ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd22i11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ290421.1|HVU290421 Hordeum vulgare mRNA for BAX inhibitor ... 460 e-126
2ref|XM_463955.1| Oryza sativa (japonica cultivar-group), mRNA 289 5e-75
3ref|XM_463954.1| Oryza sativa (japonica cultivar-group), mRNA 289 5e-75
4ref|XM_507433.1| PREDICTED Oryza sativa (japonica cultivar-group... 289 5e-75
5ref|XM_506699.2| PREDICTED Oryza sativa (japonica cultivar-group... 289 5e-75
6dbj|AB025926.3| Oryza sativa BI-1 mRNA for Bax inhibitor-1, comp... 289 5e-75
7dbj|AK101060.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 5e-75
8dbj|AK061953.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 5e-75
9dbj|AK061564.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 5e-75
10gb|AY105656.1| Zea mays PCO153521 mRNA sequence 246 6e-62
11dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 218 1e-53
12dbj|AP005311.3| Oryza sativa (japonica cultivar-group) genomic D... 218 1e-53
13gb|BT018201.1| Zea mays clone EL01N0559D10.c mRNA sequence 194 2e-46
14gb|AY107681.1| Zea mays PCO116018 mRNA sequence 153 7e-34
15gb|AC157610.2| Mus musculus chromosome 15, clone RP23-77H12, com... 48 0.029
16gb|AC131781.3| Mus musculus BAC clone RP24-344J9 from chromosome... 48 0.029
17gb|AC121137.18| Mus musculus chromosome 14, clone RP23-406K12, c... 48 0.029
18gb|AC122418.4| Mus musculus BAC clone RP24-159E6 from chromosome... 48 0.029
19gb|AC123944.4| Mus musculus BAC clone RP24-87F18 from chromosome... 48 0.029
20emb|AL499609.9| Human DNA sequence from clone RP11-309N23 on chr... 48 0.029
21emb|AL646050.7| Mouse DNA sequence from clone RP23-460G5 on chro... 48 0.029
22gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, co... 48 0.029
23gb|AC099692.4| Mus musculus chromosome 13, clone RP23-198N22, co... 48 0.029
24gb|AC150682.2| Mus musculus BAC clone RP24-210N1 from 5, complet... 48 0.029
25emb|AL672269.15| Mouse DNA sequence from clone RP23-57F11 on chr... 48 0.029
26gb|AC097832.7| Rattus norvegicus 11 BAC CH230-68C19 (Children's ... 46 0.11
27gb|AC135962.4| Mus musculus BAC clone RP23-342H15 from chromosom... 46 0.11
28gb|AC163269.3| Mus musculus chromosome 15, clone RP24-276M6, com... 46 0.11
29gb|AC126265.3| Mus musculus BAC clone RP23-383O12 from chromosom... 46 0.11
30emb|CR734140.2|CNS0GT8R Tetraodon nigroviridis full-length cDNA 46 0.11
31emb|CR731163.1|CNS0GR40 Tetraodon nigroviridis full-length cDNA 46 0.11
32emb|CR730458.2|CNS0GQKF Tetraodon nigroviridis full-length cDNA 46 0.11
33emb|CR730167.1|CNS0GQCD Tetraodon nigroviridis full-length cDNA 46 0.11
34emb|CR728214.1|CNS0GOU4 Tetraodon nigroviridis full-length cDNA 46 0.11
35emb|CR657128.2|CNS0F60E Tetraodon nigroviridis full-length cDNA 46 0.11
36emb|CR653193.2|CNS0F2Z3 Tetraodon nigroviridis full-length cDNA 46 0.11
37emb|CR648614.2|CNS0EZFW Tetraodon nigroviridis full-length cDNA 46 0.11
38emb|CR642989.2|CNS0EV3N Tetraodon nigroviridis full-length cDNA 46 0.11
39gb|AC152176.5| Medicago truncatula clone mth2-65c4, complete seq... 46 0.11
40gb|AC159748.5| Mus musculus 10 BAC RP24-363O22 (Roswell Park Can... 46 0.11
41gb|AC115699.9| Mus musculus chromosome 15, clone RP24-247B18, co... 46 0.11
42gb|AC174458.2| Mus musculus BAC clone RP23-282D14 from chromosom... 46 0.11
43emb|AL935121.9| Mouse DNA sequence from clone RP23-432M14 on chr... 46 0.11
44gb|AC124516.4| Mus musculus BAC clone RP23-387C9 from 12, comple... 46 0.11
45ref|XM_475610.1| Oryza sativa (japonica cultivar-group), predic... 44 0.45
46gb|AC162466.6| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cance... 44 0.45
47gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 44 0.45
48gb|AC131059.6| Mus musculus chromosome 1, clone RP24-108K12, com... 44 0.45
49gb|AC102342.10| Mus musculus chromosome 18, clone RP23-250K3, co... 44 0.45
50gb|AC140247.3| Mus musculus BAC clone RP23-469I15 from chromosom... 44 0.45
51gb|AC119846.14| Mus musculus chromosome 1, clone RP23-45A13, com... 44 0.45
52ref|XM_570767.1| Cryptococcus neoformans var. neoformans JEC21 h... 44 0.45
53gb|AC129609.3| Mus musculus BAC clone RP23-194H4 from chromosome... 44 0.45
54gb|AC110517.9| Mus musculus chromosome 17, clone RP23-13F15, com... 44 0.45
55gb|AC124178.3| Mus musculus BAC clone RP23-193J15 from 18, compl... 44 0.45
56gb|AC127326.4| Mus musculus BAC clone RP23-251C4 from 8, complet... 44 0.45
57gb|AC121877.2| Mus musculus BAC clone RP24-127G8 from 7, complet... 44 0.45
58gb|AC098876.4| Mus musculus BAC clone RP23-1O17 from 14, complet... 44 0.45
59gb|AC007031.2| Homo sapiens BAC clone RP11-17I10 from 7, complet... 44 0.45
60gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, c... 44 0.45
61emb|BX005144.14| Human DNA sequence from clone DASS-125F11 on ch... 44 0.45
62gb|AY691322.1| Ochlerotatus atropalpus vitellogenin C (Vg-C) gen... 44 0.45
63emb|AL606829.13| Mouse DNA sequence from clone RP23-10M12 on chr... 44 0.45
64emb|AL691470.17| Mouse DNA sequence from clone RP23-160F12 on ch... 44 0.45
65gb|AC163651.2| Mus musculus BAC clone RP24-358K11 from chromosom... 44 0.45
66gb|AC011447.7| Homo sapiens chromosome 19 clone CTC-260E6, compl... 44 0.45
67emb|X73636.1|SSLILH S.scrofa gene for leydig Insulin-like hormone 44 0.45
68gb|AC021683.10| Homo sapiens chromosome 17, clone RP11-13K12, co... 44 0.45
69gb|AE008686.1|AE008686 Mus musculus T-cell receptor alpha/delta ... 44 0.45
70dbj|AK084939.1| Mus musculus 13 days embryo lung cDNA, RIKEN ful... 44 0.45
71gb|AC160402.8| Mus musculus 10 BAC RP23-115L17 (Roswell Park Can... 44 0.45
72dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.45
73gb|AC008554.8| Homo sapiens chromosome 19 clone CTC-513N18, comp... 44 0.45
74gb|AC105186.14| Homo sapiens chromosome 8, clone CTD-2323A1, com... 44 0.45
75gb|AC104981.9| Homo sapiens chromosome 17, clone RP11-316M20, co... 44 0.45
76gb|AC135608.7| Mus musculus strain C57BL/6J clone rp23-408d14, c... 44 0.45
77dbj|BS000023.1| Pan troglodytes chromosome 22 clone:PTB-018G23, ... 44 0.45
78emb|CT010479.25| Mouse DNA sequence from clone RP23-233G23 on ch... 44 0.45
79emb|AL450341.10| Mouse DNA sequence from clone RP23-401L17 on ch... 44 0.45
80gb|AC166103.4| Mus musculus BAC clone RP23-339J4 from chromosome... 44 0.45
81emb|AL808112.34| Mouse DNA sequence from clone RP23-57N22 on chr... 44 0.45
82gb|AC005938.1|AC005938 Mus musculus chromosome 14 clone UWGC:mba... 44 0.45
83gb|AC132615.5| Mus musculus BAC clone RP23-301J15 from 9, comple... 44 0.45
84gb|AC122860.5| Mus musculus BAC clone RP23-135A22 from 12, compl... 44 0.45
85gb|AC132383.5| Mus musculus BAC clone RP23-434M19 from 10, compl... 44 0.45
86gb|AC124126.14| Mus musculus chromosome 18, clone RP23-377C8, co... 44 0.45
87emb|CR936883.15| Human DNA sequence from clone DAMC-4K22 on chro... 44 0.45
88gb|AC164160.5| Mus musculus BAC clone RP23-343P15 from chromosom... 44 0.45
89emb|AL772349.5| Mouse DNA sequence from clone RP23-466A17 on chr... 44 0.45
90emb|AL606974.9| Mouse DNA sequence from clone RP23-39E21 on chro... 44 0.45
91gb|AC164161.2| Mus musculus BAC clone RP23-274G21 from chromosom... 44 0.45
92gb|AC087425.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.45
93gb|AC124634.24| Mus musculus chromosome 18, clone RP23-450K16, c... 44 0.45
94gb|AC168266.2| Mus musculus BAC clone RP24-245G1 from chromosome... 44 0.45
95emb|AL604025.15| Mouse DNA sequence from clone RP23-455K6 on chr... 44 0.45
96gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, co... 42 1.8
97gb|AC102103.10| Mus musculus chromosome 15, clone RP23-82K1, com... 42 1.8
98gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, c... 42 1.8
99gb|AC129583.15| Mus musculus chromosome 15, clone RP23-197P10, c... 42 1.8
100gb|AC165952.4| Mus musculus BAC clone RP23-460G24 from chromosom... 42 1.8
101ref|NM_113739.2| Arabidopsis thaliana peroxidase AT3G28200 mRNA,... 42 1.8
102ref|NM_001036173.1| Arabidopsis thaliana unknown protein AT1G681... 42 1.8
103ref|NM_105484.3| Arabidopsis thaliana unknown protein AT1G68140 ... 42 1.8
104gb|AC166746.7| Mus musculus chromosome 19, clone RP24-248H10, co... 42 1.8
105gb|AC163280.2| Mus musculus BAC clone RP23-478G5 from chromosome... 42 1.8
106gb|AC157087.2| Mus musculus BAC clone RP23-287O24 from chromosom... 42 1.8
107gb|AC167970.4| Mus musculus BAC clone RP24-471H15 from chromosom... 42 1.8
108gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, co... 42 1.8
109gb|AC164549.4| Mus musculus BAC clone RP24-273K1 from chromosome... 42 1.8
110gb|AC123060.4| Mus musculus chromosome 6 clone RP23-214M22, comp... 42 1.8
111gb|AC121942.2| Mus musculus chromosome 13 clone RP24-211D12, com... 42 1.8
112gb|AC109498.10| Mus musculus chromosome 5, clone RP23-22K24, com... 42 1.8
113ref|XM_637804.1| Dictyostelium discoideum hypothetical protein (... 42 1.8
114gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosom... 42 1.8
115gb|AC163351.2| Mus musculus BAC clone RP23-150D4 from chromosome... 42 1.8
116gb|AC163032.5| Mus musculus BAC clone RP24-144G20 from chromosom... 42 1.8
117gb|AC159285.3| Mus musculus BAC clone RP23-306M13 from chromosom... 42 1.8
118ref|XM_518365.1| PREDICTED: Pan troglodytes similar to HLA-B ass... 42 1.8
119ref|XM_517797.1| PREDICTED: Pan troglodytes similar to hypotheti... 42 1.8
120ref|XM_514062.1| PREDICTED: Pan troglodytes LOC457587 (LOC457587... 42 1.8
121gb|AC102355.13| Mus musculus chromosome 5, clone RP23-120C8, com... 42 1.8
122gb|AC161574.8| Mus musculus chromosome 1, clone RP23-352D14, com... 42 1.8
123gb|AC170163.1| Homo sapiens chromosome 1 clone WI2-3014I21, comp... 42 1.8
124gb|AC109205.12| Mus musculus chromosome 7, clone RP23-137A4, com... 42 1.8
125gb|AF384675.1| Mus musculus FGF15 (Fgf15) gene, complete cds; BC... 42 1.8
126gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5... 42 1.8
127gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold 42 1.8
128gb|AF165926.2| Homo sapiens chromosome 5p13 BAC clone djn085o06 ... 42 1.8
129gb|AC139513.10| Mus musculus chromosome 15, clone RP23-151N6, co... 42 1.8
130ref|NM_176080.2| Rattus norvegicus Na+ dependent glucose transpo... 42 1.8
131gb|BC106158.1| Mus musculus cDNA clone IMAGE:3489110, with appar... 42 1.8
132gb|AC102938.20| Mus musculus chromosome 1, clone RP24-187H3, com... 42 1.8
133gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG... 42 1.8
134gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence 42 1.8
135gb|AC004493.1| Homo sapiens chromosome 16, cosmid clone 373C8 (L... 42 1.8
136gb|AC079933.3| Trypanosoma brucei chromosome 4 clone RPCI93-1H19... 42 1.8
137gb|AC121149.12| Mus musculus chromosome 3, clone RP24-383A4, com... 42 1.8
138gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, com... 42 1.8
139gb|BC094614.1| Mus musculus profilin family, member 4, mRNA (cDN... 42 1.8
140gb|AC101391.15| Mus musculus chromosome 5, clone RP23-119E13, co... 42 1.8
141gb|AC165357.4| Mus musculus BAC clone RP23-114G24 from chromosom... 42 1.8
142gb|AC160930.2| Mus musculus BAC clone RP24-383F22 from chromosom... 42 1.8
143gb|AC151715.3| Mus musculus BAC clone RP23-396L12 from chromosom... 42 1.8
144gb|AC154641.2| Mus musculus BAC clone RP23-276C17 from chromosom... 42 1.8
145gb|AC168279.3| Mus musculus 10 BAC RP23-345H24 (Roswell Park Can... 42 1.8
146gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 1.8
147gb|AC131915.7| Mus musculus chromosome 5, clone RP24-491C20, com... 42 1.8
148gb|AC113945.26| Mus musculus chromosome 3, clone RP24-96D10, com... 42 1.8
149gb|AC121291.18| Mus musculus chromosome 5, clone RP23-170M15, co... 42 1.8
150gb|AC118733.8| Mus musculus chromosome 10, clone RP24-170A20, co... 42 1.8
151gb|AC100427.25| Mus musculus chromosome 10, clone RP23-136J15, c... 42 1.8
152gb|AC109249.17| Mus musculus chromosome 13, clone RP23-78E1, com... 42 1.8
153gb|AC117784.13| Mus musculus chromosome 15, clone RP24-545F24, c... 42 1.8
154gb|AC113720.6| Rattus norvegicus 1 BAC CH230-117B1 (Children's H... 42 1.8
155gb|AC132833.10| Mus musculus chromosome 15, clone RP24-498G7, co... 42 1.8
156gb|AC112945.9| Mus musculus chromosome 15, clone RP23-382O21, co... 42 1.8
157gb|AC123722.8| Mus musculus chromosome 5, clone RP23-424O22, com... 42 1.8
158ref|XM_419932.1| PREDICTED: Gallus gallus similar to myelin tran... 42 1.8
159gb|AY653037.1|AY653037S1 Homo sapiens proteoglycan 4 (PRG4) mRNA... 42 1.8
160gb|BC076085.1| Danio rerio cDNA clone IMAGE:5913062, partial cds 42 1.8
161gb|AC115924.11| Mus musculus chromosome 15, clone RP24-511O11, c... 42 1.8
162gb|AC124023.2| Mus musculus chromosome X clone RP21-437J18 map q... 42 1.8
163gb|AC124022.2| Mus musculus chromosome X clone RP21-566N22 map q... 42 1.8
164gb|AC124021.2| Mus musculus chromosome X clone RP21-566N22 map q... 42 1.8
165gb|AC116573.7| Mus musculus BAC clone RP23-114E15 from chromosom... 42 1.8
166gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosom... 42 1.8
167gb|AC139755.3| Mus musculus BAC clone RP24-96N20 from chromosome... 42 1.8
