ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd22i14
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK109401.2| Oryza sativa (japonica cultivar-group) cDNA clon... 297 2e-77
2dbj|AK062620.1| Oryza sativa (japonica cultivar-group) cDNA clon... 291 1e-75
3ref|XM_474067.1| Oryza sativa (japonica cultivar-group), predic... 283 3e-73
4gb|AY108401.1| Zea mays PCO068228 mRNA sequence 270 4e-69
5gb|BT016343.1| Zea mays clone Contig176 mRNA sequence 262 1e-66
6gb|AY105883.1| Zea mays PCO068227 mRNA sequence 260 4e-66
7emb|AL731607.3|OSJN00250 Oryza sativa genomic DNA, chromosome 4,... 129 1e-26
8emb|AL606455.3|OSJN00015 Oryza sativa genomic DNA, chromosome 4,... 129 1e-26
9dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
10emb|AL732339.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 129 1e-26
11emb|AL442112.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 129 1e-26
12emb|AJ293489.1|SHY293489 Saccharum hybrid cultivar R570 microsat... 94 6e-16
13dbj|AK059892.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
14emb|CR376839.12| Zebrafish DNA sequence from clone DKEY-75G22 in... 44 0.46
15emb|AL034380.26|HS50O24 Human DNA sequence from clone RP1-50O24 ... 44 0.46
16emb|BX572093.1| Prochlorococcus marinus MED4 complete genome; se... 44 0.46
17gb|AC004873.3| Homo sapiens PAC clone RP4-742P4 from 1, complete... 44 0.46
18ref|XM_517941.1| PREDICTED: Pan troglodytes similar to Ptx1 (LOC... 42 1.8
19gb|AC161193.3| Mus musculus chromosome 8, clone RP23-308L22, com... 42 1.8
20gb|AC112964.8| Mus musculus chromosome 8, clone RP24-82M4, compl... 42 1.8
21gb|AC161375.4| Mus musculus BAC clone RP23-297A22 from chromosom... 42 1.8
22gb|AC154528.2| Mus musculus BAC clone RP23-460I18 from chromosom... 42 1.8
23gb|AY521556.1| Cancer magister clone Cma8b microsatellite sequence 42 1.8
24ref|XM_868038.1| PREDICTED: Bos taurus similar to gamma-aminobut... 42 1.8
25gb|AC135409.3| Rattus norvegicus 8 BAC CH230-416D7 (Children's H... 42 1.8
26gb|AY466214.1| Litopenaeus vannamei microsatellite TUMXLV7.107 s... 42 1.8
27gb|AC129016.4| Mus musculus BAC clone RP24-389J11 from chromosom... 42 1.8
28gb|AC068138.6| Homo sapiens BAC clone RP11-813K12 from 2, comple... 42 1.8
29gb|AC154517.2| Mus musculus BAC clone RP24-85L11 from chromosome... 42 1.8
30gb|AC079193.10| Homo sapiens chromosome 8, clone RP11-468H14, co... 42 1.8
31ref|XM_216230.3| PREDICTED: Rattus norvegicus RAD52 homolog (S. ... 42 1.8
32gb|U58105.1|MMU58105 Mus musculus Btk locus, alpha-D-galactosida... 42 1.8
33gb|AC091050.3| Homo sapiens chromosome 8, clone RP11-242F4, comp... 42 1.8
34gb|AC153537.4| Mus musculus 10 BAC RP23-283A2 (Roswell Park Canc... 42 1.8
35dbj|AP006207.1| Homo sapiens genomic DNA, chromosome 8, clone:RP... 42 1.8
36gb|AC145207.2| Homo sapiens chromosome 17, clone RP11-498C9, com... 42 1.8
37emb|CT030238.7| Mouse DNA sequence from clone RP23-428E20 on chr... 42 1.8
38dbj|D31781.1|TRUGTGPLAD Trimeresurus gramineus gTgPLA2-V gene fo... 42 1.8
39dbj|D31779.1|TRUGTGPLAB Trimeresurus gramineus gTgPLA6a gene for... 42 1.8
40dbj|AB020859.1| Homo sapiens genomic DNA of 8p21.3-p22 anti-onco... 42 1.8
41emb|AL807392.7| Mouse DNA sequence from clone RP23-104D24 on chr... 42 1.8
42gb|AC160028.9| Mus musculus 10 BAC RP24-570M12 (Roswell Park Can... 40 7.2
43gb|AC118472.8| Mus musculus chromosome 19, clone RP23-187N14, co... 40 7.2
44gb|AC124779.4| Mus musculus BAC clone RP23-100O18 from chromosom... 40 7.2
45ref|XM_655987.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 7.2
46gb|CP000051.1| Chlamydia trachomatis A/HAR-13, complete genome 40 7.2
47gb|AC079957.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 7.2
48gb|AC124676.7| Mus musculus chromosome 6, clone RP24-93M1, compl... 40 7.2
49gb|AC165370.4| Mus musculus BAC clone RP23-2N3 from chromosome 1... 40 7.2
50gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 7.2
51gb|AC165425.2| Mus musculus BAC clone RP23-252G18 from chromosom... 40 7.2
52gb|AC118704.17| Mus musculus chromosome 13, clone RP24-114K21, c... 40 7.2
53gb|AC132402.3| Mus musculus BAC clone RP23-404I24 from chromosom... 40 7.2
54emb|BX957236.8| Zebrafish DNA sequence from clone DKEY-178O3 in ... 40 7.2
55emb|CR956384.6| Pig DNA sequence from clone CH242-132L9 on chrom... 40 7.2
56ref|XM_849034.1| PREDICTED: Canis familiaris similar to Retinol ... 40 7.2
57gb|AC158771.2| Mus musculus chromosome 15, clone RP23-450E19, co... 40 7.2
58emb|AL133270.24| Human DNA sequence from clone RP4-810F7 on chro... 40 7.2
59emb|X52175.1|CTL2DNAK Chlamydia trachomatis L2 dnaK like gene 40 7.2
60gb|AC156039.4| Mus musculus BAC clone RP23-24C2 from chromosome ... 40 7.2
61emb|AL646051.19| Mouse DNA sequence from clone RP23-222M22 on ch... 40 7.2
62emb|AL645522.12| Mouse DNA sequence from clone RP23-64E17 on chr... 40 7.2
63gb|AC015961.16| Homo sapiens chromosome 18, clone RP11-95O2, com... 40 7.2
64gb|AC149225.18| Danio rerio clone ch211-103f17, complete sequence 40 7.2
65gb|AC008087.11| Homo sapiens chromosome 17, clone RP5-1127L24, c... 40 7.2
66gb|AC114648.25| Mus musculus chromosome 8, clone RP24-144H17, co... 40 7.2
67gb|AC012236.12| Homo sapiens chromosome 15, clone RP11-16E12, co... 40 7.2
68gb|AC008406.7| Homo sapiens chromosome 5 clone CTC-276P9, comple... 40 7.2
69gb|AF442820.1|AF442820 Mus musculus strain 129/SvJ endothelial a... 40 7.2
70gb|AF387548.1|AF387548 Mus musculus strain ICR endothelial and s... 40 7.2
71dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.2
72dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.2
73dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.2
74gb|AC137875.13| Mus musculus chromosome 15, clone RP23-62B15, co... 40 7.2
75gb|AC090386.13| Homo sapiens chromosome 18, clone RP11-797E24, c... 40 7.2
76gb|AC155655.8| Mus musculus 6 BAC RP24-66L18 (Roswell Park Cance... 40 7.2
77gb|AC087793.17| Homo sapiens chromosome 8, clone RP5-1118A7, com... 40 7.2
78gb|AC024952.4|AC024952 Homo sapiens chromosome 7 clone RP11-66F2... 40 7.2
79gb|AC138696.4| Homo sapiens chromosome 8, clone RP13-582O9, comp... 40 7.2
80gb|AC123767.2| Homo sapiens chromosome 8, clone RP11-122L4, comp... 40 7.2
81gb|AC074091.6| Homo sapiens BAC clone RP11-158I13 from 2, comple... 40 7.2
82gb|AC019172.4| Homo sapiens BAC clone RP11-178E6 from 2, complet... 40 7.2
83gb|AC027455.22| Homo sapiens chromosome 17, clone RP11-411G7, co... 40 7.2
84gb|AC104259.14| Homo sapiens chromosome 15, clone CTD-2525I4, co... 40 7.2
85gb|AC002504.1| Homo sapiens X PAC RP1-258N20 (Roswell Park Cance... 40 7.2
86gb|AC107225.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.2
87gb|AE001273.1| Chlamydia trachomatis D/UW-3/CX, complete genome 40 7.2
88dbj|AP002093.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.2
89dbj|AK024438.1| Homo sapiens mRNA for FLJ00028 protein, partial cds 40 7.2
90gb|AC006445.11|AC006445 Homo sapiens chromosome 4 clone C0367I21... 40 7.2
91dbj|AP001006.5| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 7.2
92dbj|AP005854.3| Homo sapiens genomic DNA, chromosome 8q24, clone... 40 7.2
93dbj|AP000797.6| Homo sapiens genomic DNA, chromosome 11 clone:CM... 40 7.2
94dbj|AB017651.2| Homo sapiens genomic DNA, chromosome 11q23.2, cl... 40 7.2
95emb|CT027564.7| Mouse DNA sequence from clone RP24-293N14 on chr... 40 7.2
96gb|L22180.1|CHTHSPR Chlamydia trachomatis 82 kDa protein gene, 5... 40 7.2
97gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 7.2
98emb|AL731890.2|CNS08C8U Oryza sativa chromosome 12, . BAC OJ1563... 40 7.2
99gb|AC133944.4| Mus musculus BAC clone RP24-113L10 from 10, compl... 40 7.2
100emb|AL596108.13| Mouse DNA sequence from clone RP23-326K2 on chr... 40 7.2
101gb|AC013489.17| Homo sapiens chromosome 15, clone RP11-97O12, co... 40 7.2
102gb|M27580.1|CHTOMP3D Chlamydia trachomatis 75 kD membrane protei... 40 7.2
103dbj|AP005272.2| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 7.2
104dbj|AP001999.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 7.2 
>dbj|AK109401.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-G01, full
           insert sequence
          Length = 1113

