ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | basd21a16 |
|---|---|
| Clone Library Name | barley_pub |
>gb|M28059.1|WHTUBE2 Wheat ubiquitin carrier protein (E2) mRNA, complete cds Length = 965 Score = 131 bits (66), Expect = 2e-27 Identities = 78/82 (95%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttcttcgtccac 317 ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 97 atgatgagtgactacaaggtggacatgatcaacgacgggatgcacgagttcttcgtccac 156 Query: 318 ttccacggaccaaacgacagta 339 ||||||||||| || ||||||| Sbjct: 157 ttccacggacccaaagacagta 178 Score = 83.8 bits (42), Expect = 4e-13 Identities = 45/46 (97%) Strand = Plus / Plus Query: 112 catgtcttccccaagcaagcggagggagatggatctcatgaagctg 157 ||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 51 catgtcttccccaagcaagcgcagggagatggatctcatgaagctg 96
>gb|BT016989.1| Zea mays clone EK07D2304F01.c mRNA sequence Length = 789 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttcttcgtc 314 |||||||| || ||||||||||| ||| | ||||||||||||||||| ||||||||| Sbjct: 102 atgatgagcgactacaaggtggagatggtgaacgacgggatgcaggaattcttcgtc 158
>ref|NM_196743.1| Oryza sativa (japonica cultivar-group) putative acetohydroxyacid isomeroreductase (OSJNBa0094K20.18), mRNA Length = 588 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttcttcgt 313 |||||||| || ||||||||||| ||| | ||||| |||||||||||||||||||| Sbjct: 46 atgatgagcgactacaaggtggagatggtgaacgatgggatgcaggagttcttcgt 101
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttcttcgt 313 |||||||| || ||||||||||| ||| | ||||| |||||||||||||||||||| Sbjct: 15667099 atgatgagcgactacaaggtggagatggtgaacgatgggatgcaggagttcttcgt 15667154 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22340618 atccatccatccatccatcc 22340637 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22340614 atccatccatccatccatcc 22340633 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 176 tccatccatccatccatcct 195 |||||||||||||||||||| Sbjct: 22339568 tccatccatccatccatcct 22339549 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18908563 atccatccatccatccatcc 18908582 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18756065 atccatccatccatccatcc 18756046 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatc 193 |||||||||||||||||||| Sbjct: 18603584 aatccatccatccatccatc 18603603 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 4068807 atccatccatccatccatcc 4068788
>gb|AC025907.2|AC025907 Oryza sativa (japonica cultivar-group) chromosome 10 clone nbxb0094K20, complete sequence Length = 193119 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttcttcgt 313 |||||||| || ||||||||||| ||| | ||||| |||||||||||||||||||| Sbjct: 154465 atgatgagcgactacaaggtggagatggtgaacgatgggatgcaggagttcttcgt 154520
>dbj|AK120481.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112B17, full insert sequence Length = 579 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttcttcgt 313 |||||||| || ||||||||||| ||| | ||||| |||||||||||||||||||| Sbjct: 219 atgatgagcgactacaaggtggagatggtgaacgatgggatgcaggagttcttcgt 274
>dbj|AK066993.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091F02, full insert sequence Length = 3411 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttcttcgt 313 |||||||| || ||||||||||| ||| | ||||| |||||||||||||||||||| Sbjct: 251 atgatgagcgactacaaggtggagatggtgaacgatgggatgcaggagttcttcgt 306
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 63.9 bits (32), Expect = 4e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttcttcgt 313 |||||||| || ||||||||||| ||| | ||||| |||||||||||||||||||| Sbjct: 15675340 atgatgagcgactacaaggtggagatggtgaacgatgggatgcaggagttcttcgt 15675395 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22352686 atccatccatccatccatcc 22352705 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22352682 atccatccatccatccatcc 22352701 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 176 tccatccatccatccatcct 195 |||||||||||||||||||| Sbjct: 22351636 tccatccatccatccatcct 22351617 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18919817 atccatccatccatccatcc 18919836 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18766919 atccatccatccatccatcc 18766900 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatc 193 |||||||||||||||||||| Sbjct: 18614437 aatccatccatccatccatc 18614456 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 4069628 atccatccatccatccatcc 4069609
>ref|NM_105055.2| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like activating enzyme AT1G63800 mRNA, complete cds Length = 907 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttctt 310 ||||||||||| ||||||||||| |||||||| || || ||||| |||||||| Sbjct: 123 atgatgagtgactacaaggtggagatgatcaatgatggcatgcaagagttctt 175
>gb|AY114061.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme UBC5 (At1g63800) mRNA, complete cds Length = 589 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttctt 310 ||||||||||| ||||||||||| |||||||| || || ||||| |||||||| Sbjct: 46 atgatgagtgactacaaggtggagatgatcaatgatggcatgcaagagttctt 98
>gb|AY074347.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme UBC5 (At1g63800) mRNA, complete cds Length = 915 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttctt 310 ||||||||||| ||||||||||| |||||||| || || ||||| |||||||| Sbjct: 125 atgatgagtgactacaaggtggagatgatcaatgatggcatgcaagagttctt 177
>gb|AC010852.7|AC010852 Arabidopsis thaliana chromosome 1 BAC T12P18 genomic sequence, complete sequence Length = 79469 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttctt 310 ||||||||||| ||||||||||| |||||||| || || ||||| |||||||| Sbjct: 71876 atgatgagtgactacaaggtggagatgatcaatgatggcatgcaagagttctt 71928