168gb|AC091309.13| Mus musculus chromosome 17, clone RP23-127L4, co... 42 1.8
169gb|AC183274.3| Pan troglodytes BAC clone CH251-156F5 from chromo... 42 1.8
170gb|BC021877.1| Mus musculus amyloid beta (A4) precursor-like pro... 42 1.8
171gb|AC100893.13| Mus musculus chromosome 8, clone RP23-68I8, comp... 42 1.8
172gb|AC079365.5| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 1.8
173gb|AC111275.4| Rattus norvegicus 4 BAC CH230-49L22 (Children's H... 42 1.8
174gb|AC110102.6| Rattus norvegicus 4 BAC CH230-209C7 (Children's H... 42 1.8
175gb|AC079277.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 1.8
176gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 1.8
177gb|AC100378.10| Mus musculus chromosome 10, clone RP23-130O4, co... 42 1.8
178gb|AC132462.4| Mus musculus BAC clone RP23-35F22 from chromosome... 42 1.8
179gb|AC147375.3| Mus musculus BAC clone RP24-159O13 from chromosom... 42 1.8
180gb|AC121873.3| Mus musculus BAC clone RP24-123L3 from chromosome... 42 1.8
181ref|XM_715588.1| Candida albicans SC5314 hypothetical protein (C... 42 1.8
182gb|AC129288.3| Mus musculus BAC clone RP24-481M4 from chromosome... 42 1.8
183gb|AC087102.3| Rattus norvegicus strain Brown Norway clone RP31-... 42 1.8
184gb|AC079956.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 1.8
185ref|XM_709413.1| Candida albicans SC5314 hypothetical protein (C... 42 1.8
186ref|XM_709364.1| Candida albicans SC5314 hypothetical protein (C... 42 1.8
187gb|AC146080.4| Pan troglodytes BAC clone RP43-51K11 from 7, comp... 42 1.8
188gb|AC125105.3| Mus musculus BAC clone RP24-220B7 from chromosome... 42 1.8
189gb|AC147369.3| Mus musculus BAC clone RP24-392B5 from chromosome... 42 1.8
190gb|AC140465.2| Mus musculus BAC clone RP24-389J3 from chromosome... 42 1.8
191gb|AC136518.3| Mus musculus BAC clone RP23-304K22 from chromosom... 42 1.8
192ref|NM_007467.2| Mus musculus amyloid beta (A4) precursor-like p... 42 1.8
193gb|AC158301.4| Mus musculus chromosome 5, clone RP24-71D19, comp... 42 1.8
194ref|NM_152638.2| Homo sapiens chromosome 12 open reading frame 1... 42 1.8
195ref|NM_016333.2| Homo sapiens serine/arginine repetitive matrix ... 42 1.8
196gb|AC123683.6| Mus musculus chromosome 9, clone RP23-296I6, comp... 42 1.8
197gb|AY040849.1| Homo sapiens large conductance calcium-activated ... 42 1.8
198gb|AC159888.2| Mus musculus BAC clone RP24-133O9 from chromosome... 42 1.8
199gb|AC154885.8| Mus musculus chromosome 5, clone RP24-333I1, comp... 42 1.8
200gb|AC166829.3| Mus musculus BAC clone RP23-299M19 from chromosom... 42 1.8
201gb|AC034116.10| Mus musculus chromosome 16, clone RP23-428P5, co... 42 1.8
202gb|AC126608.20| Mus musculus chromosome 19, clone RP24-166L20, c... 42 1.8
203gb|AC114411.24| Mus musculus chromosome 5, clone RP23-162F3, com... 42 1.8
204gb|AC161930.7| Mus musculus chromosome 7, clone RP23-157P17, com... 42 1.8
205ref|NM_001032810.1| Macaca mulatta calcium-activated potassium c... 42 1.8
206gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ... 42 1.8
207gb|AC163353.3| Mus musculus BAC clone RP23-55G7 from chromosome ... 42 1.8
208gb|AC148980.6| Mus musculus BAC clone RP23-230C16 from chromosom... 42 1.8
209gb|AC115948.12| Mus musculus chromosome 16, clone RP24-568J12, c... 42 1.8
210ref|XR_002066.1| PREDICTED: Mus musculus hypothetical protein LO... 42 1.8
211gb|AC117076.3| Dictyostelium discoideum chromosome 2 map 3323568... 42 1.8
212ref|XM_892831.1| PREDICTED: Mus musculus similar to protein phos... 42 1.8
213gb|AC126944.3| Mus musculus BAC clone RP23-19A4 from chromosome ... 42 1.8
214gb|AC125194.4| Mus musculus BAC clone RP23-275K6 from chromosome... 42 1.8
215gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome... 42 1.8
216gb|AC135016.3| Mus musculus BAC clone RP24-244B4 from chromosome... 42 1.8
217ref|XM_994301.1| PREDICTED: Mus musculus RIKEN cDNA 2010001E11 g... 42 1.8
218ref|XM_907955.2| PREDICTED: Mus musculus RIKEN cDNA 2010001E11 g... 42 1.8
219ref|XM_125582.4| PREDICTED: Mus musculus RIKEN cDNA 2010001E11 g... 42 1.8
220gb|AC131717.3| Mus musculus chromosome 12 clone RP23-167A18, com... 42 1.8
221gb|AC115039.7| Mus musculus chromosome 6, clone RP24-279C2, comp... 42 1.8
222gb|AC111117.15| Mus musculus chromosome 1, clone RP23-214P23, co... 42 1.8
223gb|AC112030.4| Rattus norvegicus 4 BAC CH230-100K8 (Children's H... 42 1.8
224ref|XM_923288.2| PREDICTED: Mus musculus cDNA sequence BC067047,... 42 1.8
225ref|XM_923292.2| PREDICTED: Mus musculus cDNA sequence BC067047,... 42 1.8
226ref|XM_902965.2| PREDICTED: Mus musculus cDNA sequence BC067047,... 42 1.8
227ref|XM_902966.2| PREDICTED: Mus musculus cDNA sequence BC067047,... 42 1.8
228gb|AC146078.3| Pan troglodytes BAC clone RP43-45C11 from 7, comp... 42 1.8
229gb|AC133967.2| Mus musculus BAC clone RP23-14J5 from chromosome ... 42 1.8
230gb|AC140373.2| Mus musculus BAC clone RP23-197O10 from chromosom... 42 1.8
231gb|AC124466.3| Mus musculus BAC clone RP24-160P1 from chromosome... 42 1.8
232gb|AC122499.4| Mus musculus BAC clone RP24-407O20 from chromosom... 42 1.8
233ref|XM_841781.1| Trypanosoma brucei TREU927 hypothetical protein... 42 1.8
234gb|AC141479.3| Mus musculus BAC clone RP23-281N15 from chromosom... 42 1.8
235ref|XM_862284.1| PREDICTED: Canis familiaris hypothetical protei... 42 1.8
236emb|AJ298054.1|MMA298054 Mus musculus Ly57 gene for lymphocyte a... 42 1.8
237emb|AJ246952.1|ARA246952 Ascochyta rabiei microsatellite DNA, cl... 42 1.8
238ref|XM_813634.1| Trypanosoma cruzi strain CL Brener hypothetical... 42 1.8
239gb|AC122402.2| Mus musculus BAC clone RP24-108B4 from chromosome... 42 1.8
240ref|XM_820132.1| Trypanosoma brucei TREU927 clone RPCI93-1H19 hy... 42 1.8
241emb|CR450771.10| Zebrafish DNA sequence from clone CH211-152D1 i... 42 1.8
242ref|XM_746975.1| Aspergillus fumigatus Af293 hypothetical protei... 42 1.8
243gb|AC092117.4| Homo sapiens chromosome 16 clone CTD-2270P14, com... 42 1.8
244emb|CR932164.1|CNS0KYGD Paramecium tetraurelia macronuclear, put... 42 1.8
245emb|CT009637.4| Mouse DNA sequence from clone RP23-131G16 on chr... 42 1.8
246gb|AC124484.5| Mus musculus BAC clone RP24-128N20 from chromosom... 42 1.8
247ref|XM_449563.1| Candida glabrata CBS138 hypothetical protein (C... 42 1.8
248gb|AC131769.3| Mus musculus BAC clone RP24-290G2 from chromosome... 42 1.8
249gb|AC121975.3| Mus musculus BAC clone RP24-286J21 from chromosom... 42 1.8
250gb|AC127259.3| Mus musculus BAC clone RP24-304A20 from chromosom... 42 1.8
251gb|AC126024.3| Mus musculus BAC clone RP24-423I20 from chromosom... 42 1.8
252gb|AC122184.4| Mus musculus BAC clone RP23-16C12 from chromosome... 42 1.8
253gb|AC130711.3| Mus musculus BAC clone RP23-22M24 from chromosome... 42 1.8
254gb|AC115293.5| Mus musculus BAC clone RP23-92N2 from chromosome ... 42 1.8
255gb|AC126940.4| Mus musculus BAC clone RP23-77E4 from chromosome ... 42 1.8
256gb|AC133646.4| Mus musculus BAC clone RP23-254F11 from chromosom... 42 1.8
257gb|AC122809.4| Mus musculus BAC clone RP23-272E5 from chromosome... 42 1.8
258gb|AC122342.4| Mus musculus BAC clone RP23-357O17 from chromosom... 42 1.8
259gb|AC122863.4| Mus musculus BAC clone RP23-142A14 from chromosom... 42 1.8
260gb|AC125057.5| Mus musculus BAC clone RP23-399K1 from chromosome... 42 1.8
261gb|AC132455.3| Mus musculus BAC clone RP23-129K10 from chromosom... 42 1.8
262gb|AC133100.5| Mus musculus BAC clone RP23-98O11 from chromosome... 42 1.8
263gb|AC131080.13| Mus musculus chromosome 16, clone RP23-438H16, c... 42 1.8
264gb|AC004626.1|HUAC004626 Homo sapiens Chromosome 16 BAC clone CI... 42 1.8
265gb|AC007950.7| Homo sapiens chromosome 15, clone RP11-44M14, com... 42 1.8
266gb|AC084287.9| Mus Musculus S train C57BL6/J chromosome 1 BAC, ... 42 1.8
267gb|AC102819.5| Mus musculus chromosome 8, clone RP23-117H21, com... 42 1.8
268gb|AC074277.6| Homo sapiens 3 BAC RP11-82N13 (Roswell Park Cance... 42 1.8
269ref|XM_811457.1| Trypanosoma cruzi strain CL Brener hypothetical... 42 1.8
270gb|AC124391.3| Mus musculus BAC clone RP24-439L13 from chromosom... 42 1.8
271gb|AC127234.3| Mus musculus BAC clone RP24-566K14 from chromosom... 42 1.8
272gb|AC122540.4| Mus musculus BAC clone RP24-555K13 from chromosom... 42 1.8
273gb|AC127254.3| Mus musculus BAC clone RP24-290D19 from chromosom... 42 1.8
274gb|AC121971.3| Mus musculus BAC clone RP24-275H22 from chromosom... 42 1.8
275gb|AC122456.4| Mus musculus BAC clone RP24-265M23 from chromosom... 42 1.8
276gb|AC115303.6| Mus musculus BAC clone RP24-108I6 from chromosome... 42 1.8
277gb|AC125040.4| Mus musculus BAC clone RP23-335C9 from chromosome... 42 1.8
278gb|AC123804.3| Mus musculus BAC clone RP24-140B5 from chromosome... 42 1.8
279ref|XM_814821.1| Trypanosoma cruzi strain CL Brener hypothetical... 42 1.8
280ref|XM_797234.1| Trypanosoma cruzi strain CL Brener hypothetical... 42 1.8
281gb|AC069152.5| Homo sapiens BAC clone RP11-331L17 from UL, compl... 42 1.8
282gb|AC131712.3| Mus musculus BAC clone RP23-193A5 from 17, comple... 42 1.8
283gb|AC123063.4| Mus musculus BAC clone RP23-219I20 from 5, comple... 42 1.8
284gb|AC122273.4| Mus musculus BAC clone RP23-228B2 from 9, complet... 42 1.8
285gb|AC124542.4| Mus musculus BAC clone RP23-259B10 from 12, compl... 42 1.8
286gb|AC122295.4| Mus musculus BAC clone RP23-263E3 from 13, comple... 42 1.8
287gb|AC116323.6| Mus musculus BAC clone RP23-281F3 from 8, complet... 42 1.8
288gb|AC122806.4| Mus musculus BAC clone RP23-297C11 from 8, comple... 42 1.8
289gb|AC126457.3| Mus musculus BAC clone RP23-68E6 from 16, complet... 42 1.8
290gb|AC112258.4| Mus musculus BAC clone RP23-169M10 from 8, comple... 42 1.8
291gb|AC121886.2| Mus musculus BAC clone RP24-141K3 from 18, comple... 42 1.8
292gb|AC121599.3| Mus musculus BAC clone RP23-300H21 from 14, compl... 42 1.8
293gb|AC122310.2| Mus musculus BAC clone RP23-296E17 from 12, compl... 42 1.8
294gb|AC110240.8| Mus musculus chromosome 3, clone RP23-113O9, comp... 42 1.8
295gb|AC004906.3| Homo sapiens PAC clone RP5-852O24 from 7, complet... 42 1.8
296gb|AC006015.5| Homo sapiens PAC clone RP5-965K10 from 7, complet... 42 1.8
297ref|XM_721940.1| Plasmodium yoelii yoelii str. 17XNL DNA repair ... 42 1.8
298ref|XM_947123.1| Theileria annulata strain Ankara hypothetical p... 42 1.8
299gb|BC055701.1| Mus musculus RIKEN cDNA A330102K23 gene, mRNA (cD... 42 1.8
300ref|XM_738978.1| Plasmodium chabaudi chabaudi hypothetical prote... 42 1.8
301gb|AY321292.1| Echinococcus vogeli clone Ev-7 antigen B subunit ... 42 1.8
302gb|AY321290.1| Echinococcus vogeli clone Ev-1 antigen B subunit ... 42 1.8
303ref|XM_740049.1| Plasmodium chabaudi chabaudi DNA repair protein... 42 1.8
304ref|XM_664868.1| Plasmodium berghei strain ANKA hypothetical pro... 42 1.8
305gb|AC108010.4| Homo sapiens BAC clone RP13-489A5 from 7, complet... 42 1.8
306gb|AC005014.2| Homo sapiens BAC clone GS1-166A23 from 7, complet... 42 1.8
307gb|AC108812.9| Mus musculus chromosome 18, clone RP23-417M2, com... 42 1.8
308gb|AC107761.9| Mus musculus chromosome 7, clone RP23-184M3, comp... 42 1.8
309gb|AC111103.7| Mus musculus chromosome 16, clone RP23-187G7, com... 42 1.8
310ref|XM_674554.1| Plasmodium berghei strain ANKA NAD(P)H-dependen... 42 1.8
311ref|XM_675000.1| Plasmodium berghei strain ANKA hypothetical pro... 42 1.8
312gb|AC155171.7| Mus musculus BAC clone RP23-100A10 from chromosom... 42 1.8
313gb|AC103939.8| Mus musculus chromosome 18, clone RP23-300E7, com... 42 1.8
314gb|AC156606.12| Mus musculus chromosome 7, clone RP23-78N8, comp... 42 1.8
315gb|AC149067.3| Mus musculus BAC clone RP23-56C20 from chromosome... 42 1.8
316gb|AC158144.13| Mus musculus chromosome 7, clone RP23-82N3, comp... 42 1.8
317gb|AC090530.3| Homo sapiens chromosome 1 clone RP11-416G1, compl... 42 1.8
318gb|AC163638.2| Mus musculus BAC clone RP23-188H10 from chromosom... 42 1.8
319gb|AC146855.5| Medicago truncatula clone mth2-16c23, complete se... 42 1.8
320gb|AC160107.2| Mus musculus BAC clone RP24-252N17 from chromosom... 42 1.8
321gb|AC151275.3| Mus musculus BAC clone RP24-201F8 from chromosome... 42 1.8
322gb|AC138739.8| Mus musculus chromosome 9, clone RP23-380A10, com... 42 1.8
323gb|AC159100.2| Mus musculus BAC clone RP24-248F9 from chromosome... 42 1.8
324gb|AC161876.3| Mus musculus BAC clone RP24-388H6 from chromosome... 42 1.8
325gb|AC165444.2| Mus musculus BAC clone CH25-441A19 from chromosom... 42 1.8
326emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on ch... 42 1.8
327gb|AC133425.3| Rattus norvegicus 7 BAC CH230-333I12 (Children's ... 42 1.8
328emb|X69838.1|HSG9A H.sapiens mRNA for G9a 42 1.8
329emb|Z98748.1|HS381E2 Human DNA sequence from clone RP3-381E2 on ... 42 1.8
330emb|Z84476.7|HS25J6 Human DNA sequence from clone RP1-25J6 on ch... 42 1.8
331emb|Z83846.1|HS415G2 Human DNA sequence from clone CTA-415G2 on ... 42 1.8
332gb|AC155718.4| Mus musculus 10 BAC RP24-217J7 (Roswell Park Canc... 42 1.8
333emb|AL731556.11| Human DNA sequence from clone RP11-428P16 on ch... 42 1.8
334gb|BC028054.1| Homo sapiens serine/arginine repetitive matrix 2,... 42 1.8
335emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on c... 42 1.8
336emb|AL662871.9| Human DNA sequence from clone XXbac-322C17 on ch... 42 1.8
337emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chr... 42 1.8
338emb|AL671862.6| Human DNA sequence from clone RP11-810H18 on chr... 42 1.8
339emb|AL606527.6| Human DNA sequence from clone RP11-454G24 on chr... 42 1.8
340emb|AL662859.5| Human DNA sequence from clone XXbac-196D17 on ch... 42 1.8
341emb|AL662865.4| Human DNA sequence from clone XXbac-216M5 on chr... 42 1.8
342emb|AL591475.9| Human DNA sequence from clone RP11-314C16 on chr... 42 1.8
343emb|AL513191.4| Human DNA sequence from clone RP11-224F24 on chr... 42 1.8
344emb|AL359205.15| Human DNA sequence from clone RP11-345N16 on ch... 42 1.8
345emb|AL355137.23| Human DNA sequence from clone RP11-511D14 on ch... 42 1.8
346emb|AL356357.22| Human DNA sequence from clone RP4-550F15 on chr... 42 1.8
347gb|AC111653.8| Rattus norvegicus 2 BAC CH230-108E11 (Children's ... 42 1.8
348gb|AC105631.4| Rattus norvegicus 1 BAC CH230-132J4 (Children's H... 42 1.8
349emb|AL162456.14| Human DNA sequence from clone RP11-95C14 on chr... 42 1.8
350ref|XM_795364.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 42 1.8
351emb|AL159977.10| Human DNA sequence from clone RP11-428O18 on ch... 42 1.8
352emb|AL139136.17| Human DNA sequence from clone RP11-53I24 on chr... 42 1.8
353gb|AC129292.4| Mus musculus chromosome 5 clone RP24-507A8, compl... 42 1.8
354emb|AL136377.15| Human DNA sequence from clone RP5-830A10 on chr... 42 1.8
355gb|AC016942.13| Homo sapiens 3 BAC RP11-536K4 (Roswell Park Canc... 42 1.8
356emb|AL133553.9| Human DNA sequence from clone GS1-174L6 on chrom... 42 1.8
357gb|AC158565.2| Mus musculus chromosome 15, clone RP24-354O12, co... 42 1.8
358emb|AL023807.6|HS525L6 Human DNA sequence from clone RP3-525L6 o... 42 1.8
359emb|AL009183.10|HS892F13 Human DNA sequence from clone RP5-892F1... 42 1.8
360emb|CR936965.7| Human DNA sequence from clone DAMA-219M18 on chr... 42 1.8
361emb|AL833672.1|HSM804985 Homo sapiens mRNA; cDNA DKFZp667L0421 (... 42 1.8
362gb|AY150382.1| Arabidopsis thaliana putative peroxidase (At3g282... 42 1.8
363gb|AC134407.6| Homo sapiens chromosome 17, clone RP11-855A2, com... 42 1.8
364gb|AC130459.2| Homo sapiens chromosome 16 clone CTA-427H10, comp... 42 1.8
365gb|AY034973.1| Arabidopsis thaliana putative peroxidase (At3g282... 42 1.8
366emb|CR380959.1| Candida glabrata strain CBS138 chromosome M comp... 42 1.8
367gb|AC157572.4| Mus musculus BAC clone RP23-79O10 from chromosome... 42 1.8
368gb|AC151985.2| Mus musculus BAC clone RP23-381C14 from chromosom... 42 1.8
369gb|AC161447.6| Mus musculus BAC clone RP24-333C14 from chromosom... 42 1.8
370gb|AC006454.4| Homo sapiens PAC clone RP5-852P6 from 7, complete... 42 1.8
371emb|BX883045.1| Rattus norvegicus chromosome 20, major histocomp... 42 1.8
372emb|AL606805.21| Mouse DNA sequence from clone RP23-449F16 on ch... 42 1.8
373emb|AL671968.17| Mouse DNA sequence from clone RP23-191E3 on chr... 42 1.8
374gb|AC159277.3| Mus musculus BAC clone RP23-356J2 from chromosome... 42 1.8
375gb|DQ108579.1| Corchorus olitorius SSR marker J181-M13F genomic ... 42 1.8
376emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 1.8
377gb|AC132086.4| Mus musculus BAC clone RP24-556M16 from chromosom... 42 1.8
378gb|BC026075.2| Homo sapiens chromosome 12 open reading frame 12,... 42 1.8
379gb|BC027600.2| Homo sapiens chromosome 12 open reading frame 12,... 42 1.8
380emb|AL669849.19| Mouse DNA sequence from clone RP23-341O22 on ch... 42 1.8
381emb|AL672236.18| Mouse DNA sequence from clone RP23-206L21 on ch... 42 1.8
382emb|AL669937.11| Mouse DNA sequence from clone DN-358O3 on chrom... 42 1.8
383emb|AL669869.10| Mouse DNA sequence from clone RP23-198E14 on ch... 42 1.8
384gb|BC062659.1| Homo sapiens potassium large conductance calcium-... 42 1.8
385gb|BC024965.1| Homo sapiens potassium large conductance calcium-... 42 1.8
386emb|AL607072.15| Mouse DNA sequence from clone RP23-81E16 on chr... 42 1.8
387gb|BC009695.1| Homo sapiens potassium large conductance calcium-... 42 1.8
388emb|AL161516.2|ATCHRIV28 Arabidopsis thaliana DNA chromosome 4, ... 42 1.8
389emb|AL049482.1|ATF17A8 Arabidopsis thaliana DNA chromosome 4, BA... 42 1.8
390gb|AC100400.10| Mus musculus chromosome 15, clone RP23-134E16, c... 42 1.8
391emb|AJ315532.1|HSA315532 Homo sapiens mRNA for NG36/G9a protein 42 1.8
392gb|AC163436.3| Mus musculus chromosome 1, clone RP23-102H12, com... 42 1.8
393emb|CR759942.12| Human DNA sequence from clone DAAP-182E11 on ch... 42 1.8
394gb|AC164171.5| Mus musculus 10 BAC RP24-574G7 (Roswell Park Canc... 42 1.8
395gb|AF330005.1|AF330003S3 Mus musculus USG protein (USG) gene, ex... 42 1.8
396emb|CR936237.6| Human DNA sequence from clone DAAP-66K18 on chro... 42 1.8
397emb|CR936852.6| Mouse DNA sequence from clone RP23-84I16 on chro... 42 1.8
398gb|AC165068.2| Phakopsora pachyrhizi clone JGIAFNA-605H7, comple... 42 1.8
399gb|AC164579.5| Mus musculus 6 BAC RP23-384P24 (Roswell Park Canc... 42 1.8
400emb|AL645569.21| Mouse DNA sequence from clone RP23-96I9 on chro... 42 1.8
401emb|AL645969.20| Mouse DNA sequence from clone RP23-101H2 on chr... 42 1.8
402emb|AL645965.8| Mouse DNA sequence from clone RP23-65I14 on chro... 42 1.8
403emb|AL929280.6| Mouse DNA sequence from clone RP23-67M20 on chro... 42 1.8
404emb|AL683802.5| Mouse DNA sequence from clone RP23-247G3 on chro... 42 1.8
405emb|AL596182.28| Mouse DNA sequence from clone RP23-303F24 on ch... 42 1.8
406emb|CR933731.5| Mouse DNA sequence from clone DN-160I24 on chrom... 42 1.8
407emb|BX640855.1|HSM806970 Homo sapiens genomic DNA; cDNA DKFZp686... 42 1.8
408gb|AC161570.6| Mus musculus chromosome 5, clone RP23-36O9, compl... 42 1.8
409emb|AL844494.41| Mouse DNA sequence from clone RP23-304I1 on chr... 42 1.8
410gb|BC098651.1| Rattus norvegicus Na+ dependent glucose transport... 42 1.8
411emb|CR788238.10| Human DNA sequence from clone DAMC-45E14 on chr... 42 1.8
412gb|AC163642.3| Mus musculus BAC clone RP24-456N17 from chromosom... 42 1.8
413gb|AC158143.6| Mus musculus chromosome 5, clone RP23-409I5, comp... 42 1.8
414emb|CR759784.6| Human DNA sequence from clone DAMC-303C24 on chr... 42 1.8
415gb|AC113985.11| Mus musculus chromosome 6, clone RP24-103E20, co... 42 1.8
416emb|BX666061.27| Mouse DNA sequence from clone RP24-427A22 on ch... 42 1.8
417emb|AL731844.18| Mouse DNA sequence from clone RP23-153K9 on chr... 42 1.8
418emb|BX005460.8| Human DNA sequence from clone DASS-36P22 on chro... 42 1.8
419gb|AC163282.3| Mus musculus BAC clone RP23-454I20 from chromosom... 42 1.8
420gb|AC154763.2| Mus musculus BAC clone RP24-422J16 from chromosom... 42 1.8
421emb|CR388219.12| Human DNA sequence from clone DADB-122G4 on chr... 42 1.8
422gb|AC013549.9| Homo sapiens chromosome 11, clone RP11-47J17, com... 42 1.8
423gb|AC159323.3| Mus musculus BAC clone RP23-6I8 from chromosome 1... 42 1.8
424gb|AC080038.5| Homo sapiens chromosome 17, clone CTD-3035K23, co... 42 1.8
425gb|AC117532.2| Homo sapiens chromosome 5 clone RP11-648M2, compl... 42 1.8
426gb|AC108685.4| Homo sapiens X BAC RP11-323F16 (Roswell Park Canc... 42 1.8
427gb|AC022780.19| Mus musculus chromosome 11, clone RP23-179C3, co... 42 1.8
428emb|CR627384.1| Homo sapiens mRNA; cDNA DKFZp781N1049 (from clon... 42 1.8
429gb|AC027319.5| Homo sapiens chromosome 19 clone CTC-518P12, comp... 42 1.8
430ref|NM_018034.2| Homo sapiens WD repeat domain 70 (WDR70), mRNA 42 1.8
431gb|AC022046.11| Homo sapiens chromosome , clone RP11-13L22, comp... 42 1.8
432gb|AC022098.9| Homo sapiens chromosome 19 clone CTB-55O6, comple... 42 1.8
433gb|AC111654.6| Rattus norvegicus Chr BAC CH230-108G17 (Children'... 42 1.8
434dbj|AK131434.1| Homo sapiens cDNA FLJ16561 fis, clone SYNOV40039... 42 1.8
435dbj|AK126129.1| Homo sapiens cDNA FLJ44141 fis, clone THYMU2016204 42 1.8
436gb|AC023694.4| Drosophila melanogaster X BAC RP98-18B11 (Roswell... 42 1.8
437ref|NM_005807.2| Homo sapiens proteoglycan 4 (PRG4), mRNA 42 1.8
438gb|AC087559.69| Mus musculus strain C57BL/6J clone rp23-355o11 m... 42 1.8
439gb|AC108116.2| Homo sapiens chromosome 5 clone RP11-318B23, comp... 42 1.8
440dbj|AK056655.1| Homo sapiens cDNA FLJ32093 fis, clone OCBBF2000904 42 1.8
441gb|AC105923.6| Homo sapiens BAC clone RP11-641A24 from 4, comple... 42 1.8
442ref|NM_153409.2| Mus musculus RIKEN cDNA A330102K23 gene (A33010... 42 1.8
443ref|NM_024969.2| Homo sapiens TGF-beta induced apoptosis protein... 42 1.8
444gb|AC073761.4| Mus musculus chromosome 17 clone RP23-33K21, comp... 42 1.8
445dbj|AK021765.1| Homo sapiens cDNA FLJ11703 fis, clone HEMBA1005075 42 1.8
446dbj|AK001095.1| Homo sapiens cDNA FLJ10233 fis, clone HEMBB1000266 42 1.8
447ref|NM_212463.1| Rattus norvegicus euchromatic histone lysine N-... 42 1.8
448gb|AC108358.3| Homo sapiens X BAC RP11-420H7 (Roswell Park Cance... 42 1.8
449gb|AC113223.3| Homo sapiens X BAC RP13-597O16 (Roswell Park Canc... 42 1.8
450gb|AC093431.2| Homo sapiens chromosome 1 clone RP11-574N2, compl... 42 1.8
451gb|AY093375.1| Arabidopsis thaliana unknown protein (At1g68140) ... 42 1.8
452gb|AC090857.8| Homo sapiens chromosome 11, clone RP11-670N15, co... 42 1.8
453gb|AC093183.3| Homo sapiens chromosome 7 clone RP11-786I1, compl... 42 1.8
454gb|AC078873.22| Homo sapiens 12q BAC RP11-916O13 (Roswell Park C... 42 1.8
455gb|AC108157.3| Homo sapiens BAC clone RP11-580P21 from 4, comple... 42 1.8
456gb|AC079845.31| Mus musculus clone rp23-461a12, complete sequence 42 1.8
457gb|AC164078.4| Mus musculus chromosome 3, clone RP23-123C15, com... 42 1.8
458gb|AC090685.8| Homo sapiens chromosome 17, clone RP11-252O24, co... 42 1.8
459dbj|AK154992.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 42 1.8
460dbj|AK148805.1| Mus musculus 2 days neonate sympathetic ganglion... 42 1.8
461gb|AC074139.4| Homo sapiens chromosome 19 clone LLNLF-144G11, co... 42 1.8
462dbj|AK156909.1| Mus musculus activated spleen cDNA, RIKEN full-l... 42 1.8
463ref|XM_694839.1| PREDICTED: Danio rerio hypothetical protein LOC... 42 1.8
464ref|XM_936383.1| PREDICTED: Homo sapiens similar to hydrocephalu... 42 1.8
465dbj|AK158873.1| Mus musculus visual cortex cDNA, RIKEN full-leng... 42 1.8
466gb|AC067794.5| Homo sapiens chromosome 11, clone RP11-558L11, co... 42 1.8
467gb|AC099495.2| Homo sapiens chromosome 16 clone RP11-1145B23, co... 42 1.8
468gb|AC091060.10| Homo sapiens chromosome 18, clone RP11-723J4, co... 42 1.8
469ref|XM_694664.1| PREDICTED: Danio rerio similar to PYRIN-contain... 42 1.8
470ref|XM_694453.1| PREDICTED: Danio rerio similar to PYRIN-contain... 42 1.8
471gb|AY062576.1| Arabidopsis thaliana Unknown protein (At1g68140; ... 42 1.8
472ref|NM_002247.2| Homo sapiens potassium large conductance calciu... 42 1.8
473ref|NM_001014797.1| Homo sapiens potassium large conductance cal... 42 1.8
474gb|AF332093.1|AF332093 White spot syndrome virus, complete genome 42 1.8
475dbj|AK160871.1| Mus musculus adult male brain cDNA, RIKEN full-l... 42 1.8
476gb|AC010230.6| Homo sapiens chromosome 5 clone CTC-313D10, compl... 42 1.8
477gb|DQ311323.1| Bombyx mori troponin T mRNA, complete cds 42 1.8
478dbj|AK170818.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 42 1.8
479ref|XM_689540.1| PREDICTED: Danio rerio similar to CG12531-PA (L... 42 1.8
480ref|XM_681135.1| PREDICTED: Danio rerio similar to MGC108319 pro... 42 1.8
481gb|AC158525.2| Mus musculus BAC clone RP23-367E3 from chromosome... 42 1.8
482emb|AL929393.8| Mouse DNA sequence from clone RP23-94P7 on chrom... 42 1.8
483gb|AC161113.2| Mus musculus BAC clone RP24-362N9 from chromosome... 42 1.8
484gb|AC103367.11| Mus musculus chromosome 18, clone RP24-127F15, c... 42 1.8
485gb|AC162311.7| Mus musculus 6 BAC RP23-81K19 (Roswell Park Cance... 42 1.8
486gb|AC158313.7| Mus musculus chromosome 8, clone RP23-246H16, com... 42 1.8
487gb|AC157498.2| Pan troglodytes BAC clone CH251-412M6 from chromo... 42 1.8
488gb|AC106505.4| Rattus norvegicus 1 BAC CH230-206C20 (Children's ... 42 1.8
489ref|NG_005166.1| Mus musculus protein phosphatase 4, regulatory ... 42 1.8
490gb|BC020970.1| Homo sapiens euchromatic histone-lysine N-methylt... 42 1.8
491gb|BC018718.1| Homo sapiens euchromatic histone-lysine N-methylt... 42 1.8
492gb|BC002686.1| Homo sapiens euchromatic histone-lysine N-methylt... 42 1.8
493gb|BC009351.1| Homo sapiens euchromatic histone-lysine N-methylt... 42 1.8
494gb|AC084272.41| Mus musculus strain C57BL/6J clone rp23-11g21 ma... 42 1.8
495gb|AC127352.5| Mus musculus BAC clone RP23-81P4 from chromosome ... 42 1.8
496gb|AC159818.2| Mus musculus BAC clone RP23-244M3 from chromosome... 42 1.8
497gb|AC158394.2| Mus musculus BAC clone RP23-406A1 from chromosome... 42 1.8
498gb|AC121565.4| Mus musculus BAC clone RP23-223J11 from chromosom... 42 1.8
499gb|AC154295.2| Mus musculus BAC clone RP23-431G3 from chromosome... 42 1.8
500gb|AC153650.4| Mus musculus BAC clone RP24-93I18 from chromosome... 42 1.8