 Score =  297 bits (150), Expect = 2e-77
 Identities = 270/310 (87%)
 Strand = Plus / Plus

                                                                       
Query: 214 ggggaatcatgagcggaacagggtacactgtggaagtcactaacctgtcaagcagcgcgt 273
           ||||||||||||| || || || ||||| || ||||| ||||||||||||||||| || |
Sbjct: 101 ggggaatcatgagtggtacgggatacacagttgaagttactaacctgtcaagcagggcat 160

                                                                       
Query: 274 ctgaaaatgatcttcatgagttcttctcattctctggacctattgagcatatagacctta 333
           |||||| |||||||||||||||||| |||||||||||| | |||||||||||||| ||||
Sbjct: 161 ctgaaagtgatcttcatgagttcttttcattctctggagcgattgagcatatagaactta 220

                                                                       
Query: 334 tcagatcaggaggatatggttcaactgcttatgtgactttcaaggaaccctatgccttgg 393
           |||||||||||| ||||||||| |||||||||||||| ||||||||||||||| ||||||
Sbjct: 221 tcagatcaggagaatatggttctactgcttatgtgacattcaaggaaccctattccttgg 280

                                                                       
Query: 394 aaactgcagtattgttgagtggggctaccattgtggatcagccggtgtgcatatctcgtt 453
           |||||||||||||| | ||||||||||| |||||||||||||| || || ||| |||| |
Sbjct: 281 aaactgcagtattgctcagtggggctactattgtggatcagccagtttgtatagctcgct 340

                                                                       
Query: 454 ggggacagcctgatgagcctagtaatttctgggacaggccaacttggcaggtcgaggagg 513
           ||||||||||| |||| ||    |||||||||||||  |||| |||| |    |||||||
Sbjct: 341 ggggacagcctaatgaaccatacaatttctgggacacaccaaattggtatacagaggagg 400

                     
Query: 514 aaattgaata 523
           ||||||||||
Sbjct: 401 aaattgaata 410
to top
>dbj|AK062620.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-105-B07, full
           insert sequence
          Length = 479

 Score =  291 bits (147), Expect = 1e-75
 Identities = 267/307 (86%)
 Strand = Plus / Plus

                                                                       
Query: 217 gaatcatgagcggaacagggtacactgtggaagtcactaacctgtcaagcagcgcgtctg 276
           |||||||||| || || || ||||| || ||||| ||||||||||||||||| || ||||
Sbjct: 108 gaatcatgagtggtacgggatacacagttgaagttactaacctgtcaagcagggcatctg 167

                                                                       
Query: 277 aaaatgatcttcatgagttcttctcattctctggacctattgagcatatagaccttatca 336
           ||| |||||||||||||||||| |||||||||||| | |||||||||||||| |||||||
Sbjct: 168 aaagtgatcttcatgagttcttttcattctctggagcgattgagcatatagaacttatca 227

                                                                       
Query: 337 gatcaggaggatatggttcaactgcttatgtgactttcaaggaaccctatgccttggaaa 396
           ||||||||| ||||||||| |||||||||||||| ||||||||||||||| |||||||||
Sbjct: 228 gatcaggagaatatggttctactgcttatgtgacattcaaggaaccctattccttggaaa 287

                                                                       
Query: 397 ctgcagtattgttgagtggggctaccattgtggatcagccggtgtgcatatctcgttggg 456
           ||||||||||| | ||||||||||| |||||||||||||| || || ||| |||| ||||
Sbjct: 288 ctgcagtattgctcagtggggctactattgtggatcagccagtttgtatagctcgctggg 347

                                                                       
Query: 457 gacagcctgatgagcctagtaatttctgggacaggccaacttggcaggtcgaggaggaaa 516
           |||||||| |||| ||    |||||||||||||  |||| |||| |    ||||||||||
Sbjct: 348 gacagcctaatgaaccatacaatttctgggacacaccaaattggtatacagaggaggaaa 407

                  
Query: 517 ttgaata 523
           |||||||
Sbjct: 408 ttgaata 414
to top
>ref|XM_474067.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 756

 Score =  283 bits (143), Expect = 3e-73
 Identities = 251/287 (87%)
 Strand = Plus / Plus

                                                                       
Query: 237 tacactgtggaagtcactaacctgtcaagcagcgcgtctgaaaatgatcttcatgagttc 296
           ||||| || ||||| ||||||||||||||||| || ||||||| ||||||||||||||||
Sbjct: 16  tacacagttgaagttactaacctgtcaagcagggcatctgaaagtgatcttcatgagttc 75

                                                                       
Query: 297 ttctcattctctggacctattgagcatatagaccttatcagatcaggaggatatggttca 356
           || |||||||||||| | |||||||||||||| |||||||||||||||| ||||||||| 
Sbjct: 76  ttttcattctctggagcgattgagcatatagaacttatcagatcaggagaatatggttct 135

                                                                       
Query: 357 actgcttatgtgactttcaaggaaccctatgccttggaaactgcagtattgttgagtggg 416
           |||||||||||||| ||||||||||||||| |||||||||||||||||||| | ||||||
Sbjct: 136 actgcttatgtgacattcaaggaaccctattccttggaaactgcagtattgctcagtggg 195