>gb|AY103864.1| Zea mays PCO154745 mRNA sequence Length = 906 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttcttcgtc 314 |||||||| || ||||||||||| ||| | ||||| ||||||||||| ||||||||| Sbjct: 239 atgatgagcgactacaaggtggagatggtgaacgatgggatgcaggaattcttcgtc 295
>gb|DQ027020.1| Arabidopsis thaliana ubiquitinating enzyme (At1g63800) mRNA, complete cds Length = 558 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttctt 310 ||||||||||| ||||||||||| |||||||| || || ||||| |||||||| Sbjct: 46 atgatgagtgactacaaggtggagatgatcaatgatggcatgcaagagttctt 98
>gb|L19356.1|ATHUBIQUF Arabidopsis thaliana ubiquitin conjugating enzyme (UBC5) gene, complete cds Length = 1888 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtggacatgatcaacgacgggatgcaggagttctt 310 ||||||||||| ||||||||||| |||||||| || || ||||| |||||||| Sbjct: 725 atgatgagtgactacaaggtggagatgatcaatgatggcatgcaagagttctt 777
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 56.0 bits (28), Expect = 9e-05 Identities = 28/28 (100%) Strand = Plus / Plus Query: 167 cctaccaaatccatccatccatccatcc 194 |||||||||||||||||||||||||||| Sbjct: 3839739 cctaccaaatccatccatccatccatcc 3839766 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 170 accaaatccatccatccatccatcc 194 |||| |||||||||||||||||||| Sbjct: 724992 accacatccatccatccatccatcc 725016 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27379987 atccatccatccatccatcc 27380006 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 25801365 atccatccatccatccatcc 25801346 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17990848 atccatccatccatccatcc 17990829 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 14547996 atccatccatccatccatcc 14547977 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 725005 atccatccatccatccatcc 725024 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 725001 atccatccatccatccatcc 725020
>gb|AY111755.1| Zea mays CL20312_1 mRNA sequence Length = 907 Score = 56.0 bits (28), Expect = 9e-05 Identities = 40/44 (90%) Strand = Plus / Plus Query: 113 atgtcttccccaagcaagcggagggagatggatctcatgaagct 156 |||||||| ||||||||||| |||||||||| ||||||||||| Sbjct: 108 atgtcttctccaagcaagcgccgggagatggacctcatgaagct 151 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Plus Query: 261 atgagtgattacaaggtggacatgatcaacgacgggatgcaggagttctt 310 ||||| || ||||||||||| ||| | ||||| ||||||||||||||||| Sbjct: 156 atgagcgactacaaggtggatatggtgaacgatgggatgcaggagttctt 205
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 56.0 bits (28), Expect = 9e-05 Identities = 28/28 (100%) Strand = Plus / Plus Query: 167 cctaccaaatccatccatccatccatcc 194 |||||||||||||||||||||||||||| Sbjct: 3839713 cctaccaaatccatccatccatccatcc 3839740 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 170 accaaatccatccatccatccatcc 194 |||| |||||||||||||||||||| Sbjct: 724992 accacatccatccatccatccatcc 725016 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27305587 atccatccatccatccatcc 27305606 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 25729541 atccatccatccatccatcc 25729522 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17917169 atccatccatccatccatcc 17917150 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 14502280 atccatccatccatccatcc 14502261 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 725005 atccatccatccatccatcc 725024 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 725001 atccatccatccatccatcc 725020
>emb|AL732638.6|CNS08C9D Oryza sativa chromosome 12, . Partial sequence from BAC OSJNBa0010K22 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 92728 Score = 56.0 bits (28), Expect = 9e-05 Identities = 28/28 (100%) Strand = Plus / Minus Query: 167 cctaccaaatccatccatccatccatcc 194 |||||||||||||||||||||||||||| Sbjct: 306 cctaccaaatccatccatccatccatcc 279
>emb|AL732376.2|CNS08C8Z Oryza sativa chromosome 12, . BAC OSJNBa0086B10 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 152090 Score = 56.0 bits (28), Expect = 9e-05 Identities = 28/28 (100%) Strand = Plus / Plus Query: 167 cctaccaaatccatccatccatccatcc 194 |||||||||||||||||||||||||||| Sbjct: 1715 cctaccaaatccatccatccatccatcc 1742
>gb|AC073548.5| Homo sapiens chromosome 19 clone RP11-43N16, complete sequence Length = 167722 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctcct 201 ||||||||||||||||||||||||||| Sbjct: 51766 atccatccatccatccatcctcctcct 51740 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 51770 atccatccatccatccatcc 51751
>gb|AC113977.16| Mus musculus chromosome 1, clone RP23-161E13, complete sequence Length = 235738 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctc 199 ||||||||||||||||||||||||| Sbjct: 87353 atccatccatccatccatcctcctc 87329 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 27483 atccatccatccatccatcct 27503 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87361 atccatccatccatccatcc 87342 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87357 atccatccatccatccatcc 87338 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27479 atccatccatccatccatcc 27498
>emb|BX927396.13| Zebrafish DNA sequence from clone DKEY-216H18 in linkage group 9, complete sequence Length = 115853 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctccttc 203 |||||||||||||||||||| |||||||| Sbjct: 110407 atccatccatccatccatccacctccttc 110379 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 110476 atccatccatccatccatcct 110456 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 110764 atccatccatccatccatcc 110745 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 110628 atccatccatccatccatcc 110609 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 110624 atccatccatccatccatcc 110605 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 110484 atccatccatccatccatcc 110465 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 110480 atccatccatccatccatcc 110461 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 110419 atccatccatccatccatcc 110400 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 110415 atccatccatccatccatcc 110396 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 110411 atccatccatccatccatcc 110392