>emb|AJ290421.1|HVU290421 Hordeum vulgare mRNA for BAX inhibitor 1 (pBI-1 gene)
          Length = 744

 Score =  460 bits (232), Expect = e-126
 Identities = 235/236 (99%)
 Strand = Plus / Plus

                                                                       
Query: 2   cctctggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatgg 61
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509 cctctggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatgg 568

                                                                       
Query: 62  tgtacgacacgcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagc 121
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 569 tgtacgacacgcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagc 628

                                                                       
Query: 122 acgccctcaccctcttcaccgactttgttgccgtcctcgtccgagtcctcatcatcatgc 181
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 629 acgccctcaccctcttcaccgactttgttgccgtcctcgtccgagtcctcatcatcatgc 688

                                                                   
Query: 182 tcaagaacgcaggcgacaagtcggaggacaagaagaagaggaagaggaggtcctga 237
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 689 tcaagaacgcaggcgacaagtcggaggacaagaagaagaggaagagggggtcctga 744



to top

>ref|XM_463955.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 555

 Score =  289 bits (146), Expect = 5e-75
 Identities = 203/222 (91%)
 Strand = Plus / Plus

                                                                       
Query: 7   ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtac 66
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 328 ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtat 387

                                                                       
Query: 67  gacacgcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagcacgcc 126
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||| 
Sbjct: 388 gacacgcaggagatcatcgagagggctcaccacggtgacatggactacatcaagcacgca 447

                                                                       
Query: 127 ctcaccctcttcaccgactttgttgccgtcctcgtccgagtcctcatcatcatgctcaag 186
           |||||||||||||| ||||| || |||||||| |||||  ||||| ||||||||||||||
Sbjct: 448 ctcaccctcttcactgacttcgtggccgtccttgtccggatcctcgtcatcatgctcaag 507

                                                     
Query: 187 aacgcaggcgacaagtcggaggacaagaagaagaggaagagg 228
           |||||    |||||||||||||| ||||||| || |||||||
Sbjct: 508 aacgcgtctgacaagtcggaggagaagaagaggaagaagagg 549



to top

>ref|XM_463954.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1071

 Score =  289 bits (146), Expect = 5e-75
 Identities = 203/222 (91%)
 Strand = Plus / Plus

                                                                       
Query: 7   ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtac 66
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 551 ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtat 610

                                                                       
Query: 67  gacacgcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagcacgcc 126
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||| 
Sbjct: 611 gacacgcaggagatcatcgagagggctcaccacggtgacatggactacatcaagcacgca 670

                                                                       
Query: 127 ctcaccctcttcaccgactttgttgccgtcctcgtccgagtcctcatcatcatgctcaag 186
           |||||||||||||| ||||| || |||||||| |||||  ||||| ||||||||||||||
Sbjct: 671 ctcaccctcttcactgacttcgtggccgtccttgtccggatcctcgtcatcatgctcaag 730

                                                     
Query: 187 aacgcaggcgacaagtcggaggacaagaagaagaggaagagg 228
           |||||    |||||||||||||| ||||||| || |||||||
Sbjct: 731 aacgcgtctgacaagtcggaggagaagaagaggaagaagagg 772



to top

>ref|XM_507433.1| PREDICTED Oryza sativa (japonica cultivar-group), P0482F12.1-1 mRNA
          Length = 1168

 Score =  289 bits (146), Expect = 5e-75
 Identities = 203/222 (91%)
 Strand = Plus / Plus

                                                                       
Query: 7   ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtac 66
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 662 ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtat 721

                                                                       
Query: 67  gacacgcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagcacgcc 126
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||| 
Sbjct: 722 gacacgcaggagatcatcgagagggctcaccacggtgacatggactacatcaagcacgca 781

                                                                       
Query: 127 ctcaccctcttcaccgactttgttgccgtcctcgtccgagtcctcatcatcatgctcaag 186
           |||||||||||||| ||||| || |||||||| |||||  ||||| ||||||||||||||
Sbjct: 782 ctcaccctcttcactgacttcgtggccgtccttgtccggatcctcgtcatcatgctcaag 841

                                                     
Query: 187 aacgcaggcgacaagtcggaggacaagaagaagaggaagagg 228
           |||||    |||||||||||||| ||||||| || |||||||
Sbjct: 842 aacgcgtctgacaagtcggaggagaagaagaggaagaagagg 883



to top

>ref|XM_506699.2| PREDICTED Oryza sativa (japonica cultivar-group), P0482F12.1-1 mRNA
          Length = 1193

 Score =  289 bits (146), Expect = 5e-75
 Identities = 203/222 (91%)
 Strand = Plus / Plus

                                                                       
Query: 7   ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtac 66
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 673 ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtat 732

                                                                       
Query: 67  gacacgcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagcacgcc 126
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||| 
Sbjct: 733 gacacgcaggagatcatcgagagggctcaccacggtgacatggactacatcaagcacgca 792

                                                                       
Query: 127 ctcaccctcttcaccgactttgttgccgtcctcgtccgagtcctcatcatcatgctcaag 186
           |||||||||||||| ||||| || |||||||| |||||  ||||| ||||||||||||||
Sbjct: 793 ctcaccctcttcactgacttcgtggccgtccttgtccggatcctcgtcatcatgctcaag 852

                                                     
Query: 187 aacgcaggcgacaagtcggaggacaagaagaagaggaagagg 228
           |||||    |||||||||||||| ||||||| || |||||||
Sbjct: 853 aacgcgtctgacaagtcggaggagaagaagaggaagaagagg 894



to top

>dbj|AB025926.3| Oryza sativa BI-1 mRNA for Bax inhibitor-1, complete cds
          Length = 1181

 Score =  289 bits (146), Expect = 5e-75
 Identities = 203/222 (91%)
 Strand = Plus / Plus

                                                                       
Query: 7   ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtac 66
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 648 ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtat 707

                                                                       
Query: 67  gacacgcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagcacgcc 126
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||| 
Sbjct: 708 gacacgcaggagatcatcgagagggctcaccacggtgacatggactacatcaagcacgca 767

                                                                       
Query: 127 ctcaccctcttcaccgactttgttgccgtcctcgtccgagtcctcatcatcatgctcaag 186
           |||||||||||||| ||||| || |||||||| |||||  ||||| ||||||||||||||
Sbjct: 768 ctcaccctcttcactgacttcgtggccgtccttgtccggatcctcgtcatcatgctcaag 827

                                                     
Query: 187 aacgcaggcgacaagtcggaggacaagaagaagaggaagagg 228
           |||||    |||||||||||||| ||||||| || |||||||
Sbjct: 828 aacgcgtctgacaagtcggaggagaagaagaggaagaagagg 869



to top

>dbj|AK101060.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033022C21, full
           insert sequence
          Length = 1193

 Score =  289 bits (146), Expect = 5e-75
 Identities = 203/222 (91%)
 Strand = Plus / Plus

                                                                       
Query: 7   ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtac 66
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 673 ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtat 732

                                                                       
Query: 67  gacacgcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagcacgcc 126
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||| 
Sbjct: 733 gacacgcaggagatcatcgagagggctcaccacggtgacatggactacatcaagcacgca 792

                                                                       
Query: 127 ctcaccctcttcaccgactttgttgccgtcctcgtccgagtcctcatcatcatgctcaag 186
           |||||||||||||| ||||| || |||||||| |||||  ||||| ||||||||||||||
Sbjct: 793 ctcaccctcttcactgacttcgtggccgtccttgtccggatcctcgtcatcatgctcaag 852

                                                     
Query: 187 aacgcaggcgacaagtcggaggacaagaagaagaggaagagg 228
           |||||    |||||||||||||| ||||||| || |||||||
Sbjct: 853 aacgcgtctgacaagtcggaggagaagaagaggaagaagagg 894



to top

>dbj|AK061953.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-F03, full
           insert sequence
          Length = 1168

 Score =  289 bits (146), Expect = 5e-75
 Identities = 203/222 (91%)
 Strand = Plus / Plus

                                                                       
Query: 7   ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtac 66
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 662 ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtat 721

                                                                       
Query: 67  gacacgcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagcacgcc 126
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||| 
Sbjct: 722 gacacgcaggagatcatcgagagggctcaccacggtgacatggactacatcaagcacgca 781

                                                                       
Query: 127 ctcaccctcttcaccgactttgttgccgtcctcgtccgagtcctcatcatcatgctcaag 186
           |||||||||||||| ||||| || |||||||| |||||  ||||| ||||||||||||||
Sbjct: 782 ctcaccctcttcactgacttcgtggccgtccttgtccggatcctcgtcatcatgctcaag 841

                                                     
Query: 187 aacgcaggcgacaagtcggaggacaagaagaagaggaagagg 228
           |||||    |||||||||||||| ||||||| || |||||||
Sbjct: 842 aacgcgtctgacaagtcggaggagaagaagaggaagaagagg 883



to top

>dbj|AK061564.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-E05, full
           insert sequence
          Length = 1071

 Score =  289 bits (146), Expect = 5e-75
 Identities = 203/222 (91%)
 Strand = Plus / Plus

                                                                       
Query: 7   ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtac 66
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 551 ggcagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtat 610

                                                                       
Query: 67  gacacgcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagcacgcc 126
           |||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||| 
Sbjct: 611 gacacgcaggagatcatcgagagggctcaccacggtgacatggactacatcaagcacgca 670

                                                                       
Query: 127 ctcaccctcttcaccgactttgttgccgtcctcgtccgagtcctcatcatcatgctcaag 186
           |||||||||||||| ||||| || |||||||| |||||  ||||| ||||||||||||||
Sbjct: 671 ctcaccctcttcactgacttcgtggccgtccttgtccggatcctcgtcatcatgctcaag 730

                                                     
Query: 187 aacgcaggcgacaagtcggaggacaagaagaagaggaagagg 228
           |||||    |||||||||||||| ||||||| || |||||||
Sbjct: 731 aacgcgtctgacaagtcggaggagaagaagaggaagaagagg 772



to top

>gb|AY105656.1| Zea mays PCO153521 mRNA sequence
          Length = 1096

 Score =  246 bits (124), Expect = 6e-62
 Identities = 197/220 (89%), Gaps = 1/220 (0%)
 Strand = Plus / Plus

                                                                       
Query: 9   cagcttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtacga 68
           |||||||||||| ||||| ||||| || ||| | ||||||||||| ||| ||||||||||
Sbjct: 605 cagcttcatgttcgaggtctacttcgggctgctcatcttcctgggctacgtggtgtacga 664

                                                                       
Query: 69  cacgcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagcacgccct 128
           |||||||||||||||||||||||||||||  |||||||||||| || |||||||||||||
Sbjct: 665 cacgcaggagatcatcgagagggcgcaccgcggcgacatggaccacgtcaagcacgccct 724

                                                                       
Query: 129 caccctcttcaccgactttgttgccgtcctcgtccgagtcctcatcatcatgctc-aaga 187
           |||||||||||| ||||| || |||||||||||||| |||||| ||||||||||| ||||
Sbjct: 725 caccctcttcacagacttcgtggccgtcctcgtccgcgtcctcgtcatcatgctcaaaga 784

                                                   
Query: 188 acgcaggcgacaagtcggaggacaagaagaagaggaagag 227
           |||  | ||||||||||||||||||||||| || ||||||
Sbjct: 785 acggggccgacaagtcggaggacaagaagaggaagaagag 824