                                                                       
Query: 417 gctaccattgtggatcagccggtgtgcatatctcgttggggacagcctgatgagcctagt 476
           ||||| |||||||||||||| || || ||| |||| |||||||||||| |||| ||    
Sbjct: 196 gctactattgtggatcagccagtttgtatagctcgctggggacagcctaatgaaccatac 255

                                                          
Query: 477 aatttctgggacaggccaacttggcaggtcgaggaggaaattgaata 523
           |||||||||||||  |||| |||| |    |||||||||||||||||
Sbjct: 256 aatttctgggacacaccaaattggtatacagaggaggaaattgaata 302
to top
>gb|AY108401.1| Zea mays PCO068228 mRNA sequence
          Length = 1376

 Score =  270 bits (136), Expect = 4e-69
 Identities = 265/308 (86%)
 Strand = Plus / Plus

                                                                       
Query: 216 ggaatcatgagcggaacagggtacactgtggaagtcactaacctgtcaagcagcgcgtct 275
           ||||| ||||| | ||||||| |||||||  ||||||||||||| || ||||| |  |||
Sbjct: 342 ggaattatgagtgaaacagggcacactgtacaagtcactaacctctcgagcagagtatct 401

                                                                       
Query: 276 gaaaatgatcttcatgagttcttctcattctctggacctattgagcatatagaccttatc 335
           |||| |||||||||||||||||| || |||||||| ||||||||||||||||| ||||||
Sbjct: 402 gaaagtgatcttcatgagttcttttcgttctctggtcctattgagcatatagaacttatc 461

                                                                       
Query: 336 agatcaggaggatatggttcaactgcttatgtgactttcaaggaaccctatgccttggaa 395
           ||||||| |||||| ||| | |||||||||||||| |||||||||| || ||||||||||
Sbjct: 462 agatcagaaggatacggtgccactgcttatgtgacattcaaggaacgctttgccttggaa 521

                                                                       
Query: 396 actgcagtattgttgagtggggctaccattgtggatcagccggtgtgcatatctcgttgg 455
           |||||||||||| | ||||||||||| |||||||||||||| || |||||| |   ||||
Sbjct: 522 actgcagtattgctcagtggggctactattgtggatcagccagtatgcataacctattgg 581

                                                                       
Query: 456 ggacagcctgatgagcctagtaatttctgggacaggccaacttggcaggtcgaggaggaa 515
           ||||| ||||| |   ||  ||||||||||||||||||||||||| |||| || ||||||
Sbjct: 582 ggacaacctgagggaacttttaatttctgggacaggccaacttgggaggttgaagaggaa 641

                   
Query: 516 attgaata 523
           || |||||
Sbjct: 642 atcgaata 649
to top
>gb|BT016343.1| Zea mays clone Contig176 mRNA sequence
          Length = 1045

 Score =  262 bits (132), Expect = 1e-66
 Identities = 264/308 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 ggaatcatgagcggaacagggtacactgtggaagtcactaacctgtcaagcagcgcgtct 275
           ||||| ||||| | ||||||| |||||||  ||||||||||||| || ||||| |  |||
Sbjct: 942 ggaattatgagtgaaacagggcacactgtacaagtcactaacctctcgagcagagtatct 883

                                                                       
Query: 276 gaaaatgatcttcatgagttcttctcattctctggacctattgagcatatagaccttatc 335
           |||| |||||||||||||||||| || |||||||| |||||| |||||||||| ||||||
Sbjct: 882 gaaagtgatcttcatgagttcttttcgttctctggtcctattcagcatatagaacttatc 823

                                                                       
Query: 336 agatcaggaggatatggttcaactgcttatgtgactttcaaggaaccctatgccttggaa 395
           ||||||| |||||| ||| | |||||||||||||| |||||||||| || ||||||||||
Sbjct: 822 agatcagaaggatacggtgccactgcttatgtgacattcaaggaacgctttgccttggaa 763

                                                                       
Query: 396 actgcagtattgttgagtggggctaccattgtggatcagccggtgtgcatatctcgttgg 455
           |||||||||||| | ||||||||||| |||||||||||||| || |||||| |   ||||
Sbjct: 762 actgcagtattgctcagtggggctactattgtggatcagccagtatgcataacctattgg 703

                                                                       
Query: 456 ggacagcctgatgagcctagtaatttctgggacaggccaacttggcaggtcgaggaggaa 515
           ||||| ||||| |   ||  ||||||||||||||||||||||||| |||| || ||||||
Sbjct: 702 ggacaacctgagggaacttttaatttctgggacaggccaacttgggaggttgaagaggaa 643

                   
Query: 516 attgaata 523
           || |||||
Sbjct: 642 atcgaata 635
to top
>gb|AY105883.1| Zea mays PCO068227 mRNA sequence
          Length = 1236

 Score =  260 bits (131), Expect = 4e-66
 Identities = 260/303 (85%)
 Strand = Plus / Plus

                                                                       
Query: 221 catgagcggaacagggtacactgtggaagtcactaacctgtcaagcagcgcgtctgaaaa 280
           |||||| | ||||||| |||||||  ||||||||||||| || ||||| |  ||||||| 
Sbjct: 271 catgagtgaaacagggcacactgtacaagtcactaacctctcgagcagagtatctgaaag 330

                                                                       
Query: 281 tgatcttcatgagttcttctcattctctggacctattgagcatatagaccttatcagatc 340
           ||||||| |||||||||| || |||||||| |||||||| ||| | || |||||||||||
Sbjct: 331 tgatctttatgagttcttttcgttctctggccctattgaacatgttgaacttatcagatc 390

                                                                       
Query: 341 aggaggatatggttcaactgcttatgtgactttcaaggaaccctatgccttggaaactgc 400
           ||||| ||| ||| | |||||||||||||| |||||||| | || |||||||||||||||
Sbjct: 391 aggagaatacggtgctactgcttatgtgacattcaaggagcgctttgccttggaaactgc 450

                                                                       
Query: 401 agtattgttgagtggggctaccattgtggatcagccggtgtgcatatctcgttggggaca 460
            |||||| | ||||||||||| ||||||||||||||||| |||||| ||  |||||||||
Sbjct: 451 ggtattgctcagtggggctactattgtggatcagccggtatgcataacttattggggaca 510

                                                                       
Query: 461 gcctgatgagcctagtaatttctgggacaggccaacttggcaggtcgaggaggaaattga 520
            ||||| ||| ||  ||||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 511 acctgaggagacttttaatttctgggacaggccaacttgggaggttgaagaggaaattga 570

              
Query: 521 ata 523
           |||
Sbjct: 571 ata 573
to top
>emb|AL731607.3|OSJN00250 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0063C18,
             complete sequence
          Length = 150416

 Score =  129 bits (65), Expect = 1e-26
 Identities = 107/121 (88%)
 Strand = Plus / Minus

                                                                         
Query: 217   gaatcatgagcggaacagggtacactgtggaagtcactaacctgtcaagcagcgcgtctg 276
             |||||||||| || || || ||||| || ||||| ||||||||||||||||| || ||||
Sbjct: 29779 gaatcatgagtggtacgggatacacagttgaagttactaacctgtcaagcagggcatctg 29720

                                                                         
Query: 277   aaaatgatcttcatgagttcttctcattctctggacctattgagcatatagaccttatca 336
             ||| |||||||||||||||||| |||||||||||| | |||||||||||||| |||||||
Sbjct: 29719 aaagtgatcttcatgagttcttttcattctctggagcgattgagcatatagaacttatca 29660