>emb|BX005001.6| Zebrafish DNA sequence from clone DKEY-202E22 in linkage group 21, complete sequence Length = 159375 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctc 199 ||||||||||||||||||||||||| Sbjct: 118422 atccatccatccatccatcctcctc 118398 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctc 199 ||||||||||||||||||||||||| Sbjct: 118326 atccatccatccatccatcctcctc 118302 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 51798 atccatccatccatccatcct 51778 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 51818 atccatccatccatccatcc 51799 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 51814 atccatccatccatccatcc 51795 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 51810 atccatccatccatccatcc 51791 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 51806 atccatccatccatccatcc 51787 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 51802 atccatccatccatccatcc 51783
>emb|AL645791.14| Mouse DNA sequence from clone RP23-465A12 on chromosome 11, complete sequence Length = 200883 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 171 ccaaatccatccatccatccatcct 195 ||||||||||||||||||||||||| Sbjct: 184617 ccaaatccatccatccatccatcct 184593
>gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, complete sequence Length = 201694 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 15273 atccatccatccatccatcctcct 15296 Score = 44.1 bits (22), Expect = 0.36 Identities = 29/30 (96%), Gaps = 1/30 (3%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc-tcctccttc 203 |||||||||||||||||||| ||||||||| Sbjct: 15269 atccatccatccatccatccatcctccttc 15298 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 42605 atccatccatccatccatcct 42625 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 180397 atccatccatccatccatcc 180416 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 180393 atccatccatccatccatcc 180412 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 180389 atccatccatccatccatcc 180408 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 180385 atccatccatccatccatcc 180404 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 180381 atccatccatccatccatcc 180400 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 180377 atccatccatccatccatcc 180396 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 180373 atccatccatccatccatcc 180392 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131324 atccatccatccatccatcc 131343 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131320 atccatccatccatccatcc 131339 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131316 atccatccatccatccatcc 131335 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131312 atccatccatccatccatcc 131331 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131308 atccatccatccatccatcc 131327 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58190 atccatccatccatccatcc 58171 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15265 atccatccatccatccatcc 15284 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15261 atccatccatccatccatcc 15280 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15257 atccatccatccatccatcc 15276 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7054 atccatccatccatccatcc 7035 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7050 atccatccatccatccatcc 7031 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7046 atccatccatccatccatcc 7027 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7042 atccatccatccatccatcc 7023 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7038 atccatccatccatccatcc 7019 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7034 atccatccatccatccatcc 7015 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6876 atccatccatccatccatcc 6857 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6872 atccatccatccatccatcc 6853 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6868 atccatccatccatccatcc 6849 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6864 atccatccatccatccatcc 6845
>gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 8, complete sequence Length = 1194300 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 203683 atccatccatccatccatcctcct 203706
>gb|AC145205.2| Homo sapiens chromosome 17, clone RP11-1224M18, complete sequence Length = 81310 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 2543 atccatccatccatccatcctcct 2520 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 2659 atccatccatccatccatcctcc 2637 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 179 atccatccatccatcctcct 198 |||||||||||||||||||| Sbjct: 2726 atccatccatccatcctcct 2707 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2683 atccatccatccatccatcc 2664 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2679 atccatccatccatccatcc 2660 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2675 atccatccatccatccatcc 2656 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2671 atccatccatccatccatcc 2652 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2667 atccatccatccatccatcc 2648 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2663 atccatccatccatccatcc 2644 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2547 atccatccatccatccatcc 2528 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 179 atccatccatccatcctcct 198 |||||||||||||||||||| Sbjct: 2472 atccatccatccatcctcct 2453
>gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, complete sequence Length = 152414 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 130517 atccatccatccatccatcctcct 130540 Score = 44.1 bits (22), Expect = 0.36 Identities = 29/30 (96%), Gaps = 1/30 (3%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc-tcctccttc 203 |||||||||||||||||||| ||||||||| Sbjct: 130513 atccatccatccatccatccatcctccttc 130542 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctc 196 |||||||||||||||||||||| Sbjct: 106747 atccatccatccatccatcctc 106768 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130509 atccatccatccatccatcc 130528 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130505 atccatccatccatccatcc 130524 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130501 atccatccatccatccatcc 130520 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122298 atccatccatccatccatcc 122279 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122294 atccatccatccatccatcc 122275 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122290 atccatccatccatccatcc 122271 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122286 atccatccatccatccatcc 122267 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122282 atccatccatccatccatcc 122263 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122278 atccatccatccatccatcc 122259 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122120 atccatccatccatccatcc 122101 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122116 atccatccatccatccatcc 122097 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122112 atccatccatccatccatcc 122093 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122108 atccatccatccatccatcc 122089 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109580 atccatccatccatccatcc 109599 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109576 atccatccatccatccatcc 109595 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109572 atccatccatccatccatcc 109591 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109568 atccatccatccatccatcc 109587 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109564 atccatccatccatccatcc 109583 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109560 atccatccatccatccatcc 109579 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109556 atccatccatccatccatcc 109575 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 106743 atccatccatccatccatcc 106762 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 106739 atccatccatccatccatcc 106758 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 106735 atccatccatccatccatcc 106754 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 106731 atccatccatccatccatcc 106750 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 106727 atccatccatccatccatcc 106746 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 106723 atccatccatccatccatcc 106742 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 106719 atccatccatccatccatcc 106738 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49474 atccatccatccatccatcc 49493 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49470 atccatccatccatccatcc 49489 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49466 atccatccatccatccatcc 49485 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49462 atccatccatccatccatcc 49481 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49458 atccatccatccatccatcc 49477 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49454 atccatccatccatccatcc 49473 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49450 atccatccatccatccatcc 49469 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49446 atccatccatccatccatcc 49465 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49343 atccatccatccatccatcc 49362 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49339 atccatccatccatccatcc 49358 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49335 atccatccatccatccatcc 49354 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49331 atccatccatccatccatcc 49350 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49327 atccatccatccatccatcc 49346
>gb|AC124027.2| Mus musculus chromosome X clone RP21-282L18 map qA7.2, complete sequence Length = 147432 Score = 48.1 bits (24), Expect = 0.023 Identities = 27/28 (96%) Strand = Plus / Minus Query: 168 ctaccaaatccatccatccatccatcct 195 ||||| |||||||||||||||||||||| Sbjct: 108818 ctacccaatccatccatccatccatcct 108791
>gb|AC124026.2| Mus musculus chromosome X clone RP21-564N13 map qA7.2, complete sequence Length = 178239 Score = 48.1 bits (24), Expect = 0.023 Identities = 27/28 (96%) Strand = Plus / Minus Query: 168 ctaccaaatccatccatccatccatcct 195 ||||| |||||||||||||||||||||| Sbjct: 82190 ctacccaatccatccatccatccatcct 82163
>gb|AC124020.2| Mus musculus chromosome X clone RP21-564N13 map qA7.2, complete sequence Length = 155466 Score = 48.1 bits (24), Expect = 0.023 Identities = 27/28 (96%) Strand = Plus / Minus Query: 168 ctaccaaatccatccatccatccatcct 195 ||||| |||||||||||||||||||||| Sbjct: 74246 ctacccaatccatccatccatccatcct 74219