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  218 bits (110), Expect = 1e-53
 Identities = 146/158 (92%)
 Strand = Plus / Plus

                                                                           
Query: 23      aggtttactttggcctgttgatcttcctggggtacatggtgtacgacacgcaggagatca 82
               ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 1329674 aggtttactttggcctgttgatcttcctggggtacatggtgtatgacacgcaggagatca 1329733

                                                                           
Query: 83      tcgagagggcgcaccatggcgacatggactacatcaagcacgccctcaccctcttcaccg 142
               |||||||||| ||||| || ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 1329734 tcgagagggctcaccacggtgacatggactacatcaagcacgcactcaccctcttcactg 1329793

                                                     
Query: 143     actttgttgccgtcctcgtccgagtcctcatcatcatg 180
               |||| || |||||||| |||||  ||||| ||||||||
Sbjct: 1329794 acttcgtggccgtccttgtccggatcctcgtcatcatg 1329831



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 196     gacaagtcggaggacaagaagaagaggaagagg 228
               |||||||||||||| ||||||| || |||||||
Sbjct: 1329974 gacaagtcggaggagaagaagaggaagaagagg 1330006



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 7       ggcagcttcatgtttgaggt 26
               ||||||||||||||||||||
Sbjct: 1329562 ggcagcttcatgtttgaggt 1329581



to top

>dbj|AP005311.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0482F12
          Length = 147735

 Score =  218 bits (110), Expect = 1e-53
 Identities = 146/158 (92%)
 Strand = Plus / Plus

                                                                         
Query: 23    aggtttactttggcctgttgatcttcctggggtacatggtgtacgacacgcaggagatca 82
             ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 10946 aggtttactttggcctgttgatcttcctggggtacatggtgtatgacacgcaggagatca 11005

                                                                         
Query: 83    tcgagagggcgcaccatggcgacatggactacatcaagcacgccctcaccctcttcaccg 142
             |||||||||| ||||| || ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 11006 tcgagagggctcaccacggtgacatggactacatcaagcacgcactcaccctcttcactg 11065

                                                   
Query: 143   actttgttgccgtcctcgtccgagtcctcatcatcatg 180
             |||| || |||||||| |||||  ||||| ||||||||
Sbjct: 11066 acttcgtggccgtccttgtccggatcctcgtcatcatg 11103



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 196   gacaagtcggaggacaagaagaagaggaagagg 228
             |||||||||||||| ||||||| || |||||||
Sbjct: 11246 gacaagtcggaggagaagaagaggaagaagagg 11278



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     ggcagcttcatgtttgaggt 26
             ||||||||||||||||||||
Sbjct: 10834 ggcagcttcatgtttgaggt 10853



to top

>gb|BT018201.1| Zea mays clone EL01N0559D10.c mRNA sequence
          Length = 1127

 Score =  194 bits (98), Expect = 2e-46
 Identities = 128/138 (92%)
 Strand = Plus / Plus

                                                                       
Query: 43  atcttcctggggtacatggtgtacgacacgcaggagatcatcgagagggcgcaccatggc 102
           ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||  |||
Sbjct: 574 atcttcctgggctacgtggtgtacgacacgcaggagatcatcgagagggcgcaccgcggc 633

                                                                       
Query: 103 gacatggactacatcaagcacgccctcaccctcttcaccgactttgttgccgtcctcgtc 162
           ||||||||| || ||||||||||||||||||||||||||||||| || ||||||||||||
Sbjct: 634 gacatggaccacgtcaagcacgccctcaccctcttcaccgacttcgtggccgtcctcgtc 693

                             
Query: 163 cgagtcctcatcatcatg 180
           || |||||| ||||||||
Sbjct: 694 cgcgtcctcgtcatcatg 711



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 45/49 (91%)
 Strand = Plus / Plus

                                                            
Query: 180 gctcaagaacgcaggcgacaagtcggaggacaagaagaagaggaagagg 228
           |||||||||||| | ||||||||||||||||||||||| || |||||||
Sbjct: 871 gctcaagaacgcggccgacaagtcggaggacaagaagaggaagaagagg 919



to top

>gb|AY107681.1| Zea mays PCO116018 mRNA sequence
          Length = 978

 Score =  153 bits (77), Expect = 7e-34
 Identities = 125/141 (88%)
 Strand = Plus / Plus

                                                                       
Query: 12  cttcatgtttgaggtttactttggcctgttgatcttcctggggtacatggtgtacgacac 71
           ||||||||||||| | |||||||||||  || | |||||||| || |||||||  |||||
Sbjct: 602 cttcatgtttgagctctactttggcctcctggttttcctgggatatatggtgtttgacac 661

                                                                       
Query: 72  gcaggagatcatcgagagggcgcaccatggcgacatggactacatcaagcacgccctcac 131
            ||||||||||||||||||||||||| ||| ||||||||||||||||||||||| || ||
Sbjct: 662 ccaggagatcatcgagagggcgcaccgtggggacatggactacatcaagcacgcgctgac 721

                                
Query: 132 cctcttcaccgactttgttgc 152
            ||||||||||||||||||||
Sbjct: 722 tctcttcaccgactttgttgc 742



to top

>gb|AC157610.2| Mus musculus chromosome 15, clone RP23-77H12, complete sequence
          Length = 164913

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 204    ggaggacaagaagaagaggaagaggagg 231
              |||||| |||||||||||||||||||||
Sbjct: 102566 ggaggagaagaagaagaggaagaggagg 102593



to top

>gb|AC131781.3| Mus musculus BAC clone RP24-344J9 from chromosome 15, complete sequence
          Length = 139338

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 204    ggaggacaagaagaagaggaagaggagg 231
              |||||| |||||||||||||||||||||
Sbjct: 117707 ggaggagaagaagaagaggaagaggagg 117734



to top

>gb|AC121137.18| Mus musculus chromosome 14, clone RP23-406K12, complete sequence
          Length = 164557

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 204   ggaggacaagaagaagaggaagaggagg 231
             |||||| |||||||||||||||||||||
Sbjct: 91827 ggaggagaagaagaagaggaagaggagg 91800



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 91939 aagaagaagaggaagaggagg 91919



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 91855 aagaagaagaggaagaggagg 91835



to top

>gb|AC122418.4| Mus musculus BAC clone RP24-159E6 from chromosome 13, complete sequence
          Length = 221980

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 207   ggacaagaagaagaggaagaggag 230
             ||||||||||||||||||||||||
Sbjct: 74257 ggacaagaagaagaggaagaggag 74280



to top

>gb|AC123944.4| Mus musculus BAC clone RP24-87F18 from chromosome 10, complete sequence
          Length = 194243

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 204    ggaggacaagaagaagaggaagaggagg 231
              |||||| |||||||||||||||||||||
Sbjct: 120908 ggaggagaagaagaagaggaagaggagg 120935



to top

>emb|AL499609.9| Human DNA sequence from clone RP11-309N23 on chromosome 1, complete
              sequence
          Length = 136515

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 204    ggaggacaagaagaagaggaagaggagg 231
              |||||| |||||||||||||||||||||
Sbjct: 120739 ggaggagaagaagaagaggaagaggagg 120766



to top

>emb|AL646050.7| Mouse DNA sequence from clone RP23-460G5 on chromosome 11 Contains a
              ribosomal protein L7 (Rpl7) pseudogene and a CpG island,
              complete sequence
          Length = 164018

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 204    ggaggacaagaagaagaggaagaggagg 231
              |||||| |||||||||||||||||||||
Sbjct: 102502 ggaggagaagaagaagaggaagaggagg 102475



to top

>gb|AC107766.14| Mus musculus chromosome 1, clone RP23-166L24, complete sequence
          Length = 182865

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 204    ggaggacaagaagaagaggaagaggagg 231
              |||||| |||||||||||||||||||||
Sbjct: 155370 ggaggagaagaagaagaggaagaggagg 155343



to top

>gb|AC099692.4| Mus musculus chromosome 13, clone RP23-198N22, complete sequence
          Length = 216362

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 207    ggacaagaagaagaggaagaggag 230
              ||||||||||||||||||||||||
Sbjct: 134901 ggacaagaagaagaggaagaggag 134924



to top

>gb|AC150682.2| Mus musculus BAC clone RP24-210N1 from 5, complete sequence
          Length = 164951

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 204  ggaggacaagaagaagaggaagaggagg 231
            |||||| |||||||||||||||||||||
Sbjct: 3767 ggaggagaagaagaagaggaagaggagg 3794



to top

>emb|AL672269.15| Mouse DNA sequence from clone RP23-57F11 on chromosome 11, complete
             sequence
          Length = 169954

 Score = 48.1 bits (24), Expect = 0.029
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 204   ggaggacaagaagaagaggaagaggagg 231
             |||||| |||||||||||||||||||||
Sbjct: 82424 ggaggagaagaagaagaggaagaggagg 82397



to top

>gb|AC097832.7| Rattus norvegicus 11 BAC CH230-68C19 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 262323

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 208    gacaagaagaagaggaagaggag 230
              |||||||||||||||||||||||
Sbjct: 130048 gacaagaagaagaggaagaggag 130070



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 487    tttggttttggtttggtttg 506
              ||||||||||||||||||||
Sbjct: 145735 tttggttttggtttggtttg 145754



to top

>gb|AC135962.4| Mus musculus BAC clone RP23-342H15 from chromosome 16, complete sequence
          Length = 202525

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 209    acaagaagaagaggaagaggagg 231
              |||||||||||||||||||||||
Sbjct: 181902 acaagaagaagaggaagaggagg 181880



to top

>gb|AC163269.3| Mus musculus chromosome 15, clone RP24-276M6, complete sequence
          Length = 172683

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 209   acaagaagaagaggaagaggagg 231
             |||||||||||||||||||||||
Sbjct: 21527 acaagaagaagaggaagaggagg 21505



to top

>gb|AC126265.3| Mus musculus BAC clone RP23-383O12 from chromosome 16, complete
             sequence
          Length = 186172

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 209   acaagaagaagaggaagaggagg 231
             |||||||||||||||||||||||
Sbjct: 31108 acaagaagaagaggaagaggagg 31086



to top

>emb|CR734140.2|CNS0GT8R Tetraodon nigroviridis full-length cDNA
          Length = 1190

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 204 ggaggacaagaagaagaggaaga 226
           |||||||||||||||||||||||
Sbjct: 11  ggaggacaagaagaagaggaaga 33



to top

>emb|CR731163.1|CNS0GR40 Tetraodon nigroviridis full-length cDNA
          Length = 1182

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 204 ggaggacaagaagaagaggaaga 226
           |||||||||||||||||||||||
Sbjct: 8   ggaggacaagaagaagaggaaga 30



to top

>emb|CR730458.2|CNS0GQKF Tetraodon nigroviridis full-length cDNA
          Length = 1175

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 204 ggaggacaagaagaagaggaaga 226
           |||||||||||||||||||||||
Sbjct: 11  ggaggacaagaagaagaggaaga 33



to top

>emb|CR730167.1|CNS0GQCD Tetraodon nigroviridis full-length cDNA
          Length = 1164

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 204 ggaggacaagaagaagaggaaga 226
           |||||||||||||||||||||||
Sbjct: 1   ggaggacaagaagaagaggaaga 23



to top

>emb|CR728214.1|CNS0GOU4 Tetraodon nigroviridis full-length cDNA
          Length = 1177

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 204 ggaggacaagaagaagaggaaga 226
           |||||||||||||||||||||||
Sbjct: 6   ggaggacaagaagaagaggaaga 28



to top

>emb|CR657128.2|CNS0F60E Tetraodon nigroviridis full-length cDNA
          Length = 1155

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 204 ggaggacaagaagaagaggaaga 226
           |||||||||||||||||||||||
Sbjct: 26  ggaggacaagaagaagaggaaga 48



to top

>emb|CR653193.2|CNS0F2Z3 Tetraodon nigroviridis full-length cDNA
          Length = 1216

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 204 ggaggacaagaagaagaggaaga 226
           |||||||||||||||||||||||
Sbjct: 17  ggaggacaagaagaagaggaaga 39



to top

>emb|CR648614.2|CNS0EZFW Tetraodon nigroviridis full-length cDNA
          Length = 1201

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 204 ggaggacaagaagaagaggaaga 226
           |||||||||||||||||||||||
Sbjct: 16  ggaggacaagaagaagaggaaga 38



to top

>emb|CR642989.2|CNS0EV3N Tetraodon nigroviridis full-length cDNA
          Length = 1186

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 204 ggaggacaagaagaagaggaaga 226
           |||||||||||||||||||||||
Sbjct: 10  ggaggacaagaagaagaggaaga 32



to top

>gb|AC152176.5| Medicago truncatula clone mth2-65c4, complete sequence
          Length = 161536

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 208    gacaagaagaagaggaagaggag 230
              |||||||||||||||||||||||
Sbjct: 133702 gacaagaagaagaggaagaggag 133680



to top

>gb|AC159748.5| Mus musculus 10 BAC RP24-363O22 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 131761

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 209   acaagaagaagaggaagaggagg 231
             |||||||||||||||||||||||
Sbjct: 49024 acaagaagaagaggaagaggagg 49046



to top

>gb|AC115699.9| Mus musculus chromosome 15, clone RP24-247B18, complete sequence
          Length = 169003

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 209   acaagaagaagaggaagaggagg 231
             |||||||||||||||||||||||
Sbjct: 37281 acaagaagaagaggaagaggagg 37303



to top

>gb|AC174458.2| Mus musculus BAC clone RP23-282D14 from chromosome 13, complete
             sequence
          Length = 205673

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 205   gaggacaagaagaagaggaagaggagg 231
             ||||| |||||||||||||||||||||
Sbjct: 52127 gaggagaagaagaagaggaagaggagg 52153



to top

>emb|AL935121.9| Mouse DNA sequence from clone RP23-432M14 on chromosome 2, complete
             sequence
          Length = 106940

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 204   ggaggacaagaagaagaggaaga 226
             |||||||||||||||||||||||
Sbjct: 32925 ggaggacaagaagaagaggaaga 32947



to top

>gb|AC124516.4| Mus musculus BAC clone RP23-387C9 from 12, complete sequence
          Length = 236774

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 205    gaggacaagaagaagaggaagaggagg 231
              ||||| |||||||||||||||||||||
Sbjct: 137935 gaggagaagaagaagaggaagaggagg 137909



to top

>ref|XM_475610.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1128

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 209 acaagaagaagaggaagaggag 230
           ||||||||||||||||||||||
Sbjct: 167 acaagaagaagaggaagaggag 188



to top

>gb|AC162466.6| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 186817

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 485   gatttggttttggtttggtttg 506
             ||||||||||||||||||||||
Sbjct: 86324 gatttggttttggtttggtttg 86303



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 206    aggacaagaagaagaggaagag 227
              ||||||||||||||||||||||
Sbjct: 422090 aggacaagaagaagaggaagag 422069



to top

>gb|AC131059.6| Mus musculus chromosome 1, clone RP24-108K12, complete sequence
          Length = 189961

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 211    aagaagaagaggaagaggaggt 232
              ||||||||||||||||||||||
Sbjct: 161728 aagaagaagaggaagaggaggt 161749



to top

>gb|AC102342.10| Mus musculus chromosome 18, clone RP23-250K3, complete sequence
          Length = 168009

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 204  ggaggacaagaagaagaggaagagga 229
            |||||| |||||||||||||||||||
Sbjct: 8618 ggaggagaagaagaagaggaagagga 8643



to top

>gb|AC140247.3| Mus musculus BAC clone RP23-469I15 from chromosome 9, complete sequence
          Length = 189336