              
Query: 337   g 337
             |
Sbjct: 29659 g 29659



 Score =  113 bits (57), Expect = 6e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                         
Query: 335   cagatcaggaggatatggttcaactgcttatgtgactttcaaggaaccctatgccttgga 394
             ||||||||||| ||||||||| |||||||||||||| ||||||||||||||| |||||||
Sbjct: 29322 cagatcaggagaatatggttctactgcttatgtgacattcaaggaaccctattccttgga 29263

                          
Query: 395   aactgcagtattg 407
             |||||||||||||
Sbjct: 29262 aactgcagtattg 29250



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                         
Query: 414   ggggctaccattgtggatcagccggtgtgcatatctcgttggggacagcctgatgagcct 473
             |||||||| |||||||||||||| || || ||| |||| |||||||||||| |||| || 
Sbjct: 28438 ggggctactattgtggatcagccagtttgtatagctcgctggggacagcctaatgaacca 28379

                                                                    
Query: 474   agtaatttctgggacaggccaacttggcaggtcgaggaggaaattgaatataggg 528
                |||||||||||||  |||| |||| |    ||||||||||||||||| ||||
Sbjct: 28378 tacaatttctgggacacaccaaattggtatacagaggaggaaattgaatacaggg 28324
to top
>emb|AL606455.3|OSJN00015 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0079B02,
             complete sequence
          Length = 126659

 Score =  129 bits (65), Expect = 1e-26
 Identities = 107/121 (88%)
 Strand = Plus / Minus

                                                                         
Query: 217   gaatcatgagcggaacagggtacactgtggaagtcactaacctgtcaagcagcgcgtctg 276
             |||||||||| || || || ||||| || ||||| ||||||||||||||||| || ||||
Sbjct: 65365 gaatcatgagtggtacgggatacacagttgaagttactaacctgtcaagcagggcatctg 65306

                                                                         
Query: 277   aaaatgatcttcatgagttcttctcattctctggacctattgagcatatagaccttatca 336
             ||| |||||||||||||||||| |||||||||||| | |||||||||||||| |||||||
Sbjct: 65305 aaagtgatcttcatgagttcttttcattctctggagcgattgagcatatagaacttatca 65246

              
Query: 337   g 337
             |
Sbjct: 65245 g 65245



 Score =  113 bits (57), Expect = 6e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                         
Query: 335   cagatcaggaggatatggttcaactgcttatgtgactttcaaggaaccctatgccttgga 394
             ||||||||||| ||||||||| |||||||||||||| ||||||||||||||| |||||||
Sbjct: 64908 cagatcaggagaatatggttctactgcttatgtgacattcaaggaaccctattccttgga 64849

                          
Query: 395   aactgcagtattg 407
             |||||||||||||
Sbjct: 64848 aactgcagtattg 64836



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                         
Query: 414   ggggctaccattgtggatcagccggtgtgcatatctcgttggggacagcctgatgagcct 473
             |||||||| |||||||||||||| || || ||| |||| |||||||||||| |||| || 
Sbjct: 64024 ggggctactattgtggatcagccagtttgtatagctcgctggggacagcctaatgaacca 63965

                                                                    
Query: 474   agtaatttctgggacaggccaacttggcaggtcgaggaggaaattgaatataggg 528
                |||||||||||||  |||| |||| |    ||||||||||||||||| ||||
Sbjct: 63964 tacaatttctgggacacaccaaattggtatacagaggaggaaattgaatacaggg 63910
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  129 bits (65), Expect = 1e-26
 Identities = 107/121 (88%)
 Strand = Plus / Minus

                                                                            
Query: 217      gaatcatgagcggaacagggtacactgtggaagtcactaacctgtcaagcagcgcgtctg 276
                |||||||||| || || || ||||| || ||||| ||||||||||||||||| || ||||
Sbjct: 32670344 gaatcatgagtggtacgggatacacagttgaagttactaacctgtcaagcagggcatctg 32670285

                                                                            
Query: 277      aaaatgatcttcatgagttcttctcattctctggacctattgagcatatagaccttatca 336
                ||| |||||||||||||||||| |||||||||||| | |||||||||||||| |||||||
Sbjct: 32670284 aaagtgatcttcatgagttcttttcattctctggagcgattgagcatatagaacttatca 32670225

                 
Query: 337      g 337
                |
Sbjct: 32670224 g 32670224



 Score =  113 bits (57), Expect = 6e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                            
Query: 335      cagatcaggaggatatggttcaactgcttatgtgactttcaaggaaccctatgccttgga 394
                ||||||||||| ||||||||| |||||||||||||| ||||||||||||||| |||||||
Sbjct: 32669887 cagatcaggagaatatggttctactgcttatgtgacattcaaggaaccctattccttgga 32669828

                             
Query: 395      aactgcagtattg 407
                |||||||||||||
Sbjct: 32669827 aactgcagtattg 32669815



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                            
Query: 414      ggggctaccattgtggatcagccggtgtgcatatctcgttggggacagcctgatgagcct 473
                |||||||| |||||||||||||| || || ||| |||| |||||||||||| |||| || 
Sbjct: 32669003 ggggctactattgtggatcagccagtttgtatagctcgctggggacagcctaatgaacca 32668944

                                                                       
Query: 474      agtaatttctgggacaggccaacttggcaggtcgaggaggaaattgaatataggg 528
                   |||||||||||||  |||| |||| |    ||||||||||||||||| ||||
Sbjct: 32668943 tacaatttctgggacacaccaaattggtatacagaggaggaaattgaatacaggg 32668889
to top
>emb|AL732339.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: B0414F07, complete
             sequence
          Length = 50928

 Score =  129 bits (65), Expect = 1e-26
 Identities = 107/121 (88%)
 Strand = Plus / Minus

                                                                         
Query: 217   gaatcatgagcggaacagggtacactgtggaagtcactaacctgtcaagcagcgcgtctg 276
             |||||||||| || || || ||||| || ||||| ||||||||||||||||| || ||||
Sbjct: 47626 gaatcatgagtggtacgggatacacagttgaagttactaacctgtcaagcagggcatctg 47567

                                                                         
Query: 277   aaaatgatcttcatgagttcttctcattctctggacctattgagcatatagaccttatca 336
             ||| |||||||||||||||||| |||||||||||| | |||||||||||||| |||||||
Sbjct: 47566 aaagtgatcttcatgagttcttttcattctctggagcgattgagcatatagaacttatca 47507

              
Query: 337   g 337
             |
Sbjct: 47506 g 47506



 Score =  113 bits (57), Expect = 6e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                         
Query: 335   cagatcaggaggatatggttcaactgcttatgtgactttcaaggaaccctatgccttgga 394
             ||||||||||| ||||||||| |||||||||||||| ||||||||||||||| |||||||
Sbjct: 47169 cagatcaggagaatatggttctactgcttatgtgacattcaaggaaccctattccttgga 47110

                          
Query: 395   aactgcagtattg 407
             |||||||||||||
Sbjct: 47109 aactgcagtattg 47097



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                         
Query: 414   ggggctaccattgtggatcagccggtgtgcatatctcgttggggacagcctgatgagcct 473
             |||||||| |||||||||||||| || || ||| |||| |||||||||||| |||| || 
Sbjct: 46285 ggggctactattgtggatcagccagtttgtatagctcgctggggacagcctaatgaacca 46226

                                                                    
Query: 474   agtaatttctgggacaggccaacttggcaggtcgaggaggaaattgaatataggg 528
                |||||||||||||  |||| |||| |    ||||||||||||||||| ||||
Sbjct: 46225 tacaatttctgggacacaccaaattggtatacagaggaggaaattgaatacaggg 46171
to top
>emb|AL442112.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0423H10, complete
             sequence
          Length = 76529

