ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd21f22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_469689.1| Oryza sativa (japonica cultivar-group), mRNA 507 e-140
2dbj|AK120299.1| Oryza sativa (japonica cultivar-group) cDNA clon... 507 e-140
3gb|AY104056.1| Zea mays PCO122239 mRNA sequence 464 e-127
4gb|BT016248.1| Zea mays clone Contig81 mRNA sequence 436 e-119
5gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 383 e-103
6gb|AC096855.5| Oryza sativa chromosome 3 BAC OJ1365_D05 genomic ... 383 e-103
7gb|AC092558.4| Oryza sativa chromosome 3 BAC OSJNBb0036F07 genom... 383 e-103
8dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 383 e-103
9ref|NM_196515.1| Oryza sativa (japonica cultivar-group) putative... 266 8e-68
10dbj|AK121515.1| Oryza sativa (japonica cultivar-group) cDNA clon... 258 2e-65
11gb|AF193345.1|AF193345 Oryza sativa H2A protein mRNA, complete cds 242 1e-60
12gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica culti... 204 3e-49
13dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 204 3e-49
14gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb00... 204 3e-49
15gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 204 3e-49
16dbj|AP006681.1| Lotus japonicus genomic DNA, chromosome 1, clone... 190 4e-45
17ref|NM_187762.1| Oryza sativa (japonica cultivar-group), predic... 182 9e-43
18gb|AC105729.2| Oryza sativa (japonica cultivar-group) chromosome... 182 9e-43
19dbj|AK121533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 9e-43
20dbj|AK061605.1| Oryza sativa (japonica cultivar-group) cDNA clon... 182 9e-43
21gb|AY104725.1| Zea mays PCO121651 mRNA sequence 182 9e-43
22gb|DQ215051.1| Taeniopygia guttata clone 0061P0027A01 H2A histon... 168 1e-38
23gb|DQ215050.1| Taeniopygia guttata clone 0058P0007H05 H2A histon... 168 1e-38
24gb|DQ215049.1| Taeniopygia guttata clone 0058P0049H09 H2A histon... 168 1e-38
25gb|DQ215048.1| Taeniopygia guttata clone 0058P0013F02 H2A histon... 168 1e-38
26gb|DQ215046.1| Taeniopygia guttata clone 0058P0036G12 H2A histon... 168 1e-38
27gb|DQ215052.1| Taeniopygia guttata clone 0058P0020B08 H2A histon... 161 3e-36
28gb|DQ215047.1| Taeniopygia guttata clone 0058P0026B08 H2A histon... 161 3e-36
29emb|CR719262.2|CNS0GHXG Tetraodon nigroviridis full-length cDNA 155 2e-34
30emb|CR714103.2|CNS0GDYB Tetraodon nigroviridis full-length cDNA 155 2e-34
31emb|CR710974.2|CNS0GBJE Tetraodon nigroviridis full-length cDNA 155 2e-34
32emb|CR708160.2|CNS0G9D8 Tetraodon nigroviridis full-length cDNA 155 2e-34
33emb|CR706063.2|CNS0G7QZ Tetraodon nigroviridis full-length cDNA 155 2e-34
34emb|CR706962.2|CNS0G8FY Tetraodon nigroviridis full-length cDNA 155 2e-34
35emb|CR705074.2|CNS0G6ZI Tetraodon nigroviridis full-length cDNA 155 2e-34
36emb|CR678084.2|CNS0FM61 Tetraodon nigroviridis full-length cDNA 155 2e-34
37emb|CR676044.2|CNS0FKLU Tetraodon nigroviridis full-length cDNA 155 2e-34
38emb|CR673909.2|CNS0FIYJ Tetraodon nigroviridis full-length cDNA 155 2e-34
39emb|CR671294.2|CNS0FGXW Tetraodon nigroviridis full-length cDNA 155 2e-34
40gb|BT018361.1| Zea mays clone EL01N0311D03.c mRNA sequence 153 8e-34
41gb|BC049523.1| Danio rerio similar to H2A histone family, member... 147 5e-32
42emb|CR711930.2|CNS0GC9Y Tetraodon nigroviridis full-length cDNA 147 5e-32
43ref|XM_693453.1| PREDICTED: Danio rerio similar to H2A histone f... 147 5e-32
44gb|BT014555.1| Lycopersicon esculentum clone 133985F, mRNA sequence 145 2e-31
45emb|CR671361.2|CNS0FGZR Tetraodon nigroviridis full-length cDNA 141 3e-30
46gb|AC144617.10| Medicago truncatula clone mth2-7m9, complete seq... 139 1e-29
47ref|NM_115313.3| Arabidopsis thaliana DNA binding AT3G54560 mRNA... 127 5e-26
48emb|Y12575.1|ATH2AV Arabidopsis thaliana mRNA for histone H2A.F/Z 127 5e-26
49emb|AL138656.2|ATT14E10 Arabidopsis thaliana DNA chromosome 3, B... 127 5e-26
50emb|BX825753.1|CNS0A65Y Arabidopsis thaliana Full-length cDNA Co... 127 5e-26
51gb|BT005205.1| Arabidopsis thaliana At3g54560 mRNA, complete cds 127 5e-26
52gb|AY087232.1| Arabidopsis thaliana clone 33085 mRNA, complete s... 127 5e-26
53emb|CR733482.2|CNS0GSQH Tetraodon nigroviridis full-length cDNA 119 1e-23
54emb|CR732601.2|CNS0GS7Y Tetraodon nigroviridis full-length cDNA 119 1e-23
55emb|CR725413.2|CNS0GMOB Tetraodon nigroviridis full-length cDNA 119 1e-23
56emb|CR694893.1|CNS0FZ4P Tetraodon nigroviridis full-length cDNA 119 1e-23
57emb|BX822865.1|CNS0A7LY Arabidopsis thaliana Full-length cDNA Co... 115 2e-22
58gb|BC049019.1| Danio rerio H2A histone family, member Z, mRNA (c... 111 3e-21
59ref|NM_153644.1| Danio rerio H2A histone family, member Z (h2afz... 111 3e-21
60gb|AF414110.1|AF414110 Danio rerio histone variant H2A.F/Z mRNA,... 111 3e-21
61ref|XM_702461.1| PREDICTED: Danio rerio similar to H2A histone f... 111 3e-21
62ref|XM_679474.1| PREDICTED: Danio rerio similar to H2A histone f... 111 3e-21
63emb|CR692524.2|CNS0FXAW Tetraodon nigroviridis full-length cDNA 109 1e-20
64gb|AY190700.1| Pagrus major histone H2A.F/Z variant mRNA, partia... 103 7e-19
65gb|BC078599.1| Xenopus laevis MGC85536 protein, mRNA (cDNA clone... 101 3e-18
66emb|X05547.1|SPH2AFZ Sea urchin mRNA fragment for histone H2A.F/Z 100 1e-17
67ref|XM_504921.1| Yarrowia lipolytica CLIB122, YALI0F02827g predi... 98 4e-17
68ref|XM_786337.1| PREDICTED: Strongylocentrotus purpuratus histon... 98 4e-17
69emb|X07485.1|DMH2AVD D. melanogaster H2AvD mRNA for histone 2A v... 98 4e-17
70gb|AY118910.1| Drosophila melanogaster LD21568 full insert cDNA 98 4e-17
71ref|NM_079795.2| Drosophila melanogaster Histone H2A variant CG5... 98 4e-17
72emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 98 4e-17
73ref|XM_970375.1| PREDICTED: Tribolium castaneum similar to H2A h... 96 2e-16
74emb|V00414.1|GGHI01 Gallus gallus mRNA coding for a variant hist... 96 2e-16
75ref|NM_179968.2| Arabidopsis thaliana DNA binding AT2G38810 tran... 94 7e-16
76ref|NM_129438.2| Arabidopsis thaliana DNA binding AT2G38810 tran... 94 7e-16
77ref|NM_179967.1| Arabidopsis thaliana DNA binding AT2G38810 tran... 94 7e-16
78gb|AC007133.7| Arabidopsis thaliana chromosome 2 clone F13I13 ma... 94 7e-16
79dbj|AK220868.1| Arabidopsis thaliana mRNA for histone H2A, compl... 94 7e-16
80emb|BX821413.1|CNS0AA9R Arabidopsis thaliana Full-length cDNA Co... 94 7e-16
81emb|BX821514.1|CNS0A96I Arabidopsis thaliana Full-length cDNA Co... 94 7e-16
82gb|AY088573.1| Arabidopsis thaliana clone 8 mRNA, complete sequence 94 7e-16
83gb|DQ215814.1| Taeniopygia guttata clone 0058P0009E02 histone H2... 92 3e-15
84gb|DQ215811.1| Taeniopygia guttata clone 0063P0013F11 histone H2... 92 3e-15
85gb|DQ215810.1| Taeniopygia guttata clone 0061P0002G07 histone H2... 92 3e-15
86gb|DQ215809.1| Taeniopygia guttata clone 0058P0022F11 histone H2... 92 3e-15
87gb|DQ215807.1| Taeniopygia guttata clone 0065P0002B11 histone H2... 92 3e-15
88gb|DQ215806.1| Taeniopygia guttata clone 0058P0039A02 histone H2... 92 3e-15
89gb|DQ215804.1| Taeniopygia guttata clone 0058P0059H06 histone H2... 92 3e-15
90gb|DQ215803.1| Taeniopygia guttata clone 0058P0052E09 histone H2... 92 3e-15
91emb|BX070691.1|CNS09QPJ Single read from an extremity of a full-... 88 4e-14
92emb|X15549.1|DMH2AVDG D.melanogaster H2AvD gene for histone H2A ... 88 4e-14
93gb|AC009981.6|AC009981 Drosophila melanogaster, chromosome 3R, r... 88 4e-14
94ref|XM_310818.2| Anopheles gambiae str. PEST ENSANGP00000015579 ... 88 4e-14
95gb|AE003758.4| Drosophila melanogaster chromosome 3R, section 96... 88 4e-14
96gb|BC086348.1| Rattus norvegicus H2A histone family, member Z, m... 86 2e-13
97gb|BC074203.1| Xenopus laevis MGC82121 protein, mRNA (cDNA clone... 86 2e-13
98gb|BC060564.1| Rattus norvegicus H2A histone family, member Z, m... 86 2e-13
99ref|NM_068168.2| Caenorhabditis elegans R08C7.3 (R08C7.3) mRNA, ... 86 2e-13
100ref|NM_001016178.2| Xenopus tropicalis hypothetical protein LOC5... 86 2e-13
101gb|BC091605.1| Xenopus tropicalis hypothetical protein LOC548932... 86 2e-13
102ref|NM_022674.1| Rattus norvegicus H2A histone family, member Z ... 86 2e-13
103gb|U61953.2| Caenorhabditis elegans cosmid R08C7, complete sequence 86 2e-13
104emb|X52316.1|RSH2AZ Rat mRNA for histone H2A.Z 86 2e-13
105emb|CR761860.2| Xenopus tropicalis finished cDNA, clone TGas096d24 86 2e-13
106gb|M37584.1|RATHIS2AZ Rat histone (H2A.Z) mRNA, complete cds 86 2e-13
107gb|DQ215813.1| Taeniopygia guttata clone 0058P0052D09 histone H2... 84 6e-13
108gb|DQ215808.1| Taeniopygia guttata clone 0058P0029H07 histone H2... 84 6e-13
109gb|DQ215805.1| Taeniopygia guttata clone 0061P0010E11 histone H2... 84 6e-13
110gb|BC079903.1| Mus musculus H2A histone family, member Z, mRNA (... 84 6e-13
111ref|NM_016750.1| Mus musculus H2A histone family, member Z (H2af... 84 6e-13
112ref|XM_978064.1| PREDICTED: Mus musculus similar to H2A histone ... 84 6e-13
113ref|XM_001000476.1| PREDICTED: Mus musculus similar to H2A histo... 84 6e-13
114ref|XM_001003000.1| PREDICTED: Mus musculus H2A histone family, ... 84 6e-13
115ref|XM_760084.1| Theileria parva strain Muguga histone H2A (TP02... 84 6e-13
116ref|XM_381803.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 84 6e-13
117ref|XM_947008.1| Theileria annulata strain Ankara histone H2A va... 84 6e-13
118dbj|AB225651.1| Aspergillus oryzae cDNA, contig sequence: AoEST2506 84 6e-13
119dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 84 6e-13
120dbj|AK151052.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
121dbj|AK146181.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 84 6e-13
122gb|AY074806.1| Mus musculus histone H2A.Z mRNA, complete cds 84 6e-13
123dbj|AK151868.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
124dbj|AK143572.1| Mus musculus 6 days neonate spleen cDNA, RIKEN f... 84 6e-13
125dbj|AK152848.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
126dbj|AK151509.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
127dbj|AK152398.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
128dbj|AK150454.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 84 6e-13
129dbj|AK168178.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 84 6e-13
130dbj|AK169003.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 84 6e-13
131dbj|AK088704.1| Mus musculus 2 days neonate thymus thymic cells ... 84 6e-13
132dbj|AK044932.1| Mus musculus 9.5 days embryo parthenogenote cDNA... 84 6e-13
133dbj|AK028176.1| Mus musculus 10 days embryo whole body cDNA, RIK... 84 6e-13
134dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 84 6e-13
135dbj|AP005770.3| Oryza sativa (japonica cultivar-group) genomic D... 84 6e-13
136dbj|AP004180.3| Oryza sativa (japonica cultivar-group) genomic D... 84 6e-13
137dbj|AK102414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 6e-13
138dbj|AK060832.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 6e-13
139gb|AC147612.5| Mus musculus BAC clone RP23-374K9 from 6, complet... 84 6e-13
140gb|U70494.1|MMU70494 Mus musculus histone H2A.Z (H2A.Z) mRNA, co... 84 6e-13
141gb|AF502246.1| Toxoplasma gondii histone H2A.F/Z mRNA, complete cds 82 3e-12
142gb|BC004274.1| Homo sapiens H2A histone family, member V, transc... 80 1e-11
143gb|BC014885.2| Homo sapiens H2A histone family, member V, transc... 80 1e-11
144gb|BC000098.2| Homo sapiens H2A histone family, member V, transc... 80 1e-11
145ref|NM_201436.1| Homo sapiens H2A histone family, member V (H2AF... 80 1e-11
146ref|NM_012412.3| Homo sapiens H2A histone family, member V (H2AF... 80 1e-11
147emb|CR602318.1| full-length cDNA clone CS0DC004YN11 of Neuroblas... 80 1e-11
148dbj|AK129989.1| Homo sapiens cDNA FLJ26479 fis, clone KDN05022, ... 80 1e-11
149gb|AF030235.1|AF030235 Oryctolagus cuniculus histone H2A.F/Z var... 80 1e-11
150gb|AF081192.1|AF081192 Homo sapiens histone H2A.F/Z variant (H2A... 80 1e-11
151gb|BC070169.1| Homo sapiens H2A histone family, member V, mRNA (... 80 1e-11
152dbj|AB209001.1| Homo sapiens mRNA for H2A histone family, member... 80 1e-11
153gb|DQ215812.1| Taeniopygia guttata clone 0064P0008A04 histone H2... 78 4e-11
154ref|XM_532724.2| PREDICTED: Canis familiaris similar to H2A hist... 78 4e-11
155ref|XM_857381.1| PREDICTED: Canis familiaris histone H2AF, trans... 78 4e-11
156ref|XM_857355.1| PREDICTED: Canis familiaris histone H2AF, trans... 78 4e-11
157ref|XM_535671.2| PREDICTED: Canis familiaris histone H2AF, trans... 78 4e-11
158emb|BX284748.1|NCB15B24 Neurospora crassa DNA linkage group II B... 78 4e-11
159gb|BC109743.1| Bos taurus H2A histone family, member Z, mRNA (cD... 78 4e-11
160ref|NM_174809.2| Bos taurus H2A histone family, member Z (H2AFZ)... 78 4e-11
161emb|X52318.1|BTH2AZ Bovine mRNA for histone H2A.Z 78 4e-11
162gb|M37585.1|BOVHIS2AZ Cow histone (H2A.Z) mRNA, complete cds 78 4e-11
163gb|AF069441.1| Arabidopsis thaliana BAC T19B17 from chromosome I... 76 2e-10
164ref|XM_369251.1| Magnaporthe grisea 70-15 chromosome III hypothe... 76 2e-10
165ref|XM_958245.1| Neurospora crassa OR74A hypothetical protein (N... 76 2e-10
166ref|XM_325201.1| Neurospora crassa OR74A hypothetical protein (N... 76 2e-10
167emb|AL161500.2|ATCHRIV12 Arabidopsis thaliana DNA chromosome 4, ... 76 2e-10
168gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 76 2e-10
169ref|NM_208740.1| Eremothecium gossypii ACL017Cp (ACL017C), mRNA 76 2e-10
170gb|AF076243.1|AF076243 Arabidopsis thaliana BAC T26N6 from chrom... 76 2e-10
171ref|XM_743054.1| Aspergillus fumigatus Af293 histone H2A (Afu5g0... 74 6e-10
172emb|AL672076.10| Mouse DNA sequence from clone RP23-161N17 on ch... 72 2e-09
173ref|XM_676216.1| Aspergillus nidulans FGSC A4 hypothetical prote... 70 1e-08
174ref|NM_201517.1| Homo sapiens H2A histone family, member V (H2AF... 70 1e-08
175ref|XM_850699.1| PREDICTED: Canis familiaris similar to H2A hist... 70 1e-08
176gb|AY074805.1| Ovis aries histone H2A.Z mRNA, complete cds 70 1e-08
177gb|AF414111.1|AF414111 Danio rerio histone variant H2A.F/Z gene,... 70 1e-08
178emb|BX322550.7| Zebrafish DNA sequence from clone DKEY-202N14 in... 70 1e-08
179emb|BX821662.1|CNS0A98O Arabidopsis thaliana Full-length cDNA Co... 70 1e-08
180ref|NM_001009270.1| Ovis aries histone H2A.Z (LOC443235), mRNA 70 1e-08
181emb|AL954191.5| Zebrafish DNA sequence from clone CH211-230G14, ... 70 1e-08
182ref|XM_517363.1| PREDICTED: Pan troglodytes similar to H2A histo... 66 2e-07
183ref|NM_002106.3| Homo sapiens H2A histone family, member Z (H2AF... 66 2e-07
184gb|BC103743.1| Homo sapiens H2A histone family, member Z, mRNA (... 66 2e-07
185gb|AY597416.1| Homo sapiens chromosome 13 carcinoma associated a... 66 2e-07
186ref|XM_567962.1| Cryptococcus neoformans var. neoformans JEC21 h... 66 2e-07
187emb|CR858439.1| Pongo pygmaeus mRNA; cDNA DKFZp468O2423 (from cl... 66 2e-07
188emb|CR616797.1| full-length cDNA clone CS0DI067YA11 of Placenta ... 66 2e-07
189emb|CR611014.1| full-length cDNA clone CS0DJ002YA13 of T cells (... 66 2e-07
190emb|CR599577.1| full-length cDNA clone CS0DI079YK23 of Placenta ... 66 2e-07
191emb|CR457415.1| Homo sapiens full open reading frame cDNA clone ... 66 2e-07
192gb|BC020936.1| Homo sapiens H2A histone family, member Z, mRNA (... 66 2e-07
193gb|BC018002.1| Homo sapiens H2A histone family, member Z, mRNA (... 66 2e-07
194emb|X52317.1|HSH2AZ Human mRNA for histone H2A.Z 66 2e-07
195gb|M37583.1|HUMHIS2AZ Human histone (H2A.Z) mRNA, complete cds 66 2e-07
196ref|XM_978028.1| PREDICTED: Mus musculus similar to H2A histone ... 64 6e-07
197ref|XM_001000460.1| PREDICTED: Mus musculus similar to H2A histo... 64 6e-07
198ref|XM_001002995.1| PREDICTED: Mus musculus H2A histone family, ... 64 6e-07
199ref|XM_985882.1| PREDICTED: Mus musculus similar to H2A histone ... 64 6e-07
200gb|AF483074.1| Boltenia villosa histone 2A Z variant (h2az) mRNA... 64 6e-07
201emb|BX008098.1|CNS08EEU Single read from an extremity of a full-... 64 6e-07
202dbj|AK151462.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 64 6e-07
203ref|NM_001031374.1| Gallus gallus H2A histone family, member V (... 62 2e-06
204gb|AE017352.1| Cryptococcus neoformans var. neoformans JEC21 chr... 62 2e-06
205gb|AC130809.25| Medicago truncatula clone mth2-15i12, complete s... 62 2e-06
206gb|AC151823.11| Medicago truncatula clone mth2-45h2, complete se... 62 2e-06
207emb|AJ719448.1| Gallus gallus mRNA for hypothetical protein, clo... 62 2e-06
208ref|NM_138635.2| Homo sapiens H2A histone family, member V (H2AF... 60 9e-06
209gb|AC146607.2| Mus musculus BAC clone RP23-209N19 from chromosom... 60 9e-06
210gb|AC125154.3| Mus musculus BAC clone RP24-380C2 from chromosome... 60 9e-06
211dbj|AK023973.1| Homo sapiens cDNA FLJ13911 fis, clone Y79AA10002... 60 9e-06
212gb|BC077029.1| Xenopus tropicalis MGC89861 protein, mRNA (cDNA c... 58 4e-05
213gb|AY814205.1| Schistosoma japonicum SJCHGC05820 protein mRNA, c... 58 4e-05
214ref|XR_003857.1| PREDICTED: Mus musculus hypothetical LOC631864 ... 58 4e-05
215gb|AY147422.1| Drosophila rufa isolate YY001328 histone H2A gene... 58 4e-05
216emb|CT025399.2| Xenopus tropicalis finished cDNA, clone TGas068j09 58 4e-05
217gb|AC055772.16| Mus musculus chromosome 12, clone RP23-291K4, co... 58 4e-05
218ref|NM_001005097.1| Xenopus tropicalis MGC89861 protein (MGC8986... 58 4e-05
219emb|CR761793.2| Xenopus tropicalis finished cDNA, clone TGas044m04 58 4e-05
220emb|CR761734.2| Xenopus tropicalis finished cDNA, clone TGas104o01 58 4e-05
221gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, c... 58 4e-05
222ref|XM_871500.1| PREDICTED: Bos taurus similar to Histone H2A.o ... 56 1e-04
223ref|XM_614586.2| PREDICTED: Bos taurus similar to Histone H2A.o ... 56 1e-04
224ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 56 1e-04
225ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa... 56 1e-04
226ref|XM_591391.2| PREDICTED: Bos taurus similar to Histone H2A.o ... 56 1e-04
227ref|NM_177688.2| Mus musculus H2A histone family, member J (H2af... 56 1e-04
228gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, comple... 56 1e-04
229ref|NM_001038197.1| Bos taurus H2A histone family, member V (H2A... 56 1e-04
230ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone ... 56 1e-04
231emb|AJ306721.1|PPI306721 Pinus pinaster mRNA for putative histon... 56 1e-04
232gb|BC109673.1| Bos taurus cDNA clone MGC:133654 IMAGE:8054570, c... 56 1e-04
233dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f... 56 1e-04
234gb|L17501.1|MIRHIS2AF3 Mirounga leonina histone H2AF gene, exon ... 56 1e-04
235gb|AC150773.2| Xenopus tropicalis clone CH216-69F7, complete seq... 56 1e-04
236gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (... 56 1e-04
237ref|XM_509711.1| PREDICTED: Pan troglodytes similar to H2A histo... 54 6e-04
238gb|BT016569.1| Zea mays clone Contig402 mRNA sequence 54 6e-04
239ref|XM_430420.1| PREDICTED: Gallus gallus hypothetical gene supp... 54 6e-04
240ref|XM_989419.1| PREDICTED: Mus musculus H2A histone family, mem... 54 6e-04
241ref|XM_907680.2| PREDICTED: Mus musculus H2A histone family, mem... 54 6e-04
242ref|XM_126043.7| PREDICTED: Mus musculus H2A histone family, mem... 54 6e-04
243emb|AL160155.19| Human DNA sequence from clone RP11-461N23 on ch... 54 6e-04
244emb|AL161536.2|ATCHRIV36 Arabidopsis thaliana DNA chromosome 4, ... 54 6e-04
245emb|AL049656.1|ATT6G15 Arabidopsis thaliana DNA chromosome 4, BA... 54 6e-04
246dbj|AK155105.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 54 6e-04
247dbj|AK168110.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 54 6e-04
248dbj|AK021267.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 54 6e-04
249gb|AY103710.1| Zea mays PCO123562 mRNA sequence 54 6e-04
250gb|BC028539.1| Mus musculus H2A histone family, member V, mRNA (... 54 6e-04
251emb|AJ296915.1|MMU296915 Mus musculus SDS-stable vimentin-bound ... 54 6e-04
252gb|BC060324.1| Homo sapiens histone 2, H2ac, mRNA (cDNA clone MG... 52 0.002
253ref|NM_117431.1| Arabidopsis thaliana DNA binding AT4G13570 mRNA... 52 0.002
254ref|XM_519801.1| PREDICTED: Pan troglodytes similar to H2A histo... 52 0.002
255ref|NM_003517.2| Homo sapiens histone 2, H2ac (HIST2H2AC), mRNA 52 0.002
256gb|AY648852.1| Homo sapiens histone H2A/r gene, complete cds 52 0.002
257ref|XM_612235.2| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
258ref|XM_867604.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
259ref|XM_880526.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
260ref|XM_880511.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
261ref|XM_880487.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
262ref|XM_880467.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
263ref|XM_880438.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
264ref|XM_880415.1| PREDICTED: Bos taurus similar to H2A histone fa... 52 0.002
265ref|NG_005179.1| Homo sapiens H2A histone family, member Z, pseu... 52 0.002
266ref|XM_850665.1| PREDICTED: Canis familiaris similar to H2A hist... 52 0.002
267ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone ... 52 0.002
268ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone ... 52 0.002
269ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone ... 52 0.002
270ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone ... 52 0.002
271gb|BC113287.1| Bos taurus similar to H2A histone family, member ... 52 0.002
272emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 52 0.002
273gb|AC084251.13| Homo sapiens chromosome 8, clone RP11-152C15, co... 52 0.002
274emb|X13894.1|GGH2AF Chicken histone H2A.F gene 52 0.002
275dbj|AB168678.1| Macaca fascicularis testis cDNA clone: QtsA-1409... 52 0.002
276gb|AF315729.1|AF315729 Carassius auratus histone H2A mRNA, compl... 52 0.002
277dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
278dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
279gb|AY781308.1| Cercopithecus aethiops int22h-2 duplicon sequence 52 0.002
280gb|AY781307.1| Cercopithecus aethiops int22h-1 duplicon sequence 52 0.002
281gb|AY609643.1| Sus scrofa clone Clu_23151.scr.msk.p1.Contig2, mR... 52 0.002
282gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes,... 52 0.002
283gb|AY131973.1| Homo sapiens histone H2A (HIST2H2AC) gene, comple... 52 0.002
284gb|DQ214188.1| Taeniopygia guttata clone 0058P0024E05 histone 1 ... 50 0.009
285gb|DQ214187.1| Taeniopygia guttata clone 0058P0044E04 histone 1 ... 50 0.009
286ref|XM_527281.1| PREDICTED: Pan troglodytes similar to H2A histo... 50 0.009
287ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H... 50 0.009
288ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H... 50 0.009
289gb|AY617305.1| Sterkiella histriomuscorum clone UGC1O0001_L03_F ... 50 0.009
290gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462 50 0.009
291ref|XM_425469.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.009
292ref|XM_425467.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.009
293ref|XM_425465.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.009
294ref|XM_425459.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.009
295ref|XM_425455.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.009
296ref|XM_416195.1| PREDICTED: Gallus gallus similar to histone 2, ... 50 0.009
297ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 50 0.009
298ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal hi... 50 0.009
299ref|XM_602496.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 50 0.009
300ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA 50 0.009
301ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@... 50 0.009
302ref|NM_021066.2| Homo sapiens histone 1, H2aj (HIST1H2AJ), mRNA 50 0.009
303ref|NM_003509.2| Homo sapiens histone 1, H2ai (HIST1H2AI), mRNA 50 0.009
304gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 50 0.009
305ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudo... 50 0.009
306gb|BC066234.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.009
307gb|BC066232.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.009
308gb|BC066233.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.009
309gb|BC066237.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.009
310gb|BC066236.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.009
311gb|BC066235.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IM... 50 0.009
312ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
313ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
314ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
315ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
316ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
317ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
318ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
319ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
320ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
321ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
322ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone ... 50 0.009
323ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
324ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
325ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, ... 50 0.009
326ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, ... 50 0.009
327gb|AC004854.3| Homo sapiens PAC clone RP4-673M15 from 7, complet... 50 0.009
328ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone ... 50 0.009
329gb|AY147427.1| Drosophila bocki isolate YY001333 histone H2A gen... 50 0.009
330gb|AY147423.1| Drosophila tani isolate YY001329 histone H2A gene... 50 0.009
331ref|XM_540293.2| PREDICTED: Canis familiaris similar to histone ... 50 0.009
332ref|XM_540292.2| PREDICTED: Canis familiaris similar to histone ... 50 0.009
333ref|XM_845715.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
334ref|XM_540286.2| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
335ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone ... 50 0.009
336gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with appar... 50 0.009
337emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A... 50 0.009
338emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 o... 50 0.009
339emb|Z83742.1|HSZ83742 H.sapiens hH2A/c gene 50 0.009
340emb|Z83736.1|HSZ83736 H.sapiens hH2A/e gene 50 0.009
341emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 50 0.009
342ref|NM_001030753.1| Gallus gallus histone H2A (H2A-IX), mRNA 50 0.009
343emb|X07766.1|GGH2AB11 Chicken DNA for CH1-10 histone H2A/H2B seq... 50 0.009
344emb|X07763.1|GGH2AB8 Chicken DNA for pCH3.5E histone H2A/H2B seq... 50 0.009
345emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) 50 0.009
346emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) 50 0.009
347emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 50 0.009
348gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MG... 50 0.009
349emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 50 0.009
350ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA 50 0.009
351emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 50 0.009
352emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chrom... 50 0.009
353emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 50 0.009
354emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 50 0.009
355gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MG... 50 0.009
356gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MG... 50 0.009
357ref|NM_001024282.1| Rattus norvegicus Histone H2a (predicted) (R... 50 0.009
358dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKE... 50 0.009
359dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 50 0.009
360dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 50 0.009
361ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA 50 0.009
362gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365,... 50 0.009
363gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, ... 50 0.009
364gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 50 0.009
365gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 50 0.009
366dbj|AB179140.1| Macaca fascicularis testis cDNA clone: QtsA-1353... 50 0.009
367ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA 50 0.009
368ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA 50 0.009
369ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA 50 0.009
370gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 50 0.009
371dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 50 0.009
372dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-l... 50 0.009
373ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA 50 0.009
374ref|NM_178183.1| Mus musculus histone 1, H2ak (Hist1h2ak), mRNA 50 0.009
375ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA 50 0.009
376ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone... 50 0.009
377ref|XM_577573.1| PREDICTED: Rattus norvegicus similar to Histone... 50 0.009
378ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (p... 50 0.009
379ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone... 50 0.009
380gb|AY131990.1| Homo sapiens histone H2A (HIST1H2AJ) gene, comple... 50 0.009
381gb|AY131989.1| Homo sapiens histone H2A (HIST1H2AI) gene, comple... 50 0.009
382gb|AY158937.1| Mus musculus histone protein Hist1h2bc gene, comp... 50 0.009
383gb|AY158935.1| Mus musculus histone protein Hist1h2bf gene, comp... 50 0.009
384gb|AY158928.1| Mus musculus histone protein Hist1h2bm gene, comp... 50 0.009
385gb|AY158927.1| Mus musculus histone protein Hist1h2bl gene, comp... 50 0.009
386gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, comp... 50 0.009
387gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, comp... 50 0.009
388gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, comp... 50 0.009
389gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, comp... 50 0.009
390gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, comp... 50 0.009
391gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, comp... 50 0.009
392gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, comp... 50 0.009
393gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, comp... 50 0.009
394gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, comp... 50 0.009
395gb|AY158911.1| Mus musculus histone protein Hist1h2ak gene, comp... 50 0.009
396gb|AY158910.1| Mus musculus histone protein Hist1h2aj pseudogene... 50 0.009
397gb|AY158909.1| Mus musculus histone protein Hist1h2ai gene, comp... 50 0.009
398dbj|AK216150.1| Mus musculus cDNA, clone:Y2G0137G02, strand:minu... 50 0.009
399dbj|AK214754.1| Mus musculus cDNA, clone:Y2G0132O07, strand:minu... 50 0.009
400ref|NM_175661.1| Mus musculus histone 1, H2af (Hist1h2af), mRNA 50 0.009
401ref|NM_175659.1| Mus musculus histone 1, H2ah (Hist1h2ah), mRNA 50 0.009
402gb|BC112256.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 50 0.009
403gb|BC112254.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MG... 50 0.009
404gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (... 50 0.009
405dbj|D11055.1|CHKH2A4H Gallus gallus gene for H2A histone, comple... 50 0.009
406gb|U38934.1|GGU38934 Gallus gallus histone H2A (H2A-IX) gene, co... 50 0.009
407gb|U38933.1|GGU38933 Gallus gallus histone H2A (H2A-VIII) gene, ... 50 0.009
408gb|U38932.1|GGU38932 Gallus gallus histone H2A (H2A-VII) gene, c... 50 0.009
409gb|U38931.1|GGU38931 Gallus gallus histone H2A (H2A-VI) gene, co... 50 0.009
410gb|U95113.1|RNU95113 Rattus norvegicus histone H2a gene, complet... 50 0.009
411gb|U95111.1|MSU95111 Mus spretus histone H2a pseudogene, complet... 50 0.009
412gb|U95110.1|MMU95110 Mus macedonicus histone H2a pseudogene, com... 50 0.009
413gb|M37736.1|MUSHIS2AR Mouse replication-dependent histone H2A.1 ... 50 0.009
414gb|AY576483.1| Litopenaeus vannamei tissue-type gill histone H2A... 48 0.035
415gb|BC101409.1| Homo sapiens H2A histone family, member B2, mRNA ... 48 0.035
416gb|BC101415.1| Homo sapiens H2A histone family, member B2, mRNA ... 48 0.035
417ref|XM_529212.1| PREDICTED: Pan troglodytes coagulation factor V... 48 0.035
418ref|XM_513764.1| PREDICTED: Pan troglodytes LOC457261 (LOC457261... 48 0.035
419gb|BC101418.1| Homo sapiens H2A histone family, member B2, mRNA ... 48 0.035
420gb|BC019308.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 48 0.035
421gb|BC001629.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 48 0.035
422gb|BC101417.1| Homo sapiens H2A histone family, member B2, mRNA ... 48 0.035
423ref|NG_005114.1| Homo sapiens coagulation factor VIII region (F8... 48 0.035
424ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 ... 48 0.035
425ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 48 0.035
426ref|XM_866661.1| PREDICTED: Bos taurus similar to Histone H2A.o ... 48 0.035
427ref|NM_001017991.1| Homo sapiens H2A histone family, member B2 (... 48 0.035
428ref|NM_080720.1| Homo sapiens H2A histone family, member B3 (H2A... 48 0.035
429ref|NM_003516.2| Homo sapiens histone 2, H2aa (HIST2H2AA), mRNA 48 0.035
430emb|CT025637.1| Pan troglodytes chromosome X clone PTB-011B24 ma... 48 0.035
431ref|XM_538635.2| PREDICTED: Canis familiaris similar to H2A hist... 48 0.035
432emb|BX682237.6| Human DNA sequence from clone RP11-810M4 on chro... 48 0.035
433emb|BX276110.5| Human DNA sequence from clone RP11-218L14 on chr... 48 0.035
434emb|X58069.1|MMH2AX Mouse mRNA for Histone H2A.X 48 0.035
435ref|XM_928387.1| PREDICTED: Homo sapiens similar to Histone H2A.... 48 0.035
436gb|AC163771.5| Pan troglodytes BAC clone CH251-57G17 from chromo... 48 0.035
437emb|CR541872.1| Homo sapiens full open reading frame cDNA clone ... 48 0.035
438emb|CR536525.1| Homo sapiens full open reading frame cDNA clone ... 48 0.035
439gb|AF254576.1|AF254576 Homo sapiens histone H2A variant Barr-bod... 48 0.035
440ref|XM_574181.1| PREDICTED: Rattus norvegicus similar to H2A his... 48 0.035
441ref|XM_214093.2| PREDICTED: Rattus norvegicus H2A histone family... 48 0.035
442gb|AC160653.3| Pan troglodytes BAC clone CH251-453K4 from chromo... 48 0.035
443gb|AY158929.1| Mus musculus histone protein Hist1h2bn gene, comp... 48 0.035
444dbj|AK207984.1| Mus musculus cDNA, clone:Y2G0109L23, strand:minu... 48 0.035
445gb|AY894055.1| Synthetic construct Homo sapiens clone FLH131281.... 48 0.035
446gb|AY894054.1| Synthetic construct Homo sapiens clone FLH130836.... 48 0.035
447gb|BC098171.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 48 0.035
448gb|BC096705.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 48 0.035
449gb|BC096739.1| Homo sapiens histone 2, H2aa, mRNA (cDNA clone MG... 48 0.035
450gb|AY104674.1| Zea mays PCO111827 mRNA sequence 48 0.035
451gb|AY781306.1| Pan troglodytes int22h-2 and int22h-3 duplicon se... 48 0.035
452gb|AY781305.1| Pan troglodytes int22h-1 duplicon sequence 48 0.035
453gb|AY620001.1| Homo sapiens isolate Int22h-3 F8a gene, complete cds 48 0.035
454gb|AY620000.1| Homo sapiens isolate Int22h-2 F8a gene, complete cds 48 0.035
455dbj|D11054.1|CHKH2A3H Gallus gallus gene for H2A histone, comple... 48 0.035
456gb|AC159036.3| Pan troglodytes BAC clone CH251-318E5 from chromo... 48 0.035
457gb|L19779.1|HUMH2A2A Homo sapiens histone H2A.2 mRNA, complete cds 48 0.035
458gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 48 0.035
459gb|M33988.1|MUSH2AX1 Mouse histone H2A.1 gene, complete cds 48 0.035
460gb|AY131972.1| Homo sapiens histone H2A (HIST2H2AB) gene, comple... 48 0.035
461gb|AY131971.1| Homo sapiens histone H2A (HIST2H2AA) gene, comple... 48 0.035
462ref|XM_463847.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.14
463gb|AY389588.1| Hyacinthus orientalis histone H2A mRNA, complete cds 46 0.14
464gb|BC004915.2| Homo sapiens H2A histone family, member X, mRNA (... 46 0.14
465ref|XM_868674.1| PREDICTED: Bos taurus similar to Histone H2A.1 ... 46 0.14
466gb|BC006955.1| Mus musculus H2A histone family, member Y, mRNA (... 46 0.14
467ref|XM_984914.1| PREDICTED: Mus musculus H2A histone family, mem... 46 0.14
468ref|XM_985028.1| PREDICTED: Mus musculus H2A histone family, mem... 46 0.14
469ref|XM_984999.1| PREDICTED: Mus musculus H2A histone family, mem... 46 0.14
470ref|XM_984970.1| PREDICTED: Mus musculus H2A histone family, mem... 46 0.14
471ref|XM_923889.2| PREDICTED: Mus musculus H2A histone family, mem... 46 0.14
472ref|NM_012015.1| Mus musculus H2A histone family, member Y (H2af... 46 0.14
473emb|CR673199.2|CNS0FIET Tetraodon nigroviridis full-length cDNA 46 0.14
474ref|NM_002105.2| Homo sapiens H2A histone family, member X (H2AF... 46 0.14
475emb|X14850.1|HSH2AX Human H2A.X mRNA encoding histone H2A.X 46 0.14
476emb|CR457079.1| Homo sapiens full open reading frame cDNA clone ... 46 0.14
477emb|AL034559.4|PFMAL3P7 Plasmodium falciparum MAL3P7, complete s... 46 0.14
478gb|BC013416.2| Homo sapiens H2A histone family, member X, mRNA (... 46 0.14
479emb|CR605072.1| full-length cDNA clone CS0DD007YB20 of Neuroblas... 46 0.14
480dbj|AK143498.1| Mus musculus 8 cells embryo 8 cells cDNA, RIKEN ... 46 0.14
481emb|AL732295.24| Mouse DNA sequence from clone RP23-77F19 on chr... 46 0.14
482dbj|AK039274.1| Mus musculus adult male spinal cord cDNA, RIKEN ... 46 0.14
483gb|AF171080.1|AF171080 Mus musculus histone macroH2A1.2 variant ... 46 0.14
484gb|DQ015918.1| Homo sapiens H2A histone family, member X (H2AFX)... 46 0.14
485ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (p... 46 0.14
486dbj|AK204242.1| Mus musculus cDNA, clone:Y1G0147L15, strand:minu... 46 0.14
487dbj|AB071988.2| Mus musculus mRNA for MacroH2A1.2, complete cds 46 0.14
488dbj|AP004090.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.14
489gb|BC011694.2| Homo sapiens H2A histone family, member X, mRNA (... 46 0.14
490dbj|AP003391.1| Homo sapiens genomic DNA, chromosome 11q clone:C... 46 0.14
491gb|U95109.1|MSU95109 Mus spicilegus histone H2a pseudogene, comp... 46 0.14
492ref|XM_510606.1| PREDICTED: Pan troglodytes similar to H2A histo... 44 0.55
493ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.55
494ref|XM_522264.1| PREDICTED: Pan troglodytes similar to Histone H... 44 0.55
495ref|XM_475374.1| Oryza sativa (japonica cultivar-group), predic... 44 0.55
496gb|BC107354.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG... 44 0.55
497gb|BC107355.1| Mus musculus histone 1, H2aa, mRNA (cDNA clone MG... 44 0.55
498ref|NM_193707.1| Oryza sativa (japonica cultivar-group), predic... 44 0.55
499ref|NM_175658.1| Mus musculus histone 1, H2aa (Hist1h2aa), mRNA 44 0.55
500gb|BT017719.1| Zea mays clone EL01N0447A04.c mRNA sequence 44 0.55