>gb|AC093734.3| Homo sapiens BAC clone RP11-16P10 from 7, complete sequence Length = 114085 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 101149 atccatccatccatccatcctcct 101172 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 101397 atccatccatccatccatcctcc 101419 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 101090 atccatccatccatccatcctcc 101112 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 100998 atccatccatccatccatcct 101018 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101678 atccatccatccatccatcc 101697 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 ||||||||||| |||||||||||| Sbjct: 101525 atccatccatctatccatcctcct 101548 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||| ||||||||||||||| Sbjct: 101461 atccatccttccatccatcctcct 101484 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101393 atccatccatccatccatcc 101412 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101389 atccatccatccatccatcc 101408 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101385 atccatccatccatccatcc 101404 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101145 atccatccatccatccatcc 101164 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101141 atccatccatccatccatcc 101160 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100994 atccatccatccatccatcc 101013 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100990 atccatccatccatccatcc 101009 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100986 atccatccatccatccatcc 101005 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100574 atccatccatccatccatcc 100593 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100570 atccatccatccatccatcc 100589 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100566 atccatccatccatccatcc 100585 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100562 atccatccatccatccatcc 100581 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84694 atccatccatccatccatcc 84713 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84146 atccatccatccatccatcc 84165 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84142 atccatccatccatccatcc 84161 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84138 atccatccatccatccatcc 84157
>emb|CR354390.16| Zebrafish DNA sequence from clone CH211-90K4 in linkage group 5, complete sequence Length = 141684 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 91112 atccatccatccatccatcctcct 91089 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 91117 aatccatccatccatccatcc 91097 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 90998 atccatccatccatccatcct 90978 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 90914 atccatccatccatccatcct 90894 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90938 atccatccatccatccatcc 90919 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90934 atccatccatccatccatcc 90915 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90930 atccatccatccatccatcc 90911 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90926 atccatccatccatccatcc 90907 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90922 atccatccatccatccatcc 90903 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90918 atccatccatccatccatcc 90899
>gb|AC009119.10| Homo sapiens chromosome 16 clone RP11-483P21, complete sequence Length = 181020 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 150879 atccatccatccatccatcctcct 150856 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 177 ccatccatccatccatcctcct 198 |||||||||||||||||||||| Sbjct: 150934 ccatccatccatccatcctcct 150913 Score = 42.1 bits (21), Expect = 1.4 Identities = 28/29 (96%), Gaps = 1/29 (3%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc-tcctcctt 202 |||||||||||||||||||| |||||||| Sbjct: 150883 atccatccatccatccatccatcctcctt 150855 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 150442 atccatccatccatccatcc 150423 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 150438 atccatccatccatccatcc 150419 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 150434 atccatccatccatccatcc 150415 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 150430 atccatccatccatccatcc 150411 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 150426 atccatccatccatccatcc 150407 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 150422 atccatccatccatccatcc 150403 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 ||||||||||||||||||| |||| Sbjct: 150418 atccatccatccatccatcttcct 150395
>gb|AC121922.3| Mus musculus BAC clone RP24-198H19 from chromosome 9, complete sequence Length = 180690 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 45514 atccatccatccatccatcctcct 45491 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 45478 atccatccatccatccatcctcct 45455 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 45187 atccatccatccatccatcctcct 45164 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 45327 atccatccatccatccatcctcc 45305 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52881 atccatccatccatccatcc 52900 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52877 atccatccatccatccatcc 52896 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52873 atccatccatccatccatcc 52892 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52869 atccatccatccatccatcc 52888 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45518 atccatccatccatccatcc 45499 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45347 atccatccatccatccatcc 45328 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45343 atccatccatccatccatcc 45324 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45339 atccatccatccatccatcc 45320 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45335 atccatccatccatccatcc 45316 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45331 atccatccatccatccatcc 45312 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45291 atccatccatccatccatcc 45272 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45287 atccatccatccatccatcc 45268 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45203 atccatccatccatccatcc 45184 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45199 atccatccatccatccatcc 45180 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45195 atccatccatccatccatcc 45176 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45191 atccatccatccatccatcc 45172