 Score =  129 bits (65), Expect = 1e-26
 Identities = 107/121 (88%)
 Strand = Plus / Minus

                                                                         
Query: 217   gaatcatgagcggaacagggtacactgtggaagtcactaacctgtcaagcagcgcgtctg 276
             |||||||||| || || || ||||| || ||||| ||||||||||||||||| || ||||
Sbjct: 11108 gaatcatgagtggtacgggatacacagttgaagttactaacctgtcaagcagggcatctg 11049

                                                                         
Query: 277   aaaatgatcttcatgagttcttctcattctctggacctattgagcatatagaccttatca 336
             ||| |||||||||||||||||| |||||||||||| | |||||||||||||| |||||||
Sbjct: 11048 aaagtgatcttcatgagttcttttcattctctggagcgattgagcatatagaacttatca 10989

              
Query: 337   g 337
             |
Sbjct: 10988 g 10988



 Score =  113 bits (57), Expect = 6e-22
 Identities = 69/73 (94%)
 Strand = Plus / Minus

                                                                         
Query: 335   cagatcaggaggatatggttcaactgcttatgtgactttcaaggaaccctatgccttgga 394
             ||||||||||| ||||||||| |||||||||||||| ||||||||||||||| |||||||
Sbjct: 10651 cagatcaggagaatatggttctactgcttatgtgacattcaaggaaccctattccttgga 10592

                          
Query: 395   aactgcagtattg 407
             |||||||||||||
Sbjct: 10591 aactgcagtattg 10579



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                        
Query: 414  ggggctaccattgtggatcagccggtgtgcatatctcgttggggacagcctgatgagcct 473
            |||||||| |||||||||||||| || || ||| |||| |||||||||||| |||| || 
Sbjct: 9767 ggggctactattgtggatcagccagtttgtatagctcgctggggacagcctaatgaacca 9708

                                                                   
Query: 474  agtaatttctgggacaggccaacttggcaggtcgaggaggaaattgaatataggg 528
               |||||||||||||  |||| |||| |    ||||||||||||||||| ||||
Sbjct: 9707 tacaatttctgggacacaccaaattggtatacagaggaggaaattgaatacaggg 9653
to top
>emb|AJ293489.1|SHY293489 Saccharum hybrid cultivar R570 microsatellite DNA, clone mSSCIR17
          Length = 403

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 80/91 (87%)
 Strand = Plus / Minus

                                                                       
Query: 247 aagtcactaacctgtcaagcagcgcgtctgaaaatgatcttcatgagttcttctcattct 306
           ||||||||||||| || ||||| |  ||||||| |||||||||||||||||| || ||||
Sbjct: 400 aagtcactaacctctcgagcagagtatctgaaagtgatcttcatgagttcttttcgttct 341

                                          
Query: 307 ctggacctattgagcatatagaccttatcag 337
           |||| ||||||||||| ||||| ||||||||
Sbjct: 340 ctggtcctattgagcacatagaacttatcag 310
to top
>dbj|AK059892.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-D10, full
           insert sequence
          Length = 927

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 411 agtggggctaccattgtggatcagccggtgtgcatatctcgttggggacagcctgatgag 470
           ||||||||||| |||||||||||||| || || ||| |||| |||||||||||| |||| 
Sbjct: 1   agtggggctactattgtggatcagccagtttgtatagctcgctggggacagcctaatgaa 60

                                                                
Query: 471 cctagtaatttctgggacaggccaacttggcaggtcgaggaggaaattgaata 523
           ||    |||||||||||||  |||| |||| |    |||||||||||||||||
Sbjct: 61  ccatacaatttctgggacacaccaaattggtatacagaggaggaaattgaata 113
to top
>emb|CR376839.12| Zebrafish DNA sequence from clone DKEY-75G22 in linkage group 2,
             complete sequence
          Length = 127371

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 91    tggcaacacccagacccaccgc 112
             ||||||||||||||||||||||
Sbjct: 18282 tggcaacacccagacccaccgc 18261
to top
>emb|AL034380.26|HS50O24 Human DNA sequence from clone RP1-50O24 on chromosome 1p35.1-35.3
             Contains the 3' end of the SMARCF1 gene for SWI/SNF
             related, matrix associated, actin dependent regulator of
             chromatin (subfamily f, member 1), a novel gene
             (FLJ20477), the ZDHHC18 gene for zinc finger, DHHC domain
             containing 18, the SFN gene for stratifin, two novel
             genes, a novel gene (FLJ10349), the 3' end of a novel gene
             (FLJ12455) and two CpG islands, complete sequence
          Length = 157435

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 181   gcagggagggagggagggcgag 202
             ||||||||||||||||||||||
Sbjct: 62355 gcagggagggagggagggcgag 62334
to top
>emb|BX572093.1| Prochlorococcus marinus MED4 complete genome; segment 4/5
          Length = 348986

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 323    tatagaccttatcagatcagga 344
              ||||||||||||||||||||||
Sbjct: 104615 tatagaccttatcagatcagga 104636
to top
>gb|AC004873.3| Homo sapiens PAC clone RP4-742P4 from 1, complete sequence
          Length = 131329

 Score = 44.1 bits (22), Expect = 0.46
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 181   gcagggagggagggagggcgag 202
             ||||||||||||||||||||||
Sbjct: 19945 gcagggagggagggagggcgag 19966
to top
>ref|XM_517941.1| PREDICTED: Pan troglodytes similar to Ptx1 (LOC462072), mRNA
          Length = 1736

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 178 tctgcagggagggagggaggg 198
           |||||||||||||||||||||
Sbjct: 665 tctgcagggagggagggaggg 685
to top
>gb|AC161193.3| Mus musculus chromosome 8, clone RP23-308L22, complete sequence
          Length = 177860

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   tctgcagggagggagggaggg 198
             |||||||||||||||||||||
Sbjct: 36975 tctgcagggagggagggaggg 36995
to top
>gb|AC112964.8| Mus musculus chromosome 8, clone RP24-82M4, complete sequence
          Length = 193076

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   tctgcagggagggagggaggg 198
             |||||||||||||||||||||
Sbjct: 88938 tctgcagggagggagggaggg 88958
to top
>gb|AC161375.4| Mus musculus BAC clone RP23-297A22 from chromosome 14, complete sequence
          Length = 211662

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 183    agggagggagggagggcgaga 203
              |||||||||||||||||||||
Sbjct: 123919 agggagggagggagggcgaga 123939
to top
>gb|AC154528.2| Mus musculus BAC clone RP23-460I18 from chromosome 14, complete sequence
          Length = 207430

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 183    agggagggagggagggcgaga 203
              |||||||||||||||||||||
Sbjct: 206102 agggagggagggagggcgaga 206082
to top
>gb|AY521556.1| Cancer magister clone Cma8b microsatellite sequence
          Length = 272

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 agggagggagggagggcgaga 203
           |||||||||||||||||||||
Sbjct: 93  agggagggagggagggcgaga 73
to top
>ref|XM_868038.1| PREDICTED: Bos taurus similar to gamma-aminobutyric acid (GABA-A)
            transporter 4 (LOC616071), partial mRNA
          Length = 1233

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 140  gcgaggagcaggaggagggac 160
            |||||||||||||||||||||
Sbjct: 1183 gcgaggagcaggaggagggac 1163
to top
>gb|AC135409.3| Rattus norvegicus 8 BAC CH230-416D7 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 231716

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 183    agggagggagggagggcgaga 203
              |||||||||||||||||||||
Sbjct: 197708 agggagggagggagggcgaga 197728
to top
>gb|AY466214.1| Litopenaeus vannamei microsatellite TUMXLV7.107 sequence
          Length = 416