>ref|XM_469689.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 671

 Score =  507 bits (256), Expect = e-140
 Identities = 376/416 (90%)
 Strand = Plus / Plus

                                                                       
Query: 159 gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
           |||||| || || ||||| |||||| ||||||| || |||||||||||||||||| | ||
Sbjct: 175 gatggcgggaaaaggaggtaagggcttgctcgccgcgaagacgacggccgccaagtcggc 234

                                                                       
Query: 219 cgagaaggacaaggggaagaaggcccccatctcccgctcgtcccgcgccgggctccagtt 278
            ||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||||
Sbjct: 235 ggagaaggacaaggggaagaaggcccccgtctcccgctcgtcccgcgctggtctccagtt 294

                                                                       
Query: 279 ccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccgtgttgg 338
           ||||||||||||||||||||| ||| ||||||||||||| ||||| ||||| ||||||||
Sbjct: 295 ccctgttggccgtatccatcgccagttgaagcaaaggactcaggcaaatggacgtgttgg 354

                                                                       
Query: 339 tgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggttctgga 398
           ||||||||| || || |||||||||||||| || |||||| | || || |||||||||||
Sbjct: 355 tgctactgccgcagtttactctgctgctattctggagtacttaacagctgaggttctgga 414

                                                                       
Query: 399 gctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcacctgca 458
            |||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||
Sbjct: 415 actggctgggaacgctagcaaggatctgaaggtcaagcgtatcacccctcgccatctgca 474

                                                                       
Query: 459 gctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctggtgg 518
           ||| |||||||||||||| |||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 475 gcttgccatccgtggagatgaggagctcgacactctcatcaagggtaccatcgctggtgg 534

                                                                   
Query: 519 aggtgtgatcccacacatccacaagtccctgatcaacaagtcctccaaagagtgaa 574
           |||||| || || |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 535 aggtgtcattcctcacatccacaagtccctgatcaacaagtcctccaaagagtgaa 590



to top

>dbj|AK120299.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013052C06, full
           insert sequence
          Length = 1004

 Score =  507 bits (256), Expect = e-140
 Identities = 376/416 (90%)
 Strand = Plus / Plus

                                                                       
Query: 159 gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
           |||||| || || ||||| |||||| ||||||| || |||||||||||||||||| | ||
Sbjct: 190 gatggcgggaaaaggaggtaagggcttgctcgccgcgaagacgacggccgccaagtcggc 249

                                                                       
Query: 219 cgagaaggacaaggggaagaaggcccccatctcccgctcgtcccgcgccgggctccagtt 278
            ||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||||
Sbjct: 250 ggagaaggacaaggggaagaaggcccccgtctcccgctcgtcccgcgctggtctccagtt 309

                                                                       
Query: 279 ccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccgtgttgg 338
           ||||||||||||||||||||| ||| ||||||||||||| ||||| ||||| ||||||||
Sbjct: 310 ccctgttggccgtatccatcgccagttgaagcaaaggactcaggcaaatggacgtgttgg 369

                                                                       
Query: 339 tgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggttctgga 398
           ||||||||| || || |||||||||||||| || |||||| | || || |||||||||||
Sbjct: 370 tgctactgccgcagtttactctgctgctattctggagtacttaacagctgaggttctgga 429

                                                                       
Query: 399 gctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcacctgca 458
            |||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||
Sbjct: 430 actggctgggaacgctagcaaggatctgaaggtcaagcgtatcacccctcgccatctgca 489

                                                                       
Query: 459 gctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctggtgg 518
           ||| |||||||||||||| |||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 490 gcttgccatccgtggagatgaggagctcgacactctcatcaagggtaccatcgctggtgg 549

                                                                   
Query: 519 aggtgtgatcccacacatccacaagtccctgatcaacaagtcctccaaagagtgaa 574
           |||||| || || |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 550 aggtgtcattcctcacatccacaagtccctgatcaacaagtcctccaaagagtgaa 605



to top

>gb|AY104056.1| Zea mays PCO122239 mRNA sequence
          Length = 924

 Score =  464 bits (234), Expect = e-127
 Identities = 375/422 (88%)
 Strand = Plus / Plus

                                                                       
Query: 153 ggaggagatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaa 212
           ||||| |||||| ||||||||||| || ||  ||||||| || ||||||||||| |||||
Sbjct: 212 ggaggcgatggctgggaagggaggaaaaggattgctcgccgcgaagacgacggcggccaa 271

                                                                       
Query: 213 gaccgccgagaaggacaaggggaagaaggcccccatctcccgctcgtcccgcgccgggct 272
           | | || |||||||||||||||||||||||||||||||| || || |||||||| || ||
Sbjct: 272 gtcggcggagaaggacaaggggaagaaggcccccatctcacggtcctcccgcgcgggcct 331

                                                                       
Query: 273 ccagttccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccg 332
           |||||| |||||||| || ||||| |||||||||||||||||||| ||||| ||||||||
Sbjct: 332 ccagtttcctgttggacgaatccaccgtcagctgaagcaaaggactcaggcaaatggccg 391

                                                                       
Query: 333 tgttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggt 392
            |||||||| ||||| || |||||||| || || ||||| |||||| | || ||||||||
Sbjct: 392 cgttggtgccactgcagccgtctactccgccgccatcctggagtacttaactgccgaggt 451

                                                                       
Query: 393 tctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtca 452
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 452 tctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgcca 511

                                                                       
Query: 453 cctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgc 512
           ||| ||| ||||||| || |||||||||||||| || |||||||||||||||||||| ||
Sbjct: 512 cctacagttggccattcgcggagacgaggagctggataccctcatcaagggcaccatcgc 571

                                                                       
Query: 513 tggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtcctccaaagagtg 572
            |||||||| || ||||| ||||||||||||||||||||||||||||||||||| |||||
Sbjct: 572 aggtggaggcgtcatcccgcacatccacaagtccctgatcaacaagtcctccaaggagtg 631

             
Query: 573 aa 574
           ||
Sbjct: 632 aa 633



 Score = 48.1 bits (24), Expect = 0.035
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 63  cgggatccgcccgattcgtcccccgatccgcgctgattcg 102
           |||||||||||||||||| ||  ||||| |||||||||||
Sbjct: 114 cgggatccgcccgattcggccgtcgatctgcgctgattcg 153



to top

>gb|BT016248.1| Zea mays clone Contig81 mRNA sequence
          Length = 623

 Score =  436 bits (220), Expect = e-119
 Identities = 325/360 (90%)
 Strand = Plus / Plus

                                                                       
Query: 215 ccgccgagaaggacaaggggaagaaggcccccatctcccgctcgtcccgcgccgggctcc 274
           ||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||| ||||
Sbjct: 11  ccgccgagaaggacaaggggaagaaggccccaatctcacgctcctcccgcgccggcctcc 70

                                                                       
Query: 275 agttccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccgtg 334
           ||||||||||||| |||||||| |||||||||||||||||||| ||||| ||||| || |
Sbjct: 71  agttccctgttgggcgtatccaccgtcagctgaagcaaaggactcaggcaaatggtcgcg 130

                                                                       
Query: 335 ttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggttc 394
           ||||||| || || || |||||||| ||||| ||||| |||||| ||||  |||||||||
Sbjct: 131 ttggtgccaccgcagccgtctactccgctgccatcctggagtacttgactcccgaggttc 190

                                                                       
Query: 395 tggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcacc 454
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||  ||  
Sbjct: 191 tggagctggctgggaatgctagcaaggatctgaaggtgaagcgtatcacccctccccatt 250

                                                                       
Query: 455 tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
           ||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||| || |
Sbjct: 251 tgcagctagccattcgtggagacgaggagctggacaccctcatcaagggcaccatcgcag 310

                                                                       
Query: 515 gtggaggtgtgatcccacacatccacaagtccctgatcaacaagtcctccaaagagtgaa 574
           | |||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 311 gcggaggtgtcatcccgcacattcacaagtccctgatcaacaagtcctccaaggagtgaa 370



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  383 bits (193), Expect = e-103
 Identities = 274/301 (91%)
 Strand = Plus / Plus

                                                                            
Query: 274      cagttccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccgt 333
                |||||||||||||||||||||||||| ||| ||||||||||||| ||||| ||||| |||
Sbjct: 30223513 cagttccctgttggccgtatccatcgccagttgaagcaaaggactcaggcaaatggacgt 30223572

                                                                            
Query: 334      gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
                |||||||||||||| || || |||||||||||||| || |||||| | || || ||||||
Sbjct: 30223573 gttggtgctactgccgcagtttactctgctgctattctggagtacttaacagctgaggtt 30223632

                                                                            
Query: 394      ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
                ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| || 
Sbjct: 30223633 ctggaactggctgggaacgctagcaaggatctgaaggtcaagcgtatcacccctcgccat 30223692

                                                                            
Query: 454      ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
                |||||||| |||||||||||||| |||||||| ||||| ||||||||||| ||||| |||
Sbjct: 30223693 ctgcagcttgccatccgtggagatgaggagctcgacactctcatcaagggtaccatcgct 30223752

                                                                            
Query: 514      ggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtcctccaaagagtga 573
                ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 30223753 ggtggaggtgtcattcctcacatccacaagtccctgatcaacaagtcctccaaagagtga 30223812

                 
Query: 574      a 574
                |
Sbjct: 30223813 a 30223813



 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Plus

                                                                           
Query: 370     ctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaag 429
               ||||||||||| || |||||||| ||||||||||| || ||||| ||||||||||| |||
Sbjct: 3353514 ctcgagtacctaaccgccgaggtcctggagctggccggcaacgcgagcaaggatctcaag 3353573

                                                                           
Query: 430     gtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgac 489
               ||||||||||||||||| || || || ||||| |||||||| || || |||||||| |||
Sbjct: 3353574 gtgaagcgtatcaccccgcgccatctccagctagccatccgcggggatgaggagctcgac 3353633

                                                                           
Query: 490     accctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctg 549
               || ||||||||||||||||| || || || || || ||||| || ||||||||||| || 
Sbjct: 3353634 acgctcatcaagggcaccatcgccggcggtggcgtcatcccccatatccacaagtcgctc 3353693

                                       
Query: 550     atcaacaagtcctccaaagagtga 573
               ||||||||| ||||||||||||||
Sbjct: 3353694 atcaacaagacctccaaagagtga 3353717



 Score =  131 bits (66), Expect = 3e-27
 Identities = 105/118 (88%)
 Strand = Plus / Plus

                                                                            
Query: 159      gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
                |||||| || || ||||| |||||| ||||||| || |||||||||||||||||| | ||
Sbjct: 30221753 gatggcgggaaaaggaggtaagggcttgctcgccgcgaagacgacggccgccaagtcggc 30221812

                                                                          
Query: 219      cgagaaggacaaggggaagaaggcccccatctcccgctcgtcccgcgccgggctccag 276
                 ||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||
Sbjct: 30221813 ggagaaggacaaggggaagaaggcccccgtctcccgctcgtcccgcgctggtctccag 30221870



 Score =  109 bits (55), Expect = 1e-20
 Identities = 105/121 (86%), Gaps = 3/121 (2%)
 Strand = Plus / Plus

                                                                           
Query: 159     gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
               |||||| || |||||||||||||| || |||||||||||||| ||||| || |||| |||
Sbjct: 3353143 gatggcgggcaagggaggcaaggggctcctcgcggccaagaccacggcggcaaagagcgc 3353202

                                                                           
Query: 219     cgagaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctcca 275
               ||| ||||||||||    ||||||||||||| |||||||||| ||||||||||| |||||
Sbjct: 3353203 cgacaaggacaaggacaagaagaaggcccccgtctcccgctcctcccgcgccggcctcca 3353262

                
Query: 276     g 276
               |
Sbjct: 3353263 g 3353263



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 265     gccgggctccagttccctgttggccgtatc 294
               ||||||||||||||||| || |||||||||
Sbjct: 9471620 gccgggctccagttccccgtcggccgtatc 9471591



to top

>gb|AC096855.5| Oryza sativa chromosome 3 BAC OJ1365_D05 genomic sequence, complete
           sequence
          Length = 163972

 Score =  383 bits (193), Expect = e-103
 Identities = 274/301 (91%)
 Strand = Plus / Minus

                                                                       
Query: 274 cagttccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccgt 333
           |||||||||||||||||||||||||| ||| ||||||||||||| ||||| ||||| |||
Sbjct: 382 cagttccctgttggccgtatccatcgccagttgaagcaaaggactcaggcaaatggacgt 323

                                                                       
Query: 334 gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
           |||||||||||||| || || |||||||||||||| || |||||| | || || ||||||
Sbjct: 322 gttggtgctactgccgcagtttactctgctgctattctggagtacttaacagctgaggtt 263

                                                                       
Query: 394 ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
           ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| || 
Sbjct: 262 ctggaactggctgggaacgctagcaaggatctgaaggtcaagcgtatcacccctcgccat 203

                                                                       
Query: 454 ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
           |||||||| |||||||||||||| |||||||| ||||| ||||||||||| ||||| |||
Sbjct: 202 ctgcagcttgccatccgtggagatgaggagctcgacactctcatcaagggtaccatcgct 143

                                                                       
Query: 514 ggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtcctccaaagagtga 573
           ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 ggtggaggtgtcattcctcacatccacaagtccctgatcaacaagtcctccaaagagtga 83

            
Query: 574 a 574
           |
Sbjct: 82  a 82



 Score =  131 bits (66), Expect = 3e-27
 Identities = 105/118 (88%)
 Strand = Plus / Minus

                                                                        
Query: 159  gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
            |||||| || || ||||| |||||| ||||||| || |||||||||||||||||| | ||
Sbjct: 2142 gatggcgggaaaaggaggtaagggcttgctcgccgcgaagacgacggccgccaagtcggc 2083

                                                                      
Query: 219  cgagaaggacaaggggaagaaggcccccatctcccgctcgtcccgcgccgggctccag 276
             ||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||
Sbjct: 2082 ggagaaggacaaggggaagaaggcccccgtctcccgctcgtcccgcgctggtctccag 2025



to top

>gb|AC092558.4| Oryza sativa chromosome 3 BAC OSJNBb0036F07 genomic sequence, complete
             sequence
          Length = 130359

 Score =  383 bits (193), Expect = e-103
 Identities = 274/301 (91%)
 Strand = Plus / Plus

                                                                         
Query: 274   cagttccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccgt 333
             |||||||||||||||||||||||||| ||| ||||||||||||| ||||| ||||| |||
Sbjct: 15193 cagttccctgttggccgtatccatcgccagttgaagcaaaggactcaggcaaatggacgt 15252

                                                                         
Query: 334   gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
             |||||||||||||| || || |||||||||||||| || |||||| | || || ||||||
Sbjct: 15253 gttggtgctactgccgcagtttactctgctgctattctggagtacttaacagctgaggtt 15312

                                                                         
Query: 394   ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
             ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| || 
Sbjct: 15313 ctggaactggctgggaacgctagcaaggatctgaaggtcaagcgtatcacccctcgccat 15372