>gb|AC158512.2| Mus musculus BAC clone RP24-319O6 from chromosome 9, complete sequence Length = 171723 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 59643 atccatccatccatccatcctcct 59666 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59639 atccatccatccatccatcc 59658 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59635 atccatccatccatccatcc 59654 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59631 atccatccatccatccatcc 59650 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59627 atccatccatccatccatcc 59646 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59623 atccatccatccatccatcc 59642 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59619 atccatccatccatccatcc 59638 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59615 atccatccatccatccatcc 59634
>emb|BX537131.17| Zebrafish DNA sequence from clone CH211-266K2 in linkage group 14, complete sequence Length = 140171 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcctcc 197 |||||||||||||||||||||||| Sbjct: 19962 aatccatccatccatccatcctcc 19985 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 20191 atccatccatccatccatcctcc 20213 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 20182 aatccatccatccatccatcc 20202 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20731 atccatccatccatccatcc 20750 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20727 atccatccatccatccatcc 20746 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20723 atccatccatccatccatcc 20742 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20719 atccatccatccatccatcc 20738 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20187 atccatccatccatccatcc 20206
>gb|AC094784.13| Rattus norvegicus 11 BAC CH230-4O6 (Children's Hospital Oakland Research Institute) complete sequence Length = 228501 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 192836 atccatccatccatccatcctcct 192859 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 192832 atccatccatccatccatcc 192851
>emb|Z93942.1|HS230I19 Human DNA sequence from clone RP1-230I19 on chromosome 20q12-13.12 Contains part of the PTPRT gene for protein tyrosine phosphatase receptor type T, genomic marker D20S858, a ca repeat polymorphism, ESTs, STS and GSSs, complete sequence Length = 144201 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcctcc 197 |||||||||||||||||||||||| Sbjct: 126641 aatccatccatccatccatcctcc 126664 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 35422 atccatccatccatccatcc 35441 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 35418 atccatccatccatccatcc 35437 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 35414 atccatccatccatccatcc 35433 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 35410 atccatccatccatccatcc 35429 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 35406 atccatccatccatccatcc 35425 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 35402 atccatccatccatccatcc 35421 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 35398 atccatccatccatccatcc 35417
>emb|AL691497.8| Human DNA sequence from clone RP11-542C10 on chromosome 1 Contains putative novel transcript, complete sequence Length = 174648 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 72089 atccatccatccatccatcctcct 72066
>emb|AL589202.1| Human DNA sequence from clone RP11-391F23 on chromosome 6, complete sequence Length = 52411 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 19123 atccatccatccatccatcctcct 19146 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 18944 atccatccatccatccatcctcct 18967 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19455 atccatccatccatccatcc 19474 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 179 atccatccatccatcctcct 198 |||||||||||||||||||| Sbjct: 19355 atccatccatccatcctcct 19374 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 ||||| |||||||||||||||||| Sbjct: 19175 atccacccatccatccatcctcct 19198 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19119 atccatccatccatccatcc 19138 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19115 atccatccatccatccatcc 19134 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19111 atccatccatccatccatcc 19130 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19107 atccatccatccatccatcc 19126 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19103 atccatccatccatccatcc 19122 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19099 atccatccatccatccatcc 19118 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19095 atccatccatccatccatcc 19114 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 ||||| |||||||||||||||||| Sbjct: 18996 atccacccatccatccatcctcct 19019 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18940 atccatccatccatccatcc 18959 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18936 atccatccatccatccatcc 18955 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18932 atccatccatccatccatcc 18951 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18928 atccatccatccatccatcc 18947 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18924 atccatccatccatccatcc 18943
>emb|AL513327.34| Human DNA sequence from clone RP11-415J8 on chromosome 1 Contains the gene for a novel protein (FLJ35476), the gene for a novel protein similar to ABO family protein, two novel genes, the PHC2 gene for polyhomeotic-like 2 (Drosophila) and two CpG islands, complete sequence Length = 188665 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcct 195 |||||||||||||||||||||||| Sbjct: 111842 caaatccatccatccatccatcct 111865