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 187 agggagggagggcgagaccgc 207
           |||||||||||||||||||||
Sbjct: 59  agggagggagggcgagaccgc 39
to top
>gb|AC129016.4| Mus musculus BAC clone RP24-389J11 from chromosome 10, complete
            sequence
          Length = 160180

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 183  agggagggagggagggcgagaccgcgaga 211
            |||||||||||||||| ||||||| ||||
Sbjct: 1767 agggagggagggagggagagaccgagaga 1739
to top
>gb|AC068138.6| Homo sapiens BAC clone RP11-813K12 from 2, complete sequence
          Length = 168698

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 183   agggagggagggagggcgaga 203
             |||||||||||||||||||||
Sbjct: 52576 agggagggagggagggcgaga 52596
to top
>gb|AC154517.2| Mus musculus BAC clone RP24-85L11 from chromosome 12, complete sequence
          Length = 167631

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 183    agggagggagggagggcgaga 203
              |||||||||||||||||||||
Sbjct: 119979 agggagggagggagggcgaga 119999
to top
>gb|AC079193.10| Homo sapiens chromosome 8, clone RP11-468H14, complete sequence
          Length = 169041

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 286    ttcatgagttcttctcattctctgg 310
              |||||||||||||||| ||||||||
Sbjct: 149865 ttcatgagttcttctccttctctgg 149841
to top
>ref|XM_216230.3| PREDICTED: Rattus norvegicus RAD52 homolog (S. cerevisiae)
            (predicted) (Rad52_predicted), mRNA
          Length = 1999

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 174  gcactctgcagggagggagggaggg 198
            |||||||| ||||||||||||||||
Sbjct: 1973 gcactctgaagggagggagggaggg 1949
to top
>gb|U58105.1|MMU58105 Mus musculus Btk locus, alpha-D-galactosidase A (Ags), ribosomal
            protein (L44L), and Bruton's tyrosine kinase (Btk) genes,
            complete cds
          Length = 88871

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 183  agggagggagggagggcgaga 203
            |||||||||||||||||||||
Sbjct: 4000 agggagggagggagggcgaga 4020
to top
>gb|AC091050.3| Homo sapiens chromosome 8, clone RP11-242F4, complete sequence
          Length = 139980

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 286   ttcatgagttcttctcattctctgg 310
             |||||||||||||||| ||||||||
Sbjct: 86172 ttcatgagttcttctccttctctgg 86196
to top
>gb|AC153537.4| Mus musculus 10 BAC RP23-283A2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 221267

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 183    agggagggagggagggcgagaccgcgaga 211
              |||||||||||||||| ||||||| ||||
Sbjct: 150169 agggagggagggagggagagaccgagaga 150141
to top
>dbj|AP006207.1| Homo sapiens genomic DNA, chromosome 8, clone:RP11-702B3, complete
              sequence
          Length = 170015

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 286    ttcatgagttcttctcattctctgg 310
              |||||||||||||||| ||||||||
Sbjct: 119187 ttcatgagttcttctccttctctgg 119163
to top
>gb|AC145207.2| Homo sapiens chromosome 17, clone RP11-498C9, complete sequence
          Length = 182848

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 182   cagggagggagggagggcgag 202
             |||||||||||||||||||||
Sbjct: 18931 cagggagggagggagggcgag 18951
to top
>emb|CT030238.7| Mouse DNA sequence from clone RP23-428E20 on chromosome 14, complete
              sequence
          Length = 194408

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 183    agggagggagggagggcgaga 203
              |||||||||||||||||||||
Sbjct: 180941 agggagggagggagggcgaga 180961
to top
>dbj|D31781.1|TRUGTGPLAD Trimeresurus gramineus gTgPLA2-V gene for phospholipase A2, complete
            cds (exon1-4)
          Length = 2828

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 179  ctgcagggagggagggagggcgaga 203
            |||||||||||||||||||| ||||
Sbjct: 1431 ctgcagggagggagggagggagaga 1407
to top
>dbj|D31779.1|TRUGTGPLAB Trimeresurus gramineus gTgPLA6a gene for phospholipase A2, complete
            cds (exon1-4)
          Length = 3571

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 179  ctgcagggagggagggagggcgaga 203
            |||||||||||||||||||| ||||
Sbjct: 1668 ctgcagggagggagggagggagaga 1644
to top
>dbj|AB020859.1| Homo sapiens genomic DNA of 8p21.3-p22 anti-oncogene of hepatocellular
             colorectal and non-small cell lung cancer , segment 2/11
          Length = 100000

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 286   ttcatgagttcttctcattctctgg 310
             |||||||||||||||| ||||||||
Sbjct: 80092 ttcatgagttcttctccttctctgg 80068
to top
>emb|AL807392.7| Mouse DNA sequence from clone RP23-104D24 on chromosome 4, complete
             sequence
          Length = 132773

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 183   agggagggagggagggcgaga 203
             |||||||||||||||||||||
Sbjct: 76293 agggagggagggagggcgaga 76273
to top
>gb|AC160028.9| Mus musculus 10 BAC RP24-570M12 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 223055

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 179    ctgcagggagggagggaggg 198
              ||||||||||||||||||||
Sbjct: 153802 ctgcagggagggagggaggg 153783
to top
>gb|AC118472.8| Mus musculus chromosome 19, clone RP23-187N14, complete sequence
          Length = 222869

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 179    ctgcagggagggagggaggg 198
              ||||||||||||||||||||
Sbjct: 172974 ctgcagggagggagggaggg 172993
to top
>gb|AC124779.4| Mus musculus BAC clone RP23-100O18 from chromosome 6, complete sequence
          Length = 197482

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   ctgcagggagggagggaggg 198
             ||||||||||||||||||||
Sbjct: 71648 ctgcagggagggagggaggg 71629
to top
>ref|XM_655987.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3475.2), mRNA
          Length = 2283

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 141 cgaggagcaggaggagggac 160
           ||||||||||||||||||||
Sbjct: 462 cgaggagcaggaggagggac 481
to top
>gb|CP000051.1| Chlamydia trachomatis A/HAR-13, complete genome
          Length = 1044459

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    ggccgcgaggagcaggagga 155
              ||||||||||||||||||||
Sbjct: 455368 ggccgcgaggagcaggagga 455349
to top
>gb|AC079957.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-144I17, complete
              sequence
          Length = 196474

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 183    agggagggagggagggcgag 202
              ||||||||||||||||||||
Sbjct: 189236 agggagggagggagggcgag 189255
to top
>gb|AC124676.7| Mus musculus chromosome 6, clone RP24-93M1, complete sequence
          Length = 212789

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 183    agggagggagggagggcgag 202
              ||||||||||||||||||||
Sbjct: 100540 agggagggagggagggcgag 100521
to top
>gb|AC165370.4| Mus musculus BAC clone RP23-2N3 from chromosome 10, complete sequence
          Length = 219653

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 183    agggagggagggagggcgag 202
              ||||||||||||||||||||
Sbjct: 172217 agggagggagggagggcgag 172198
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 139     cgcgaggagcaggaggaggg 158
               ||||||||||||||||||||
Sbjct: 3584188 cgcgaggagcaggaggaggg 3584207
to top
>gb|AC165425.2| Mus musculus BAC clone RP23-252G18 from chromosome 9, complete sequence
          Length = 217329

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 179    ctgcagggagggagggaggg 198
              ||||||||||||||||||||
Sbjct: 112879 ctgcagggagggagggaggg 112860
to top
>gb|AC118704.17| Mus musculus chromosome 13, clone RP24-114K21, complete sequence
          Length = 197574