                                                                         
Query: 454   ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
             |||||||| |||||||||||||| |||||||| ||||| ||||||||||| ||||| |||
Sbjct: 15373 ctgcagcttgccatccgtggagatgaggagctcgacactctcatcaagggtaccatcgct 15432

                                                                         
Query: 514   ggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtcctccaaagagtga 573
             ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15433 ggtggaggtgtcattcctcacatccacaagtccctgatcaacaagtcctccaaagagtga 15492

              
Query: 574   a 574
             |
Sbjct: 15493 a 15493



 Score =  131 bits (66), Expect = 3e-27
 Identities = 105/118 (88%)
 Strand = Plus / Plus

                                                                         
Query: 159   gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
             |||||| || || ||||| |||||| ||||||| || |||||||||||||||||| | ||
Sbjct: 13433 gatggcgggaaaaggaggtaagggcttgctcgccgcgaagacgacggccgccaagtcggc 13492

                                                                       
Query: 219   cgagaaggacaaggggaagaaggcccccatctcccgctcgtcccgcgccgggctccag 276
              ||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||
Sbjct: 13493 ggagaaggacaaggggaagaaggcccccgtctcccgctcgtcccgcgctggtctccag 13550



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  383 bits (193), Expect = e-103
 Identities = 274/301 (91%)
 Strand = Plus / Plus

                                                                            
Query: 274      cagttccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccgt 333
                |||||||||||||||||||||||||| ||| ||||||||||||| ||||| ||||| |||
Sbjct: 30314935 cagttccctgttggccgtatccatcgccagttgaagcaaaggactcaggcaaatggacgt 30314994

                                                                            
Query: 334      gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
                |||||||||||||| || || |||||||||||||| || |||||| | || || ||||||
Sbjct: 30314995 gttggtgctactgccgcagtttactctgctgctattctggagtacttaacagctgaggtt 30315054

                                                                            
Query: 394      ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
                ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| || 
Sbjct: 30315055 ctggaactggctgggaacgctagcaaggatctgaaggtcaagcgtatcacccctcgccat 30315114

                                                                            
Query: 454      ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
                |||||||| |||||||||||||| |||||||| ||||| ||||||||||| ||||| |||
Sbjct: 30315115 ctgcagcttgccatccgtggagatgaggagctcgacactctcatcaagggtaccatcgct 30315174

                                                                            
Query: 514      ggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtcctccaaagagtga 573
                ||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 30315175 ggtggaggtgtcattcctcacatccacaagtccctgatcaacaagtcctccaaagagtga 30315234

                 
Query: 574      a 574
                |
Sbjct: 30315235 a 30315235



 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Plus

                                                                           
Query: 370     ctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaag 429
               ||||||||||| || |||||||| ||||||||||| || ||||| ||||||||||| |||
Sbjct: 3353625 ctcgagtacctaaccgccgaggtcctggagctggccggcaacgcgagcaaggatctcaag 3353684

                                                                           
Query: 430     gtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgac 489
               ||||||||||||||||| || || || ||||| |||||||| || || |||||||| |||
Sbjct: 3353685 gtgaagcgtatcaccccgcgccatctccagctagccatccgcggggatgaggagctcgac 3353744

                                                                           
Query: 490     accctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctg 549
               || ||||||||||||||||| || || || || || ||||| || ||||||||||| || 
Sbjct: 3353745 acgctcatcaagggcaccatcgccggcggtggcgtcatcccccatatccacaagtcgctc 3353804

                                       
Query: 550     atcaacaagtcctccaaagagtga 573
               ||||||||| ||||||||||||||
Sbjct: 3353805 atcaacaagacctccaaagagtga 3353828



 Score =  131 bits (66), Expect = 3e-27
 Identities = 105/118 (88%)
 Strand = Plus / Plus

                                                                            
Query: 159      gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
                |||||| || || ||||| |||||| ||||||| || |||||||||||||||||| | ||
Sbjct: 30313175 gatggcgggaaaaggaggtaagggcttgctcgccgcgaagacgacggccgccaagtcggc 30313234

                                                                          
Query: 219      cgagaaggacaaggggaagaaggcccccatctcccgctcgtcccgcgccgggctccag 276
                 ||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||
Sbjct: 30313235 ggagaaggacaaggggaagaaggcccccgtctcccgctcgtcccgcgctggtctccag 30313292



 Score =  109 bits (55), Expect = 1e-20
 Identities = 105/121 (86%), Gaps = 3/121 (2%)
 Strand = Plus / Plus

                                                                           
Query: 159     gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
               |||||| || |||||||||||||| || |||||||||||||| ||||| || |||| |||
Sbjct: 3353254 gatggcgggcaagggaggcaaggggctcctcgcggccaagaccacggcggcaaagagcgc 3353313

                                                                           
Query: 219     cgagaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctcca 275
               ||| ||||||||||    ||||||||||||| |||||||||| ||||||||||| |||||
Sbjct: 3353314 cgacaaggacaaggacaagaagaaggcccccgtctcccgctcctcccgcgccggcctcca 3353373

                
Query: 276     g 276
               |
Sbjct: 3353374 g 3353374



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 265     gccgggctccagttccctgttggccgtatc 294
               ||||||||||||||||| || |||||||||
Sbjct: 9469741 gccgggctccagttccccgtcggccgtatc 9469712



to top

>ref|NM_196515.1| Oryza sativa (japonica cultivar-group) putative histone H2A
           (OSJNBa0061K21.20), mRNA
          Length = 420

 Score =  266 bits (134), Expect = 8e-68
 Identities = 348/418 (83%), Gaps = 6/418 (1%)
 Strand = Plus / Plus

                                                                       
Query: 160 atggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgcc 219
           ||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||| |||||
Sbjct: 1   atggcggggaagggagggaaggggctgctcgcggcgaagacgacggcggcgaaggccgcc 60

                                                                       
Query: 220 g---agaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctc 273
           |   | ||||||||||   | |||||||| ||| |||||||||| |||||||||||| ||
Sbjct: 61  gccgacaaggacaaggaccgcaagaaggcgcccgtctcccgctcctcccgcgccgggatc 120

                                                                       
Query: 274 cagttccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccgt 333
           |||||||| || || ||||||||  | |||||||||   |||     |||||| ||||| 
Sbjct: 121 cagttcccggtggggcgtatccacaggcagctgaaggggagggtgtcggcgaacggccgc 180

                                                                       
Query: 334 gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
           || || || || |||||||| ||| | || || |||||||||||||||||||| ||||| 
Sbjct: 181 gtgggggcgacggcggcggtgtacacggcggcgatcctcgagtacctgacggcggaggtc 240

                                                                       
Query: 394 ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
           |||||||| || || ||||| |||||||| || ||||||||||| |||||||| || |||
Sbjct: 241 ctggagctcgccggcaacgccagcaaggacctcaaggtgaagcgcatcaccccgcgccac 300

                                                                       
Query: 454 ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
           |||||||| |||||||| || ||||||||||| ||||||||||||||||||||||| || 
Sbjct: 301 ctgcagctcgccatccgcggggacgaggagctcgacaccctcatcaagggcaccatagcc 360

                                                                     
Query: 514 ggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtcctccaaagagt 571
           || || || || ||||| ||||||||||||||||| ||||||||| || |||| ||||
Sbjct: 361 ggcggcggcgtcatcccgcacatccacaagtccctcatcaacaagaccgccaaggagt 418



to top

>dbj|AK121515.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033025E19, full
           insert sequence
          Length = 804

 Score =  258 bits (130), Expect = 2e-65
 Identities = 347/418 (83%), Gaps = 6/418 (1%)
 Strand = Plus / Plus

                                                                       
Query: 160 atggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgcc 219
           ||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||| |||||
Sbjct: 83  atggcggggaagggagggaaggggctgctcgcggcgaagacgacggcggcgaaggccgcc 142

                                                                       
Query: 220 g---agaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctc 273
           |   | ||||||||||   | |||||||| ||| |||||||||| |||||||||||| ||
Sbjct: 143 gccgacaaggacaaggaccgcaagaaggcgcccgtctcccgctcctcccgcgccgggatc 202

                                                                       
Query: 274 cagttccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccgt 333
           |||||||| || || ||||||||  | |||||||||   |||     |||||| ||||| 
Sbjct: 203 cagttcccggtggggcgtatccacaggcagctgaaggggagggtgtcggcgaacggccgc 262

                                                                       
Query: 334 gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
           || || || || |||||||| ||| | || || |||||||||||||||||||| ||||| 
Sbjct: 263 gtgggggcgacggcggcggtgtacacggcggcgatcctcgagtacctgacggcggaggtc 322

                                                                       
Query: 394 ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
           |||||||| || || ||||| |||||||| || ||||||||||| |||||||| || |||
Sbjct: 323 ctggagctcgccggcaacgccagcaaggacctcaaggtgaagcgcatcaccccgcgccac 382

                                                                       
Query: 454 ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
           |||||||| |||||||| || ||||||||||| |||||||| |||||||||||||| || 
Sbjct: 383 ctgcagctcgccatccgcggggacgaggagctcgacaccctaatcaagggcaccatagcc 442

                                                                     
Query: 514 ggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtcctccaaagagt 571
           || || || || ||||| ||||||||||||||||| ||||||||| || |||| ||||
Sbjct: 443 ggcggcggcgtcatcccgcacatccacaagtccctcatcaacaagaccgccaaggagt 500



to top

>gb|AF193345.1|AF193345 Oryza sativa H2A protein mRNA, complete cds
          Length = 948

 Score =  242 bits (122), Expect = 1e-60
 Identities = 345/418 (82%), Gaps = 6/418 (1%)
 Strand = Plus / Plus

                                                                       
Query: 160 atggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgcc 219
           ||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||| |||||
Sbjct: 207 atggcggggaagggagggaaggggctgctcgcggcgaagacgacggcggcgaaggccgcc 266

                                                                       
Query: 220 g---agaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctc 273
           |   | ||||||||||   | |||||||| ||| |||||| ||| |||||||||||| ||
Sbjct: 267 gccgacaaggacaaggaccgcaagaaggcgcccctctccccctcctcccgcgccgggatc 326

                                                                       
Query: 274 cagttccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccgt 333
           |||||||| || || ||||||||  | |||||||||   |||     |||||| ||||  
Sbjct: 327 cagttcccggtggggcgtatccacaggcagctgaaggggagggtgtcggcgaacggcccc 386

                                                                       
Query: 334 gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
           || || || || |||||||| ||| | || || |||||||||||||||||||  ||||| 
Sbjct: 387 gtgggggcgacggcggcggtgtacacggcggcgatcctcgagtacctgacgggggaggtc 446

                                                                       
Query: 394 ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
           |||||||| || || ||||| |||||||| || ||||||||||| |||||||| || |||
Sbjct: 447 ctggagctcgccggcaacgccagcaaggacctcaaggtgaagcgcatcaccccgcgccac 506

                                                                       
Query: 454 ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
           |||||||| |||||||| || ||||||||||| ||||||||||||||||||||||| || 
Sbjct: 507 ctgcagctcgccatccgcggggacgaggagctcgacaccctcatcaagggcaccatagcc 566

                                                                     
Query: 514 ggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtcctccaaagagt 571
           || || || || ||||| ||||||||||||||||| ||||||||| || |||| ||||
Sbjct: 567 ggcggcggcgtcatcccgcacatccacaagtccctcatcaacaagaccgccaaggagt 624



to top

>gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica cultivar-group) cultivar
              Nipponbare Clone OSJNBa0061K21 From Chromosome 10, complete
              sequence
          Length = 112721

 Score =  204 bits (103), Expect = 3e-49
 Identities = 214/251 (85%)
 Strand = Plus / Plus

                                                                          
Query: 321    ggcgaatggccgtgttggtgctactgcggcggtctactctgctgctatcctcgagtacct 380
              |||||| ||||| || || || || |||||||| ||| | || || ||||||||||||||
Sbjct: 104168 ggcgaacggccgcgtgggggcgacggcggcggtgtacacggcggcgatcctcgagtacct 104227

                                                                          
Query: 381    gacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtat 440
              |||||| ||||| |||||||| || || ||||| |||||||| || ||||||||||| ||
Sbjct: 104228 gacggcggaggtcctggagctcgccggcaacgccagcaaggacctcaaggtgaagcgcat 104287

                                                                          
Query: 441    cacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccctcatcaa 500
              |||||| || ||||||||||| |||||||| || ||||||||||| ||||||||||||||
Sbjct: 104288 caccccgcgccacctgcagctcgccatccgcggggacgaggagctcgacaccctcatcaa 104347

                                                                          
Query: 501    gggcaccattgctggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtc 560
              ||||||||| || || || || || ||||| ||||||||||||||||| ||||||||| |
Sbjct: 104348 gggcaccatagccggcggcggcgtcatcccgcacatccacaagtccctcatcaacaagac 104407

                         
Query: 561    ctccaaagagt 571
              | |||| ||||
Sbjct: 104408 cgccaaggagt 104418



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 104/123 (84%), Gaps = 6/123 (4%)
 Strand = Plus / Plus

                                                                          
Query: 160    atggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgcc 219
              ||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||| |||||
Sbjct: 103631 atggcggggaagggagggaaggggctgctcgcggcgaagacgacggcggcgaaggccgcc 103690

                                                                          
Query: 220    g---agaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctc 273
              |   | ||||||||||   | |||||||| ||| |||||||||| |||||||||||| ||
Sbjct: 103691 gccgacaaggacaaggaccgcaagaaggcgcccgtctcccgctcctcccgcgccgggatc 103750

                 
Query: 274    cag 276
              |||
Sbjct: 103751 cag 103753



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  204 bits (103), Expect = 3e-49
 Identities = 214/251 (85%)
 Strand = Plus / Plus

                                                                            
Query: 321      ggcgaatggccgtgttggtgctactgcggcggtctactctgctgctatcctcgagtacct 380
                |||||| ||||| || || || || |||||||| ||| | || || ||||||||||||||
Sbjct: 14164640 ggcgaacggccgcgtgggggcgacggcggcggtgtacacggcggcgatcctcgagtacct 14164699

                                                                            
Query: 381      gacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtat 440
                |||||| ||||| |||||||| || || ||||| |||||||| || ||||||||||| ||
Sbjct: 14164700 gacggcggaggtcctggagctcgccggcaacgccagcaaggacctcaaggtgaagcgcat 14164759

                                                                            
Query: 441      cacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccctcatcaa 500
                |||||| || ||||||||||| |||||||| || ||||||||||| ||||||||||||||
Sbjct: 14164760 caccccgcgccacctgcagctcgccatccgcggggacgaggagctcgacaccctcatcaa 14164819

                                                                            
Query: 501      gggcaccattgctggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtc 560
                ||||||||| || || || || || ||||| ||||||||||||||||| ||||||||| |
Sbjct: 14164820 gggcaccatagccggcggcggcgtcatcccgcacatccacaagtccctcatcaacaagac 14164879

                           
Query: 561      ctccaaagagt 571
                | |||| ||||
Sbjct: 14164880 cgccaaggagt 14164890



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 104/123 (84%), Gaps = 6/123 (4%)
 Strand = Plus / Plus

                                                                            
Query: 160      atggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgcc 219
                ||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||| |||||
Sbjct: 14164103 atggcggggaagggagggaaggggctgctcgcggcgaagacgacggcggcgaaggccgcc 14164162

                                                                            
Query: 220      g---agaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctc 273
                |   | ||||||||||   | |||||||| ||| |||||||||| |||||||||||| ||
Sbjct: 14164163 gccgacaaggacaaggaccgcaagaaggcgcccgtctcccgctcctcccgcgccgggatc 14164222

                   
Query: 274      cag 276
                |||
Sbjct: 14164223 cag 14164225



to top

>gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb0006I13 chromosome 10,
             complete sequence
          Length = 142737

 Score =  204 bits (103), Expect = 3e-49
 Identities = 214/251 (85%)
 Strand = Plus / Plus

                                                                         
Query: 321   ggcgaatggccgtgttggtgctactgcggcggtctactctgctgctatcctcgagtacct 380
             |||||| ||||| || || || || |||||||| ||| | || || ||||||||||||||
Sbjct: 36713 ggcgaacggccgcgtgggggcgacggcggcggtgtacacggcggcgatcctcgagtacct 36772

                                                                         
Query: 381   gacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtat 440
             |||||| ||||| |||||||| || || ||||| |||||||| || ||||||||||| ||
Sbjct: 36773 gacggcggaggtcctggagctcgccggcaacgccagcaaggacctcaaggtgaagcgcat 36832

                                                                         
Query: 441   cacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccctcatcaa 500
             |||||| || ||||||||||| |||||||| || ||||||||||| ||||||||||||||
Sbjct: 36833 caccccgcgccacctgcagctcgccatccgcggggacgaggagctcgacaccctcatcaa 36892

                                                                         
Query: 501   gggcaccattgctggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtc 560
             ||||||||| || || || || || ||||| ||||||||||||||||| ||||||||| |
Sbjct: 36893 gggcaccatagccggcggcggcgtcatcccgcacatccacaagtccctcatcaacaagac 36952

                        
Query: 561   ctccaaagagt 571
             | |||| ||||
Sbjct: 36953 cgccaaggagt 36963



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 104/123 (84%), Gaps = 6/123 (4%)
 Strand = Plus / Plus

                                                                         
Query: 160   atggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgcc 219
             ||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||| |||||
Sbjct: 36176 atggcggggaagggagggaaggggctgctcgcggcgaagacgacggcggcgaaggccgcc 36235

                                                                         
Query: 220   g---agaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctc 273
             |   | ||||||||||   | |||||||| ||| |||||||||| |||||||||||| ||
Sbjct: 36236 gccgacaaggacaaggaccgcaagaaggcgcccgtctcccgctcctcccgcgccgggatc 36295

                
Query: 274   cag 276
             |||
Sbjct: 36296 cag 36298



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  204 bits (103), Expect = 3e-49
 Identities = 214/251 (85%)
 Strand = Plus / Plus

                                                                            
Query: 321      ggcgaatggccgtgttggtgctactgcggcggtctactctgctgctatcctcgagtacct 380
                |||||| ||||| || || || || |||||||| ||| | || || ||||||||||||||
Sbjct: 14172882 ggcgaacggccgcgtgggggcgacggcggcggtgtacacggcggcgatcctcgagtacct 14172941

                                                                            
Query: 381      gacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtat 440
                |||||| ||||| |||||||| || || ||||| |||||||| || ||||||||||| ||
Sbjct: 14172942 gacggcggaggtcctggagctcgccggcaacgccagcaaggacctcaaggtgaagcgcat 14173001

                                                                            
Query: 441      cacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccctcatcaa 500
                |||||| || ||||||||||| |||||||| || ||||||||||| ||||||||||||||
Sbjct: 14173002 caccccgcgccacctgcagctcgccatccgcggggacgaggagctcgacaccctcatcaa 14173061

                                                                            
Query: 501      gggcaccattgctggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtc 560
                ||||||||| || || || || || ||||| ||||||||||||||||| ||||||||| |
Sbjct: 14173062 gggcaccatagccggcggcggcgtcatcccgcacatccacaagtccctcatcaacaagac 14173121

                           
Query: 561      ctccaaagagt 571
                | |||| ||||
Sbjct: 14173122 cgccaaggagt 14173132



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 104/123 (84%), Gaps = 6/123 (4%)
 Strand = Plus / Plus

                                                                            
Query: 160      atggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgcc 219
                ||||| ||||||||||| ||||| ||||||||||| ||||||||||| || ||| |||||
Sbjct: 14172345 atggcggggaagggagggaaggggctgctcgcggcgaagacgacggcggcgaaggccgcc 14172404

                                                                            
Query: 220      g---agaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctc 273
                |   | ||||||||||   | |||||||| ||| |||||||||| |||||||||||| ||
Sbjct: 14172405 gccgacaaggacaaggaccgcaagaaggcgcccgtctcccgctcctcccgcgccgggatc 14172464

                   
Query: 274      cag 276
                |||
Sbjct: 14172465 cag 14172467



to top

>dbj|AP006681.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT45D03, TM0375b,
             complete sequence
          Length = 61653

 Score =  190 bits (96), Expect = 4e-45
 Identities = 171/196 (87%)
 Strand = Plus / Plus

                                                                         
Query: 379   ctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgt 438
             ||||| || ||||| ||||||||||||||||| || ||||||||||||||||||||| | 
Sbjct: 37366 ctgactgctgaggtgctggagctggctgggaatgcaagcaaggatctgaaggtgaagagg 37425

                                                                         
Query: 439   atcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccctcatc 498
             ||||| || |||||| ||||||| || ||| | ||||| || ||||||||||||||||||
Sbjct: 37426 atcacaccgcgtcacttgcagctcgctatcaggggagatgaagagcttgacaccctcatc 37485

                                                                         
Query: 499   aagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctgatcaacaag 558
             || || |||||||||||||| ||||| ||||| ||||| ||||||||| |||||||||| 
Sbjct: 37486 aaaggaaccattgctggtggtggtgtcatccctcacattcacaagtccttgatcaacaaa 37545

                             
Query: 559   tcctccaaagagtgaa 574
              |||||||||||||||
Sbjct: 37546 acctccaaagagtgaa 37561



to top

>ref|NM_187762.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 417

 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Plus

                                                                       
Query: 370 ctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaag 429
           ||||||||||| || |||||||| ||||||||||| || ||||| ||||||||||| |||
Sbjct: 214 ctcgagtacctaaccgccgaggtcctggagctggccggcaacgcgagcaaggatctcaag 273

                                                                       
Query: 430 gtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgac 489
           ||||||||||||||||| || || || ||||| |||||||| || || |||||||| |||
Sbjct: 274 gtgaagcgtatcaccccgcgccatctccagctagccatccgcggggatgaggagctcgac 333

                                                                       
Query: 490 accctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctg 549
           || ||||||||||||||||| || || || || || ||||| || ||||||||||| || 
Sbjct: 334 acgctcatcaagggcaccatcgccggcggtggcgtcatcccccatatccacaagtcgctc 393

                                   
Query: 550 atcaacaagtcctccaaagagtga 573
           ||||||||| ||||||||||||||
Sbjct: 394 atcaacaagacctccaaagagtga 417



 Score =  123 bits (62), Expect = 7e-25
 Identities = 121/140 (86%), Gaps = 3/140 (2%)
 Strand = Plus / Plus

                                                                       
Query: 160 atggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgcc 219
           ||||| || |||||||||||||| || |||||||||||||| ||||| || |||| ||||
Sbjct: 1   atggcgggcaagggaggcaaggggctcctcgcggccaagaccacggcggcaaagagcgcc 60

                                                                       
Query: 220 gagaaggacaaggg---gaagaaggcccccatctcccgctcgtcccgcgccgggctccag 276
           || ||||||||||    ||||||||||||| |||||||||| ||||||||||| ||||||
Sbjct: 61  gacaaggacaaggacaagaagaaggcccccgtctcccgctcctcccgcgccggcctccag 120

                               
Query: 277 ttccctgttggccgtatcca 296
           ||||| || || ||||||||
Sbjct: 121 ttcccggtggggcgtatcca 140



to top

>gb|AC105729.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1607A12,
             complete sequence
          Length = 177327

 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Minus

                                                                         
Query: 370   ctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaag 429
             ||||||||||| || |||||||| ||||||||||| || ||||| ||||||||||| |||
Sbjct: 75700 ctcgagtacctaaccgccgaggtcctggagctggccggcaacgcgagcaaggatctcaag 75641

                                                                         
Query: 430   gtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgac 489
             ||||||||||||||||| || || || ||||| |||||||| || || |||||||| |||
Sbjct: 75640 gtgaagcgtatcaccccgcgccatctccagctagccatccgcggggatgaggagctcgac 75581

                                                                         
Query: 490   accctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctg 549
             || ||||||||||||||||| || || || || || ||||| || ||||||||||| || 
Sbjct: 75580 acgctcatcaagggcaccatcgccggcggtggcgtcatcccccatatccacaagtcgctc 75521

                                     
Query: 550   atcaacaagtcctccaaagagtga 573
             ||||||||| ||||||||||||||
Sbjct: 75520 atcaacaagacctccaaagagtga 75497



 Score =  109 bits (55), Expect = 1e-20
 Identities = 105/121 (86%), Gaps = 3/121 (2%)
 Strand = Plus / Minus

                                                                         
Query: 159   gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
             |||||| || |||||||||||||| || |||||||||||||| ||||| || |||| |||
Sbjct: 76071 gatggcgggcaagggaggcaaggggctcctcgcggccaagaccacggcggcaaagagcgc 76012

                                                                         
Query: 219   cgagaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctcca 275
             ||| ||||||||||    ||||||||||||| |||||||||| ||||||||||| |||||
Sbjct: 76011 cgacaaggacaaggacaagaagaaggcccccgtctcccgctcctcccgcgccggcctcca 75952

              
Query: 276   g 276
             |
Sbjct: 75951 g 75951



to top

>dbj|AK121533.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030P21, full
           insert sequence
          Length = 817

 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Plus

                                                                       
Query: 370 ctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaag 429
           ||||||||||| || |||||||| ||||||||||| || ||||| ||||||||||| |||
Sbjct: 309 ctcgagtacctaaccgccgaggtcctggagctggccggcaacgcgagcaaggatctcaag 368

                                                                       
Query: 430 gtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgac 489
           ||||||||||||||||| || || || ||||| |||||||| || || |||||||| |||
Sbjct: 369 gtgaagcgtatcaccccgcgccatctccagctagccatccgcggggatgaggagctcgac 428

                                                                       
Query: 490 accctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctg 549
           || ||||||||||||||||| || || || || || ||||| || ||||||||||| || 
Sbjct: 429 acgctcatcaagggcaccatcgccggcggtggcgtcatcccccatatccacaagtcgctc 488

                                   
Query: 550 atcaacaagtcctccaaagagtga 573
           ||||||||| ||||||||||||||
Sbjct: 489 atcaacaagacctccaaagagtga 512



 Score =  125 bits (63), Expect = 2e-25
 Identities = 122/141 (86%), Gaps = 3/141 (2%)
 Strand = Plus / Plus

                                                                       
Query: 159 gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
           |||||| || |||||||||||||| || |||||||||||||| ||||| || |||| |||
Sbjct: 95  gatggcgggcaagggaggcaaggggctcctcgcggccaagaccacggcggcaaagagcgc 154

                                                                       
Query: 219 cgagaaggacaaggg---gaagaaggcccccatctcccgctcgtcccgcgccgggctcca 275
           ||| ||||||||||    ||||||||||||| |||||||||| ||||||||||| |||||
Sbjct: 155 cgacaaggacaaggacaagaagaaggcccccgtctcccgctcctcccgcgccggcctcca 214

                                
Query: 276 gttccctgttggccgtatcca 296
           |||||| || || ||||||||
Sbjct: 215 gttcccggtggggcgtatcca 235



to top

>dbj|AK061605.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-030-C05, full
           insert sequence
          Length = 785

 Score =  182 bits (92), Expect = 9e-43
 Identities = 176/204 (86%)
 Strand = Plus / Plus

                                                                       
Query: 370 ctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaag 429
           ||||||||||| || |||||||| ||||||||||| || ||||| ||||||||||| |||
Sbjct: 304 ctcgagtacctaaccgccgaggtcctggagctggccggcaacgcgagcaaggatctcaag 363

                                                                       
Query: 430 gtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgac 489
           ||||||||||||||||| || || || ||||| |||||||| || || |||||||| |||
Sbjct: 364 gtgaagcgtatcaccccgcgccatctccagctagccatccgcggggatgaggagctcgac 423

                                                                       
Query: 490 accctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctg 549
           || ||||||||||||||||| || || || || || ||||| || ||||||||||| || 
Sbjct: 424 acgctcatcaagggcaccatcgccggcggtggcgtcatcccccatatccacaagtcgctc 483

                                   
Query: 550 atcaacaagtcctccaaagagtga 573
           ||||||||| ||||||||||||||
Sbjct: 484 atcaacaagacctccaaagagtga 507



 Score =  125 bits (63), Expect = 2e-25
 Identities = 122/141 (86%), Gaps = 3/141 (2%)
 Strand = Plus / Plus

                                                                       
Query: 159 gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
           |||||| || |||||||||||||| || |||||||||||||| ||||| || |||| |||
Sbjct: 90  gatggcgggcaagggaggcaaggggctcctcgcggccaagaccacggcggcaaagagcgc 149

                                                                       
Query: 219 cgagaaggacaaggg---gaagaaggcccccatctcccgctcgtcccgcgccgggctcca 275
           ||| ||||||||||    ||||||||||||| |||||||||| ||||||||||| |||||
Sbjct: 150 cgacaaggacaaggacaagaagaaggcccccgtctcccgctcctcccgcgccggcctcca 209