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 204    ggaggacaagaagaagaggaagagga 229
              |||||| |||||||||||||||||||
Sbjct: 110847 ggaggagaagaagaagaggaagagga 110822



to top

>gb|AC119846.14| Mus musculus chromosome 1, clone RP23-45A13, complete sequence
          Length = 242338

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 211    aagaagaagaggaagaggaggt 232
              ||||||||||||||||||||||
Sbjct: 141736 aagaagaagaggaagaggaggt 141715



to top

>ref|XM_570767.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNE01540) partial mRNA
          Length = 2520

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 206  aggacaagaagaagaggaagag 227
            ||||||||||||||||||||||
Sbjct: 2345 aggacaagaagaagaggaagag 2366



to top

>gb|AC129609.3| Mus musculus BAC clone RP23-194H4 from chromosome 7, complete sequence
          Length = 225829

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 204   ggaggacaagaagaagaggaagagga 229
             |||||| |||||||||||||||||||
Sbjct: 75119 ggaggagaagaagaagaggaagagga 75144



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 204  ggaggacaagaagaagaggaagaggagg 231
            |||||| ||||||||||||| |||||||
Sbjct: 1827 ggaggagaagaagaagaggaggaggagg 1854



to top

>gb|AC110517.9| Mus musculus chromosome 17, clone RP23-13F15, complete sequence
          Length = 218657

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 204    ggaggacaagaagaagaggaagagga 229
              |||||| |||||||||||||||||||
Sbjct: 213062 ggaggagaagaagaagaggaagagga 213087



to top

>gb|AC124178.3| Mus musculus BAC clone RP23-193J15 from 18, complete sequence
          Length = 206833

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 204    ggaggacaagaagaagaggaagagga 229
              |||||| |||||||||||||||||||
Sbjct: 172012 ggaggagaagaagaagaggaagagga 171987



to top

>gb|AC127326.4| Mus musculus BAC clone RP23-251C4 from 8, complete sequence
          Length = 207802

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 204   ggaggacaagaagaagaggaagagga 229
             |||||| |||||||||||||||||||
Sbjct: 58085 ggaggagaagaagaagaggaagagga 58110



to top

>gb|AC121877.2| Mus musculus BAC clone RP24-127G8 from 7, complete sequence
          Length = 130451

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 485   gatttggttttggtttggtttg 506
             ||||||||||||||||||||||
Sbjct: 12654 gatttggttttggtttggtttg 12633



to top

>gb|AC098876.4| Mus musculus BAC clone RP23-1O17 from 14, complete sequence
          Length = 234499

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 485    gatttggttttggtttggtttg 506
              ||||||||||||||||||||||
Sbjct: 189077 gatttggttttggtttggtttg 189098



to top

>gb|AC007031.2| Homo sapiens BAC clone RP11-17I10 from 7, complete sequence
          Length = 47042

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 204   ggaggacaagaagaagaggaagagga 229
             ||||||||||||||||| ||||||||
Sbjct: 21789 ggaggacaagaagaagaagaagagga 21764



to top

>gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, complete sequence
          Length = 137137

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 204   ggaggacaagaagaagaggaagagga 229
             |||||| |||||||||||||||||||
Sbjct: 14773 ggaggagaagaagaagaggaagagga 14748



to top

>emb|BX005144.14| Human DNA sequence from clone DASS-125F11 on chromosome 6, complete
            sequence
          Length = 19086

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 211  aagaagaagaggaagaggaggt 232
            ||||||||||||||||||||||
Sbjct: 8686 aagaagaagaggaagaggaggt 8707



to top

>gb|AY691322.1| Ochlerotatus atropalpus vitellogenin C (Vg-C) gene, partial cds
          Length = 6248

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 211  aagaagaagaggaagaggaggt 232
            ||||||||||||||||||||||
Sbjct: 1809 aagaagaagaggaagaggaggt 1788



to top

>emb|AL606829.13| Mouse DNA sequence from clone RP23-10M12 on chromosome 11 Contains a
              novel gene (MOR280-1) similar to the olfactory receptor
              family, a novel gene (D330012D11Rik), the Zfp62 gene for
              zinc finger protein 62, the Mgat1 gene for mannoside
              acetylglucosaminyltransferase 1, a novel gene (MOR256-24)
              similar to the olfactory receptor family, a novel gene
              (MOR256-25) similar to the olfactory receptor family, a
              novel gene (LOC216715) similar to the olfactory receptor
              MOR256 family, a novel gene (MOR256-27) similar to the
              olfactory receptor family, a novel gene (MOR256-2) similar
              to the olfactory receptor family and three CpG islands,
              complete sequence
          Length = 203286

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 211    aagaagaagaggaagaggaggt 232
              ||||||||||||||||||||||
Sbjct: 108440 aagaagaagaggaagaggaggt 108419



to top

>emb|AL691470.17| Mouse DNA sequence from clone RP23-160F12 on chromosome 11 Contains the
             3' end of gene FLJ13305, a novel gene, a novel gene
             (1700061J23Rik) and a CpG island, complete sequence
          Length = 195614

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 204   ggaggacaagaagaagaggaagagga 229
             |||||| |||||||||||||||||||
Sbjct: 93736 ggaggagaagaagaagaggaagagga 93711



to top

>gb|AC163651.2| Mus musculus BAC clone RP24-358K11 from chromosome 12, complete
             sequence
          Length = 186790

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 204   ggaggacaagaagaagaggaagagga 229
             |||||| |||||||||||||||||||
Sbjct: 99686 ggaggagaagaagaagaggaagagga 99711



to top

>gb|AC011447.7| Homo sapiens chromosome 19 clone CTC-260E6, complete sequence
          Length = 165676

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 31    tttggcctgttgatcttcctgg 52
             ||||||||||||||||||||||
Sbjct: 83744 tttggcctgttgatcttcctgg 83723



to top

>emb|X73636.1|SSLILH S.scrofa gene for leydig Insulin-like hormone
          Length = 2706

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 206 aggacaagaagaagaggaagaggagg 231
           |||| |||||||||||||||||||||
Sbjct: 592 aggagaagaagaagaggaagaggagg 617



to top

>gb|AC021683.10| Homo sapiens chromosome 17, clone RP11-13K12, complete sequence
          Length = 162615

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 206    aggacaagaagaagaggaagaggagg 231
              |||| |||||||||||||||||||||
Sbjct: 127091 aggagaagaagaagaggaagaggagg 127066



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 24919 aagaagaagaggaagaggagg 24899



to top

>gb|AE008686.1|AE008686 Mus musculus T-cell receptor alpha/delta locus  section 4 of 4 of the
             complete region
          Length = 461875

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 485   gatttggttttggtttggtttg 506
             ||||||||||||||||||||||
Sbjct: 75521 gatttggttttggtttggtttg 75542



to top

>dbj|AK084939.1| Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched
           library, clone:D430017D17 product:hypothetical protein,
           full insert sequence
          Length = 3796

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 205 gaggacaagaagaagaggaaga 226
           ||||||||||||||||||||||
Sbjct: 25  gaggacaagaagaagaggaaga 4



to top

>gb|AC160402.8| Mus musculus 10 BAC RP23-115L17 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 224566

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 204  ggaggacaagaagaagaggaagagga 229
            |||||| |||||||||||||||||||
Sbjct: 6764 ggaggagaagaagaagaggaagagga 6789



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 209     acaagaagaagaggaagaggag 230
               ||||||||||||||||||||||
Sbjct: 3297356 acaagaagaagaggaagaggag 3297377



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 487      tttggttttggtttggtttg 506
                ||||||||||||||||||||
Sbjct: 25725756 tttggttttggtttggtttg 25725775



to top

>gb|AC008554.8| Homo sapiens chromosome 19 clone CTC-513N18, complete sequence
          Length = 166873

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 31    tttggcctgttgatcttcctgg 52
             ||||||||||||||||||||||
Sbjct: 49559 tttggcctgttgatcttcctgg 49580



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 31    tttggcctgttgatcttcctg 51
             |||||||||||||||||||||
Sbjct: 44997 tttggcctgttgatcttcctg 44977



to top

>gb|AC105186.14| Homo sapiens chromosome 8, clone CTD-2323A1, complete sequence
          Length = 114669

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 486   atttggttttggtttggtttgc 507
             ||||||||||||||||||||||
Sbjct: 39745 atttggttttggtttggtttgc 39766



to top

>gb|AC104981.9| Homo sapiens chromosome 17, clone RP11-316M20, complete sequence
          Length = 193181

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 206    aggacaagaagaagaggaagaggagg 231
              |||| |||||||||||||||||||||
Sbjct: 183088 aggagaagaagaagaggaagaggagg 183113



to top

>gb|AC135608.7| Mus musculus strain C57BL/6J clone rp23-408d14, complete sequence
          Length = 213801

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 204   ggaggacaagaagaagaggaagagga 229
             |||||| |||||||||||||||||||
Sbjct: 73393 ggaggagaagaagaagaggaagagga 73418



to top

>dbj|BS000023.1| Pan troglodytes chromosome 22 clone:PTB-018G23, map 22, complete
              sequences
          Length = 135513

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 206    aggacaagaagaagaggaagaggagg 231
              |||| |||||||||||||||||||||
Sbjct: 109968 aggaaaagaagaagaggaagaggagg 109943



to top

>emb|CT010479.25| Mouse DNA sequence from clone RP23-233G23 on chromosome 17, complete
             sequence
          Length = 203311

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 204   ggaggacaagaagaagaggaagagga 229
             |||||| |||||||||||||||||||
Sbjct: 57630 ggaggagaagaagaagaggaagagga 57655



to top

>emb|AL450341.10| Mouse DNA sequence from clone RP23-401L17 on chromosome 2, complete
             sequence
          Length = 214573

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 204   ggaggacaagaagaagaggaagagga 229
             |||||| |||||||||||||||||||
Sbjct: 49418 ggaggagaagaagaagaggaagagga 49393



to top

>gb|AC166103.4| Mus musculus BAC clone RP23-339J4 from chromosome 14, complete sequence
          Length = 214477

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 485    gatttggttttggtttggtttg 506
              ||||||||||||||||||||||
Sbjct: 100867 gatttggttttggtttggtttg 100846



to top

>emb|AL808112.34| Mouse DNA sequence from clone RP23-57N22 on chromosome 4, complete
              sequence
          Length = 236158

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 204    ggaggacaagaagaagaggaagagga 229
              |||||| |||||||||||||||||||
Sbjct: 122330 ggaggagaagaagaagaggaagagga 122305



to top

>gb|AC005938.1|AC005938 Mus musculus chromosome 14 clone UWGC:mbac24 or RG:200P8 map 14D1-D2,
             complete sequence
          Length = 161871

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 485   gatttggttttggtttggtttg 506
             ||||||||||||||||||||||
Sbjct: 99199 gatttggttttggtttggtttg 99220



to top

>gb|AC132615.5| Mus musculus BAC clone RP23-301J15 from 9, complete sequence
          Length = 201718

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 204    ggaggacaagaagaagaggaagagga 229
              |||||| |||||||||||||||||||
Sbjct: 168375 ggaggagaagaagaagaggaagagga 168400



to top

>gb|AC122860.5| Mus musculus BAC clone RP23-135A22 from 12, complete sequence
          Length = 233864

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 210   caagaagaagaggaagaggagg 231
             ||||||||||||||||||||||
Sbjct: 91242 caagaagaagaggaagaggagg 91263



to top

>gb|AC132383.5| Mus musculus BAC clone RP23-434M19 from 10, complete sequence
          Length = 212242

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 204    ggaggacaagaagaagaggaagagga 229
              |||||| |||||||||||||||||||
Sbjct: 116743 ggaggagaagaagaagaggaagagga 116718



to top

>gb|AC124126.14| Mus musculus chromosome 18, clone RP23-377C8, complete sequence
          Length = 192355

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 204    ggaggacaagaagaagaggaagagga 229
              |||||| |||||||||||||||||||
Sbjct: 146958 ggaggagaagaagaagaggaagagga 146983



to top

>emb|CR936883.15| Human DNA sequence from clone DAMC-4K22 on chromosome 6, complete
             sequence
          Length = 42376

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 211   aagaagaagaggaagaggaggt 232
             ||||||||||||||||||||||
Sbjct: 14648 aagaagaagaggaagaggaggt 14669



to top

>gb|AC164160.5| Mus musculus BAC clone RP23-343P15 from chromosome 7, complete sequence
          Length = 235030

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 485    gatttggttttggtttggtttg 506
              ||||||||||||||||||||||
Sbjct: 108766 gatttggttttggtttggtttg 108745



to top

>emb|AL772349.5| Mouse DNA sequence from clone RP23-466A17 on chromosome 4, complete
              sequence
          Length = 196489

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 204    ggaggacaagaagaagaggaagagga 229
              |||||| |||||||||||||||||||
Sbjct: 160884 ggaggagaagaagaagaggaagagga 160859



to top

>emb|AL606974.9| Mouse DNA sequence from clone RP23-39E21 on chromosome 4, complete
              sequence
          Length = 232587

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 204    ggaggacaagaagaagaggaagagga 229
              |||||| |||||||||||||||||||
Sbjct: 197671 ggaggagaagaagaagaggaagagga 197696



to top

>gb|AC164161.2| Mus musculus BAC clone RP23-274G21 from chromosome 9, complete sequence
          Length = 198367

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 210    caagaagaagaggaagaggagg 231
              ||||||||||||||||||||||
Sbjct: 171221 caagaagaagaggaagaggagg 171242



to top

>gb|AC087425.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0676G05,
             complete sequence
          Length = 167317

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 209   acaagaagaagaggaagaggag 230
             ||||||||||||||||||||||
Sbjct: 91180 acaagaagaagaggaagaggag 91201



to top

>gb|AC124634.24| Mus musculus chromosome 18, clone RP23-450K16, complete sequence
          Length = 178989

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 206    aggacaagaagaagaggaagaggagg 231
              |||| |||||||||||||||||||||
Sbjct: 103212 aggagaagaagaagaggaagaggagg 103237



to top

>gb|AC168266.2| Mus musculus BAC clone RP24-245G1 from chromosome 9, complete sequence
          Length = 188778

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 204    ggaggacaagaagaagaggaagagga 229
              |||||| |||||||||||||||||||
Sbjct: 104599 ggaggagaagaagaagaggaagagga 104574



to top

>emb|AL604025.15| Mouse DNA sequence from clone RP23-455K6 on chromosome 11, complete
              sequence
          Length = 151207

 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 211    aagaagaagaggaagaggaggt 232
              ||||||||||||||||||||||
Sbjct: 143373 aagaagaagaggaagaggaggt 143394



to top

>gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, complete sequence
          Length = 214638

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 18430 aagaagaagaggaagaggagg 18450



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 18319 aagaagaagaggaagaggagg 18339



to top

>gb|AC102103.10| Mus musculus chromosome 15, clone RP23-82K1, complete sequence
          Length = 237423

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 148312 aagaagaagaggaagaggagg 148332



to top

>gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, complete sequence
          Length = 152183

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 57645 aagaagaagaggaagaggagg 57665



to top

>gb|AC129583.15| Mus musculus chromosome 15, clone RP23-197P10, complete sequence
          Length = 206094

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 191558 aagaagaagaggaagaggagg 191578



to top

>gb|AC165952.4| Mus musculus BAC clone RP23-460G24 from chromosome 14, complete
             sequence
          Length = 183416

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 14836 aagaagaagaggaagaggagg 14816



to top

>ref|NM_113739.2| Arabidopsis thaliana peroxidase AT3G28200 mRNA, complete cds
          Length = 1097