>gb|AC119619.5| Homo sapiens X BAC RP11-1J4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 94158 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 10411 atccatccatccatccatcctcct 10388
>emb|AL109615.42|HS1120P11 Human DNA sequence from clone RP5-1120P11 on chromosome 6p12.3-21.2, complete sequence Length = 146655 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 85249 atccatccatccatccatcctcct 85226 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85277 atccatccatccatccatcc 85258 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85273 atccatccatccatccatcc 85254 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85269 atccatccatccatccatcc 85250 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85265 atccatccatccatccatcc 85246 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85261 atccatccatccatccatcc 85242 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85257 atccatccatccatccatcc 85238 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85253 atccatccatccatccatcc 85234
>emb|CR376835.6| Zebrafish DNA sequence from clone CH211-59E4 in linkage group 23, complete sequence Length = 23743 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 16968 atccatccatccatccatcctcct 16991 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17193 atccatccatccatccatcc 17212 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17189 atccatccatccatccatcc 17208 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17185 atccatccatccatccatcc 17204 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17181 atccatccatccatccatcc 17200 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17096 atccatccatccatccatcc 17115 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17092 atccatccatccatccatcc 17111 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17088 atccatccatccatccatcc 17107 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17084 atccatccatccatccatcc 17103 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17080 atccatccatccatccatcc 17099 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17076 atccatccatccatccatcc 17095 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17049 atccatccatccatccatcc 17068 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17045 atccatccatccatccatcc 17064 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16964 atccatccatccatccatcc 16983 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16960 atccatccatccatccatcc 16979 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16956 atccatccatccatccatcc 16975
>emb|BX569779.35| Zebrafish DNA sequence from clone CH211-113I9 in linkage group 11, complete sequence Length = 182464 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 171 ccaaatccatccatccatccatcc 194 |||||||||||||||||||||||| Sbjct: 26038 ccaaatccatccatccatccatcc 26015 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 25923 atccatccatccatccatcct 25903 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26235 atccatccatccatccatcc 26216 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26231 atccatccatccatccatcc 26212 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26030 atccatccatccatccatcc 26011 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 25887 atccatccatccatccatcc 25868 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 25883 atccatccatccatccatcc 25864
>emb|BX927088.11| Zebrafish DNA sequence from clone CH211-212M21 in linkage group 2, complete sequence Length = 201361 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 17236 atccatccatccatccatcctcct 17259 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 16877 atccatccatccatccatcctcct 16900 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 190668 atccatccatccatccatcct 190648 Score = 42.1 bits (21), Expect = 1.4 Identities = 28/29 (96%), Gaps = 1/29 (3%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc-tcctcctt 202 |||||||||||||||||||| |||||||| Sbjct: 17232 atccatccatccatccatccatcctcctt 17260 Score = 42.1 bits (21), Expect = 1.4 Identities = 28/29 (96%), Gaps = 1/29 (3%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc-tcctcctt 202 |||||||||||||||||||| |||||||| Sbjct: 16873 atccatccatccatccatccatcctcctt 16901 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190680 atccatccatccatccatcc 190661 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190676 atccatccatccatccatcc 190657 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190672 atccatccatccatccatcc 190653 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190516 atccatccatccatccatcc 190497 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190512 atccatccatccatccatcc 190493 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190508 atccatccatccatccatcc 190489 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190504 atccatccatccatccatcc 190485 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190500 atccatccatccatccatcc 190481 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190496 atccatccatccatccatcc 190477 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190492 atccatccatccatccatcc 190473 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190488 atccatccatccatccatcc 190469 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190484 atccatccatccatccatcc 190465 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190480 atccatccatccatccatcc 190461 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190476 atccatccatccatccatcc 190457 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190472 atccatccatccatccatcc 190453 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190468 atccatccatccatccatcc 190449 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190464 atccatccatccatccatcc 190445 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190460 