                                
Query: 276 gttccctgttggccgtatcca 296
           |||||| || || ||||||||
Sbjct: 210 gttcccggtggggcgtatcca 230



to top

>gb|AY104725.1| Zea mays PCO121651 mRNA sequence
          Length = 716

 Score =  182 bits (92), Expect = 9e-43
 Identities = 179/208 (86%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           |||||||||||||| || |||||||| || |||||||| || ||||| |||||||| || 
Sbjct: 314 atcctcgagtacctcaccgccgaggtcctcgagctggccggcaacgccagcaaggacctc 373

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||| |||||||| || ||||||||||| |||||||| || ||||||||||| 
Sbjct: 374 aaggtcaagcgcatcaccccgcgccacctgcagctcgccatccgcggggacgaggagctc 433

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||||||||||||||||||||||| || || || || || ||||| |||||||||||||| 
Sbjct: 434 gacaccctcatcaagggcaccatcgccgggggcggcgtcatcccgcacatccacaagtcg 493

                                       
Query: 547 ctgatcaacaagtcctccaaagagtgaa 574
           || ||||||||| || |||| |||||||
Sbjct: 494 ctcatcaacaagaccgccaaggagtgaa 521



 Score =  111 bits (56), Expect = 3e-21
 Identities = 109/126 (86%), Gaps = 3/126 (2%)
 Strand = Plus / Plus

                                                                       
Query: 159 gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
           |||||| || |||||||| ||||| ||||| ||||||||||||||||| ||||||| | |
Sbjct: 103 gatggcgggtaagggagggaagggtctgctggcggccaagacgacggcggccaagagcac 162

                                                                       
Query: 219 cgagaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctcca 275
           ||| ||||||||||   |||||||||||||| | || ||||| ||||||||||| |||||
Sbjct: 163 cgacaaggacaaggacaggaagaaggcccccgtgtcgcgctcttcccgcgccggcctcca 222

                 
Query: 276 gttccc 281
           ||||||
Sbjct: 223 gttccc 228



to top

>gb|DQ215051.1| Taeniopygia guttata clone 0061P0027A01 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 707

 Score =  168 bits (85), Expect = 1e-38
 Identities = 160/185 (86%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||||||||| ||||| ||||||||||| |||||||||  ||||||||||
Sbjct: 222 atcctggagtacctgacggctgaggtgctggagctggccgggaacgcttccaaggatctg 281

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           || |||||||| ||||| || || |||||||||||||||||||| || || |||||||| 
Sbjct: 282 aaagtgaagcggatcacgccccggcacctgcagctggccatccgcggcgatgaggagctg 341

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||| | || ||||| | |||||| |||||||||||||| || || |||||||||||||| 
Sbjct: 342 gactcgctgatcaaagccaccatcgctggtggaggtgtcattccccacatccacaagtct 401

                
Query: 547 ctgat 551
           |||||
Sbjct: 402 ctgat 406



to top

>gb|DQ215050.1| Taeniopygia guttata clone 0058P0007H05 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 701

 Score =  168 bits (85), Expect = 1e-38
 Identities = 160/185 (86%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||||||||| ||||| ||||||||||| |||||||||  ||||||||||
Sbjct: 216 atcctggagtacctgacggctgaggtgctggagctggccgggaacgcttccaaggatctg 275

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           || |||||||| ||||| || || |||||||||||||||||||| || || |||||||| 
Sbjct: 276 aaagtgaagcggatcacgccccggcacctgcagctggccatccgcggcgatgaggagctg 335

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||| | || ||||| | |||||| |||||||||||||| || || |||||||||||||| 
Sbjct: 336 gactcgctgatcaaagccaccatcgctggtggaggtgtcattccccacatccacaagtct 395

                
Query: 547 ctgat 551
           |||||
Sbjct: 396 ctgat 400



to top

>gb|DQ215049.1| Taeniopygia guttata clone 0058P0049H09 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 685

 Score =  168 bits (85), Expect = 1e-38
 Identities = 160/185 (86%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||||||||| ||||| ||||||||||| |||||||||  ||||||||||
Sbjct: 199 atcctggagtacctgacggctgaggtgctggagctggccgggaacgcttccaaggatctg 258

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           || |||||||| ||||| || || |||||||||||||||||||| || || |||||||| 
Sbjct: 259 aaagtgaagcggatcacgccccggcacctgcagctggccatccgcggcgatgaggagctg 318

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||| | || ||||| | |||||| |||||||||||||| || || |||||||||||||| 
Sbjct: 319 gactcgctgatcaaagccaccatcgctggtggaggtgtcattccccacatccacaagtct 378

                
Query: 547 ctgat 551
           |||||
Sbjct: 379 ctgat 383



to top

>gb|DQ215048.1| Taeniopygia guttata clone 0058P0013F02 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 685

 Score =  168 bits (85), Expect = 1e-38
 Identities = 160/185 (86%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||||||||| ||||| ||||||||||| |||||||||  ||||||||||
Sbjct: 199 atcctggagtacctgacggctgaggtgctggagctggccgggaacgcttccaaggatctg 258

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           || |||||||| ||||| || || |||||||||||||||||||| || || |||||||| 
Sbjct: 259 aaagtgaagcggatcacgccccggcacctgcagctggccatccgcggcgatgaggagctg 318

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||| | || ||||| | |||||| |||||||||||||| || || |||||||||||||| 
Sbjct: 319 gactcgctgatcaaagccaccatcgctggtggaggtgtcattccccacatccacaagtct 378

                
Query: 547 ctgat 551
           |||||
Sbjct: 379 ctgat 383



to top

>gb|DQ215046.1| Taeniopygia guttata clone 0058P0036G12 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 661

 Score =  168 bits (85), Expect = 1e-38
 Identities = 160/185 (86%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||||||||| ||||| ||||||||||| |||||||||  ||||||||||
Sbjct: 163 atcctggagtacctgacggctgaggtgctggagctggccgggaacgcttccaaggatctg 222

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           || |||||||| ||||| || || |||||||||||||||||||| || || |||||||| 
Sbjct: 223 aaagtgaagcggatcacgccccggcacctgcagctggccatccgcggcgatgaggagctg 282

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||| | || ||||| | |||||| |||||||||||||| || || |||||||||||||| 
Sbjct: 283 gactcgctgatcaaagccaccatcgctggtggaggtgtcattccccacatccacaagtct 342

                
Query: 547 ctgat 551
           |||||
Sbjct: 343 ctgat 347



to top

>gb|DQ215052.1| Taeniopygia guttata clone 0058P0020B08 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 704

 Score =  161 bits (81), Expect = 3e-36
 Identities = 159/185 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||||||||| ||||| ||||||||||| |||||||||  ||||||||| 
Sbjct: 219 atcctggagtacctgacggctgaggtgctggagctggccgggaacgcttccaaggatctc 278

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           || |||||||| ||||| || || |||||||||||||||||||| || || |||||||| 
Sbjct: 279 aaagtgaagcggatcacgccccggcacctgcagctggccatccgcggcgatgaggagctg 338

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||| | || ||||| | |||||| |||||||||||||| || || |||||||||||||| 
Sbjct: 339 gactcgctgatcaaagccaccatcgctggtggaggtgtcattccccacatccacaagtct 398

                
Query: 547 ctgat 551
           |||||
Sbjct: 399 ctgat 403



to top

>gb|DQ215047.1| Taeniopygia guttata clone 0058P0026B08 H2A histone family member V
           variant 1-like mRNA, complete sequence
          Length = 729

 Score =  161 bits (81), Expect = 3e-36
 Identities = 159/185 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||||||||| ||||| ||||||||||| |||||||||  ||||||||| 
Sbjct: 244 atcctggagtacctgacggctgaggtgctggagctggccgggaacgcttccaaggatctc 303

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           || |||||||| ||||| || || |||||||||||||||||||| || || |||||||| 
Sbjct: 304 aaagtgaagcggatcacgccccggcacctgcagctggccatccgcggcgatgaggagctg 363

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||| | || ||||| | |||||| |||||||||||||| || || |||||||||||||| 
Sbjct: 364 gactcgctgatcaaagccaccatcgctggtggaggtgtcattccccacatccacaagtct 423

                
Query: 547 ctgat 551
           |||||
Sbjct: 424 ctgat 428



to top

>emb|CR719262.2|CNS0GHXG Tetraodon nigroviridis full-length cDNA
          Length = 831

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 255 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 314

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||||||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 315 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 374

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 375 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 434

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 435 ctgatc 440



to top

>emb|CR714103.2|CNS0GDYB Tetraodon nigroviridis full-length cDNA
          Length = 842

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 269 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 328

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||||||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 329 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 388

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 389 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 448

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 449 ctgatc 454



to top

>emb|CR710974.2|CNS0GBJE Tetraodon nigroviridis full-length cDNA
          Length = 843

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 268 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 327

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||||||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 328 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 387

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 388 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 447

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 448 ctgatc 453



to top

>emb|CR708160.2|CNS0G9D8 Tetraodon nigroviridis full-length cDNA
          Length = 832

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 261 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 320

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||||||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 321 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 380

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 381 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 440

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 441 ctgatc 446



to top

>emb|CR706063.2|CNS0G7QZ Tetraodon nigroviridis full-length cDNA
          Length = 809

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 239 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 298

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||||||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 299 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 358

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 359 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 418

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 419 ctgatc 424



to top

>emb|CR706962.2|CNS0G8FY Tetraodon nigroviridis full-length cDNA
          Length = 842

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 269 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 328

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||||||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 329 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 388

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 389 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 448

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 449 ctgatc 454



to top

>emb|CR705074.2|CNS0G6ZI Tetraodon nigroviridis full-length cDNA
          Length = 786

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 212 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 271

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||||||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 272 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 331

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 332 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 391

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 392 ctgatc 397



to top

>emb|CR678084.2|CNS0FM61 Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 265 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 324

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||||||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 325 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 384

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 385 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 444

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 445 ctgatc 450



to top

>emb|CR676044.2|CNS0FKLU Tetraodon nigroviridis full-length cDNA
          Length = 840

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 268 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 327

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||||||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 328 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 387

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 388 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 447

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 448 ctgatc 453



to top

>emb|CR673909.2|CNS0FIYJ Tetraodon nigroviridis full-length cDNA
          Length = 846

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 269 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 328

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||||||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 329 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 388

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 389 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 448

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 449 ctgatc 454



to top

>emb|CR671294.2|CNS0FGXW Tetraodon nigroviridis full-length cDNA
          Length = 820

 Score =  155 bits (78), Expect = 2e-34
 Identities = 159/186 (85%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 242 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 301

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||||||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 302 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 361

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 362 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 421

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 422 ctgatc 427



to top

>gb|BT018361.1| Zea mays clone EL01N0311D03.c mRNA sequence
          Length = 675

 Score =  153 bits (77), Expect = 8e-34
 Identities = 177/209 (84%), Gaps = 1/209 (0%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           |||||||||||||| || |||||||| || |||||||| || ||||| |||||||| || 
Sbjct: 316 atcctcgagtacctcaccgccgaggtcctcgagctggccggcaacgccagcaaggacctc 375

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacc-tgcagctggccatccgtggagacgaggagct 485
           ||||| ||||| || ||||| || |||| ||||||| |||||||| || |||||||||||
Sbjct: 376 aaggtcaagcgcattaccccgcgccaccctgcagctcgccatccgcggggacgaggagct 435

                                                                       
Query: 486 tgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtc 545
            ||||||||||||| ||||||||| || || || || || ||||| ||||||||||||||
Sbjct: 436 cgacaccctcatcaggggcaccatcgccgggggcggcgtcatcccgcacatccacaagtc 495

                                        
Query: 546 cctgatcaacaagtcctccaaagagtgaa 574
            || ||||||||| || |||| |||||||
Sbjct: 496 gctcatcaacaagaccgccaaggagtgaa 524



 Score =  111 bits (56), Expect = 3e-21
 Identities = 109/126 (86%), Gaps = 3/126 (2%)
 Strand = Plus / Plus

                                                                       
Query: 159 gatggccgggaagggaggcaagggcctgctcgcggccaagacgacggccgccaagaccgc 218
           |||||| || |||||||| ||||| ||||| ||||||||||||||||| ||||||| | |
Sbjct: 105 gatggcgggtaagggagggaagggtctgctggcggccaagacgacggcggccaagagcac 164

                                                                       
Query: 219 cgagaaggacaagg---ggaagaaggcccccatctcccgctcgtcccgcgccgggctcca 275
           ||| ||||||||||   |||||||||||||| | || ||||| ||||||||||| |||||
Sbjct: 165 cgacaaggacaaggacaggaagaaggcccccgtgtcgcgctcctcccgcgccggcctcca 224

                 
Query: 276 gttccc 281
           ||||||
Sbjct: 225 gttccc 230



to top

>gb|BC049523.1| Danio rerio similar to H2A histone family, member V, mRNA (cDNA
           clone IMAGE:6033710), partial cds
          Length = 843

 Score =  147 bits (74), Expect = 5e-32
 Identities = 188/226 (83%)
 Strand = Plus / Plus

                                                                       
Query: 326 atggccgtgttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacgg 385
           |||||||||| || ||||| || ||||| |||  |||||||||||| ||||| || || |
Sbjct: 195 atggccgtgtcggagctacagctgcggtttacagtgctgctatcctggagtatctcaccg 254

                                                                       
Query: 386 ccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcaccc 445
           | ||||| |||||| ||||||| ||||||   |||||||||||||||||||| ||||| |
Sbjct: 255 ctgaggtgctggagttggctggaaacgcttctaaggatctgaaggtgaagcgaatcactc 314

                                                                       
Query: 446 ctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggca 505
           |  | ||  | |||||||||||||| |||||||||||||| ||| | || ||||||| ||
Sbjct: 315 ccagacatttacagctggccatccgcggagacgaggagctggactcgcttatcaaggcca 374

                                                         
Query: 506 ccattgctggtggaggtgtgatcccacacatccacaagtccctgat 551
           |||||||||| ||||| || || || |||||||||||||| |||||
Sbjct: 375 ccattgctggaggaggagtcattcctcacatccacaagtctctgat 420



to top

>emb|CR711930.2|CNS0GC9Y Tetraodon nigroviridis full-length cDNA
          Length = 837

 Score =  147 bits (74), Expect = 5e-32
 Identities = 158/186 (84%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 269 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 328

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||||| ||| |||||||| || |||||||||||||||||||| || ||||||||||| 
Sbjct: 329 aaggtgaggcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagctg 388

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  || | ||||| | |||||| ||||| |||||||||||||| |||||||||||||| 
Sbjct: 389 gattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtct 448

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 449 ctgatc 454



to top

>ref|XM_693453.1| PREDICTED: Danio rerio similar to H2A histone family, member V
           (H2AV), mRNA
          Length = 718

 Score =  147 bits (74), Expect = 5e-32
 Identities = 188/226 (83%)
 Strand = Plus / Plus

                                                                       
Query: 326 atggccgtgttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacgg 385
           |||||||||| || ||||| || ||||| |||  |||||||||||| ||||| || || |
Sbjct: 89  atggccgtgtcggagctacagctgcggtttacagtgctgctatcctggagtatctcaccg 148

                                                                       
Query: 386 ccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcaccc 445
           | ||||| |||||| ||||||| ||||||   |||||||||||||||||||| ||||| |
Sbjct: 149 ctgaggtgctggagttggctggaaacgcttctaaggatctgaaggtgaagcgaatcactc 208

                                                                       
Query: 446 ctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggca 505
           |  | ||  | |||||||||||||| |||||||||||||| ||| | || ||||||| ||
Sbjct: 209 ccagacatttacagctggccatccgcggagacgaggagctggactcgcttatcaaggcca 268

                                                         
Query: 506 ccattgctggtggaggtgtgatcccacacatccacaagtccctgat 551
           |||||||||| ||||| || || || |||||||||||||| |||||
Sbjct: 269 ccattgctggaggaggagtcattcctcacatccacaagtctctgat 314



to top

>gb|BT014555.1| Lycopersicon esculentum clone 133985F, mRNA sequence
          Length = 772

 Score =  145 bits (73), Expect = 2e-31
 Identities = 184/221 (83%)
 Strand = Plus / Plus

                                                                       
Query: 355 tactctgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgct 414
           |||||||||||||| || || |||||||| || |||||||| ||  ||||||| || || 
Sbjct: 308 tactctgctgctattctggaatacctgacagcagaggttcttgaattggctggcaatgca 367

                                                                       
Query: 415 agcaaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtgga 474
           ||||||||||||||||||||| | ||||| ||  | || |||||||||||||| ||||||
Sbjct: 368 agcaaggatctgaaggtgaagaggatcacacccaggcatctgcagctggccattcgtgga 427

                                                                       
Query: 475 gacgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacac 534
           || ||||| ||||||||||| || || || |||||||||||||| ||||| ||||| |||
Sbjct: 428 gatgaggaacttgacacccttattaaagggaccattgctggtggcggtgtcatccctcac 487

                                                    
Query: 535 atccacaagtccctgatcaacaagtcctccaaagagtgaaa 575
           || ||||| || || || |||||  || |||| ||||||||
Sbjct: 488 attcacaaatcactcataaacaaaaccaccaaggagtgaaa 528



to top

>emb|CR671361.2|CNS0FGZR Tetraodon nigroviridis full-length cDNA
          Length = 842

 Score =  141 bits (71), Expect = 3e-30
 Identities = 159/187 (85%), Gaps = 1/187 (0%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 268 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 327

                                                                       
Query: 427 aaggtgaagcgtatcacccct-cgtcacctgcagctggccatccgtggagacgaggagct 485
           ||||||||||| ||||||||  || |||||||||||||||||||| || |||||||||||
Sbjct: 328 aaggtgaagcgaatcacccccgcgccacctgcagctggccatccgaggcgacgaggagct 387

                                                                       
Query: 486 tgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtc 545
            ||  || | ||||| | |||||| ||||| |||||||||||||| ||||||||||||||
Sbjct: 388 ggattccttgatcaaagccaccatcgctggcggaggtgtgatcccgcacatccacaagtc 447

                  
Query: 546 cctgatc 552
            ||||||
Sbjct: 448 tctgatc 454



to top

>gb|AC144617.10| Medicago truncatula clone mth2-7m9, complete sequence
          Length = 122853

 Score =  139 bits (70), Expect = 1e-29
 Identities = 235/290 (81%)
 Strand = Plus / Plus

                                                                        
Query: 274  cagttccctgttggccgtatccatcgtcagctgaagcaaaggacccaggcgaatggccgt 333
            |||||||||||||| |||||||||||||  ||||||   |||||   |||  ||||  | 
Sbjct: 1377 cagttccctgttggacgtatccatcgtcttctgaagtcgaggacaatggcacatggaaga 1436

                                                                        
Query: 334  gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
            ||||| ||||| || || || || |||||||||||||| |||||  | || || ||||| 
Sbjct: 1437 gttggggctacagctgcagtttattctgctgctatcctggagtatttaactgcagaggtg 1496

                                                                        
Query: 394  ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
             ||||| ||||||| || || |||||||||||||||||||||||||| || ||| | || 
Sbjct: 1497 ttggagttggctggcaatgcaagcaaggatctgaaggtgaagcgtattacacctagacat 1556

                                                                        
Query: 454  ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
            || || || || |||||||||||||| || |||||||| |||||||| || || || |||
Sbjct: 1557 ctacaacttgctatccgtggagacgaagaacttgacactctcatcaaaggaacaatagct 1616

                                                              
Query: 514  ggtggaggtgtgatcccacacatccacaagtccctgatcaacaagtcctc 563
            ||||| ||||| || || || ||||||||||| || ||||||||||||||
Sbjct: 1617 ggtggtggtgttattcctcatatccacaagtctcttatcaacaagtcctc 1666



to top

>ref|NM_115313.3| Arabidopsis thaliana DNA binding AT3G54560 mRNA, complete cds
          Length = 685

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 334 gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
           |||||||| ||||| || |||||| | ||| | ||||| ||||| ||||| || ||||||
Sbjct: 262 gttggtgccactgcagccgtctacacagcttcaatcctggagtatctgacagcagaggtt 321

                                                                       
Query: 394 ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
           || ||| |||||||||| || ||||||||||| || |||||| | || || ||  | || 
Sbjct: 322 cttgagttggctgggaatgcgagcaaggatctcaaagtgaagaggataacgccaaggcat 381

                                                                       
Query: 454 ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
           |||||| |||| ||  | ||||| |||||||| ||||| ||||||||||| || ||||||
Sbjct: 382 ctgcagttggcgattagaggagatgaggagctggacacactcatcaagggaacgattgct 441

                                                       
Query: 514 ggtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           || || ||||||||||| |||||||||||||| || ||||||||
Sbjct: 442 ggaggtggtgtgatccctcacatccacaagtctctcatcaacaa 485



to top

>emb|Y12575.1|ATH2AV Arabidopsis thaliana mRNA for histone H2A.F/Z
          Length = 714

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 334 gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
           |||||||| ||||| || |||||| | ||| | ||||| ||||| ||||| || ||||||
Sbjct: 270 gttggtgccactgcagccgtctacacagcttcaatcctggagtatctgacagcagaggtt 329

                                                                       
Query: 394 ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
           || ||| |||||||||| || ||||||||||| || |||||| | || || ||  | || 
Sbjct: 330 cttgagttggctgggaatgcgagcaaggatctcaaagtgaagaggataacgccaaggcat 389

                                                                       
Query: 454 ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
           |||||| |||| ||  | ||||| |||||||| ||||| ||||||||||| || ||||||
Sbjct: 390 ctgcagttggcgattagaggagatgaggagctggacacactcatcaagggaacgattgct 449

                                                       
Query: 514 ggtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           || || ||||||||||| |||||||||||||| || ||||||||
Sbjct: 450 ggaggtggtgtgatccctcacatccacaagtctctcatcaacaa 493



to top

>emb|AL138656.2|ATT14E10 Arabidopsis thaliana DNA chromosome 3, BAC clone T14E10
          Length = 94911

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                         
Query: 334   gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
             |||||||| ||||| || |||||| | ||| | ||||| ||||| ||||| || ||||||
Sbjct: 65955 gttggtgccactgcagccgtctacacagcttcaatcctggagtatctgacagcagaggtt 66014

                                                                         
Query: 394   ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
             || ||| |||||||||| || ||||||||||| || |||||| | || || ||  | || 
Sbjct: 66015 cttgagttggctgggaatgcgagcaaggatctcaaagtgaagaggataacgccaaggcat 66074

                                                                         
Query: 454   ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
             |||||| |||| ||  | ||||| |||||||| ||||| ||||||||||| || ||||||
Sbjct: 66075 ctgcagttggcgattagaggagatgaggagctggacacactcatcaagggaacgattgct 66134

                                                         
Query: 514   ggtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
             || || ||||||||||| |||||||||||||| || ||||||||
Sbjct: 66135 ggaggtggtgtgatccctcacatccacaagtctctcatcaacaa 66178



to top

>emb|BX825753.1|CNS0A65Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL60ZA04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 616

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 334 gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
           |||||||| ||||| || |||||| | ||| | ||||| ||||| ||||| || ||||||
Sbjct: 230 gttggtgccactgcagccgtctacacagcttcaatcctggagtatctgacagcagaggtt 289

                                                                       
Query: 394 ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
           || ||| |||||||||| || ||||||||||| || |||||| | || || ||  | || 
Sbjct: 290 cttgagttggctgggaatgcgagcaaggatctcaaagtgaagaggataacgccaaggcat 349

                                                                       
Query: 454 ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
           |||||| |||| ||  | ||||| |||||||| ||||| ||||||||||| || ||||||
Sbjct: 350 ctgcagttggcgattagaggagatgaggagctggacacactcatcaagggaacgattgct 409

                                                       
Query: 514 ggtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           || || ||||||||||| |||||||||||||| || ||||||||
Sbjct: 410 ggaggtggtgtgatccctcacatccacaagtctctcatcaacaa 453



to top

>gb|BT005205.1| Arabidopsis thaliana At3g54560 mRNA, complete cds
          Length = 411

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 334 gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
           |||||||| ||||| || |||||| | ||| | ||||| ||||| ||||| || ||||||
Sbjct: 172 gttggtgccactgcagccgtctacacagcttcaatcctggagtatctgacagcagaggtt 231

                                                                       
Query: 394 ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
           || ||| |||||||||| || ||||||||||| || |||||| | || || ||  | || 
Sbjct: 232 cttgagttggctgggaatgcgagcaaggatctcaaagtgaagaggataacgccaaggcat 291

                                                                       
Query: 454 ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
           |||||| |||| ||  | ||||| |||||||| ||||| ||||||||||| || ||||||
Sbjct: 292 ctgcagttggcgattagaggagatgaggagctggacacactcatcaagggaacgattgct 351

                                                       
Query: 514 ggtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           || || ||||||||||| |||||||||||||| || ||||||||
Sbjct: 352 ggaggtggtgtgatccctcacatccacaagtctctcatcaacaa 395



to top

>gb|AY087232.1| Arabidopsis thaliana clone 33085 mRNA, complete sequence
          Length = 669

 Score =  127 bits (64), Expect = 5e-26
 Identities = 184/224 (82%)
 Strand = Plus / Plus

                                                                       
Query: 334 gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
           |||||||| ||||| || |||||| | ||| | ||||| ||||| ||||| || ||||||
Sbjct: 261 gttggtgccactgcagccgtctacacagcttcaatcctggagtatctgacagcagaggtt 320

                                                                       
Query: 394 ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
           || ||| |||||||||| || ||||||||||| || |||||| | || || ||  | || 
Sbjct: 321 cttgagttggctgggaatgcgagcaaggatctcaaagtgaagaggataacgccaaggcat 380

                                                                       
Query: 454 ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
           |||||| |||| ||  | ||||| |||||||| ||||| ||||||||||| || ||||||
Sbjct: 381 ctgcagttggcgattagaggagatgaggagctggacacactcatcaagggaacgattgct 440

                                                       
Query: 514 ggtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           || || ||||||||||| |||||||||||||| || ||||||||
Sbjct: 441 ggaggtggtgtgatccctcacatccacaagtctctcatcaacaa 484



to top

>emb|CR733482.2|CNS0GSQH Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||||||||||||||| ||||| ||| |||||||||||||||| || ||||||||| 
Sbjct: 291 tgaaggtgaagcgtatcactcctcgccacttgcagctggccatccgcggtgacgaggagt 350

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| ||||||||||||  || ||||| || |||||||| || |||||||||||||| |
Sbjct: 351 tggactccctcatcaaggcaacaattgccggaggaggtgtcattccacacatccacaaat 410

               
Query: 545 ccct 548
           ||||
Sbjct: 411 ccct 414



to top

>emb|CR732601.2|CNS0GS7Y Tetraodon nigroviridis full-length cDNA
          Length = 1260

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||||||||||||||| ||||| ||| |||||||||||||||| || ||||||||| 
Sbjct: 292 tgaaggtgaagcgtatcactcctcgccacttgcagctggccatccgcggtgacgaggagt 351

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| ||||||||||||  || ||||| || |||||||| || |||||||||||||| |
Sbjct: 352 tggactccctcatcaaggcaacaattgccggaggaggtgtcattccacacatccacaaat 411

               
Query: 545 ccct 548
           ||||
Sbjct: 412 ccct 415



to top

>emb|CR725413.2|CNS0GMOB Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||||||||||||||| ||||| ||| |||||||||||||||| || ||||||||| 
Sbjct: 288 tgaaggtgaagcgtatcactcctcgccacttgcagctggccatccgcggtgacgaggagt 347

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| ||||||||||||  || ||||| || |||||||| || |||||||||||||| |
Sbjct: 348 tggactccctcatcaaggcaacaattgccggaggaggtgtcattccacacatccacaaat 407

               
Query: 545 ccct 548
           ||||
Sbjct: 408 ccct 411



to top

>emb|CR694893.1|CNS0FZ4P Tetraodon nigroviridis full-length cDNA
          Length = 582

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||||||||||||||| ||||| ||| |||||||||||||||| || ||||||||| 
Sbjct: 304 tgaaggtgaagcgtatcactcctcgccacttgcagctggccatccgcggtgacgaggagt 363

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| ||||||||||||  || ||||| || |||||||| || |||||||||||||| |
Sbjct: 364 tggactccctcatcaaggcaacaattgccggaggaggtgtcattccacacatccacaaat 423

               
Query: 545 ccct 548
           ||||
Sbjct: 424 ccct 427



to top

>emb|BX822865.1|CNS0A7LY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB69ZH03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 670

 Score =  115 bits (58), Expect = 2e-22
 Identities = 184/226 (81%)
 Strand = Plus / Plus