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 56  aagaagaagaggaagaggagg 36



to top

>ref|NM_001036173.1| Arabidopsis thaliana unknown protein AT1G68140 transcript variant
            AT1G68140.2 mRNA, complete cds
          Length = 1571

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 994  aagaagaagaggaagaggagg 1014



to top

>ref|NM_105484.3| Arabidopsis thaliana unknown protein AT1G68140 transcript variant
            AT1G68140.1 mRNA, complete cds
          Length = 1649

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1072 aagaagaagaggaagaggagg 1092



to top

>gb|AC166746.7| Mus musculus chromosome 19, clone RP24-248H10, complete sequence
          Length = 156084

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 5836 aagaagaagaggaagaggagg 5816



to top

>gb|AC163280.2| Mus musculus BAC clone RP23-478G5 from chromosome 14, complete sequence
          Length = 202761

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 197226 aagaagaagaggaagaggagg 197246



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    aagaagaagaggaagaggag 230
              ||||||||||||||||||||
Sbjct: 197202 aagaagaagaggaagaggag 197221



to top

>gb|AC157087.2| Mus musculus BAC clone RP23-287O24 from chromosome 9, complete sequence
          Length = 226149

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 140597 aagaagaagaggaagaggagg 140617



to top

>gb|AC167970.4| Mus musculus BAC clone RP24-471H15 from chromosome 7, complete sequence
          Length = 238950

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 178050 aagaagaagaggaagaggagg 178070



to top

>gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, complete sequence
          Length = 175318

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 47066 aagaagaagaggaagaggagg 47046



to top

>gb|AC164549.4| Mus musculus BAC clone RP24-273K1 from chromosome 16, complete sequence
          Length = 182658

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 41222 aagaagaagaggaagaggagg 41242



to top

>gb|AC123060.4| Mus musculus chromosome 6 clone RP23-214M22, complete sequence
          Length = 210248

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 485   gatttggttttggtttggttt 505
             |||||||||||||||||||||
Sbjct: 26864 gatttggttttggtttggttt 26844



to top

>gb|AC121942.2| Mus musculus chromosome 13 clone RP24-211D12, complete sequence
          Length = 164932

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 95109 aagaagaagaggaagaggagg 95129



to top

>gb|AC109498.10| Mus musculus chromosome 5, clone RP23-22K24, complete sequence
          Length = 218246

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 3188 aagaagaagaggaagaggagg 3168



to top

>ref|XM_637804.1| Dictyostelium discoideum hypothetical protein (DDB0202655), partial
           mRNA
          Length = 1860

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 523 aagaagaagaggaagaggagg 503



to top

>gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosome 6, complete sequence
          Length = 218586

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 210615 aagaagaagaggaagaggagg 210595



to top

>gb|AC163351.2| Mus musculus BAC clone RP23-150D4 from chromosome 13, complete sequence
          Length = 214062

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 125012 aagaagaagaggaagaggagg 124992



to top

>gb|AC163032.5| Mus musculus BAC clone RP24-144G20 from chromosome 12, complete sequence
          Length = 186416

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 172486 aagaagaagaggaagaggagg 172466



to top

>gb|AC159285.3| Mus musculus BAC clone RP23-306M13 from chromosome 8, complete sequence
          Length = 231778

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 121790 aagaagaagaggaagaggagg 121770



to top

>ref|XM_518365.1| PREDICTED: Pan troglodytes similar to HLA-B associated transcript 8
            BAT8 isoform a; G9A histone methyltransferase; ankyrin
            repeat-containing protein; NG36 protein; chromosome 6
            open reading frame 30 (LOC462572), mRNA
          Length = 3837

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 986  aagaagaagaggaagaggagg 1006



to top

>ref|XM_517797.1| PREDICTED: Pan troglodytes similar to hypothetical protein FLJ10233
           (LOC461912), mRNA
          Length = 1782

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 398 aagaagaagaggaagaggagg 418



to top

>ref|XM_514062.1| PREDICTED: Pan troglodytes LOC457587 (LOC457587), mRNA
          Length = 4116

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 529 aagaagaagaggaagaggagg 509



to top

>gb|AC102355.13| Mus musculus chromosome 5, clone RP23-120C8, complete sequence
          Length = 194854

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 162692 aagaagaagaggaagaggagg 162712



to top

>gb|AC161574.8| Mus musculus chromosome 1, clone RP23-352D14, complete sequence
          Length = 187614

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 87885 aagaagaagaggaagaggagg 87905



to top

>gb|AC170163.1| Homo sapiens chromosome 1 clone WI2-3014I21, complete sequence
          Length = 40554

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 7255 aagaagaagaggaagaggagg 7235



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 7219 aagaagaagaggaagaggagg 7199



to top

>gb|AC109205.12| Mus musculus chromosome 7, clone RP23-137A4, complete sequence
          Length = 225302

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 139051 aagaagaagaggaagaggagg 139031



to top

>gb|AF384675.1| Mus musculus FGF15 (Fgf15) gene, complete cds; BC1 scRNA gene, complete
              sequence; hypothetical protein and cyclin D1 (Ccnd1) genes,
              complete cds
          Length = 154480

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 136927 aagaagaagaggaagaggagg 136907



to top

>gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5 of 8 of the complete
              sequence
          Length = 249995

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 186273 aagaagaagaggaagaggagg 186253



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 186249 aagaagaagaggaagaggagg 186229



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 186225 aagaagaagaggaagaggagg 186205



to top

>gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold
          Length = 1743090

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 826897 aagaagaagaggaagaggagg 826917



to top

>gb|AF165926.2| Homo sapiens chromosome 5p13 BAC clone djn085o06 containing NUP155
             gene, complete sequence
          Length = 165617

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 42828 aagaagaagaggaagaggagg 42808



to top

>gb|AC139513.10| Mus musculus chromosome 15, clone RP23-151N6, complete sequence
          Length = 238980

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 42058 aagaagaagaggaagaggagg 42038



to top

>ref|NM_176080.2| Rattus norvegicus Na+ dependent glucose transporter 1 (Naglt1),
           mRNA
          Length = 2173

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 961 aagaagaagaggaagaggagg 941



to top

>gb|BC106158.1| Mus musculus cDNA clone IMAGE:3489110, with apparent retained intron
          Length = 2490

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 993  aagaagaagaggaagaggagg 1013



to top

>gb|AC102938.20| Mus musculus chromosome 1, clone RP24-187H3, complete sequence
          Length = 197114

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 16951 aagaagaagaggaagaggagg 16931



to top

>gb|AF134726.1| Homo sapiens BAC clone 215O12 NG35, NG36, G9A, NG22, G9, HSP70-2,
             HSP70-1, HSP70-HOM, snRNP, G7A, NG37, NG23, and MutSH5
             genes, complete cds
          Length = 180283

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 28485 aagaagaagaggaagaggagg 28505



to top

>gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence
          Length = 1590432

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 699887 aagaagaagaggaagaggagg 699907



to top

>gb|AC004493.1| Homo sapiens chromosome 16, cosmid clone 373C8 (LANL), complete
            sequence
          Length = 43661

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 7645 aagaagaagaggaagaggagg 7665



to top

>gb|AC079933.3| Trypanosoma brucei chromosome 4 clone RPCI93-1H19, complete sequence
          Length = 171392

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 152384 aagaagaagaggaagaggagg 152404



to top

>gb|AC121149.12| Mus musculus chromosome 3, clone RP24-383A4, complete sequence
          Length = 172369

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 152355 aagaagaagaggaagaggagg 152335



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 204    ggaggacaagaagaagaggaagaggagg 231
              |||||| ||||||||||||| |||||||
Sbjct: 110079 ggaggagaagaagaagaggaggaggagg 110106



to top

>gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, complete sequence
          Length = 242587

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 90610 aagaagaagaggaagaggagg 90630



to top

>gb|BC094614.1| Mus musculus profilin family, member 4, mRNA (cDNA clone
            IMAGE:6852241), with apparent retained intron
          Length = 4800

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 2942 aagaagaagaggaagaggagg 2962



to top

>gb|AC101391.15| Mus musculus chromosome 5, clone RP23-119E13, complete sequence
          Length = 209590

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 171333 aagaagaagaggaagaggagg 171353



to top

>gb|AC165357.4| Mus musculus BAC clone RP23-114G24 from chromosome 10, complete
             sequence
          Length = 216816

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 41234 aagaagaagaggaagaggagg 41214



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   agaagaagaggaagaggagg 231
             ||||||||||||||||||||
Sbjct: 40596 agaagaagaggaagaggagg 40577



to top

>gb|AC160930.2| Mus musculus BAC clone RP24-383F22 from chromosome 14, complete sequence
          Length = 230236

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 217018 aagaagaagaggaagaggagg 217038



to top

>gb|AC151715.3| Mus musculus BAC clone RP23-396L12 from chromosome 7, complete sequence
          Length = 204221

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 200367 aagaagaagaggaagaggagg 200387



to top

>gb|AC154641.2| Mus musculus BAC clone RP23-276C17 from chromosome 16, complete sequence
          Length = 190523

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 153162 aagaagaagaggaagaggagg 153182



to top

>gb|AC168279.3| Mus musculus 10 BAC RP23-345H24 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 196860

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 59210 aagaagaagaggaagaggagg 59230



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 104     acatggactacatcaagcacg 124
               |||||||||||||||||||||
Sbjct: 3404543 acatggactacatcaagcacg 3404523



to top

>gb|AC131915.7| Mus musculus chromosome 5, clone RP24-491C20, complete sequence
          Length = 154195

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 22235 aagaagaagaggaagaggagg 22255



to top

>gb|AC113945.26| Mus musculus chromosome 3, clone RP24-96D10, complete sequence
          Length = 144239

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 96371 aagaagaagaggaagaggagg 96351



to top

>gb|AC121291.18| Mus musculus chromosome 5, clone RP23-170M15, complete sequence
          Length = 192717

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 30897 aagaagaagaggaagaggagg 30877



to top

>gb|AC118733.8| Mus musculus chromosome 10, clone RP24-170A20, complete sequence
          Length = 188335

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 31685 aagaagaagaggaagaggagg 31665



to top

>gb|AC100427.25| Mus musculus chromosome 10, clone RP23-136J15, complete sequence
          Length = 206339

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 55357 aagaagaagaggaagaggagg 55377



to top

>gb|AC109249.17| Mus musculus chromosome 13, clone RP23-78E1, complete sequence
          Length = 203574

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 47766 aagaagaagaggaagaggagg 47786



to top

>gb|AC117784.13| Mus musculus chromosome 15, clone RP24-545F24, complete sequence
          Length = 190734

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 164071 aagaagaagaggaagaggagg 164051



to top

>gb|AC113720.6| Rattus norvegicus 1 BAC CH230-117B1 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 249629

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 179616 aagaagaagaggaagaggagg 179636



to top

>gb|AC132833.10| Mus musculus chromosome 15, clone RP24-498G7, complete sequence
          Length = 154206

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 34830 aagaagaagaggaagaggagg 34810



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 34770 aagaagaagaggaagaggagg 34750



to top

>gb|AC112945.9| Mus musculus chromosome 15, clone RP23-382O21, complete sequence
          Length = 189335

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 38583 aagaagaagaggaagaggagg 38603



to top

>gb|AC123722.8| Mus musculus chromosome 5, clone RP23-424O22, complete sequence
          Length = 205851

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 16159 aagaagaagaggaagaggagg 16139



to top

>ref|XM_419932.1| PREDICTED: Gallus gallus similar to myelin transcription factor
           1-like (LOC421915), mRNA
          Length = 4628

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 877 aagaagaagaggaagaggagg 897



to top

>gb|AY653037.1|AY653037S1 Homo sapiens proteoglycan 4 (PRG4) mRNA, partial cds
          Length = 486

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 436 aagaagaagaggaagaggagg 416



to top

>gb|BC076085.1| Danio rerio cDNA clone IMAGE:5913062, partial cds
          Length = 2158

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1959 aagaagaagaggaagaggagg 1979



to top

>gb|AC115924.11| Mus musculus chromosome 15, clone RP24-511O11, complete sequence
          Length = 166860

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 135989 aagaagaagaggaagaggagg 135969



to top

>gb|AC124023.2| Mus musculus chromosome X clone RP21-437J18 map qA7.2, complete
             sequence
          Length = 168775

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 44938 aagaagaagaggaagaggagg 44958



to top

>gb|AC124022.2| Mus musculus chromosome X clone RP21-566N22 map qA7.2, complete sequence
          Length = 163107

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 116465 aagaagaagaggaagaggagg 116485



to top

>gb|AC124021.2| Mus musculus chromosome X clone RP21-566N22 map qA7.2, complete sequence
          Length = 152943

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 110622 aagaagaagaggaagaggagg 110642



to top

>gb|AC116573.7| Mus musculus BAC clone RP23-114E15 from chromosome 6, complete sequence
          Length = 211910

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 485    gatttggttttggtttggttt 505
              |||||||||||||||||||||
Sbjct: 184736 gatttggttttggtttggttt 184716



to top

>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence
          Length = 203437

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 184654 aagaagaagaggaagaggagg 184674



to top

>gb|AC139755.3| Mus musculus BAC clone RP24-96N20 from chromosome 6, complete sequence
          Length = 192869

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 80744 aagaagaagaggaagaggagg 80764



to top

>gb|AC091309.13| Mus musculus chromosome 17, clone RP23-127L4, complete sequence
          Length = 184755

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 164164 aagaagaagaggaagaggagg 164144



to top

>gb|AC183274.3| Pan troglodytes BAC clone CH251-156F5 from chromosome 7, complete
             sequence
          Length = 163934

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 69457 aagaagaagaggaagaggagg 69437



to top

>gb|BC021877.1| Mus musculus amyloid beta (A4) precursor-like protein 1, mRNA (cDNA
           clone MGC:25658 IMAGE:4481838), complete cds
          Length = 2389

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 884 aagaagaagaggaagaggagg 904



to top

>gb|AC100893.13| Mus musculus chromosome 8, clone RP23-68I8, complete sequence
          Length = 253420

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 244064 aagaagaagaggaagaggagg 244084



to top

>gb|AC079365.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-172N5, complete
              sequence
          Length = 191310

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 179114 aagaagaagaggaagaggagg 179134



to top

>gb|AC111275.4| Rattus norvegicus 4 BAC CH230-49L22 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 227595

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 216880 aagaagaagaggaagaggagg 216860



to top

>gb|AC110102.6| Rattus norvegicus 4 BAC CH230-209C7 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 219273

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 165070 aagaagaagaggaagaggagg 165050



to top

>gb|AC079277.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-65N7, complete
              sequence
          Length = 190328

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 204    ggaggacaagaagaagaggaagagg 228
              |||||||||||||||||||| ||||
Sbjct: 134872 ggaggacaagaagaagaggaggagg 134896



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 104    acatggactacatcaagcacg 124
              |||||||||||||||||||||
Sbjct: 442073 acatggactacatcaagcacg 442053



to top

>gb|AC100378.10| Mus musculus chromosome 10, clone RP23-130O4, complete sequence
          Length = 218363

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 86773 aagaagaagaggaagaggagg 86753



to top

>gb|AC132462.4| Mus musculus BAC clone RP23-35F22 from chromosome 7, complete sequence
          Length = 194641

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 194283 aagaagaagaggaagaggagg 194303



to top

>gb|AC147375.3| Mus musculus BAC clone RP24-159O13 from chromosome 12, complete sequence
          Length = 176510

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 152523 aagaagaagaggaagaggagg 152543



to top

>gb|AC121873.3| Mus musculus BAC clone RP24-123L3 from chromosome 19, complete sequence
          Length = 209035

