14598 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 ggcggcgtcggcaagtccac 101 |||||||||||||||||||| Sbjct: 4823 ggcggcgtcggcaagtccac 4804
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 67 gtcgcctcggggaaaggcggcgtcggcaagtc 98 |||||||| || || ||||||||||||||||| Sbjct: 3885329 gtcgcctccggcaagggcggcgtcggcaagtc 3885360
>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence Length = 2124241 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 ggcggcgtcggcaagtccac 101 |||||||||||||||||||| Sbjct: 63505 ggcggcgtcggcaagtccac 63524
>dbj|AP004756.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0592C05 Length = 150478 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 83 gcggcgtcggcaagtccacc 102 |||||||||||||||||||| Sbjct: 64671 gcggcgtcggcaagtccacc 64690
>gb|AE005043.1| Halobacterium sp. NRC-1 section 74 of 170 of the complete genome Length = 11677 Score = 40.1 bits (20), Expect = 8.5 Identities = 35/40 (87%) Strand = Plus / Minus Query: 62 ttgctgtcgcctcggggaaaggcggcgtcggcaagtccac 101 |||| |||||||| || ||||| || |||||||||||||| Sbjct: 4146 ttgcggtcgcctccggcaaaggtggggtcggcaagtccac 4107
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 78 gaaaggcggcgtcggcaagtccac 101 ||||||||||||||||||| |||| Sbjct: 2808891 gaaaggcggcgtcggcaagaccac 2808868
>gb|AC155274.2| Mus musculus BAC clone RP23-55F17 from 12, complete sequence Length = 127447 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 347 tagcctggggtaatctggat 366 |||||||||||||||||||| Sbjct: 65456 tagcctggggtaatctggat 65437
>emb|AL929220.13| Zebrafish DNA sequence from clone DKEY-65B13 in linkage group 20, complete sequence Length = 227539 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 cccaaagtgtggtgagaagt 583 |||||||||||||||||||| Sbjct: 183419 cccaaagtgtggtgagaagt 183400
>gb|U62986.1|PFU62986 Pseudomonas fragi cold acclimation protein B (capB) and ATPase genes, complete cds Length = 2154 Score = 40.1 bits (20), Expect = 8.5 Identities = 35/40 (87%) Strand = Plus / Minus Query: 70 gcctcggggaaaggcggcgtcggcaagtccaccactgcag 109 |||||||| ||||||||||| || || |||||||| |||| Sbjct: 1910 gcctcgggcaaaggcggcgtgggtaaatccaccacggcag 1871
>emb|AL928855.7| Mouse DNA sequence from clone RP23-452C10 on chromosome 2, complete sequence Length = 196567 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 566 caaagtgtggtgagaagtct 585 |||||||||||||||||||| Sbjct: 35886 caaagtgtggtgagaagtct 35867
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome Length = 7215267 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 379 gatatgccccccggcactgg 398 |||||||||||||||||||| Sbjct: 1932110 gatatgccccccggcactgg 1932129
>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain 2308 Length = 2121359 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 ggcggcgtcggcaagtccac 101 |||||||||||||||||||| Sbjct: 59906 ggcggcgtcggcaagtccac 59925
>gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete genome Length = 2056416 Score = 40.1 bits (20), Expect = 8.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 78 gaaaggcggcgtcggcaagtccac 101 ||||||||||||||||||| |||| Sbjct: 1995255 gaaaggcggcgtcggcaagaccac 1995278
>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome Length = 2256640 Score = 40.1 bits (20), Expect = 8.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 68 tcgcctcggggaaaggcggcgtcggcaagtcc 99 ||||||| || || |||||||||||||||||| Sbjct: 70193 tcgcctccggtaagggcggcgtcggcaagtcc 70224
>gb|M62843.1|HUMBRAINPR Human brain protein recognized by the sera of patients with paraneoplastic sensory neuronopathy mRNA, complete cds Length = 1441 Score = 40.1 bits (20), Expect = 8.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 280 ttgtagacaaagatgcacca 299 |||||||||||||||||||| Sbjct: 1002 ttgtagacaaagatgcacca 983 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,338,079 Number of Sequences: 3902068 Number of extensions: 5338079 Number of successful extensions: 127834 Number of sequences better than 10.0: 142 Number of HSP's better than 10.0 without gapping: 143 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 126751 Number of HSP's gapped (non-prelim): 1079 length of query: 624 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 601 effective length of database: 17,143,297,704 effective search space: 10303121920104 effective search space used: 10303121920104 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