                                                                       
Query: 332 gtgttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgagg 391
           |||||||||| ||||| || |||||| | ||| | ||||| ||||| || || || ||||
Sbjct: 245 gtgttggtgccactgcagccgtctacacagcttcaatcctggagtatctaacagcagagg 304

                                                                       
Query: 392 ttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtc 451
           |||| ||| |||||||||| || ||||||| ||| || |||||| | || || ||  | |
Sbjct: 305 ttcttgagttggctgggaatgcgagcaaggttctcaaagtgaagaggataacgccaaggc 364

                                                                       
Query: 452 acctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattg 511
           | |||||| |||| ||  | ||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 365 atctgcagttggcgattagaggagatgaggagctggacacactcatcaagggaacgattg 424

                                                         
Query: 512 ctggtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           |||| || ||||||||||| |||||||||||||| || ||||||||
Sbjct: 425 ctggaggtggtgtgatccctcacatccacaagtctcttatcaacaa 470



to top

>gb|BC049019.1| Danio rerio H2A histone family, member Z, mRNA (cDNA clone
           MGC:56421 IMAGE:5611777), complete cds
          Length = 843

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 424 ctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggag 483
           |||||||||||||| ||||| ||||| ||  | ||||||||||| || ||||| ||||||
Sbjct: 307 ctgaaggtgaagcgcatcactcctcgacatttacagctggccattcgaggagatgaggag 366

                                                                       
Query: 484 cttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaag 543
           || ||  |||| ||||||| ||| |||||||| ||||||||||| |||||||||||||||
Sbjct: 367 ctcgattcccttatcaaggccactattgctggaggaggtgtgattccacacatccacaag 426

                   
Query: 544 tccctgat 551
           || |||||
Sbjct: 427 tctctgat 434



to top

>ref|NM_153644.1| Danio rerio H2A histone family, member Z (h2afz), mRNA
          Length = 833

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 424 ctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggag 483
           |||||||||||||| ||||| ||||| ||  | ||||||||||| || ||||| ||||||
Sbjct: 279 ctgaaggtgaagcgcatcactcctcgacatttacagctggccattcgaggagatgaggag 338

                                                                       
Query: 484 cttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaag 543
           || ||  |||| ||||||| ||| |||||||| ||||||||||| |||||||||||||||
Sbjct: 339 ctcgattcccttatcaaggccactattgctggaggaggtgtgattccacacatccacaag 398

                   
Query: 544 tccctgat 551
           || |||||
Sbjct: 399 tctctgat 406



to top

>gb|AF414110.1|AF414110 Danio rerio histone variant H2A.F/Z mRNA, complete cds
          Length = 833

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 424 ctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggag 483
           |||||||||||||| ||||| ||||| ||  | ||||||||||| || ||||| ||||||
Sbjct: 279 ctgaaggtgaagcgcatcactcctcgacatttacagctggccattcgaggagatgaggag 338

                                                                       
Query: 484 cttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaag 543
           || ||  |||| ||||||| ||| |||||||| ||||||||||| |||||||||||||||
Sbjct: 339 ctcgattcccttatcaaggccactattgctggaggaggtgtgattccacacatccacaag 398

                   
Query: 544 tccctgat 551
           || |||||
Sbjct: 399 tctctgat 406



to top

>ref|XM_702461.1| PREDICTED: Danio rerio similar to H2A histone family, member V
           isoform 1, transcript variant 2 (LOC573415), mRNA
          Length = 824

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 424 ctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggag 483
           |||||||||||||| ||||| ||||| ||  | ||||||||||| || ||||| ||||||
Sbjct: 305 ctgaaggtgaagcgcatcactcctcgacatttacagctggccattcgaggagatgaggag 364

                                                                       
Query: 484 cttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaag 543
           || ||  |||| ||||||| ||| |||||||| ||||||||||| |||||||||||||||
Sbjct: 365 ctcgattcccttatcaaggccactattgctggaggaggtgtgattccacacatccacaag 424

                   
Query: 544 tccctgat 551
           || |||||
Sbjct: 425 tctctgat 432



to top

>ref|XM_679474.1| PREDICTED: Danio rerio similar to H2A histone family, member V
           isoform 1, transcript variant 1 (LOC573415), mRNA
          Length = 831

 Score =  111 bits (56), Expect = 3e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 424 ctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggag 483
           |||||||||||||| ||||| ||||| ||  | ||||||||||| || ||||| ||||||
Sbjct: 312 ctgaaggtgaagcgcatcactcctcgacatttacagctggccattcgaggagatgaggag 371

                                                                       
Query: 484 cttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaag 543
           || ||  |||| ||||||| ||| |||||||| ||||||||||| |||||||||||||||
Sbjct: 372 ctcgattcccttatcaaggccactattgctggaggaggtgtgattccacacatccacaag 431

                   
Query: 544 tccctgat 551
           || |||||
Sbjct: 432 tctctgat 439



to top

>emb|CR692524.2|CNS0FXAW Tetraodon nigroviridis full-length cDNA
          Length = 355

 Score =  109 bits (55), Expect = 1e-20
 Identities = 103/119 (86%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||| || || ||||| ||||| |||||||| |||||   |||||| |||
Sbjct: 236 atcctggagtacctcaccgcggaggtgctggaactggctggaaacgcgtccaaggacctg 295

                                                                      
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagct 485
           ||||||||||| |||||||| || |||||||||||||||||||| || |||||||||||
Sbjct: 296 aaggtgaagcgaatcaccccgcgccacctgcagctggccatccgaggcgacgaggagct 354



to top

>gb|AY190700.1| Pagrus major histone H2A.F/Z variant mRNA, partial cds
          Length = 399

 Score =  103 bits (52), Expect = 7e-19
 Identities = 106/124 (85%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||||||||||||||| || |||||  ||||||||||||||||||| || |||||| 
Sbjct: 246 tgaaggtgaagcgtatcactccccgtcatttgcagctggccatccgtggtgatgaggagt 305

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | ||||||||||  || |||||||| |||||||| || || ||||||||||| |
Sbjct: 306 tggactctctcatcaaggcaacaattgctggaggaggtgtcattccccacatccacaaat 365

               
Query: 545 ccct 548
           ||||
Sbjct: 366 ccct 369



to top

>gb|BC078599.1| Xenopus laevis MGC85536 protein, mRNA (cDNA clone MGC:85536
           IMAGE:6875774), complete cds
          Length = 727

 Score =  101 bits (51), Expect = 3e-18
 Identities = 114/135 (84%)
 Strand = Plus / Plus

                                                                       
Query: 417 caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
           |||||||||||| ||||| |||||||| ||||| ||| ||||||| ||||| ||||| ||
Sbjct: 315 caaggatctgaaagtgaaacgtatcactcctcggcacttgcagctagccattcgtgggga 374

                                                                       
Query: 477 cgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacat 536
            |||||||||||  | || ||||| | |||||||||||| |||||||| || || || ||
Sbjct: 375 tgaggagcttgattctcttatcaaagccaccattgctggaggaggtgtcattcctcatat 434

                          
Query: 537 ccacaagtccctgat 551
           ||||||||| |||||
Sbjct: 435 ccacaagtctctgat 449



to top

>emb|X05547.1|SPH2AFZ Sea urchin mRNA fragment for histone H2A.F/Z
          Length = 379

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 176/218 (80%)
 Strand = Plus / Plus

                                                                       
Query: 326 atggccgtgttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacgg 385
           ||||||| || ||||| || || || || |||||||| |||||  | || ||||| || |
Sbjct: 123 atggccgcgtcggtgccacagccgctgtatactctgccgctattttggaatacctcacag 182

                                                                       
Query: 386 ccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcaccc 445
           | || ||||| ||| |||| || || ||||| || ||||||||||| ||||||||||| |
Sbjct: 183 ctgaagttcttgagttggcaggcaatgctagtaaagatctgaaggtaaagcgtatcacac 242

                                                                       
Query: 446 ctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggca 505
           | |||||| |||||||||||||| | |||||||| ||  | ||| | || |||||||  |
Sbjct: 243 cccgtcacttgcagctggccatcaggggagacgaagaattggactcgcttatcaaggcaa 302

                                                 
Query: 506 ccattgctggtggaggtgtgatcccacacatccacaag 543
           |||| |||||||| ||||| ||||| ||||||||||||
Sbjct: 303 ccatcgctggtggtggtgtcatccctcacatccacaag 340



to top

>ref|XM_504921.1| Yarrowia lipolytica CLIB122, YALI0F02827g predicted mRNA
          Length = 423

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 120/141 (85%), Gaps = 2/141 (1%)
 Strand = Plus / Plus

                                                                       
Query: 373 gagtacctgacggccgaggttctggagctggctgggaacgctagcaag-gatctgaaggt 431
           ||||| ||||| || |||||||||||| |||| || |||||| ||| | ||||| |||||
Sbjct: 214 gagtatctgactgctgaggttctggagttggcgggtaacgct-gcacgtgatctcaaggt 272

                                                                       
Query: 432 gaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacac 491
            ||||| ||||| ||||| ||| ||||||| ||||| || |||||||||||||| |||||
Sbjct: 273 caagcgaatcactcctcgacacttgcagcttgccattcgaggagacgaggagctggacac 332

                                
Query: 492 cctcatcaagggcaccattgc 512
           ||||||| ||| |||||||||
Sbjct: 333 cctcatccaggccaccattgc 353



to top

>ref|XM_786337.1| PREDICTED: Strongylocentrotus purpuratus histone H2 A.F/Z
           (H2A.F/Z), mRNA
          Length = 1599

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 127/153 (83%)
 Strand = Plus / Plus

                                                                       
Query: 391 gttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgt 450
           ||||| ||| |||| || || ||||| || ||||||||||| ||||||||||| || |||
Sbjct: 265 gttcttgagttggcaggcaatgctagtaaagatctgaaggtaaagcgtatcacaccccgt 324

                                                                       
Query: 451 cacctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccatt 510
           ||| |||||||||||||| | |||||||| ||  | ||| | || |||||||  ||||| 
Sbjct: 325 cacttgcagctggccatcaggggagacgaagaattggactcgcttatcaaggcaaccatc 384

                                            
Query: 511 gctggtggaggtgtgatcccacacatccacaag 543
           |||||||| ||||| ||||| ||||||||||||
Sbjct: 385 gctggtggtggtgtcatccctcacatccacaag 417



to top

>emb|X07485.1|DMH2AVD D. melanogaster H2AvD mRNA for histone 2A variant
          Length = 913

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 145/177 (81%)
 Strand = Plus / Plus

                                                                       
Query: 376 tacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaag 435
           |||||||| |||||||| |||||| |||| || |||||    |||||  |||| ||||| 
Sbjct: 330 tacctgaccgccgaggtcctggagttggcaggcaacgcatcgaaggacttgaaagtgaaa 389

                                                                       
Query: 436 cgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccctc 495
           |||||||| ||||| ||| | ||||| ||||| || |||||||||||||| |||| ||| 
Sbjct: 390 cgtatcactcctcgccacttacagctcgccattcgcggagacgaggagctggacagcctg 449

                                                                    
Query: 496 atcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctgatc 552
           |||||||  ||||| |||||||| ||||| || || ||||| |||||||| ||||||
Sbjct: 450 atcaaggcaaccatcgctggtggcggtgtcattccgcacatacacaagtcgctgatc 506



to top

>gb|AY118910.1| Drosophila melanogaster LD21568 full insert cDNA
          Length = 904

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 145/177 (81%)
 Strand = Plus / Plus

                                                                       
Query: 376 tacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaag 435
           |||||||| |||||||| |||||| |||| || |||||    |||||  |||| ||||| 
Sbjct: 318 tacctgaccgccgaggtcctggagttggcaggcaacgcatcgaaggacttgaaagtgaaa 377

                                                                       
Query: 436 cgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccctc 495
           |||||||| ||||| ||| | ||||| ||||| || |||||||||||||| |||| ||| 
Sbjct: 378 cgtatcactcctcgccacttacagctcgccattcgcggagacgaggagctggacagcctg 437

                                                                    
Query: 496 atcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctgatc 552
           |||||||  ||||| |||||||| ||||| || || ||||| |||||||| ||||||
Sbjct: 438 atcaaggcaaccatcgctggtggcggtgtcattccgcacatacacaagtcgctgatc 494



to top

>ref|NM_079795.2| Drosophila melanogaster Histone H2A variant CG5499-RA (His2Av),
           mRNA
          Length = 910

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 145/177 (81%)
 Strand = Plus / Plus

                                                                       
Query: 376 tacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaag 435
           |||||||| |||||||| |||||| |||| || |||||    |||||  |||| ||||| 
Sbjct: 343 tacctgaccgccgaggtcctggagttggcaggcaacgcatcgaaggacttgaaagtgaaa 402

                                                                       
Query: 436 cgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccctc 495
           |||||||| ||||| ||| | ||||| ||||| || |||||||||||||| |||| ||| 
Sbjct: 403 cgtatcactcctcgccacttacagctcgccattcgcggagacgaggagctggacagcctg 462

                                                                    
Query: 496 atcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctgatc 552
           |||||||  ||||| |||||||| ||||| || || ||||| |||||||| ||||||
Sbjct: 463 atcaaggcaaccatcgctggtggcggtgtcattccgcacatacacaagtcgctgatc 519



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 120/141 (85%), Gaps = 2/141 (1%)
 Strand = Plus / Plus

                                                                          
Query: 373    gagtacctgacggccgaggttctggagctggctgggaacgctagcaag-gatctgaaggt 431
              ||||| ||||| || |||||||||||| |||| || |||||| ||| | ||||| |||||
Sbjct: 407553 gagtatctgactgctgaggttctggagttggcgggtaacgct-gcacgtgatctcaaggt 407611

                                                                          
Query: 432    gaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacac 491
               ||||| ||||| ||||| ||| ||||||| ||||| || |||||||||||||| |||||
Sbjct: 407612 caagcgaatcactcctcgacacttgcagcttgccattcgaggagacgaggagctggacac 407671

                                   
Query: 492    cctcatcaagggcaccattgc 512
              ||||||| ||| |||||||||
Sbjct: 407672 cctcatccaggccaccattgc 407692



to top

>ref|XM_970375.1| PREDICTED: Tribolium castaneum similar to H2A histone family,
           member Z (LOC664368), mRNA
          Length = 743

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 129/156 (82%)
 Strand = Plus / Plus

                                                                       
Query: 388 gaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccct 447
           ||||| |||||| |||| |||||||| || |||||  ||||||||||| | |||||||| 
Sbjct: 232 gaggtcctggagttggccgggaacgccagtaaggacttgaaggtgaagaggatcaccccc 291

                                                                       
Query: 448 cgtcacctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcacc 507
            | ||| |||||||||||||| | || ||||||||||| |||| ||| ||||||| ||| 
Sbjct: 292 aggcacttgcagctggccatcagaggggacgaggagctggacagcctgatcaaggccact 351

                                               
Query: 508 attgctggtggaggtgtgatcccacacatccacaag 543
           || || || ||||| || || |||||||||||||||
Sbjct: 352 atcgccggcggaggcgtcattccacacatccacaag 387



to top

>emb|V00414.1|GGHI01 Gallus gallus mRNA coding for a variant histone H2A
          Length = 650

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 156/192 (81%)
 Strand = Plus / Plus

                                                                       
Query: 361 gctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaag 420
           ||||| ||||||||||| || || || ||||| |||||| |||| || |||||   ||||
Sbjct: 236 gctgccatcctcgagtatctcactgctgaggtcctggagttggcaggcaacgcctccaag 295

                                                                       
Query: 421 gatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgag 480
           || |||||||||||||| ||||| || || ||  |||||||||| ||||| || ||||| 
Sbjct: 296 gacctgaaggtgaagcgcatcactccccgccatttgcagctggcgatccgcggcgacgaa 355

                                                                       
Query: 481 gagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccac 540
           ||| | ||  |||||||||| | |||||| || || ||||| || ||||| |||||||||
Sbjct: 356 gagttggattccctcatcaaagccaccatagcggggggaggcgtcatcccccacatccac 415

                       
Query: 541 aagtccctgatc 552
           ||||| ||||||
Sbjct: 416 aagtctctgatc 427



to top

>ref|NM_179968.2| Arabidopsis thaliana DNA binding AT2G38810 transcript variant
           AT2G38810.3 mRNA, complete cds
          Length = 720

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                       
Query: 455 tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
           ||||||| || ||| | ||||| ||||| |||||||| |||||||| || |||||||| |
Sbjct: 443 tgcagcttgcaatcagaggagatgaggaacttgacactctcatcaaaggaaccattgcag 502

                                                      
Query: 515 gtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           | |||||||||||||| |||||||||||||||||  |||||||
Sbjct: 503 gaggaggtgtgatccctcacatccacaagtcccttgtcaacaa 545



to top

>ref|NM_129438.2| Arabidopsis thaliana DNA binding AT2G38810 transcript variant
           AT2G38810.1 mRNA, complete cds
          Length = 688

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                       
Query: 455 tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
           ||||||| || ||| | ||||| ||||| |||||||| |||||||| || |||||||| |
Sbjct: 411 tgcagcttgcaatcagaggagatgaggaacttgacactctcatcaaaggaaccattgcag 470

                                                      
Query: 515 gtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           | |||||||||||||| |||||||||||||||||  |||||||
Sbjct: 471 gaggaggtgtgatccctcacatccacaagtcccttgtcaacaa 513



to top

>ref|NM_179967.1| Arabidopsis thaliana DNA binding AT2G38810 transcript variant
           AT2G38810.2 mRNA, complete cds
          Length = 591

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                       
Query: 455 tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
           ||||||| || ||| | ||||| ||||| |||||||| |||||||| || |||||||| |
Sbjct: 314 tgcagcttgcaatcagaggagatgaggaacttgacactctcatcaaaggaaccattgcag 373

                                                      
Query: 515 gtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           | |||||||||||||| |||||||||||||||||  |||||||
Sbjct: 374 gaggaggtgtgatccctcacatccacaagtcccttgtcaacaa 416



to top

>gb|AC007133.7| Arabidopsis thaliana chromosome 2 clone F13I13 map CIC10A06, complete
            sequence
          Length = 21988

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                        
Query: 455  tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
            ||||||| || ||| | ||||| ||||| |||||||| |||||||| || |||||||| |
Sbjct: 7687 tgcagcttgcaatcagaggagatgaggaacttgacactctcatcaaaggaaccattgcag 7628

                                                       
Query: 515  gtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
            | |||||||||||||| |||||||||||||||||  |||||||
Sbjct: 7627 gaggaggtgtgatccctcacatccacaagtcccttgtcaacaa 7585



to top

>dbj|AK220868.1| Arabidopsis thaliana mRNA for histone H2A, complete cds, clone:
           RAFL22-42-E22
          Length = 602

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                       
Query: 455 tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
           ||||||| || ||| | ||||| ||||| |||||||| |||||||| || |||||||| |
Sbjct: 314 tgcagcttgcaatcagaggagatgaggaacttgacactctcatcaaaggaaccattgcag 373

                                                      
Query: 515 gtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           | |||||||||||||| |||||||||||||||||  |||||||
Sbjct: 374 gaggaggtgtgatccctcacatccacaagtcccttgtcaacaa 416



to top

>emb|BX821413.1|CNS0AA9R Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL3ZE05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 489

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                       
Query: 455 tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
           ||||||| || ||| | ||||| ||||| |||||||| |||||||| || |||||||| |
Sbjct: 298 tgcagcttgcgatcagaggagatgaggaacttgacactctcatcaaaggaaccattgcag 357

                                                      
Query: 515 gtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           | |||||||||||||| |||||||||||||||||  |||||||
Sbjct: 358 gaggaggtgtgatccctcacatccacaagtcccttctcaacaa 400



to top

>emb|BX821514.1|CNS0A96I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL47ZE12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 543

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                       
Query: 455 tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
           ||||||| || ||| | ||||| ||||| |||||||| |||||||| || |||||||| |
Sbjct: 300 tgcagcttgcaatcagaggagatgaggaacttgacactctcatcaaaggaaccattgcag 359

                                                      
Query: 515 gtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           | |||||||||||||| |||||||||||||||||  |||||||
Sbjct: 360 gaggaggtgtgatccctcacatccacaagtcccttgtcaacaa 402



to top

>gb|AY088573.1| Arabidopsis thaliana clone 8 mRNA, complete sequence
          Length = 674

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                       
Query: 455 tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
           ||||||| || ||| | ||||| ||||| |||||||| |||||||| || |||||||| |
Sbjct: 411 tgcagcttgcaatcagaggagatgaggaacttgacactctcatcaaaggaaccattgcag 470

                                                      
Query: 515 gtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           | |||||||||||||| |||||||||||||||||  |||||||
Sbjct: 471 gaggaggtgtgatccctcacatccacaagtcccttgtcaacaa 513



to top

>gb|DQ215814.1| Taeniopygia guttata clone 0058P0009E02 histone H2A.Z-like mRNA,
           complete sequence
          Length = 799

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 151/186 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || || ||   |||
Sbjct: 279 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaatgcctccaa 338

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  |||||||||| |||||||| || |||||||||||||| |||||  | ||||| ||
Sbjct: 339 agacttgaaggtgaaacgtatcactccccgtcacctgcagcttgccattagaggagatga 398

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||||| ||  | || |||||||  || ||||||||||| ||||| || |||||||||||
Sbjct: 399 agagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcca 458

                 
Query: 540 caagtc 545
           ||||||
Sbjct: 459 caagtc 464



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 193 cagttccctgttggccgcatccat 216



to top

>gb|DQ215811.1| Taeniopygia guttata clone 0063P0013F11 histone H2A.Z-like mRNA,
           complete sequence
          Length = 852

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 151/186 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || || ||   |||
Sbjct: 283 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaatgcctccaa 342

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  |||||||||| |||||||| || |||||||||||||| |||||  | ||||| ||
Sbjct: 343 agacttgaaggtgaaacgtatcactccccgtcacctgcagcttgccattagaggagatga 402

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||||| ||  | || |||||||  || ||||||||||| ||||| || |||||||||||
Sbjct: 403 agagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcca 462

                 
Query: 540 caagtc 545
           ||||||
Sbjct: 463 caagtc 468



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 197 cagttccctgttggccgcatccat 220



to top

>gb|DQ215810.1| Taeniopygia guttata clone 0061P0002G07 histone H2A.Z-like mRNA,
           complete sequence
          Length = 874

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 151/186 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || || ||   |||
Sbjct: 309 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaatgcctccaa 368

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  |||||||||| |||||||| || |||||||||||||| |||||  | ||||| ||
Sbjct: 369 agacttgaaggtgaaacgtatcactccccgtcacctgcagcttgccattagaggagatga 428

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||||| ||  | || |||||||  || ||||||||||| ||||| || |||||||||||
Sbjct: 429 agagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcca 488

                 
Query: 540 caagtc 545
           ||||||
Sbjct: 489 caagtc 494



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 223 cagttccctgttggccgcatccat 246



to top

>gb|DQ215809.1| Taeniopygia guttata clone 0058P0022F11 histone H2A.Z-like mRNA,
           complete sequence
          Length = 843

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 151/186 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || || ||   |||
Sbjct: 262 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaatgcctccaa 321

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  |||||||||| |||||||| || |||||||||||||| |||||  | ||||| ||
Sbjct: 322 agacttgaaggtgaaacgtatcactccccgtcacctgcagcttgccattagaggagatga 381

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||||| ||  | || |||||||  || ||||||||||| ||||| || |||||||||||
Sbjct: 382 agagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcca 441

                 
Query: 540 caagtc 545
           ||||||
Sbjct: 442 caagtc 447



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 176 cagttccctgttggccgcatccat 199



to top

>gb|DQ215807.1| Taeniopygia guttata clone 0065P0002B11 histone H2A.Z-like mRNA,
           complete sequence
          Length = 901

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 151/186 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || || ||   |||
Sbjct: 332 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaatgcctccaa 391

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  |||||||||| |||||||| || |||||||||||||| |||||  | ||||| ||
Sbjct: 392 agacttgaaggtgaaacgtatcactccccgtcacctgcagcttgccattagaggagatga 451

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||||| ||  | || |||||||  || ||||||||||| ||||| || |||||||||||
Sbjct: 452 agagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcca 511

                 
Query: 540 caagtc 545
           ||||||
Sbjct: 512 caagtc 517



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 246 cagttccctgttggccgcatccat 269



to top

>gb|DQ215806.1| Taeniopygia guttata clone 0058P0039A02 histone H2A.Z-like mRNA,
           complete sequence
          Length = 851

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 151/186 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || || ||   |||
Sbjct: 283 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaatgcctccaa 342

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  |||||||||| |||||||| || |||||||||||||| |||||  | ||||| ||
Sbjct: 343 agacttgaaggtgaaacgtatcactccccgtcacctgcagcttgccattagaggagatga 402

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||||| ||  | || |||||||  || ||||||||||| ||||| || |||||||||||
Sbjct: 403 agagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcca 462

                 
Query: 540 caagtc 545
           ||||||
Sbjct: 463 caagtc 468



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 197 cagttccctgttggccgcatccat 220



to top

>gb|DQ215804.1| Taeniopygia guttata clone 0058P0059H06 histone H2A.Z-like mRNA,
           complete sequence
          Length = 851

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 151/186 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || || ||   |||
Sbjct: 266 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaatgcctccaa 325

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  |||||||||| |||||||| || |||||||||||||| |||||  | ||||| ||
Sbjct: 326 agacttgaaggtgaaacgtatcactccccgtcacctgcagcttgccattagaggagatga 385

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||||| ||  | || |||||||  || ||||||||||| ||||| || |||||||||||
Sbjct: 386 agagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcca 445

                 
Query: 540 caagtc 545
           ||||||
Sbjct: 446 caagtc 451



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 180 cagttccctgttggccgcatccat 203



to top

>gb|DQ215803.1| Taeniopygia guttata clone 0058P0052E09 histone H2A.Z-like mRNA,
           complete sequence
          Length = 851

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 151/186 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || || ||   |||
Sbjct: 283 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaatgcctccaa 342

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  |||||||||| |||||||| || |||||||||||||| |||||  | ||||| ||
Sbjct: 343 agacttgaaggtgaaacgtatcactccccgtcacctgcagcttgccattagaggagatga 402

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||||| ||  | || |||||||  || ||||||||||| ||||| || |||||||||||
Sbjct: 403 agagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcca 462

                 
Query: 540 caagtc 545
           ||||||
Sbjct: 463 caagtc 468



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 197 cagttccctgttggccgcatccat 220



to top

>emb|BX070691.1|CNS09QPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 592

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 143/176 (81%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||||||||| ||||| |||||| |||| || |||||    |||||||| 
Sbjct: 219 atcctggagtacctgacggctgaggtgctggagttggccggcaacgcctcgaaggatctc 278

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           || |||||||| ||||| ||  | || |||||||||||||| || || ||||||||||| 
Sbjct: 279 aaagtgaagcgaatcacgcccaggcatctgcagctggccattcgcggtgacgaggagctg 338

                                                                   
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaa 542
           |||| | | ||||||| ||||||||| || || || || || || |||||||||||
Sbjct: 339 gacagcttgatcaaggccaccattgccggcggtggcgtcattccccacatccacaa 394



to top

>emb|X15549.1|DMH2AVDG D.melanogaster H2AvD gene for histone H2A variant
          Length = 2255

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                        
Query: 425  tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
            |||| ||||| |||||||| ||||| ||| | ||||| ||||| || |||||||||||||
Sbjct: 1689 tgaaagtgaaacgtatcactcctcgccacttacagctcgccattcgcggagacgaggagc 1748

                                                                        
Query: 485  ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
            | |||| ||| |||||||  ||||| |||||||| ||||| || || ||||| |||||||
Sbjct: 1749 tggacagcctgatcaaggcaaccatcgctggtggcggtgtcattccgcacatacacaagt 1808

                    
Query: 545  ccctgatc 552
            | ||||||
Sbjct: 1809 cgctgatc 1816



to top

>gb|AC009981.6|AC009981 Drosophila melanogaster, chromosome 3R, region 97C-97D, BAC clone
              BACR24O14, complete sequence
          Length = 170356

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                          
Query: 425    tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
              |||| ||||| |||||||| ||||| ||| | ||||| ||||| || |||||||||||||
Sbjct: 126911 tgaaagtgaaacgtatcactcctcgccacttacagctcgccattcgcggagacgaggagc 126970

                                                                          
Query: 485    ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
              | |||| ||| |||||||  ||||| |||||||| ||||| || || ||||| |||||||
Sbjct: 126971 tggacagcctgatcaaggcaaccatcgctggtggcggtgtcattccgcacatacacaagt 127030