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 27027 aagaagaagaggaagaggagg 27047



to top

>ref|XM_715588.1| Candida albicans SC5314 hypothetical protein (CaO19_11720), mRNA
          Length = 1335

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 209 acaagaagaagaggaagagga 229
           |||||||||||||||||||||
Sbjct: 522 acaagaagaagaggaagagga 542



to top

>gb|AC129288.3| Mus musculus BAC clone RP24-481M4 from chromosome 1, complete
            sequence
          Length = 179082

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 3192 aagaagaagaggaagaggagg 3172



to top

>gb|AC087102.3| Rattus norvegicus strain Brown Norway clone RP31-331N5, complete
             sequence
          Length = 151673

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 71858 aagaagaagaggaagaggagg 71878



to top

>gb|AC079956.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-106D2, complete
            sequence
          Length = 183441

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 5413 aagaagaagaggaagaggagg 5433



to top

>ref|XM_709413.1| Candida albicans SC5314 hypothetical protein (CaO19.11096), mRNA
          Length = 1404

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1331 aagaagaagaggaagaggagg 1351



to top

>ref|XM_709364.1| Candida albicans SC5314 hypothetical protein (CaO19.3613), mRNA
          Length = 1404

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1331 aagaagaagaggaagaggagg 1351



to top

>gb|AC146080.4| Pan troglodytes BAC clone RP43-51K11 from 7, complete sequence
          Length = 190306

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 169617 aagaagaagaggaagaggagg 169597



to top

>gb|AC125105.3| Mus musculus BAC clone RP24-220B7 from chromosome 16, complete sequence
          Length = 153616

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 150143 aagaagaagaggaagaggagg 150163



to top

>gb|AC147369.3| Mus musculus BAC clone RP24-392B5 from chromosome 19, complete sequence
          Length = 184037

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 106087 aagaagaagaggaagaggagg 106107



to top

>gb|AC140465.2| Mus musculus BAC clone RP24-389J3 from chromosome 16, complete sequence
          Length = 189550

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 25750 aagaagaagaggaagaggagg 25730



to top

>gb|AC136518.3| Mus musculus BAC clone RP23-304K22 from chromosome 16, complete sequence
          Length = 206486

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 143367 aagaagaagaggaagaggagg 143387



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 143331 aagaagaagaggaagaggagg 143351



to top

>ref|NM_007467.2| Mus musculus amyloid beta (A4) precursor-like protein 1 (Aplp1),
           mRNA
          Length = 2389

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 884 aagaagaagaggaagaggagg 904



to top

>gb|AC158301.4| Mus musculus chromosome 5, clone RP24-71D19, complete sequence
          Length = 234479

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 134076 aagaagaagaggaagaggagg 134056



to top

>ref|NM_152638.2| Homo sapiens chromosome 12 open reading frame 12 (C12orf12), mRNA
          Length = 2977

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 216  gaagaggaagaggaggtcctg 236
            |||||||||||||||||||||
Sbjct: 1455 gaagaggaagaggaggtcctg 1475



to top

>ref|NM_016333.2| Homo sapiens serine/arginine repetitive matrix 2 (SRRM2), mRNA
          Length = 9027

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 8131 aagaagaagaggaagaggagg 8111



to top

>gb|AC123683.6| Mus musculus chromosome 9, clone RP23-296I6, complete sequence
          Length = 189100

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 93807 aagaagaagaggaagaggagg 93827



to top

>gb|AY040849.1| Homo sapiens large conductance calcium-activated potassium channel
           subfamily M alpha member 1 (KCNMA1) mRNA, complete cds
          Length = 3577

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 93  aagaagaagaggaagaggagg 73



to top

>gb|AC159888.2| Mus musculus BAC clone RP24-133O9 from chromosome 12, complete
            sequence
          Length = 181236

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1500 aagaagaagaggaagaggagg 1480



to top

>gb|AC154885.8| Mus musculus chromosome 5, clone RP24-333I1, complete sequence
          Length = 176471

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 160147 aagaagaagaggaagaggagg 160127



to top

>gb|AC166829.3| Mus musculus BAC clone RP23-299M19 from chromosome 1, complete sequence
          Length = 211292

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 42492 aagaagaagaggaagaggagg 42512



to top

>gb|AC034116.10| Mus musculus chromosome 16, clone RP23-428P5, complete sequence
          Length = 210023

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 45967 aagaagaagaggaagaggagg 45987



to top

>gb|AC126608.20| Mus musculus chromosome 19, clone RP24-166L20, complete sequence
          Length = 139126

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 89252 aagaagaagaggaagaggagg 89272



to top

>gb|AC114411.24| Mus musculus chromosome 5, clone RP23-162F3, complete sequence
          Length = 208432

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 195313 aagaagaagaggaagaggagg 195293



to top

>gb|AC161930.7| Mus musculus chromosome 7, clone RP23-157P17, complete sequence
          Length = 212109

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 66189 aagaagaagaggaagaggagg 66169



to top

>ref|NM_001032810.1| Macaca mulatta calcium-activated potassium channel alpha subunit
           (KCNMA1), mRNA
          Length = 3456

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 70  aagaagaagaggaagaggagg 50



to top

>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence
          Length = 243671

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 59837 aagaagaagaggaagaggagg 59817



to top

>gb|AC163353.3| Mus musculus BAC clone RP23-55G7 from chromosome 6, complete sequence
          Length = 264135

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 153099 aagaagaagaggaagaggagg 153079



to top

>gb|AC148980.6| Mus musculus BAC clone RP23-230C16 from chromosome 7, complete sequence
          Length = 192433

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 128947 aagaagaagaggaagaggagg 128967



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 208    gacaagaagaagaggaagaggagg 231
              |||||||||||||||| |||||||
Sbjct: 128301 gacaagaagaagaggaggaggagg 128324



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 208    gacaagaagaagaggaagaggagg 231
              |||||||||||||||| |||||||
Sbjct: 128054 gacaagaagaagaggaggaggagg 128077



to top

>gb|AC115948.12| Mus musculus chromosome 16, clone RP24-568J12, complete sequence
          Length = 212604

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 10877 aagaagaagaggaagaggagg 10897



 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 10841 aagaagaagaggaagaggagg 10861



to top

>ref|XR_002066.1| PREDICTED: Mus musculus hypothetical protein LOC667730 (LOC667730),
           mRNA
          Length = 452

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 178 aagaagaagaggaagaggagg 198



to top

>gb|AC117076.3| Dictyostelium discoideum chromosome 2 map 3323568-3470138 strain AX4,
              complete sequence
          Length = 146570

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 100156 aagaagaagaggaagaggagg 100136



to top

>ref|XM_892831.1| PREDICTED: Mus musculus similar to protein phosphatase 4,
           regulatory subunit 2, transcript variant 1 (LOC627908),
           mRNA
          Length = 2344

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 551 aagaagaagaggaagaggagg 571



to top

>gb|AC126944.3| Mus musculus BAC clone RP23-19A4 from chromosome 19, complete sequence
          Length = 184164

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 71076 aagaagaagaggaagaggagg 71096



to top

>gb|AC125194.4| Mus musculus BAC clone RP23-275K6 from chromosome 18, complete sequence
          Length = 155706

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 50429 aagaagaagaggaagaggagg 50449



to top

>gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome 5, complete
            sequence
          Length = 181395

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 2591 aagaagaagaggaagaggagg 2571



to top

>gb|AC135016.3| Mus musculus BAC clone RP24-244B4 from chromosome 18, complete sequence
          Length = 177193

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 39832 aagaagaagaggaagaggagg 39852



to top

>ref|XM_994301.1| PREDICTED: Mus musculus RIKEN cDNA 2010001E11 gene (2010001E11Rik),
            mRNA
          Length = 2621

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1217 aagaagaagaggaagaggagg 1197



to top

>ref|XM_907955.2| PREDICTED: Mus musculus RIKEN cDNA 2010001E11 gene (2010001E11Rik),
            mRNA
          Length = 2621

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1217 aagaagaagaggaagaggagg 1197



to top

>ref|XM_125582.4| PREDICTED: Mus musculus RIKEN cDNA 2010001E11 gene (2010001E11Rik),
            mRNA
          Length = 2621

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1217 aagaagaagaggaagaggagg 1197



to top

>gb|AC131717.3| Mus musculus chromosome 12 clone RP23-167A18, complete sequence
          Length = 190372

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 72876 aagaagaagaggaagaggagg 72856



to top

>gb|AC115039.7| Mus musculus chromosome 6, clone RP24-279C2, complete sequence
          Length = 195362

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 177568 aagaagaagaggaagaggagg 177548



to top

>gb|AC111117.15| Mus musculus chromosome 1, clone RP23-214P23, complete sequence
          Length = 201442

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 97952 aagaagaagaggaagaggagg 97932



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 487    tttggttttggtttggtttg 506
              ||||||||||||||||||||
Sbjct: 138099 tttggttttggtttggtttg 138118



 Score = 40.1 bits (20), Expect = 7.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   agaagaagaggaagaggagg 231
             ||||||||||||||||||||
Sbjct: 98002 agaagaagaggaagaggagg 97983



to top

>gb|AC112030.4| Rattus norvegicus 4 BAC CH230-100K8 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 237374

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 27139 aagaagaagaggaagaggagg 27119



to top

>ref|XM_923288.2| PREDICTED: Mus musculus cDNA sequence BC067047, transcript variant 12
            (BC067047), mRNA
          Length = 3881

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 3573 aagaagaagaggaagaggagg 3553



to top

>ref|XM_923292.2| PREDICTED: Mus musculus cDNA sequence BC067047, transcript variant 13
            (BC067047), mRNA
          Length = 1797

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1489 aagaagaagaggaagaggagg 1469



to top

>ref|XM_902965.2| PREDICTED: Mus musculus cDNA sequence BC067047, transcript variant 4
            (BC067047), mRNA
          Length = 3881

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 3573 aagaagaagaggaagaggagg 3553



to top

>ref|XM_902966.2| PREDICTED: Mus musculus cDNA sequence BC067047, transcript variant 5
            (BC067047), mRNA
          Length = 1797

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1489 aagaagaagaggaagaggagg 1469



to top

>gb|AC146078.3| Pan troglodytes BAC clone RP43-45C11 from 7, complete sequence
          Length = 53091

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 13416 aagaagaagaggaagaggagg 13436



to top

>gb|AC133967.2| Mus musculus BAC clone RP23-14J5 from chromosome 16, complete sequence
          Length = 195446

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 50823 aagaagaagaggaagaggagg 50843



to top

>gb|AC140373.2| Mus musculus BAC clone RP23-197O10 from chromosome 15, complete
             sequence
          Length = 215314

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 35556 aagaagaagaggaagaggagg 35576



to top

>gb|AC124466.3| Mus musculus BAC clone RP24-160P1 from chromosome 18, complete sequence
          Length = 169529

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 485   gatttggttttggtttggttt 505
             |||||||||||||||||||||
Sbjct: 74525 gatttggttttggtttggttt 74505



to top

>gb|AC122499.4| Mus musculus BAC clone RP24-407O20 from chromosome 9, complete
            sequence
          Length = 186516

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 9271 aagaagaagaggaagaggagg 9291



to top

>ref|XM_841781.1| Trypanosoma brucei TREU927 hypothetical protein (Tb927.1.3670)
            partial mRNA
          Length = 2142

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 2081 aagaagaagaggaagaggagg 2101



to top

>gb|AC141479.3| Mus musculus BAC clone RP23-281N15 from chromosome 12, complete sequence
          Length = 190974

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 130772 aagaagaagaggaagaggagg 130792



to top

>ref|XM_862284.1| PREDICTED: Canis familiaris hypothetical protein LOC610793
           (LOC610793), mRNA
          Length = 219

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 44  aagaagaagaggaagaggagg 64



to top

>emb|AJ298054.1|MMA298054 Mus musculus Ly57 gene for lymphocyte antigen 57
          Length = 71456

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 329 aagaagaagaggaagaggagg 309



to top

>emb|AJ246952.1|ARA246952 Ascochyta rabiei microsatellite DNA, clone ArA08T
          Length = 387

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 316 aagaagaagaggaagaggagg 296



to top

>ref|XM_813634.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053511725.160) partial mRNA
          Length = 4899

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1247 aagaagaagaggaagaggagg 1267



to top

>gb|AC122402.2| Mus musculus BAC clone RP24-108B4 from chromosome 13, complete sequence
          Length = 175669

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 152441 aagaagaagaggaagaggagg 152461



to top

>ref|XM_820132.1| Trypanosoma brucei TREU927 clone RPCI93-1H19 hypothetical protein
            (Tb927.4.2640) partial mRNA
          Length = 3825

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1970 aagaagaagaggaagaggagg 1990



to top

>emb|CR450771.10| Zebrafish DNA sequence from clone CH211-152D1 in linkage group 2,
              complete sequence
          Length = 152893

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 216    gaagaggaagaggaggtcctg 236
              |||||||||||||||||||||
Sbjct: 121651 gaagaggaagaggaggtcctg 121631



to top

>ref|XM_746975.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g07570) partial
            mRNA
          Length = 1554

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1505 aagaagaagaggaagaggagg 1525



to top

>gb|AC092117.4| Homo sapiens chromosome 16 clone CTD-2270P14, complete sequence
          Length = 211606

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 160240 aagaagaagaggaagaggagg 160220



to top

>emb|CR932164.1|CNS0KYGD Paramecium tetraurelia macronuclear, putative gene for the
           regulatory subunit of cAMP-dependent protein kinase 3,
           isoform 1, complete gene
          Length = 1320

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 211 aagaagaagaggaagaggagg 231
           |||||||||||||||||||||
Sbjct: 257 aagaagaagaggaagaggagg 277



to top

>emb|CT009637.4| Mouse DNA sequence from clone RP23-131G16 on chromosome 17, complete
             sequence
          Length = 222316

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 72436 aagaagaagaggaagaggagg 72456



to top

>gb|AC124484.5| Mus musculus BAC clone RP24-128N20 from chromosome 12, complete sequence
          Length = 204507

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 211    aagaagaagaggaagaggagg 231
              |||||||||||||||||||||
Sbjct: 156059 aagaagaagaggaagaggagg 156079



to top

>ref|XM_449563.1| Candida glabrata CBS138 hypothetical protein (CAGL0M04961g) partial
            mRNA
          Length = 1209

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 211  aagaagaagaggaagaggagg 231
            |||||||||||||||||||||
Sbjct: 1085 aagaagaagaggaagaggagg 1105



to top

>gb|AC131769.3| Mus musculus BAC clone RP24-290G2 from chromosome 3, complete sequence
          Length = 148675

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 63280 aagaagaagaggaagaggagg 63300



to top

>gb|AC121975.3| Mus musculus BAC clone RP24-286J21 from chromosome 8, complete sequence
          Length = 174928

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 58829 aagaagaagaggaagaggagg 58809



to top

>gb|AC127259.3| Mus musculus BAC clone RP24-304A20 from chromosome 9, complete sequence
          Length = 162717

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 211   aagaagaagaggaagaggagg 231
             |||||||||||||||||||||
Sbjct: 77048 aagaagaagaggaagaggagg 77068


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,445,326
Number of Sequences: 3902068
Number of extensions: 5445326
Number of successful extensions: 280084
Number of sequences better than 10.0: 1539
Number of HSP's better than 10.0 without gapping: 1542
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 267848
Number of HSP's gapped (non-prelim): 12217
length of query: 518
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 495
effective length of database: 17,143,297,704
effective search space: 8485932363480
effective search space used: 8485932363480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top