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 183    agggagggagggagggcgag 202
              ||||||||||||||||||||
Sbjct: 181231 agggagggagggagggcgag 181250
to top
>gb|AC132402.3| Mus musculus BAC clone RP23-404I24 from chromosome 19, complete sequence
          Length = 217490

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 183    agggagggagggagggcgag 202
              ||||||||||||||||||||
Sbjct: 135705 agggagggagggagggcgag 135724
to top
>emb|BX957236.8| Zebrafish DNA sequence from clone DKEY-178O3 in linkage group 6,
             complete sequence
          Length = 211391

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 292   agttcttctcattctctgga 311
             ||||||||||||||||||||
Sbjct: 16628 agttcttctcattctctgga 16647
to top
>emb|CR956384.6| Pig DNA sequence from clone CH242-132L9 on chromosome 17, complete
             sequence
          Length = 71546

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   ctgcagggagggagggaggg 198
             ||||||||||||||||||||
Sbjct: 55440 ctgcagggagggagggaggg 55421
to top
>ref|XM_849034.1| PREDICTED: Canis familiaris similar to Retinol dehydrogenase 13
          (LOC611373), mRNA
          Length = 1005

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                      
Query: 39 cggcgcggcggtgggtggtgccgtgctg 66
          |||| ||||||||||||| |||||||||
Sbjct: 33 cggcacggcggtgggtggcgccgtgctg 60
to top
>gb|AC158771.2| Mus musculus chromosome 15, clone RP23-450E19, complete sequence
          Length = 199600

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 183    agggagggagggagggcgag 202
              ||||||||||||||||||||
Sbjct: 146189 agggagggagggagggcgag 146208
to top
>emb|AL133270.24| Human DNA sequence from clone RP4-810F7 on chromosome 6 Contains a
             ferritin pseudogene, complete sequence
          Length = 87789

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   agggagggagggagggcgag 202
             ||||||||||||||||||||
Sbjct: 22455 agggagggagggagggcgag 22474
to top
>emb|X52175.1|CTL2DNAK Chlamydia trachomatis L2 dnaK like gene
          Length = 2340

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 136  ggccgcgaggagcaggagga 155
            ||||||||||||||||||||
Sbjct: 1606 ggccgcgaggagcaggagga 1587
to top
>gb|AC156039.4| Mus musculus BAC clone RP23-24C2 from chromosome 10, complete sequence
          Length = 206634

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 183    agggagggagggagggcgag 202
              ||||||||||||||||||||
Sbjct: 106892 agggagggagggagggcgag 106873
to top
>emb|AL646051.19| Mouse DNA sequence from clone RP23-222M22 on chromosome 11 Contains the
             5' end of the Hs3st3a gene for heparan sulfate
             (glucosamine) 3-O-sulfotransferase 3A and a CpG island,
             complete sequence
          Length = 144847

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   agggagggagggagggcgag 202
             ||||||||||||||||||||
Sbjct: 62552 agggagggagggagggcgag 62533
to top
>emb|AL645522.12| Mouse DNA sequence from clone RP23-64E17 on chromosome 11 Cntains the
             3' end of the Nipsnap1 gene for 4-nitrophenylphosphatase
             domain and non-neuronal SNAP25-like protein homolog 1 (C.
             elegans), a novel gene, a ribosomal protein L17 (Rpl17)
             pseudogene, the Nefh gene for neurofilament heavy
             polypeptide, the Ap1b1 gene for adaptor protein complex
             AP-1 beta 1 subunit, the gene for the ortholog of human
             RAS-related protein on chromosome 22, the gene for the
             ortholog of human growth arrest-specific 2 like 1 GAS2L1
             and six CpG islands, complete sequence
          Length = 183758

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   agggagggagggagggcgag 202
             ||||||||||||||||||||
Sbjct: 16048 agggagggagggagggcgag 16029
to top
>gb|AC015961.16| Homo sapiens chromosome 18, clone RP11-95O2, complete sequence
          Length = 163808

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 179    ctgcagggagggagggaggg 198
              ||||||||||||||||||||
Sbjct: 157694 ctgcagggagggagggaggg 157713
to top
>gb|AC149225.18| Danio rerio clone ch211-103f17, complete sequence
          Length = 185038

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 292    agttcttctcattctctgga 311
              ||||||||||||||||||||
Sbjct: 152518 agttcttctcattctctgga 152499
to top
>gb|AC008087.11| Homo sapiens chromosome 17, clone RP5-1127L24, complete sequence
          Length = 104726

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 183 agggagggagggagggcgag 202
           ||||||||||||||||||||
Sbjct: 581 agggagggagggagggcgag 562
to top
>gb|AC114648.25| Mus musculus chromosome 8, clone RP24-144H17, complete sequence
          Length = 171191

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   agggagggagggagggcgag 202
             ||||||||||||||||||||
Sbjct: 99625 agggagggagggagggcgag 99606
to top
>gb|AC012236.12| Homo sapiens chromosome 15, clone RP11-16E12, complete sequence
          Length = 173729

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 135   gggccgcgaggagcaggaggaggg 158
             ||||||||||||| ||||||||||
Sbjct: 18404 gggccgcgaggaggaggaggaggg 18427
to top
>gb|AC008406.7| Homo sapiens chromosome 5 clone CTC-276P9, complete sequence
          Length = 178030

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   gcagggagggagggagggcg 200
             ||||||||||||||||||||
Sbjct: 24158 gcagggagggagggagggcg 24139
to top
>gb|AF442820.1|AF442820 Mus musculus strain 129/SvJ endothelial and smooth muscle
           cell-derived  neuropilin-like protein (Esdn) mRNA,
           partial cds
          Length = 531

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 184 gggagggagggagggcgaga 203
           ||||||||||||||||||||
Sbjct: 51  gggagggagggagggcgaga 70
to top
>gb|AF387548.1|AF387548 Mus musculus strain ICR endothelial and smooth muscle cell-derived 
           neuropilin-like protein (Esdn) mRNA, complete cds
          Length = 2642

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 184 gggagggagggagggcgaga 203
           ||||||||||||||||||||
Sbjct: 29  gggagggagggagggcgaga 48
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 183      agggagggagggagggcgag 202
                ||||||||||||||||||||
Sbjct: 11731665 agggagggagggagggcgag 11731646
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 139     cgcgaggagcaggaggaggg 158
               ||||||||||||||||||||
Sbjct: 3584299 cgcgaggagcaggaggaggg 3584318
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 192     gggagggcgagaccgcgaga 211
               ||||||||||||||||||||
Sbjct: 5971540 gggagggcgagaccgcgaga 5971559
to top
>gb|AC137875.13| Mus musculus chromosome 15, clone RP23-62B15, complete sequence
          Length = 195956

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 183    agggagggagggagggcgag 202
              ||||||||||||||||||||
Sbjct: 166771 agggagggagggagggcgag 166752
to top
>gb|AC090386.13| Homo sapiens chromosome 18, clone RP11-797E24, complete sequence
          Length = 185563

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 179    ctgcagggagggagggaggg 198
              ||||||||||||||||||||
Sbjct: 157943 ctgcagggagggagggaggg 157924
to top
>gb|AC155655.8| Mus musculus 6 BAC RP24-66L18 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 203618

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   agggagggagggagggcgag 202
             ||||||||||||||||||||
Sbjct: 79536 agggagggagggagggcgag 79517
to top
>gb|AC087793.17| Homo sapiens chromosome 8, clone RP5-1118A7, complete sequence
          Length = 124060

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   tctgcagggagggagggagg 197
             ||||||||||||||||||||
Sbjct: 13173 tctgcagggagggagggagg 13154
to top
>gb|AC024952.4|AC024952 Homo sapiens chromosome 7 clone RP11-66F23, complete sequence
          Length = 182426