                      
Query: 545    ccctgatc 552
              | ||||||
Sbjct: 127031 cgctgatc 127038



to top

>ref|XM_310818.2| Anopheles gambiae str. PEST ENSANGP00000015579
           (ENSANGG00000013090), partial mRNA
          Length = 363

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 143/176 (81%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||||||||| ||||| |||||| |||| || |||||    |||||||| 
Sbjct: 169 atcctggagtacctgacggctgaggtgctggagttggccggcaacgcctcgaaggatctc 228

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           || |||||||| ||||| ||  | || |||||||||||||| || || ||||||||||| 
Sbjct: 229 aaagtgaagcgaatcacgcccaggcatctgcagctggccattcgcggtgacgaggagctg 288

                                                                   
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaa 542
           |||| | | ||||||| ||||||||| || || || || || || |||||||||||
Sbjct: 289 gacagcttgatcaaggccaccattgccggcggtggcgtcattccccacatccacaa 344



to top

>gb|AE003758.4| Drosophila melanogaster chromosome 3R, section 96 of 118 of the
             complete sequence
          Length = 228635

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                         
Query: 425   tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
             |||| ||||| |||||||| ||||| ||| | ||||| ||||| || |||||||||||||
Sbjct: 80427 tgaaagtgaaacgtatcactcctcgccacttacagctcgccattcgcggagacgaggagc 80486

                                                                         
Query: 485   ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
             | |||| ||| |||||||  ||||| |||||||| ||||| || || ||||| |||||||
Sbjct: 80487 tggacagcctgatcaaggcaaccatcgctggtggcggtgtcattccgcacatacacaagt 80546

                     
Query: 545   ccctgatc 552
             | ||||||
Sbjct: 80547 cgctgatc 80554



to top

>gb|BC086348.1| Rattus norvegicus H2A histone family, member Z, mRNA (cDNA clone
           MGC:105426 IMAGE:7302603), complete cds
          Length = 880

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || ||||| ||||| || ||| 
Sbjct: 319 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctatccgcggagatgaagagt 378

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | || |||||||  || ||||||||||| ||||| ||||||||||||||||| |
Sbjct: 379 tggactctctgatcaaggctacgattgctggtggtggtgtcatcccacacatccacaaat 438

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 439 cactgat 445



to top

>gb|BC074203.1| Xenopus laevis MGC82121 protein, mRNA (cDNA clone MGC:82121
           IMAGE:7012019), complete cds
          Length = 788

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Plus

                                                                       
Query: 417 caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
           |||||||||||| ||||| |||||||| ||||| ||| ||||||| ||||| ||||| ||
Sbjct: 321 caaggatctgaaagtgaaacgtatcactcctcggcacttgcagctagccattcgtgggga 380

                                                                       
Query: 477 cgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacat 536
            || ||||| ||  | || ||||| | |||||||||||| |||||||| || || || ||
Sbjct: 381 tgaagagctcgattctctgatcaaagccaccattgctggaggaggtgtcattcctcatat 440

                          
Query: 537 ccacaagtccctgat 551
           ||||||||| |||||
Sbjct: 441 ccacaagtctctgat 455



to top

>gb|BC060564.1| Rattus norvegicus H2A histone family, member Z, mRNA (cDNA clone
           MGC:72814 IMAGE:6922321), complete cds
          Length = 897

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || ||||| ||||| || ||| 
Sbjct: 339 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctatccgcggagatgaagagt 398

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | || |||||||  || ||||||||||| ||||| ||||||||||||||||| |
Sbjct: 399 tggactctctgatcaaggctacgattgctggtggtggtgtcatcccacacatccacaaat 458

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 459 cactgat 465



to top

>ref|NM_068168.2| Caenorhabditis elegans R08C7.3 (R08C7.3) mRNA, complete cds
          Length = 762

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 103/123 (83%)
 Strand = Plus / Plus

                                                                       
Query: 417 caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
           ||||||||| ||||||||||||||||||||  | || || || || || ||| | |||||
Sbjct: 305 caaggatcttaaggtgaagcgtatcaccccaagacatcttcatcttgctatcagaggaga 364

                                                                       
Query: 477 cgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacat 536
           ||| ||||| ||||| |||||||||| |||||| || || ||||| || |||||||||||
Sbjct: 365 cgaagagctcgacactctcatcaaggccaccatcgccggaggaggagtcatcccacacat 424

              
Query: 537 cca 539
           |||
Sbjct: 425 cca 427



to top

>ref|NM_001016178.2| Xenopus tropicalis hypothetical protein LOC548932 (LOC548932), mRNA
          Length = 943

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Plus

                                                                       
Query: 417 caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
           |||||||||||| ||||| |||||||| ||||| ||| ||||||| ||||| ||||| ||
Sbjct: 437 caaggatctgaaagtgaaacgtatcactcctcggcacttgcagctagccattcgtgggga 496

                                                                       
Query: 477 cgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacat 536
            |||||||| ||  | || ||||| |  ||||||||||| |||||||| || || || ||
Sbjct: 497 tgaggagctggattctctgatcaaagcgaccattgctggaggaggtgtcattcctcatat 556

                          
Query: 537 ccacaagtccctgat 551
           ||||||||| |||||
Sbjct: 557 ccacaagtctctgat 571



to top

>gb|BC091605.1| Xenopus tropicalis hypothetical protein LOC548932, mRNA (cDNA clone
           MGC:97691 IMAGE:6983532), complete cds
          Length = 943

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Plus

                                                                       
Query: 417 caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
           |||||||||||| ||||| |||||||| ||||| ||| ||||||| ||||| ||||| ||
Sbjct: 437 caaggatctgaaagtgaaacgtatcactcctcggcacttgcagctagccattcgtgggga 496

                                                                       
Query: 477 cgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacat 536
            |||||||| ||  | || ||||| |  ||||||||||| |||||||| || || || ||
Sbjct: 497 tgaggagctggattctctgatcaaagcgaccattgctggaggaggtgtcattcctcatat 556

                          
Query: 537 ccacaagtccctgat 551
           ||||||||| |||||
Sbjct: 557 ccacaagtctctgat 571



to top

>ref|NM_022674.1| Rattus norvegicus H2A histone family, member Z (H2afz), mRNA
          Length = 811

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || ||||| ||||| || ||| 
Sbjct: 274 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctatccgcggagatgaagagt 333

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | || |||||||  || ||||||||||| ||||| ||||||||||||||||| |
Sbjct: 334 tggactctctgatcaaggctacgattgctggtggtggtgtcatcccacacatccacaaat 393

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 394 cactgat 400



to top

>gb|U61953.2| Caenorhabditis elegans cosmid R08C7, complete sequence
          Length = 39012

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 103/123 (83%)
 Strand = Plus / Plus

                                                                         
Query: 417   caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
             ||||||||| ||||||||||||||||||||  | || || || || || ||| | |||||
Sbjct: 25451 caaggatcttaaggtgaagcgtatcaccccaagacatcttcatcttgctatcagaggaga 25510

                                                                         
Query: 477   cgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacat 536
             ||| ||||| ||||| |||||||||| |||||| || || ||||| || |||||||||||
Sbjct: 25511 cgaagagctcgacactctcatcaaggccaccatcgccggaggaggagtcatcccacacat 25570

                
Query: 537   cca 539
             |||
Sbjct: 25571 cca 25573



to top

>emb|X52316.1|RSH2AZ Rat mRNA for histone H2A.Z
          Length = 778

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || ||||| ||||| || ||| 
Sbjct: 245 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctatccgcggagatgaagagt 304

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | || |||||||  || ||||||||||| ||||| ||||||||||||||||| |
Sbjct: 305 tggactctctgatcaaggctacgattgctggtggtggtgtcatcccacacatccacaaat 364

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 365 cactgat 371



to top

>emb|CR761860.2| Xenopus tropicalis finished cDNA, clone TGas096d24
          Length = 751

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 112/135 (82%)
 Strand = Plus / Plus

                                                                       
Query: 417 caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
           |||||||||||| ||||| |||||||| ||||| ||| ||||||| ||||| ||||| ||
Sbjct: 280 caaggatctgaaagtgaaacgtatcactcctcggcacttgcagctagccattcgtgggga 339

                                                                       
Query: 477 cgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacat 536
            |||||||| ||  | || ||||| |  ||||||||||| |||||||| || || || ||
Sbjct: 340 tgaggagctggattctctgatcaaagcgaccattgctggaggaggtgtcattcctcatat 399

                          
Query: 537 ccacaagtccctgat 551
           ||||||||| |||||
Sbjct: 400 ccacaagtctctgat 414



to top

>gb|M37584.1|RATHIS2AZ Rat histone (H2A.Z) mRNA, complete cds
          Length = 811

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 106/127 (83%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || ||||| ||||| || ||| 
Sbjct: 274 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctatccgcggagatgaagagt 333

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | || |||||||  || ||||||||||| ||||| ||||||||||||||||| |
Sbjct: 334 tggactctctgatcaaggctacgattgctggtggtggtgtcatcccacacatccacaaat 393

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 394 cactgat 400



to top

>gb|DQ215813.1| Taeniopygia guttata clone 0058P0052D09 histone H2A.Z-like mRNA,
           complete sequence
          Length = 839

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 150/186 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || || ||   |||
Sbjct: 262 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaatgcctccaa 321

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  |||||||||| |||||||| || ||||| |||||||| |||||  | ||||| ||
Sbjct: 322 agacttgaaggtgaaacgtatcactccccgtcatctgcagcttgccattagaggagatga 381

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||||| ||  | || |||||||  || ||||||||||| ||||| || |||||||||||
Sbjct: 382 agagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcca 441

                 
Query: 540 caagtc 545
           ||||||
Sbjct: 442 caagtc 447



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 176 cagttccctgttggccgcatccat 199



to top

>gb|DQ215808.1| Taeniopygia guttata clone 0058P0029H07 histone H2A.Z-like mRNA,
           complete sequence
          Length = 836

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 150/186 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || || ||   |||
Sbjct: 272 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaatgcctccaa 331

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  |||||||||| |||||||| || ||||| |||||||| |||||  | ||||| ||
Sbjct: 332 agacttgaaggtgaaacgtatcactccccgtcatctgcagcttgccattagaggagatga 391

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||||| ||  | || |||||||  || ||||||||||| ||||| || |||||||||||
Sbjct: 392 agagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcca 451

                 
Query: 540 caagtc 545
           ||||||
Sbjct: 452 caagtc 457



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 186 cagttccctgttggccgcatccat 209



to top

>gb|DQ215805.1| Taeniopygia guttata clone 0061P0010E11 histone H2A.Z-like mRNA,
           complete sequence
          Length = 844

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 150/186 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || |||||   |||
Sbjct: 279 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaacgcctccaa 338

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  |||||||||| |||||||| || ||||| || ||||| |||||  | ||||| ||
Sbjct: 339 agacttgaaggtgaaacgtatcactccccgtcatcttcagcttgccattagaggagatga 398

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||||| ||  | || |||||||  || ||||||||||| ||||| || |||||||||||
Sbjct: 399 agagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcca 458

                 
Query: 540 caagtc 545
           ||||||
Sbjct: 459 caagtc 464



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 193 cagttccctgttggccgcatccat 216



to top

>gb|BC079903.1| Mus musculus H2A histone family, member Z, mRNA (cDNA clone
           MGC:96771 IMAGE:30622912), complete cds
          Length = 912

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 361 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 420

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 421 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 480

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 481 ctgatc 486



to top

>ref|NM_016750.1| Mus musculus H2A histone family, member Z (H2afz), mRNA
          Length = 989

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 327 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 386

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 387 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 446

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 447 ctgatc 452



to top

>ref|XM_978064.1| PREDICTED: Mus musculus similar to H2A histone family, member Z,
           transcript variant 2 (LOC669445), mRNA
          Length = 912

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 347 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 406

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 407 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 466

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 467 ctgatc 472



to top

>ref|XM_001000476.1| PREDICTED: Mus musculus similar to H2A histone family, member Z,
            transcript variant 2 (LOC666634), mRNA
          Length = 2916

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                        
Query: 427  aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
            ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 2352 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 2411

                                                                        
Query: 487  gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
            ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 2412 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 2471

                  
Query: 547  ctgatc 552
            ||||||
Sbjct: 2472 ctgatc 2477



to top

>ref|XM_001003000.1| PREDICTED: Mus musculus H2A histone family, member Z, transcript
            variant 2 (H2afz), mRNA
          Length = 2916

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                        
Query: 427  aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
            ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 2352 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 2411

                                                                        
Query: 487  gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
            ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 2412 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 2471

                  
Query: 547  ctgatc 552
            ||||||
Sbjct: 2472 ctgatc 2477



to top

>ref|XM_760084.1| Theileria parva strain Muguga histone H2A (TP02_0611) partial mRNA
          Length = 631

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 418 aaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagac 477
           ||||| || ||||| ||||||||||| || |||||| |||| ||||||||| | ||||||
Sbjct: 361 aaggacctcaaggtcaagcgtatcacgccacgtcacttgcaactggccatcagaggagac 420

                                                                       
Query: 478 gaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatc 537
           ||||| || ||||| ||| ||||||  |||||||| || || || || ||||||||||||
Sbjct: 421 gaggaactcgacacactcgtcaaggctaccattgccggcggtggagtcatcccacacatc 480

             
Query: 538 ca 539
           ||
Sbjct: 481 ca 482



to top

>ref|XM_381803.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG01627.1) partial mRNA
          Length = 435

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 370 ctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaag 429
           |||||||||||||| || || ||||||||| |||| || ||||||  |||||| || |||
Sbjct: 208 ctcgagtacctgactgctgaagttctggagttggcaggcaacgctgccaaggacctcaag 267

                                                                       
Query: 430 gtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgac 489
           || ||||||||||| || || ||||| ||||| ||||| ||||| || |||||||| |||
Sbjct: 268 gtcaagcgtatcacaccccgccaccttcagcttgccattcgtggtgatgaggagctcgac 327

             
Query: 490 ac 491
           ||
Sbjct: 328 ac 329



to top

>ref|XM_947008.1| Theileria annulata strain Ankara histone H2A variant (TA14155)
           partial mRNA
          Length = 459

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 418 aaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagac 477
           |||||||| ||||||||||||||||| || |||||| |||| ||||||||| | ||||||
Sbjct: 277 aaggatctcaaggtgaagcgtatcactccacgtcacttgcaactggccatcagaggagac 336

                                                                       
Query: 478 gaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatc 537
           || || || ||||| ||  ||||||  |||||||| ||||| ||||| || ||||| |||
Sbjct: 337 gaagaactcgacacacttgtcaaggcaaccattgcaggtggtggtgtcataccacatatc 396

             
Query: 538 ca 539
           ||
Sbjct: 397 ca 398



to top

>dbj|AB225651.1| Aspergillus oryzae cDNA, contig sequence: AoEST2506
          Length = 683

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 417 caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
           |||||| || ||||| |||||||||||||| |||||| ||||||| ||||||||||||||
Sbjct: 362 caaggacctcaaggtcaagcgtatcaccccccgtcacttgcagcttgccatccgtggaga 421

                                 
Query: 477 cgaggagcttgacaccctcatc 498
           ||| ||| | ||||| ||||||
Sbjct: 422 cgaagagttggacactctcatc 443



to top

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                           
Query: 417     caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
               |||||| || ||||| |||||||||||||| |||||| ||||||| ||||||||||||||
Sbjct: 3588059 caaggacctcaaggtcaagcgtatcaccccccgtcacttgcagcttgccatccgtggaga 3588118

                                     
Query: 477     cgaggagcttgacaccctcatc 498
               ||| ||| | ||||| ||||||
Sbjct: 3588119 cgaagagttggacactctcatc 3588140



to top

>dbj|AK151052.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830022D13 product:H2A histone
           family, member Z, full insert sequence
          Length = 966

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 338 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 397

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 398 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 457

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 458 ctgatc 463



to top

>dbj|AK146181.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730030H15 product:H2A histone family, member Z,
           full insert sequence
          Length = 997

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 371 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 430

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 431 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 490

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 491 ctgatc 496



to top

>gb|AY074806.1| Mus musculus histone H2A.Z mRNA, complete cds
          Length = 863

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 336 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 395

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 396 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 455

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 456 ctgatc 461



to top

>dbj|AK151868.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830041F09 product:H2A histone
           family, member Z, full insert sequence
          Length = 864

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 338 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 397

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 398 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 457

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 458 ctgatc 463



to top

>dbj|AK143572.1| Mus musculus 6 days neonate spleen cDNA, RIKEN full-length enriched
           library, clone:F420005H14 product:H2A histone family,
           member Z, full insert sequence
          Length = 964

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 338 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 397

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 398 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 457

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 458 ctgatc 463



to top

>dbj|AK152848.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830087J03 product:H2A histone
           family, member Z, full insert sequence
          Length = 964

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 337 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 396

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 397 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 456

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 457 ctgatc 462



to top

>dbj|AK151509.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830031C05 product:H2A histone
           family, member Z, full insert sequence
          Length = 864

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 338 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 397

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 398 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 457

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 458 ctgatc 463



to top

>dbj|AK152398.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830067P16 product:H2A histone
           family, member Z, full insert sequence
          Length = 862

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 336 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 395

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 396 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 455

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 456 ctgatc 461



to top

>dbj|AK150454.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830007N24 product:H2A histone
           family, member Z, full insert sequence
          Length = 864

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 338 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 397

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 398 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 457

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 458 ctgatc 463



to top

>dbj|AK168178.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730064A04 product:H2A histone family,
           member Z, full insert sequence
          Length = 865

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 338 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 397

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 398 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 457

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 458 ctgatc 463



to top

>dbj|AK169003.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I920073D12 product:H2A histone family,
           member Z, full insert sequence
          Length = 850

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 224 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 283

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 284 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 343

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 344 ctgatc 349



to top

>dbj|AK088704.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430024B19
           product:H2A histone family, member Z, full insert
           sequence
          Length = 1012

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 386 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 445

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 446 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 505

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 506 ctgatc 511



to top

>dbj|AK044932.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length
           enriched library, clone:B130014G07 product:H2A histone
           family, member Z, full insert sequence
          Length = 2697

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 346 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 287

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 286 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 227

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 226 ctgatc 221



to top

>dbj|AK028176.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2600014O08 product:H2A histone
           family, member Z, full insert sequence
          Length = 863

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 336 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 395

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 396 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 455

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 456 ctgatc 461



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                            
Query: 193      gccaagacgacggccgccaagaccgccgagaaggacaaggggaagaaggcccccatctcc 252
                |||||| ||||||| |||||| | || |||||||| |||||||||||||||||| | |||
Sbjct: 13947404 gccaaggcgacggcggccaagtcggcggagaaggaaaaggggaagaaggcccccgtatcc 13947345

                                  
Query: 253      cgctcgtcccgcgccggg 270
                ||||| ||||||||||||
Sbjct: 13947344 cgctcatcccgcgccggg 13947327



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 147    ggaaggggaggagatggccggga 169
              |||||||||||||||||||||||
Sbjct: 711514 ggaaggggaggagatggccggga 711536



to top

>dbj|AP005770.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0065F08
          Length = 144091

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                          
Query: 193    gccaagacgacggccgccaagaccgccgagaaggacaaggggaagaaggcccccatctcc 252
              |||||| ||||||| |||||| | || |||||||| |||||||||||||||||| | |||
Sbjct: 119302 gccaaggcgacggcggccaagtcggcggagaaggaaaaggggaagaaggcccccgtatcc 119243

                                
Query: 253    cgctcgtcccgcgccggg 270
              ||||| ||||||||||||
Sbjct: 119242 cgctcatcccgcgccggg 119225



to top

>dbj|AP004180.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1126_B05
          Length = 117057

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                         
Query: 193   gccaagacgacggccgccaagaccgccgagaaggacaaggggaagaaggcccccatctcc 252
             |||||| ||||||| |||||| | || |||||||| |||||||||||||||||| | |||
Sbjct: 17042 gccaaggcgacggcggccaagtcggcggagaaggaaaaggggaagaaggcccccgtatcc 16983

                               
Query: 253   cgctcgtcccgcgccggg 270
             ||||| ||||||||||||
Sbjct: 16982 cgctcatcccgcgccggg 16965



to top

>dbj|AK102414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093B11, full
           insert sequence
          Length = 1760

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 69/78 (88%)
 Strand = Plus / Plus

                                                                       
Query: 193 gccaagacgacggccgccaagaccgccgagaaggacaaggggaagaaggcccccatctcc 252
           |||||| ||||||| |||||| | || |||||||| |||||||||||||||||| | |||
Sbjct: 485 gccaaggcgacggcggccaagtcggcggagaaggaaaaggggaagaaggcccccgtatcc 544

                             
Query: 253 cgctcgtcccgcgccggg 270
           ||||| ||||||||||||
Sbjct: 545 cgctcatcccgcgccggg 562



to top

>dbj|AK060832.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-C06, full
           insert sequence
          Length = 1526

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 69/78 (88%)
 Strand = Plus / Plus

                                                                       
Query: 193 gccaagacgacggccgccaagaccgccgagaaggacaaggggaagaaggcccccatctcc 252
           |||||| ||||||| |||||| | || |||||||| |||||||||||||||||| | |||
Sbjct: 323 gccaaggcgacggcggccaagtcggcggagaaggaaaaggggaagaaggcccccgtatcc 382

                             
Query: 253 cgctcgtcccgcgccggg 270
           ||||| ||||||||||||
Sbjct: 383 cgctcatcccgcgccggg 400



to top

>gb|AC147612.5| Mus musculus BAC clone RP23-374K9 from 6, complete sequence
          Length = 190156

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                          
Query: 427    aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
              ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 145834 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 145775

                                                                          
Query: 487    gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
              ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 145774 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 145715

                    
Query: 547    ctgatc 552
              ||||||
Sbjct: 145714 ctgatc 145709



to top

>gb|U70494.1|MMU70494 Mus musculus histone H2A.Z (H2A.Z) mRNA, complete cds
          Length = 989

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||||||||||||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 327 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 386

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  |||||||||||||| ||||| ||||||||||||||||| || 
Sbjct: 387 gattctctgatcaaagctaccattgctggtggtggtgtcatcccacacatccacaaatcg 446

                 
Query: 547 ctgatc 552
           ||||||
Sbjct: 447 ctgatc 452



to top

>gb|AF502246.1| Toxoplasma gondii histone H2A.F/Z mRNA, complete cds
          Length = 996

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 167/209 (79%)
 Strand = Plus / Plus

                                                                       
Query: 343 actgcggcggtctactctgctgctatcctcgagtacctgacggccgaggttctggagctg 402
           |||||||| |||||| |  | ||||| ||||||||||| || ||||| ||||| ||| ||
Sbjct: 397 actgcggctgtctacgcatcggctattctcgagtacctcaccgccgaagttctcgagttg 456

                                                                       
Query: 403 gctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctg 462
           || || ||||| ||||||||||| || |||||  | || || || |||||| |||| || 
Sbjct: 457 gcgggaaacgccagcaaggatctcaaagtgaaaagaattactccccgtcacttgcaactt 516

                                                                       
Query: 463 gccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctggtggaggt 522
           |||||  | || ||||| ||| | || || || ||||||| ||| ||||| ||||| |||
Sbjct: 517 gccattagaggtgacgaagagttggatactctgatcaaggccactattgccggtggtggt 576

                                        
Query: 523 gtgatcccacacatccacaagtccctgat 551
           || ||||| |||||||||||||| |||||
Sbjct: 577 gtcatcccgcacatccacaagtcgctgat 605



to top

>gb|BC004274.1| Homo sapiens H2A histone family, member V, transcript variant 1,
           mRNA (cDNA clone IMAGE:3615320)
          Length = 678

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 172 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 231

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||||||||| || |||||| ||||||| || |||||||| || ||
Sbjct: 232 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtggtgatga 291

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || |||||||  ||||| ||||| || ||||||||||| ||||||||
Sbjct: 292 agagttggattctcttatcaaggctaccatagctgggggtggtgtgatccctcacatcca 351

                       
Query: 540 caagtccctgat 551
           ||| || |||||
Sbjct: 352 caaatctctgat 363



to top

>gb|BC014885.2| Homo sapiens H2A histone family, member V, transcript variant 1,
           mRNA (cDNA clone MGC:10170 IMAGE:3907411), complete cds
          Length = 644

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 216 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 275

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||||||||| || |||||| ||||||| || |||||||| || ||
Sbjct: 276 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtggtgatga 335

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || |||||||  ||||| ||||| || ||||||||||| ||||||||
Sbjct: 336 agagttggattctcttatcaaggctaccatagctgggggtggtgtgatccctcacatcca 395

                       
Query: 540 caagtccctgat 551
           ||| || |||||
Sbjct: 396 caaatctctgat 407



to top

>gb|BC000098.2| Homo sapiens H2A histone family, member V, transcript variant 1,
           mRNA (cDNA clone MGC:1947 IMAGE:3505930), complete cds
          Length = 758

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 247 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 306

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||||||||| || |||||| ||||||| || |||||||| || ||
Sbjct: 307 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtggtgatga 366

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || |||||||  ||||| ||||| || ||||||||||| ||||||||
Sbjct: 367 agagttggattctcttatcaaggctaccatagctgggggtggtgtgatccctcacatcca 426

                       
Query: 540 caagtccctgat 551
           ||| || |||||
Sbjct: 427 caaatctctgat 438



to top

>ref|NM_201436.1| Homo sapiens H2A histone family, member V (H2AFV), transcript
           variant 3, mRNA
          Length = 1075

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 226 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 285

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||||||||| || |||||| ||||||| || |||||||| || ||
Sbjct: 286 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtggtgatga 345

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || |||||||  ||||| ||||| || ||||||||||| ||||||||
Sbjct: 346 agagttggattctcttatcaaggctaccatagctgggggtggtgtgatccctcacatcca 405

                       
Query: 540 caagtccctgat 551
           ||| || |||||
Sbjct: 406 caaatctctgat 417



to top

>ref|NM_012412.3| Homo sapiens H2A histone family, member V (H2AFV), transcript
           variant 1, mRNA
          Length = 1153

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 304 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 363

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||||||||| || |||||| ||||||| || |||||||| || ||
Sbjct: 364 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtggtgatga 423

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || |||||||  ||||| ||||| || ||||||||||| ||||||||
Sbjct: 424 agagttggattctcttatcaaggctaccatagctgggggtggtgtgatccctcacatcca 483

                       
Query: 540 caagtccctgat 551
           ||| || |||||
Sbjct: 484 caaatctctgat 495



to top

>emb|CR602318.1| full-length cDNA clone CS0DC004YN11 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 752

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 257 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 316

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||||||||| || |||||| ||||||| || |||||||| || ||
Sbjct: 317 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtggtgatga 376

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || |||||||  ||||| ||||| || ||||||||||| ||||||||
Sbjct: 377 agagttggattctcttatcaaggctaccatagctgggggtggtgtgatccctcacatcca 436

                       
Query: 540 caagtccctgat 551
           ||| || |||||
Sbjct: 437 caaatctctgat 448



to top

>dbj|AK129989.1| Homo sapiens cDNA FLJ26479 fis, clone KDN05022, highly similar to
           Histone H2A
          Length = 727

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 240 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 299

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||||||||| || |||||| ||||||| || |||||||| || ||
Sbjct: 300 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtggtgatga 359

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || |||||||  ||||| ||||| || ||||||||||| ||||||||
Sbjct: 360 agagttggattctcttatcaaggctaccatagctgggggtggtgtgatccctcacatcca 419

                       
Query: 540 caagtccctgat 551
           ||| || |||||
Sbjct: 420 caaatctctgat 431



to top

>gb|AF030235.1|AF030235 Oryctolagus cuniculus histone H2A.F/Z variant (H2A.F/Z) mRNA,
           complete cds
          Length = 689

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || ||||||  |||
Sbjct: 189 tgctgcaattctggagtacctcactgctgaggtactggagctggcaggtaacgcttccaa 248

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||||||||| || |||||| ||||||| || |||||||| || ||
Sbjct: 249 ggatctcaaagtaaagcgtatcactccacgtcacttgcagcttgcaatccgtggtgatga 308

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||  | ||  | || |||||||  ||||| ||||| || |||| |||||| ||||||||
Sbjct: 309 agaattggattctcttatcaaggctaccatagctgggggtggtgcgatccctcacatcca 368

                       
Query: 540 caagtccctgat 551
           ||| || |||||
Sbjct: 369 caaatctctgat 380



to top

>gb|AF081192.1|AF081192 Homo sapiens histone H2A.F/Z variant (H2AV) mRNA, complete cds
          Length = 576

