>gb|AC093509.3| Homo sapiens chromosome 16 clone CTD-2337L2, complete sequence
          Length = 120592

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 128   atcagtgattcttccagtgtg 148
             |||||||||||||||||||||
Sbjct: 40589 atcagtgattcttccagtgtg 40609

>gb|AC164660.3| Pan troglodytes BAC clone CH251-50D16 from chromosome unknown, complete
             sequence
          Length = 246546

 Score = 42.1 bits (21), Expect = 0.73
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 128   atcagtgattcttccagtgtg 148
             |||||||||||||||||||||
Sbjct: 41760 atcagtgattcttccagtgtg 41740

>emb|AL445471.13| Human DNA sequence from clone RP11-84D1 on chromosome 1 Contains the
            5' end of the RUNX3 gene for runt-related transcription
            factor 3 and a novel gene, complete sequence
          Length = 10805

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 91   cctggcaacaatggtggtgg 110
            ||||||||||||||||||||
Sbjct: 5530 cctggcaacaatggtggtgg 5511

>emb|BX927148.1| Corynebacterium glutamicum ATCC 13032, IS fingerprint type 4-5, complete
              genome; segment 1/10
          Length = 348071

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 47     catgctggaaatctgagcagctggttta 74
              |||||||||||||| |||||||| ||||
Sbjct: 133776 catgctggaaatctcagcagctgattta 133749

>gb|AC092643.2| Homo sapiens BAC clone RP11-393P9 from 4, complete sequence
          Length = 151902

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   gattaacaaaggcagctgtg 194
             ||||||||||||||||||||
Sbjct: 52121 gattaacaaaggcagctgtg 52140

>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome
          Length = 3309401

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 47     catgctggaaatctgagcagctggttta 74
              |||||||||||||| |||||||| ||||
Sbjct: 133775 catgctggaaatctcagcagctgattta 133748

>emb|AJ238394.1|HSA238394 Homo sapiens AML2 gene (partial)
          Length = 7338

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 91   cctggcaacaatggtggtgg 110
            ||||||||||||||||||||
Sbjct: 1782 cctggcaacaatggtggtgg 1801


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,980,124
Number of Sequences: 3902068
Number of extensions: 1980124
Number of successful extensions: 131068
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 131031
Number of HSP's gapped (non-prelim): 37
length of query: 226
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 204
effective length of database: 17,147,199,772
effective search space: 3498028753488
effective search space used: 3498028753488
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)