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   gcagggagggagggagggcg 200
             ||||||||||||||||||||
Sbjct: 75875 gcagggagggagggagggcg 75856
to top
>gb|AC138696.4| Homo sapiens chromosome 8, clone RP13-582O9, complete sequence
          Length = 165019

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    tctgcagggagggagggagg 197
              ||||||||||||||||||||
Sbjct: 125036 tctgcagggagggagggagg 125017
to top
>gb|AC123767.2| Homo sapiens chromosome 8, clone RP11-122L4, complete sequence
          Length = 154078

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 276   gaaaatgatcttcatgagtt 295
             ||||||||||||||||||||
Sbjct: 64152 gaaaatgatcttcatgagtt 64133
to top
>gb|AC074091.6| Homo sapiens BAC clone RP11-158I13 from 2, complete sequence
          Length = 204153

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 179   ctgcagggagggagggaggg 198
             ||||||||||||||||||||
Sbjct: 38966 ctgcagggagggagggaggg 38985
to top
>gb|AC019172.4| Homo sapiens BAC clone RP11-178E6 from 2, complete sequence
          Length = 176983

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 285   cttcatgagttcttctcatt 304
             ||||||||||||||||||||
Sbjct: 99493 cttcatgagttcttctcatt 99474
to top
>gb|AC027455.22| Homo sapiens chromosome 17, clone RP11-411G7, complete sequence
          Length = 145410

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   agggagggagggagggcgag 202
             ||||||||||||||||||||
Sbjct: 47914 agggagggagggagggcgag 47895
to top
>gb|AC104259.14| Homo sapiens chromosome 15, clone CTD-2525I4, complete sequence
          Length = 155753

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   ctgcagggagggagggaggg 198
             ||||||||||||||||||||
Sbjct: 83098 ctgcagggagggagggaggg 83079
to top
>gb|AC002504.1| Homo sapiens X PAC RP1-258N20 (Roswell Park Cancer Institute Human PAC
             Library) complete sequence
          Length = 134970

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 181   gcagggagggagggagggcgagac 204
             |||||||||||||||||| |||||
Sbjct: 50659 gcagggagggagggagggagagac 50636
to top
>gb|AC107225.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0026H19,
              complete sequence
          Length = 150620

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 139    cgcgaggagcaggaggaggg 158
              ||||||||||||||||||||
Sbjct: 101841 cgcgaggagcaggaggaggg 101860
to top
>gb|AE001273.1| Chlamydia trachomatis D/UW-3/CX, complete genome
          Length = 1042519

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    ggccgcgaggagcaggagga 155
              ||||||||||||||||||||
Sbjct: 453012 ggccgcgaggagcaggagga 452993
to top
>dbj|AP002093.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0466B10
          Length = 151806

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 192   gggagggcgagaccgcgaga 211
             ||||||||||||||||||||
Sbjct: 39428 gggagggcgagaccgcgaga 39447
to top
>dbj|AK024438.1| Homo sapiens mRNA for FLJ00028 protein, partial cds
          Length = 4673

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 178  tctgcagggagggagggagg 197
            ||||||||||||||||||||
Sbjct: 3213 tctgcagggagggagggagg 3194
to top
>gb|AC006445.11|AC006445 Homo sapiens chromosome 4 clone C0367I21, complete sequence
          Length = 174547

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 142  gaggagcaggaggagggacg 161
            ||||||||||||||||||||
Sbjct: 9060 gaggagcaggaggagggacg 9079
to top
>dbj|AP001006.5| Homo sapiens genomic DNA, chromosome 18 clone:RP11-687I9, complete
              sequence
          Length = 193999

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 412    gtggggctaccattgtggat 431
              ||||||||||||||||||||
Sbjct: 169165 gtggggctaccattgtggat 169146
to top
>dbj|AP005854.3| Homo sapiens genomic DNA, chromosome 8q24, clone: KB1063B1, complete
             sequence
          Length = 55116

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   tctgcagggagggagggagg 197
             ||||||||||||||||||||
Sbjct: 20453 tctgcagggagggagggagg 20434
to top
>dbj|AP000797.6| Homo sapiens genomic DNA, chromosome 11 clone:CMB9-36B5, complete
              sequence
          Length = 148490

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 142    gaggagcaggaggagggacg 161
              ||||||||||||||||||||
Sbjct: 106430 gaggagcaggaggagggacg 106411
to top
>dbj|AB017651.2| Homo sapiens genomic DNA, chromosome 11q23.2, clone:KB615C6, complete
            sequence
          Length = 131668

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 142  gaggagcaggaggagggacg 161
            ||||||||||||||||||||
Sbjct: 4384 gaggagcaggaggagggacg 4365
to top
>emb|CT027564.7| Mouse DNA sequence from clone RP24-293N14 on chromosome 16, complete
             sequence
          Length = 180784

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 184   gggagggagggagggcgaga 203
             ||||||||||||||||||||
Sbjct: 87833 gggagggagggagggcgaga 87852
to top
>gb|L22180.1|CHTHSPR Chlamydia trachomatis 82 kDa protein gene, 5' end
          Length = 1900

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 136  ggccgcgaggagcaggagga 155
            ||||||||||||||||||||
Sbjct: 1420 ggccgcgaggagcaggagga 1401
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 183      agggagggagggagggcgag 202
                ||||||||||||||||||||
Sbjct: 11731336 agggagggagggagggcgag 11731317
to top
>emb|AL731890.2|CNS08C8U Oryza sativa chromosome 12, . BAC OJ1563_B02 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 101314

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   agggagggagggagggcgag 202
             ||||||||||||||||||||
Sbjct: 25001 agggagggagggagggcgag 25020
to top
>gb|AC133944.4| Mus musculus BAC clone RP24-113L10 from 10, complete sequence
          Length = 167418

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 183    agggagggagggagggcgag 202
              ||||||||||||||||||||
Sbjct: 142183 agggagggagggagggcgag 142202
to top
>emb|AL596108.13| Mouse DNA sequence from clone RP23-326K2 on chromosome 11, complete
             sequence
          Length = 200966

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   agggagggagggagggcgag 202
             ||||||||||||||||||||
Sbjct: 38627 agggagggagggagggcgag 38646
to top
>gb|AC013489.17| Homo sapiens chromosome 15, clone RP11-97O12, complete sequence
          Length = 175836

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 179  ctgcagggagggagggaggg 198
            ||||||||||||||||||||
Sbjct: 7595 ctgcagggagggagggaggg 7576
to top
>gb|M27580.1|CHTOMP3D Chlamydia trachomatis 75 kD membrane protein gene, complete cds
          Length = 2282

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 136  ggccgcgaggagcaggagga 155
            ||||||||||||||||||||
Sbjct: 1525 ggccgcgaggagcaggagga 1506
to top
>dbj|AP005272.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-172F10, complete
             sequence
          Length = 164943

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   gtggggctaccattgtggat 431
             ||||||||||||||||||||
Sbjct: 34453 gtggggctaccattgtggat 34434
to top
>dbj|AP001999.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-469N6, complete
              sequence
          Length = 172504

 Score = 40.1 bits (20), Expect = 7.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 276    gaaaatgatcttcatgagtt 295
              ||||||||||||||||||||
Sbjct: 139842 gaaaatgatcttcatgagtt 139861


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,663,297
Number of Sequences: 3902068
Number of extensions: 4663297
Number of successful extensions: 377469
Number of sequences better than 10.0: 104
Number of HSP's better than 10.0 without gapping: 104
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 376191
Number of HSP's gapped (non-prelim): 1238
length of query: 531
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 508
effective length of database: 17,143,297,704
effective search space: 8708795233632
effective search space used: 8708795233632
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top