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 185 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 244

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||||||||| || |||||| ||||||| || |||||||| || ||
Sbjct: 245 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtggtgatga 304

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || |||||||  ||||| ||||| || ||||||||||| ||||||||
Sbjct: 305 agagttggattctcttatcaaggctaccatagctgggggtggtgtgatccctcacatcca 364

                       
Query: 540 caagtccctgat 551
           ||| || |||||
Sbjct: 365 caaatctctgat 376



to top

>gb|BC070169.1| Homo sapiens H2A histone family, member V, mRNA (cDNA clone
           MGC:88149 IMAGE:6458566), complete cds
          Length = 770

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 247 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 306

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||||||||| || |||||| ||||||| || |||||||| || ||
Sbjct: 307 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtggtgatga 366

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || |||||||  ||||| ||||| || ||||||||||| ||||||||
Sbjct: 367 agagttggattctcttatcaaggctaccatagctgggggtggtgtgatccctcacatcca 426

                       
Query: 540 caagtccctgat 551
           ||| || |||||
Sbjct: 427 caaatctctgat 438



to top

>dbj|AB209001.1| Homo sapiens mRNA for H2A histone family, member V isoform 1
           variant protein
          Length = 1018

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 231 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 290

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||||||||| || |||||| ||||||| || |||||||| || ||
Sbjct: 291 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtggtgatga 350

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || |||||||  ||||| ||||| || ||||||||||| ||||||||
Sbjct: 351 agagttggattctcttatcaaggctaccatagctgggggtggtgtgatccctcacatcca 410

                       
Query: 540 caagtccctgat 551
           ||| || |||||
Sbjct: 411 caaatctctgat 422



to top

>gb|DQ215812.1| Taeniopygia guttata clone 0064P0008A04 histone H2A.Z-like mRNA,
           complete sequence
          Length = 852

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 151/187 (80%), Gaps = 1/187 (0%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| ||||||||||| || ||||| || |||||||| || || ||   |||
Sbjct: 283 tgctgcaatcctggagtacctgacagctgaggtccttgagctggcgggaaatgcctccaa 342

                                                                       
Query: 420 ggatctgaa-ggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacg 478
            ||  |||| |||||| |||||||| || |||||||||||||| |||||  | ||||| |
Sbjct: 343 agacttgaanggtgaaacgtatcactccccgtcacctgcagcttgccattagaggagatg 402

                                                                       
Query: 479 aggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcc 538
           | ||||| ||  | || |||||||  || ||||||||||| ||||| || ||||||||||
Sbjct: 403 aagagctggattctctgatcaaggcaacaattgctggtggtggtgtaataccacacatcc 462

                  
Query: 539 acaagtc 545
           |||||||
Sbjct: 463 acaagtc 469



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 274 cagttccctgttggccgtatccat 297
           ||||||||||||||||| ||||||
Sbjct: 197 cagttccctgttggccgcatccat 220



to top

>ref|XM_532724.2| PREDICTED: Canis familiaris similar to H2A histone family, member V
           isoform 5, transcript variant 1 (LOC475501), mRNA
          Length = 2125

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 144/179 (80%)
 Strand = Plus / Plus

                                                                       
Query: 373 gagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtg 432
           |||||||| || || ||||| ||||||||||| || ||||||  |||||| || ||||| 
Sbjct: 242 gagtacctcactgcagaggtgctggagctggcaggtaacgcttccaaggacctcaaggta 301

                                                                       
Query: 433 aagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacacc 492
           ||||| ||||| || || ||| ||||||| || ||||| || || || ||  | ||  | 
Sbjct: 302 aagcggatcactccgcgccacttgcagcttgcaatccgcggtgatgaagaattggattct 361

                                                                      
Query: 493 ctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctgat 551
           ||||||||||  ||||| ||||| || ||||||||||| |||||||||||||| |||||
Sbjct: 362 ctcatcaaggctaccatcgctgggggtggtgtgatcccgcacatccacaagtctctgat 420



to top

>ref|XM_857381.1| PREDICTED: Canis familiaris histone H2AF, transcript variant 3
           (LOC478493), mRNA
          Length = 1124

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  
Sbjct: 567 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaat 626

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||  ||||||||||||  || ||||||||||| ||||| || |||||||||||||| |
Sbjct: 627 tggattccctcatcaaggctacaattgctggtggtggtgttattccacacatccacaaat 686

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 687 ctctgat 693



to top

>ref|XM_857355.1| PREDICTED: Canis familiaris histone H2AF, transcript variant 2
           (LOC478493), mRNA
          Length = 1106

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  
Sbjct: 567 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaat 626

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||  ||||||||||||  || ||||||||||| ||||| || |||||||||||||| |
Sbjct: 627 tggattccctcatcaaggctacaattgctggtggtggtgttattccacacatccacaaat 686

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 687 ctctgat 693



to top

>ref|XM_535671.2| PREDICTED: Canis familiaris histone H2AF, transcript variant 1
           (LOC478493), mRNA
          Length = 1106

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  
Sbjct: 567 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaat 626

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||  ||||||||||||  || ||||||||||| ||||| || |||||||||||||| |
Sbjct: 627 tggattccctcatcaaggctacaattgctggtggtggtgttattccacacatccacaaat 686

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 687 ctctgat 693



to top

>emb|BX284748.1|NCB15B24 Neurospora crassa DNA linkage group II BAC clone B15B24
          Length = 54958

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                         
Query: 408   gaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccat 467
             |||||||  |||||| |||||||| |||||||| || || || || || ||||| |||||
Sbjct: 41365 gaacgctgccaaggacctgaaggtcaagcgtattactccccgccatcttcagcttgccat 41306

                                            
Query: 468   ccgtggagacgaggagcttgacaccctcatc 498
             ||||||||| ||||||||||| |||||||||
Sbjct: 41305 ccgtggagatgaggagcttgataccctcatc 41275



to top

>gb|BC109743.1| Bos taurus H2A histone family, member Z, mRNA (cDNA clone
           MGC:133929 IMAGE:8065476), complete cds
          Length = 884

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  
Sbjct: 340 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaat 399

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | ||||||||||  || ||||||||||| ||||| || |||||||||||||| |
Sbjct: 400 tggactctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaat 459

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 460 ctctgat 466



to top

>ref|NM_174809.2| Bos taurus H2A histone family, member Z (H2AFZ), mRNA
          Length = 948

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  
Sbjct: 274 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaat 333

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | ||||||||||  || ||||||||||| ||||| || |||||||||||||| |
Sbjct: 334 tggactctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaat 393

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 394 ctctgat 400



to top

>emb|X52318.1|BTH2AZ Bovine mRNA for histone H2A.Z
          Length = 906

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  
Sbjct: 230 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaat 289

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | ||||||||||  || ||||||||||| ||||| || |||||||||||||| |
Sbjct: 290 tggactctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaat 349

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 350 ctctgat 356



to top

>gb|M37585.1|BOVHIS2AZ Cow histone (H2A.Z) mRNA, complete cds
          Length = 948

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 105/127 (82%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  
Sbjct: 274 tgaaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaat 333

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | ||||||||||  || ||||||||||| ||||| || |||||||||||||| |
Sbjct: 334 tggactctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaat 393

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 394 ctctgat 400



to top

>gb|AF069441.1| Arabidopsis thaliana BAC T19B17 from chromosome IV, near 19.3 cM,
            complete sequence
          Length = 105830

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                        
Query: 472  ggagacgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatccca 531
            ||||| |||||||||||||| |||||||| || || |||| ||| |||||||||||||| 
Sbjct: 3942 ggagatgaggagcttgacacactcatcaaaggaacaattgttggaggaggtgtgatccct 4001

                          
Query: 532  cacatccacaagtc 545
            ||||||||| ||||
Sbjct: 4002 cacatccactagtc 4015



to top

>ref|XM_369251.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein
           (MG06213.4) partial mRNA
          Length = 429

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 104/126 (82%)
 Strand = Plus / Plus

                                                                       
Query: 373 gagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtg 432
           |||||| |||| || |||||| ||||||| || || |||||    |||||||| ||||| 
Sbjct: 205 gagtacttgactgcagaggttttggagctcgcgggtaacgccgcaaaggatctcaaggtc 264

                                                                       
Query: 433 aagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacacc 492
           ||||| ||||| || |||||||| ||||| ||||| ||||| ||||||||||| ||||| 
Sbjct: 265 aagcgaatcactccccgtcacctacagcttgccattcgtggcgacgaggagctggacacg 324

                 
Query: 493 ctcatc 498
           ||||||
Sbjct: 325 ctcatc 330



to top

>ref|XM_958245.1| Neurospora crassa OR74A hypothetical protein (NCU05347.1) partial
           mRNA
          Length = 432

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 71/82 (86%)
 Strand = Plus / Plus

                                                                       
Query: 417 caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
           |||||| |||||||| |||||||| || || || || || ||||| ||||||||||||||
Sbjct: 252 caaggacctgaaggtcaagcgtattactccccgccatcttcagcttgccatccgtggaga 311

                                 
Query: 477 cgaggagcttgacaccctcatc 498
            ||||||||||| |||||||||
Sbjct: 312 tgaggagcttgataccctcatc 333



to top

>ref|XM_325201.1| Neurospora crassa OR74A hypothetical protein (NCU05347.1) partial
           mRNA
          Length = 432

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 71/82 (86%)
 Strand = Plus / Plus

                                                                       
Query: 417 caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
           |||||| |||||||| |||||||| || || || || || ||||| ||||||||||||||
Sbjct: 252 caaggacctgaaggtcaagcgtattactccccgccatcttcagcttgccatccgtggaga 311

                                 
Query: 477 cgaggagcttgacaccctcatc 498
            ||||||||||| |||||||||
Sbjct: 312 tgaggagcttgataccctcatc 333



to top

>emb|AL161500.2|ATCHRIV12 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 12
          Length = 199759

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                          
Query: 472    ggagacgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatccca 531
              ||||| |||||||||||||| |||||||| || || |||| ||| |||||||||||||| 
Sbjct: 105919 ggagatgaggagcttgacacactcatcaaaggaacaattgttggaggaggtgtgatccct 105860

                            
Query: 532    cacatccacaagtc 545
              ||||||||| ||||
Sbjct: 105859 cacatccactagtc 105846



to top

>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                          
Query: 373    gagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtg 432
              ||||| ||||| |||||||| ||||||||||| || |||||    |||||||||||||| 
Sbjct: 330764 gagtatctgacagccgaggtgctggagctggcgggaaacgccgcaaaggatctgaaggtc 330705

                                                    
Query: 433    aagcgtatcacccctcgtcacctgcagctggccatccg 470
              || |||||||| || || || |||||||||||||||||
Sbjct: 330704 aaacgtatcacgccgcgccatctgcagctggccatccg 330667



to top

>ref|NM_208740.1| Eremothecium gossypii ACL017Cp (ACL017C), mRNA
          Length = 402

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 373 gagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtg 432
           ||||| ||||| |||||||| ||||||||||| || |||||    |||||||||||||| 
Sbjct: 193 gagtatctgacagccgaggtgctggagctggcgggaaacgccgcaaaggatctgaaggtc 252

                                                 
Query: 433 aagcgtatcacccctcgtcacctgcagctggccatccg 470
           || |||||||| || || || |||||||||||||||||
Sbjct: 253 aaacgtatcacgccgcgccatctgcagctggccatccg 290



to top

>gb|AF076243.1|AF076243 Arabidopsis thaliana BAC T26N6 from chromosome IV at 19.3 cM,
            complete sequence
          Length = 99384

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                        
Query: 472  ggagacgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatccca 531
            ||||| |||||||||||||| |||||||| || || |||| ||| |||||||||||||| 
Sbjct: 5573 ggagatgaggagcttgacacactcatcaaaggaacaattgttggaggaggtgtgatccct 5514

                          
Query: 532  cacatccacaagtc 545
            ||||||||| ||||
Sbjct: 5513 cacatccactagtc 5500



to top

>ref|XM_743054.1| Aspergillus fumigatus Af293 histone H2A (Afu5g01950) partial mRNA
          Length = 417

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                       
Query: 417 caaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
           |||||||||||| || ||||||||||| || || ||||||||||| ||||| ||||| ||
Sbjct: 240 caaggatctgaaagtcaagcgtatcacgccccgccacctgcagctcgccattcgtggtga 299

                    
Query: 477 cgaggagct 485
           |||||||||
Sbjct: 300 cgaggagct 308



to top

>emb|AL672076.10| Mouse DNA sequence from clone RP23-161N17 on chromosome 4, complete
              sequence
          Length = 208396

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 90/108 (83%)
 Strand = Plus / Plus

                                                                          
Query: 435    gcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacaccct 494
              ||||||||||||||||||| ||||||| || || |||||||| || ||  | ||  | ||
Sbjct: 176851 gcgtatcacccctcgtcacttgcagcttgctatacgtggagatgaagaattggattctct 176910

                                                              
Query: 495    catcaagggcaccattgctggtggaggtgtgatcccacacatccacaa 542
               ||||| |  |||||||||||||| ||||| |||||||||||||||||
Sbjct: 176911 gatcaaagctaccattgctggtggtggtgtcatcccacacatccacaa 176958



to top

>ref|XM_676216.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8039.2), mRNA
          Length = 411

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                      
Query: 433 aagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttgacac 491
           ||||||||||| || |||||||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 256 aagcgtatcacgccgcgtcacctacagcttgccatccgtggagacgaagagctcgacac 314



to top

>ref|NM_201517.1| Homo sapiens H2A histone family, member V (H2AFV), transcript
           variant 5, mRNA
          Length = 1039

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 131/163 (80%)
 Strand = Plus / Plus

                                                                       
Query: 389 aggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctc 448
           |||| ||||||||||| || || |||   |||||||| || || ||||||||||| || |
Sbjct: 219 aggtgctggagctggcaggtaatgcttctaaggatctcaaagtaaagcgtatcactccgc 278

                                                                       
Query: 449 gtcacctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcacca 508
           ||||| ||||||| || |||||||| || || ||| | ||  | || |||||||  ||||
Sbjct: 279 gtcacttgcagcttgcaatccgtggtgatgaagagttggattctcttatcaaggctacca 338

                                                      
Query: 509 ttgctggtggaggtgtgatcccacacatccacaagtccctgat 551
           | ||||| || ||||||||||| ||||||||||| || |||||
Sbjct: 339 tagctgggggtggtgtgatccctcacatccacaaatctctgat 381



to top

>ref|XM_850699.1| PREDICTED: Canis familiaris similar to H2A histone family, member V
           isoform 5, transcript variant 3 (LOC475501), mRNA
          Length = 620

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 131/163 (80%)
 Strand = Plus / Plus

                                                                       
Query: 389 aggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctc 448
           |||| ||||||||||| || ||||||  |||||| || ||||| ||||| ||||| || |
Sbjct: 132 aggtgctggagctggcaggtaacgcttccaaggacctcaaggtaaagcggatcactccgc 191

                                                                       
Query: 449 gtcacctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcacca 508
           | ||| ||||||| || ||||| || || || ||  | ||  | ||||||||||  ||||
Sbjct: 192 gccacttgcagcttgcaatccgcggtgatgaagaattggattctctcatcaaggctacca 251

                                                      
Query: 509 ttgctggtggaggtgtgatcccacacatccacaagtccctgat 551
           | ||||| || ||||||||||| |||||||||||||| |||||
Sbjct: 252 tcgctgggggtggtgtgatcccgcacatccacaagtctctgat 294



to top

>gb|AY074805.1| Ovis aries histone H2A.Z mRNA, complete cds
          Length = 862

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 104/127 (81%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||  |||| || || || |||||||| || ||  
Sbjct: 334 tgaaggtaaagcgtattacccctcgtcatttgcaacttgctattcgtggagatgaagaat 393

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | ||||||||||  || ||||||||||| ||||| || |||||||||||||| |
Sbjct: 394 tggactctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaat 453

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 454 ctctgat 460



to top

>gb|AF414111.1|AF414111 Danio rerio histone variant H2A.F/Z gene, complete cds
          Length = 5754

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                        
Query: 424  ctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggag 483
            |||||||||||||| ||||| ||||| ||  | ||||||||||| || ||||| ||||||
Sbjct: 4025 ctgaaggtgaagcgcatcactcctcgacatttacagctggccattcgaggagatgaggag 4084

                                                   
Query: 484  cttgacaccctcatcaagggcaccattgctggtggaggt 522
            || ||  |||| ||||||| ||| |||||||| ||||||
Sbjct: 4085 ctcgattcccttatcaaggccactattgctggaggaggt 4123



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 519  aggtgtgatcccacacatccacaagtccctgat 551
            ||||||||| ||||||||||||||||| |||||
Sbjct: 5670 aggtgtgattccacacatccacaagtctctgat 5702



to top

>emb|BX322550.7| Zebrafish DNA sequence from clone DKEY-202N14 in linkage group 5,
             complete sequence
          Length = 184426

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 83/99 (83%)
 Strand = Plus / Plus

                                                                         
Query: 424   ctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggag 483
             |||||||||||||| ||||| ||||| ||  | ||||||||||| || ||||| ||||||
Sbjct: 18701 ctgaaggtgaagcgcatcactcctcgacatttacagctggccattcgaggagatgaggag 18760

                                                    
Query: 484   cttgacaccctcatcaagggcaccattgctggtggaggt 522
             || ||  |||| ||||||| ||| |||||||| ||||||
Sbjct: 18761 ctcgattcccttatcaaggccactattgctggaggaggt 18799



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 519   aggtgtgatcccacacatccacaagtccctgat 551
             ||||||||| ||||||||||||||||| |||||
Sbjct: 20343 aggtgtgattccacacatccacaagtctctgat 20375



to top

>emb|BX821662.1|CNS0A98O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL62ZC09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 694

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                       
Query: 455 tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
           ||||||| || ||| | ||||| ||||| ||| | || |||||||| || |||||||| |
Sbjct: 418 tgcagcttgcaatcagaggagatgaggaacttaaaactctcatcaaaggaaccattgcag 477

                                                      
Query: 515 gtggaggtgtgatcccacacatccacaagtccctgatcaacaa 557
           | ||||||||||||||  ||||||||||||||||  |||||||
Sbjct: 478 gaggaggtgtgatccctaacatccacaagtcccttgtcaacaa 520



to top

>ref|NM_001009270.1| Ovis aries histone H2A.Z (LOC443235), mRNA
          Length = 862

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 104/127 (81%)
 Strand = Plus / Plus

                                                                       
Query: 425 tgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagc 484
           ||||||| |||||||| |||||||||||  |||| || || || |||||||| || ||  
Sbjct: 334 tgaaggtaaagcgtattacccctcgtcatttgcaacttgctattcgtggagatgaagaat 393

                                                                       
Query: 485 ttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagt 544
           | ||| | ||||||||||  || ||||||||||| ||||| || |||||||||||||| |
Sbjct: 394 tggactctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaat 453

                  
Query: 545 ccctgat 551
           | |||||
Sbjct: 454 ctctgat 460



to top

>emb|AL954191.5| Zebrafish DNA sequence from clone CH211-230G14, complete sequence
          Length = 151595

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 83/99 (83%)
 Strand = Plus / Minus

                                                                         
Query: 424   ctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggag 483
             |||||||||||||| ||||| ||||| ||  | ||||||||||| || ||||| ||||||
Sbjct: 10255 ctgaaggtgaagcgcatcactcctcgacatttacagctggccattcgaggagatgaggag 10196

                                                    
Query: 484   cttgacaccctcatcaagggcaccattgctggtggaggt 522
             || ||  |||| ||||||| ||| |||||||| ||||||
Sbjct: 10195 ctcgattcccttatcaaggccactattgctggaggaggt 10157



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 519  aggtgtgatcccacacatccacaagtccctgat 551
            ||||||||| ||||||||||||||||| |||||
Sbjct: 8639 aggtgtgattccacacatccacaagtctctgat 8607



to top

>ref|XM_517363.1| PREDICTED: Pan troglodytes similar to H2A histone family, member Z
           (LOC461400), mRNA
          Length = 633

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 329 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 388

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 389 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 448

                
Query: 547 ctgat 551
           |||||
Sbjct: 449 ctgat 453



to top

>ref|NM_002106.3| Homo sapiens H2A histone family, member Z (H2AFZ), mRNA
          Length = 951

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 417 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 476

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 477 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 536

                
Query: 547 ctgat 551
           |||||
Sbjct: 537 ctgat 541



to top

>gb|BC103743.1| Homo sapiens H2A histone family, member Z, mRNA (cDNA clone
           MGC:117173 IMAGE:6175124), complete cds
          Length = 1024

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 452 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 511

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 512 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 571

                
Query: 547 ctgat 551
           |||||
Sbjct: 572 ctgat 576



to top

>gb|AY597416.1| Homo sapiens chromosome 13 carcinoma associated antigen CRC-L-9
           mRNA sequence
          Length = 726

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 354 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 413

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 414 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 473

                
Query: 547 ctgat 551
           |||||
Sbjct: 474 ctgat 478



to top

>ref|XM_567962.1| Cryptococcus neoformans var. neoformans JEC21 histone h2a variant
           (CNL04080) partial mRNA
          Length = 544

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 376 tacctgacggccgaggttctggagctggctgggaacgctagcaaggatctgaaggtgaag 435
           |||||||| ||||||||||| ||||| || || ||||||  ||| || ||    ||||| 
Sbjct: 196 tacctgactgccgaggttcttgagctcgccggtaacgctgccaaagacctccgcgtgaaa 255

                                                                
Query: 436 cgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttga 488
           ||||| || ||||| |||||||| || ||||||||||||||||| ||||||||
Sbjct: 256 cgtattactcctcgacacctgcaacttgccatccgtggagacgaagagcttga 308



to top

>emb|CR858439.1| Pongo pygmaeus mRNA; cDNA DKFZp468O2423 (from clone DKFZp468O2423)
          Length = 881

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 338 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 397

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 398 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 457

                
Query: 547 ctgat 551
           |||||
Sbjct: 458 ctgat 462



to top

>emb|CR616797.1| full-length cDNA clone CS0DI067YA11 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 847

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 315 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 374

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 375 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 434

                
Query: 547 ctgat 551
           |||||
Sbjct: 435 ctgat 439



to top

>emb|CR611014.1| full-length cDNA clone CS0DJ002YA13 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1254

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 757 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 816

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 817 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 876

                
Query: 547 ctgat 551
           |||||
Sbjct: 877 ctgat 881



to top

>emb|CR599577.1| full-length cDNA clone CS0DI079YK23 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 843

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 314 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 373

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 374 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 433

                
Query: 547 ctgat 551
           |||||
Sbjct: 434 ctgat 438



to top

>emb|CR457415.1| Homo sapiens full open reading frame cDNA clone RZPDo834H1010D for
           gene H2AFZ, H2A histone family, member Z; complete cds,
           incl. stopcodon
          Length = 387

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 232 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 291

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 292 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 351

                
Query: 547 ctgat 551
           |||||
Sbjct: 352 ctgat 356



to top

>gb|BC020936.1| Homo sapiens H2A histone family, member Z, mRNA (cDNA clone
           MGC:24740 IMAGE:4281642), complete cds
          Length = 896

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 337 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 396

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 397 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 456

                
Query: 547 ctgat 551
           |||||
Sbjct: 457 ctgat 461



to top

>gb|BC018002.1| Homo sapiens H2A histone family, member Z, mRNA (cDNA clone
           MGC:24682 IMAGE:4271353), complete cds
          Length = 892

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 337 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 396

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 397 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 456

                
Query: 547 ctgat 551
           |||||
Sbjct: 457 ctgat 461



to top

>emb|X52317.1|HSH2AZ Human mRNA for histone H2A.Z
          Length = 869

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 338 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 397

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 398 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 457

                
Query: 547 ctgat 551
           |||||
Sbjct: 458 ctgat 462



to top

>gb|M37583.1|HUMHIS2AZ Human histone (H2A.Z) mRNA, complete cds
          Length = 873

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 338 aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 397

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | ||||||||||  || ||||||||||| ||||| || |||||||||||||| || 
Sbjct: 398 gattctctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatct 457

                
Query: 547 ctgat 551
           |||||
Sbjct: 458 ctgat 462



to top

>ref|XM_978028.1| PREDICTED: Mus musculus similar to H2A histone family, member Z,
           transcript variant 1 (LOC669445), mRNA
          Length = 839

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 505 accattgctggtggaggtgtgatcccacacatccacaagtccctgatc 552
           |||||||||||||| ||||| ||||||||||||||||| || ||||||
Sbjct: 352 accattgctggtggtggtgtcatcccacacatccacaaatcgctgatc 399



to top

>ref|XM_001000460.1| PREDICTED: Mus musculus similar to H2A histone family, member Z,
           transcript variant 1 (LOC666634), mRNA
          Length = 838

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 505 accattgctggtggaggtgtgatcccacacatccacaagtccctgatc 552
           |||||||||||||| ||||| ||||||||||||||||| || ||||||
Sbjct: 352 accattgctggtggtggtgtcatcccacacatccacaaatcgctgatc 399



to top

>ref|XM_001002995.1| PREDICTED: Mus musculus H2A histone family, member Z, transcript
           variant 3 (H2afz), mRNA
          Length = 838

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 505 accattgctggtggaggtgtgatcccacacatccacaagtccctgatc 552
           |||||||||||||| ||||| ||||||||||||||||| || ||||||
Sbjct: 352 accattgctggtggtggtgtcatcccacacatccacaaatcgctgatc 399



to top

>ref|XM_985882.1| PREDICTED: Mus musculus similar to H2A histone family, member Z
           (LOC675899), mRNA
          Length = 1282

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 505 accattgctggtggaggtgtgatcccacacatccacaagtccctgatc 552
           |||||||||||||| ||||| ||||||||||||||||| || ||||||
Sbjct: 730 accattgctggtggtggtgtcatcccacacatccacaaatcgctgatc 777



to top

>gb|AF483074.1| Boltenia villosa histone 2A Z variant (h2az) mRNA, complete cds
          Length = 750

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 113/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 403 gctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcacctgcagctg 462
           ||||| || |||||||||||| |||| || ||| | |||||||| || ||  |||| || 
Sbjct: 277 gctggcaatgctagcaaggatttgaaagtaaagagaatcaccccccggcatttgcaactt 336

                                                                       
Query: 463 gccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctggtggaggt 522
           || ||| | ||||| |||||||| ||  | ||||||||||  || || ||||| ||||||
Sbjct: 337 gcaatcagaggagatgaggagctggattctctcatcaaggctacaatagctggaggaggt 396

                               
Query: 523 gtgatcccacacatccacaa 542
           || |||||||||||||||||
Sbjct: 397 gtcatcccacacatccacaa 416



to top

>emb|BX008098.1|CNS08EEU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 357

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 101/124 (81%)
 Strand = Plus / Plus

                                                                       
Query: 367 atcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaaggatctg 426
           ||||| |||||||||||||| ||||| |||||| |||| || |||||    |||||||| 
Sbjct: 219 atcctggagtacctgacggctgaggtgctggagttggccggcaacgcctcgaaggatctc 278

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           || ||||| || ||||| ||  | || |||||||||||||| || || ||||||||||| 
Sbjct: 279 aaagtgaaacgaatcacgcccaggcatctgcagctggccattcgcggtgacgaggagctg 338

               
Query: 487 gaca 490
           ||||
Sbjct: 339 gaca 342



to top

>dbj|AK151462.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830030H04 product:H2A histone
           family, member Z, full insert sequence
          Length = 793

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 505 accattgctggtggaggtgtgatcccacacatccacaagtccctgatc 552
           |||||||||||||| ||||| ||||||||||||||||| || ||||||
Sbjct: 345 accattgctggtggtggtgtcatcccacacatccacaaatcgctgatc 392



to top

>ref|NM_001031374.1| Gallus gallus H2A histone family, member V (H2AFV), mRNA
          Length = 920

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 145/183 (79%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| |||||| |||| || |||||||| |||||||| || || ||   |||
Sbjct: 325 tgctgccatcctggagtacttgacagctgaggttcttgagctggcaggaaatgcatccaa 384

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  ||||||||||||||||||| || |||||| ||||||| || ||  | ||||| ||
Sbjct: 385 agacttgaaggtgaagcgtatcactccccgtcacttgcagcttgcaattagaggagatga 444

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||  | ||| | ||||| ||||  || ||||||||||| ||||| || ||||| |||||
Sbjct: 445 agaattggactcgctcattaaggcaacaattgctggtggtggtgtaataccacatatcca 504

              
Query: 540 caa 542
           |||
Sbjct: 505 caa 507



to top

>gb|AE017352.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 12, complete
              sequence
          Length = 906719

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                         
Query: 430    gtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagcttga 488
              ||||| ||||| || ||||| |||||||| || ||||||||||||||||| ||||||||
Sbjct: 112827 gtgaaacgtattactcctcgacacctgcaacttgccatccgtggagacgaagagcttga 112885



to top

>gb|AC130809.25| Medicago truncatula clone mth2-15i12, complete sequence
          Length = 114664

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                         
Query: 472   ggagacgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatccca 531
             ||||| ||||| ||||| ||||| |||||||| || ||||||||||| ||||| || || 
Sbjct: 47652 ggagatgaggaacttgatacccttatcaagggaacgattgctggtggtggtgtcattcct 47593

                                    
Query: 532   cacatccacaagtccctgatcaa 554
              |||| ||||||||| |||||||
Sbjct: 47592 aacattcacaagtccttgatcaa 47570



to top

>gb|AC151823.11| Medicago truncatula clone mth2-45h2, complete sequence
          Length = 125855

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                         
Query: 472   ggagacgaggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatccca 531
             ||||| ||||| ||||| ||||| |||||||| || ||||||||||| ||||| || || 
Sbjct: 94427 ggagatgaggaacttgatacccttatcaagggaacgattgctggtggtggtgtcattcct 94486

                                    
Query: 532   cacatccacaagtccctgatcaa 554
              |||| ||||||||| |||||||
Sbjct: 94487 aacattcacaagtccttgatcaa 94509



to top

>emb|AJ719448.1| Gallus gallus mRNA for hypothetical protein, clone 2h11
          Length = 920

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 145/183 (79%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| ||||| |||||| |||| || |||||||| |||||||| || || ||   |||
Sbjct: 325 tgctgccatcctggagtacttgacagctgaggttcttgagctggcaggaaatgcatccaa 384

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
            ||  ||||||||||||||||||| || |||||| ||||||| || ||  | ||||| ||
Sbjct: 385 agacttgaaggtgaagcgtatcactccccgtcacttgcagcttgcaattagaggagatga 444

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||  | ||| | ||||| ||||  || ||||||||||| ||||| || ||||| |||||
Sbjct: 445 agaattggactcgctcattaaggcaacaattgctggtggtggtgtaataccacatatcca 504

              
Query: 540 caa 542
           |||
Sbjct: 505 caa 507



to top

>ref|NM_138635.2| Homo sapiens H2A histone family, member V (H2AFV), transcript
           variant 2, mRNA
          Length = 825

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 93/114 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 304 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 363

                                                                 
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtgg 473
           |||||| || || ||||||||||| || |||||| ||||||| || ||||||||
Sbjct: 364 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtgg 417



to top

>gb|AC146607.2| Mus musculus BAC clone RP23-209N19 from chromosome 3, complete sequence
          Length = 173758

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                                
Query: 427    aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
              ||||| ||||||||||||||||||||| ||||||| || || ||||||||
Sbjct: 150380 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggaga 150331



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 519    aggtgtgatcccacacatccacaagtccctgatc 552
              |||||| ||||||||||||||||| || ||||||
Sbjct: 150043 aggtgtcatcccacacatccacaaatcgctgatc 150010



to top

>gb|AC125154.3| Mus musculus BAC clone RP24-380C2 from chromosome 3, complete sequence
          Length = 186277

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 427    aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggaga 476
              ||||| ||||||||||||||||||||| ||||||| || || ||||||||
Sbjct: 181383 aaggtaaagcgtatcacccctcgtcacttgcagcttgctatacgtggaga 181432



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                
Query: 519    aggtgtgatcccacacatccacaagtccctgatc 552
              |||||| ||||||||||||||||| || ||||||
Sbjct: 181720 aggtgtcatcccacacatccacaaatcgctgatc 181753



to top

>dbj|AK023973.1| Homo sapiens cDNA FLJ13911 fis, clone Y79AA1000214, weakly similar
           to Homo sapiens histone H2A.F/Z variant (H2AV) mRNA
          Length = 3383

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 93/114 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || |||   ||
Sbjct: 271 tgctgcgattctggagtacctcactgcagaggtgctggagctggcaggtaatgcttctaa 330

                                                                 
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtgg 473
           |||||| || || ||||||||||| || |||||| ||||||| || ||||||||
Sbjct: 331 ggatctcaaagtaaagcgtatcactccgcgtcacttgcagcttgcaatccgtgg 384



to top

>gb|BC077029.1| Xenopus tropicalis MGC89861 protein, mRNA (cDNA clone MGC:89861
           IMAGE:7029021), complete cds
          Length = 881

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                       
Query: 388 gaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccct 447
           |||||||| ||  ||||||| || |||  ||| ||||| |||||||||||||||| ||| 
Sbjct: 263 gaggttcttgaattggctggaaatgcttccaaagatcttaaggtgaagcgtatcagccca 322

                                
Query: 448 cgtcacctgcagctggccatc 468
           |||||| ||||||| ||||||
Sbjct: 323 cgtcacttgcagcttgccatc 343



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 505 accattgctggtggaggtgtgatcccacacatccacaagtc 545
           |||||||||||||| || || || |||||||| ||||||||
Sbjct: 380 accattgctggtggtggagtcattccacacatacacaagtc 420



to top

>gb|AY814205.1| Schistosoma japonicum SJCHGC05820 protein mRNA, complete cds
          Length = 610

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 146/185 (78%)
 Strand = Plus / Plus

                                                                       
Query: 334 gttggtgctactgcggcggtctactctgctgctatcctcgagtacctgacggccgaggtt 393
           |||||||||||||| || |||||||| || || ||||| || || ||||| ||||| |||
Sbjct: 142 gttggtgctactgccgcagtctactcggcggcaatcctggaatatctgactgccgaagtt 201

                                                                       
Query: 394 ctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccctcgtcac 453
           |||||  | ||||||||||| || || ||  |||| || || ||||| || ||||| || 
Sbjct: 202 ctggaattagctgggaacgccagtaaagacttgaaagtcaaacgtataacacctcgacat 261

                                                                       
Query: 454 ctgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgct 513
           || ||||| || || ||||| || || || ||||| || || |||||||  |||||||| 
Sbjct: 262 cttcagctagctattcgtggggatgaagaacttgatacactaatcaaggcaaccattgcg 321

                
Query: 514 ggtgg 518
           |||||
Sbjct: 322 ggtgg 326



to top

>ref|XR_003857.1| PREDICTED: Mus musculus hypothetical LOC631864 (LOC631864), mRNA
          Length = 988

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 101/125 (80%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| ||| |||| |||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 341 aaggtaaagtgtattacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 400

                                                                       
Query: 487 gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
           ||  | || ||||| |  ||||||||||||||  |||| ||||||||||||||||| || 
Sbjct: 401 gattctctgatcaaagctaccattgctggtggttgtgtcatcccacacatccacaaatcg 460

                
Query: 547 ctgat 551
           |||||
Sbjct: 461 ctgat 465



to top

>gb|AY147422.1| Drosophila rufa isolate YY001328 histone H2A gene, partial cds;
           H2A/H2B intergenic spacer region, complete sequence; and
           histone H2B gene, partial cds
          Length = 486

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 265 gccgggctccagttccctgttggccgtatccatcgtc 301
           ||||| |||||||||||||| ||||||||||||||||
Sbjct: 72  gccggactccagttccctgtcggccgtatccatcgtc 36



to top

>emb|CT025399.2| Xenopus tropicalis finished cDNA, clone TGas068j09
          Length = 4117

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                        
Query: 388  gaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccct 447
            |||||||| ||  ||||||| || |||  ||| ||||| |||||||||||||||| ||| 
Sbjct: 3628 gaggttcttgaattggctggaaatgcttccaaagatcttaaggtgaagcgtatcagccca 3687

                                 
Query: 448  cgtcacctgcagctggccatc 468
            |||||| ||||||| ||||||
Sbjct: 3688 cgtcacttgcagcttgccatc 3708



to top

>gb|AC055772.16| Mus musculus chromosome 12, clone RP23-291K4, complete sequence
          Length = 168350

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 101/125 (80%)
 Strand = Plus / Plus

                                                                          
Query: 427    aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
              ||||| ||| |||| |||||||||||| ||||||| || || |||||||| || ||  | 
Sbjct: 111348 aaggtaaagtgtattacccctcgtcacttgcagcttgctatacgtggagatgaagaattg 111407

                                                                          
Query: 487    gacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtcc 546
              ||  | || ||||| |  ||||||||||||||  |||| ||||||||||||||||| || 
Sbjct: 111408 gattctctgatcaaagctaccattgctggtggttgtgtcatcccacacatccacaaatcg 111467

                   
Query: 547    ctgat 551
              |||||
Sbjct: 111468 ctgat 111472



to top

>ref|NM_001005097.1| Xenopus tropicalis MGC89861 protein (MGC89861), mRNA
          Length = 881

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                       
Query: 388 gaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccct 447
           |||||||| ||  ||||||| || |||  ||| ||||| |||||||||||||||| ||| 
Sbjct: 263 gaggttcttgaattggctggaaatgcttccaaagatcttaaggtgaagcgtatcagccca 322

                                
Query: 448 cgtcacctgcagctggccatc 468
           |||||| ||||||| ||||||
Sbjct: 323 cgtcacttgcagcttgccatc 343



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 505 accattgctggtggaggtgtgatcccacacatccacaagtc 545
           |||||||||||||| || || || |||||||| ||||||||
Sbjct: 380 accattgctggtggtggagtcattccacacatacacaagtc 420



to top

>emb|CR761793.2| Xenopus tropicalis finished cDNA, clone TGas044m04
          Length = 841

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                       
Query: 388 gaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccct 447
           |||||||| ||  ||||||| || |||  ||| ||||| |||||||||||||||| ||| 
Sbjct: 239 gaggttcttgaattggctggaaatgcttccaaagatcttaaggtgaagcgtatcagccca 298

                                
Query: 448 cgtcacctgcagctggccatc 468
           |||||| ||||||| ||||||
Sbjct: 299 cgtcacttgcagcttgccatc 319



to top

>emb|CR761734.2| Xenopus tropicalis finished cDNA, clone TGas104o01
          Length = 864

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                       
Query: 388 gaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccct 447
           |||||||| ||  ||||||| || |||  ||| ||||| |||||||||||||||| ||| 
Sbjct: 241 gaggttcttgaattggctggaaatgcttccaaagatcttaaggtgaagcgtatcagccca 300

                                
Query: 448 cgtcacctgcagctggccatc 468
           |||||| ||||||| ||||||
Sbjct: 301 cgtcacttgcagcttgccatc 321



 Score = 42.1 bits (21), Expect = 2.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 505 accattgctggtggaggtgtgatcccacacatccacaagtc 545
           |||||||||||||| || || || |||||||| ||||||||
Sbjct: 358 accattgctggtggtggagtcattccacacatacacaagtc 398



to top

>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds
          Length = 2132

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 373 gagtacctgacggccgaggttctggagctggctgggaacgc 413
           ||||||||||| || |||||||||||||||||||| |||||
Sbjct: 662 gagtacctgactgctgaggttctggagctggctggcaacgc 622



to top

>ref|XM_871500.1| PREDICTED: Bos taurus similar to Histone H2A.o (H2A/o) (H2A.2)
           (H2a-615) (LOC619178), mRNA
          Length = 487

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 439 atcacccctcgtcacctgcagctggccatccg 470
           |||| |||||||||||||||||||||||||||
Sbjct: 258 atcatccctcgtcacctgcagctggccatccg 289



to top

>ref|XM_614586.2| PREDICTED: Bos taurus similar to Histone H2A.o (H2A/o) (H2A.2)
           (H2a-615) (LOC541108), mRNA
          Length = 508

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 439 atcacccctcgtcacctgcagctggccatccg 470
           |||| |||||||||||||||||||||||||||
Sbjct: 279 atcatccctcgtcacctgcagctggccatccg 310



to top

>ref|XM_869001.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616875), mRNA
          Length = 449

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 439 atcacccctcgtcacctgcagctggccatccg 470
           |||| |||||||||||||||||||||||||||
Sbjct: 236 atcatccctcgtcacctgcagctggccatccg 267



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 373 gagtacctgacggccgaggttctggagctggctgggaacgc 413
           |||||||||||||||||| | ||||||||||| || |||||
Sbjct: 170 gagtacctgacggccgagatcctggagctggcgggcaacgc 210



to top

>ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
           (LOC615056), mRNA
          Length = 1029

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 439 atcacccctcgtcacctgcagctggccatccg 470
           |||| |||||||||||||||||||||||||||
Sbjct: 82  atcatccctcgtcacctgcagctggccatccg 113



to top

>ref|XM_591391.2| PREDICTED: Bos taurus similar to Histone H2A.o (H2A/o) (H2A.2)
           (H2a-615) (LOC513666), mRNA
          Length = 563

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 439 atcacccctcgtcacctgcagctggccatccg 470
           |||| |||||||||||||||||||||||||||
Sbjct: 282 atcatccctcgtcacctgcagctggccatccg 313



to top

>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA
          Length = 1754

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 439 atcacccctcgtcacctgcagctggccatccg 470
           |||| |||||||||||||||||||||||||||
Sbjct: 252 atcatccctcgtcacctgcagctggccatccg 283



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 373 gagtacctgacggccgaggttctggagctggctgggaacgc 413
           |||||||||||||||||| | ||||||||||| || |||||
Sbjct: 186 gagtacctgacggccgagatcctggagctggcgggcaacgc 226



to top

>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence
          Length = 205659

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                              
Query: 439    atcacccctcgtcacctgcagctggccatccg 470
              |||| |||||||||||||||||||||||||||
Sbjct: 108709 atcatccctcgtcacctgcagctggccatccg 108678



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                       
Query: 373    gagtacctgacggccgaggttctggagctggctgggaacgc 413
              |||||||||||||||||| | ||||||||||| || |||||
Sbjct: 108775 gagtacctgacggccgagatcctggagctggcgggcaacgc 108735



to top

>ref|NM_001038197.1| Bos taurus H2A histone family, member V (H2AFV), mRNA
          Length = 742

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 151/192 (78%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || ||   |||
Sbjct: 229 tgctgcaattctggagtacctcactgctgaggtgctggagctggcaggtaatgcatccaa 288

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||| ||||| || || ||| ||||||| || |||||||| || ||
Sbjct: 289 ggatctcaaagttaagcggatcactccacgccacttgcagcttgcaatccgtggtgatga 348

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || ||||| |  ||||| ||||| || || |||||||| ||||||||
Sbjct: 349 agagttggattctcttatcaaagctaccatagctgggggtggagtgatccctcacatcca 408

                       
Query: 540 caagtccctgat 551
           |||||| |||||
Sbjct: 409 caagtctctgat 420



to top

>ref|XM_848163.1| PREDICTED: Canis familiaris similar to Histone H2A.x (H2a/x)
           (LOC489372), mRNA
          Length = 841

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 370 ctcgagtacctgacggccgaggttctggagctggctgggaacgc 413
           ||||||||||||||||||||| | ||||||||||| || |||||
Sbjct: 463 ctcgagtacctgacggccgagatcctggagctggcgggcaacgc 506



 Score = 44.1 bits (22), Expect = 0.55
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 253 cgctcgtcccgcgccgggctccagttccctgttggccg 290
           |||||||| |||||||| ||||||||||| || |||||
Sbjct: 349 cgctcgtcgcgcgccggcctccagttccccgtgggccg 386



 Score = 40.1 bits (20), Expect = 8.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 451 cacctgcagctggccatccg 470
           ||||||||||||||||||||
Sbjct: 544 cacctgcagctggccatccg 563



to top

>emb|AJ306721.1|PPI306721 Pinus pinaster mRNA for putative histone H2A
          Length = 716

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 388 gaggttctggagctggctgggaacgctagcaaggatctgaaggtgaagcgtatcacccct 447
           |||||| ||||| |||| || || || ||||| ||||||||||| |||||||||||||||
Sbjct: 313 gaggttttggagttggcaggaaatgcaagcaaagatctgaaggtcaagcgtatcacccct 372



to top

>gb|BC109673.1| Bos taurus cDNA clone MGC:133654 IMAGE:8054570, complete cds
          Length = 781

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 151/192 (78%)
 Strand = Plus / Plus

                                                                       
Query: 360 tgctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaa 419
           |||||| || || |||||||| || || ||||| ||||||||||| || || ||   |||
Sbjct: 268 tgctgcaattctggagtacctcactgctgaggtgctggagctggcaggtaatgcatccaa 327

                                                                       
Query: 420 ggatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacga 479
           |||||| || || ||||| ||||| || || ||| ||||||| || |||||||| || ||
Sbjct: 328 ggatctcaaagttaagcggatcactccacgccacttgcagcttgcaatccgtggtgatga 387

                                                                       
Query: 480 ggagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatcca 539
            ||| | ||  | || ||||| |  ||||| ||||| || || |||||||| ||||||||
Sbjct: 388 agagttggattctcttatcaaagctaccatagctgggggtggagtgatccctcacatcca 447

                       
Query: 540 caagtccctgat 551
           |||||| |||||
Sbjct: 448 caagtctctgat 459



to top

>dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130307C13 product:HISTONE H2A homolog
           [Gallus gallus], full insert sequence
          Length = 1754

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 439 atcacccctcgtcacctgcagctggccatccg 470
           |||| |||||||||||||||||||||||||||
Sbjct: 252 atcatccctcgtcacctgcagctggccatccg 283



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 373 gagtacctgacggccgaggttctggagctggctgggaacgc 413
           |||||||||||||||||| | ||||||||||| || |||||
Sbjct: 186 gagtacctgacggccgagatcctggagctggcgggcaacgc 226



to top

>gb|L17501.1|MIRHIS2AF3 Mirounga leonina histone H2AF gene, exon 4 (3' end)
          Length = 338

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 427 aaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgaggagctt 486
           ||||| |||||||| |||||||||||| |||| || || || |||||||| || ||  | 
Sbjct: 1   aaggtaaagcgtattacccctcgtcacttgcaacttgctattcgtggagatgaagaattg 60

                                           
Query: 487 gacaccctcatcaagggcaccattgctggtgg 518
           ||| | ||||||||||  ||||||||||||||
Sbjct: 61  gactctctcatcaaggctaccattgctggtgg 92



to top

>gb|AC150773.2| Xenopus tropicalis clone CH216-69F7, complete sequence
          Length = 115925

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                             
Query: 421   gatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatc 468
             ||||| |||||||||||||||| ||| |||||| ||||||| ||||||
Sbjct: 38899 gatcttaaggtgaagcgtatcagcccacgtcacttgcagcttgccatc 38852



to top

>gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone
           MGC:118637 IMAGE:1383389), complete cds
          Length = 587

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 439 atcacccctcgtcacctgcagctggccatccg 470
           |||| |||||||||||||||||||||||||||
Sbjct: 309 atcatccctcgtcacctgcagctggccatccg 340



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 373 gagtacctgacggccgaggttctggagctggctgggaacgc 413
           |||||||||||||||||| | ||||||||||| || |||||
Sbjct: 243 gagtacctgacggccgagatcctggagctggcgggcaacgc 283



to top

>ref|XM_509711.1| PREDICTED: Pan troglodytes similar to H2A histone family, member Z
           (LOC452636), mRNA
          Length = 387

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 493 ctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctgat 551
           ||||||||||  || ||||||||||| ||||| || |||||||||||||| || |||||
Sbjct: 298 ctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatctctgat 356



to top

>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence
          Length = 719

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 368 tcctcgagtacctgacggccgaggttctggagctggctgggaacgct 414
           |||||||||||||| | |||||||| ||||||||||| || ||||||
Sbjct: 296 tcctcgagtacctggccgccgaggtgctggagctggccggcaacgct 342



to top

>ref|XM_430420.1| PREDICTED: Gallus gallus hypothetical gene supported by V00414
           (LOC426617), partial mRNA
          Length = 515

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                       
Query: 361 gctgctatcctcgagtacctgacggccgaggttctggagctggctgggaacgctagcaag 420
           ||||| ||||||||||| || || || ||||| |||||| |||| || |||||   ||||
Sbjct: 419 gctgccatcctcgagtatctcactgctgaggtcctggagttggcaggcaacgcctccaag 478

                                  
Query: 421 gatctgaaggtgaagcgtatcac 443
           || |||||||||||||| |||||
Sbjct: 479 gacctgaaggtgaagcgcatcac 501



to top

>ref|XM_989419.1| PREDICTED: Mus musculus H2A histone family, member V (H2afv), mRNA
          Length = 964

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 421 gatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgag 480
           ||||| || |||||||| |||||||| |||||| | ||||| || ||||| || || || 
Sbjct: 451 gatctcaaagtgaagcgcatcaccccacgtcacttacagcttgcaatccgcggtgatgaa 510

                                                                       
Query: 481 gagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccac 540
           ||| | ||  | || ||||||| |||||| || || || || |||||||| |||||||||
Sbjct: 511 gagttggattctcttatcaaggccaccatagccgggggcggcgtgatcccgcacatccac 570

                      
Query: 541 aagtccctgat 551
           ||||| |||||
Sbjct: 571 aagtctctgat 581



to top

>ref|XM_907680.2| PREDICTED: Mus musculus H2A histone family, member V (H2afv), mRNA
          Length = 1633

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 421 gatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgag 480
           ||||| || |||||||| |||||||| |||||| | ||||| || ||||| || || || 
Sbjct: 326 gatctcaaagtgaagcgcatcaccccacgtcacttacagcttgcaatccgcggtgatgaa 385

                                                                       
Query: 481 gagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccac 540
           ||| | ||  | || ||||||| |||||| || || || || |||||||| |||||||||
Sbjct: 386 gagttggattctcttatcaaggccaccatagccgggggcggcgtgatcccgcacatccac 445

                      
Query: 541 aagtccctgat 551
           ||||| |||||
Sbjct: 446 aagtctctgat 456



to top

>ref|XM_126043.7| PREDICTED: Mus musculus H2A histone family, member V (H2afv), mRNA
          Length = 839

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 421 gatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgag 480
           ||||| || |||||||| |||||||| |||||| | ||||| || ||||| || || || 
Sbjct: 326 gatctcaaagtgaagcgcatcaccccacgtcacttacagcttgcaatccgcggtgatgaa 385

                                                                       
Query: 481 gagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccac 540
           ||| | ||  | || ||||||| |||||| || || || || |||||||| |||||||||
Sbjct: 386 gagttggattctcttatcaaggccaccatagccgggggcggcgtgatcccgcacatccac 445

                      
Query: 541 aagtccctgat 551
           ||||| |||||
Sbjct: 446 aagtctctgat 456



to top

>emb|AL160155.19| Human DNA sequence from clone RP11-461N23 on chromosome 13 Contains
             part of a novel gene (FLJ30001), a H2A histone family,
             pseudogene, the GPR18 gene for G protein-coupled receptor
             18, the EBI2 gene for Epstein-Barr virus induced gene 2
             (lymphocyte-specific G protein-coupled receptor), two
             novel genes and a CpG island, complete sequence
          Length = 149478

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                        
Query: 493   ctcatcaagggcaccattgctggtggaggtgtgatcccacacatccacaagtccctgat 551
             ||||||||||  || ||||||||||| ||||| || |||||||||||||| || |||||
Sbjct: 12803 ctcatcaaggctacaattgctggtggtggtgtcattccacacatccacaaatctctgat 12745



to top

>emb|AL161536.2|ATCHRIV36 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 36
          Length = 199634

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                          
Query: 455    tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
              ||||| |||| ||| | ||||| || ||||||||||| |||||||| || || |||  ||
Sbjct: 172318 tgcagttggcgatcagaggagatgaagagcttgacacactcatcaaaggaacaattattg 172377

                                             
Query: 515    gtggaggtgtgatcccacacatccacaagtc 545
              | ||| |||||||||| ||||||||| ||||
Sbjct: 172378 gaggaagtgtgatccctcacatccactagtc 172408



to top

>emb|AL049656.1|ATT6G15 Arabidopsis thaliana DNA chromosome 4, BAC clone  T6G15 (ESSA project)
          Length = 113970

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                         
Query: 455   tgcagctggccatccgtggagacgaggagcttgacaccctcatcaagggcaccattgctg 514
             ||||| |||| ||| | ||||| || ||||||||||| |||||||| || || |||  ||
Sbjct: 70110 tgcagttggcgatcagaggagatgaagagcttgacacactcatcaaaggaacaattattg 70169

                                            
Query: 515   gtggaggtgtgatcccacacatccacaagtc 545
             | ||| |||||||||| ||||||||| ||||
Sbjct: 70170 gaggaagtgtgatccctcacatccactagtc 70200



to top

>dbj|AK155105.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630201N14
           product:H2A histone family, member V, full insert
           sequence
          Length = 721

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 421 gatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgag 480
           ||||| || |||||||| |||||||| |||||| | ||||| || ||||| || || || 
Sbjct: 333 gatctcaaagtgaagcgcatcaccccacgtcacttacagcttgcaatccgcggtgatgaa 392

                                                                       
Query: 481 gagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccac 540
           ||| | ||  | || ||||||| |||||| || || || || |||||||| |||||||||
Sbjct: 393 gagttggattctcttatcaaggccaccatagccgggggcggcgtgatcccgcacatccac 452

                      
Query: 541 aagtccctgat 551
           ||||| |||||
Sbjct: 453 aagtctctgat 463



to top

>dbj|AK168110.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730057M16 product:H2A histone family,
           member V, full insert sequence
          Length = 690

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 421 gatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgag 480
           ||||| || |||||||| |||||||| |||||| | ||||| || ||||| || || || 
Sbjct: 302 gatctcaaagtgaagcgcatcaccccacgtcacttacagcttgcaatccgcggtgatgaa 361

                                                                       
Query: 481 gagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccac 540
           ||| | ||  | || ||||||| |||||| || || || || |||||||| |||||||||
Sbjct: 362 gagttggattctcttatcaaggccaccatagccgggggcggcgtgatcccgcacatccac 421

                      
Query: 541 aagtccctgat 551
           ||||| |||||
Sbjct: 422 aagtctctgat 432



to top

>dbj|AK021267.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:C530002L11 product:HISTONE H2A.F
           homolog [Homo sapiens], full insert sequence
          Length = 641

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 421 gatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgag 480
           ||||| || |||||||| |||||||| |||||| | ||||| || ||||| || || || 
Sbjct: 253 gatctcaaagtgaagcgcatcaccccacgtcacttacagcttgcaatccgcggtgatgaa 312

                                                                       
Query: 481 gagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccac 540
           ||| | ||  | || ||||||| |||||| || || || || |||||||| |||||||||
Sbjct: 313 gagttggattctcttatcaaggccaccatagccgggggcggcgtgatcccgcacatccac 372

                      
Query: 541 aagtccctgat 551
           ||||| |||||
Sbjct: 373 aagtctctgat 383



to top

>gb|AY103710.1| Zea mays PCO123562 mRNA sequence
          Length = 770

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 368 tcctcgagtacctgacggccgaggttctggagctggctgggaacgct 414
           |||||||||||||| | |||||||| ||||||||||| || ||||||
Sbjct: 296 tcctcgagtacctggccgccgaggtgctggagctggccggcaacgct 342



to top

>gb|BC028539.1| Mus musculus H2A histone family, member V, mRNA (cDNA clone
           IMAGE:3369668), complete cds
          Length = 535

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 421 gatctgaaggtgaagcgtatcacccctcgtcacctgcagctggccatccgtggagacgag 480
           ||||| || |||||||| |||||||| |||||| | ||||| || ||||| || || || 
Sbjct: 125 gatctcaaagtgaagcgcatcaccccacgtcacttacagcttgcaatccgcggtgatgaa 184

                                                                       
Query: 481 gagcttgacaccctcatcaagggcaccattgctggtggaggtgtgatcccacacatccac 540
           ||| | ||  | || ||||||| |||||| || || || || |||||||| |||||||||
Sbjct: 185 gagttggattctcttatcaaggccaccatagccgggggcggcgtgatcccgcacatccac 244

                      
Query: 541 aagtccctgat 551
           ||||| |||||
Sbjct: 245 aagtctctgat 255


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,419,134
Number of Sequences: 3902068
Number of extensions: 4419134
Number of successful extensions: 123631
Number of sequences better than 10.0: 793
Number of HSP's better than 10.0 without gapping: 799
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 120942
Number of HSP's gapped (non-prelim): 2629
length of query: 634
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 611
effective length of database: 17,143,297,704
effective search space: 10474554897144
effective search space used: 10474554897144
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top