atccatccatccatccatcc 190441 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190456 atccatccatccatccatcc 190437 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190452 atccatccatccatccatcc 190433 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190448 atccatccatccatccatcc 190429 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190444 atccatccatccatccatcc 190425 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190440 atccatccatccatccatcc 190421 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190436 atccatccatccatccatcc 190417 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190412 atccatccatccatccatcc 190393 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190408 atccatccatccatccatcc 190389 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190404 atccatccatccatccatcc 190385 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190400 atccatccatccatccatcc 190381 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190396 atccatccatccatccatcc 190377 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17343 atccatccatccatccatcc 17362 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17339 atccatccatccatccatcc 17358 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17228 atccatccatccatccatcc 17247 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17224 atccatccatccatccatcc 17243 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17220 atccatccatccatccatcc 17239 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17216 atccatccatccatccatcc 17235 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17212 atccatccatccatccatcc 17231 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17208 atccatccatccatccatcc 17227 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17204 atccatccatccatccatcc 17223 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17200 atccatccatccatccatcc 17219 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17196 atccatccatccatccatcc 17215 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17192 atccatccatccatccatcc 17211 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17188 atccatccatccatccatcc 17207 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17184 atccatccatccatccatcc 17203 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16869 atccatccatccatccatcc 16888 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16865 atccatccatccatccatcc 16884 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16861 atccatccatccatccatcc 16880 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16857 atccatccatccatccatcc 16876 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16853 atccatccatccatccatcc 16872 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16849 atccatccatccatccatcc 16868 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16845 atccatccatccatccatcc 16864 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16841 atccatccatccatccatcc 16860 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16837 atccatccatccatccatcc 16856 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16833 atccatccatccatccatcc 16852 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16829 atccatccatccatccatcc 16848 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16825 atccatccatccatccatcc 16844 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16821 atccatccatccatccatcc 16840
>emb|AL807799.5| Zebrafish DNA sequence from clone CH211-257P7 in linkage group 2, complete sequence Length = 175342 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 171 ccaaatccatccatccatccatcc 194 |||||||||||||||||||||||| Sbjct: 7497 ccaaatccatccatccatccatcc 7520 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7529 atccatccatccatccatcc 7548 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7525 atccatccatccatccatcc 7544 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7521 atccatccatccatccatcc 7540 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7517 atccatccatccatccatcc 7536 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7513 atccatccatccatccatcc 7532 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7509 atccatccatccatccatcc 7528 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7505 atccatccatccatccatcc 7524 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7386 atccatccatccatccatcc 7405 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7124 atccatccatccatccatcc 7143 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7120 atccatccatccatccatcc 7139 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7116 atccatccatccatccatcc 7135 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7112 atccatccatccatccatcc 7131 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7108 atccatccatccatccatcc 7127 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7104 atccatccatccatccatcc 7123 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7100 atccatccatccatccatcc 7119 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7096 atccatccatccatccatcc 7115 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7092 atccatccatccatccatcc 7111 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7088 atccatccatccatccatcc 7107 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7084 atccatccatccatccatcc 7103 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7080 atccatccatccatccatcc 7099 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7076 atccatccatccatccatcc 7095 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7072 atccatccatccatccatcc 7091 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7068 atccatccatccatccatcc 7087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7064 atccatccatccatccatcc 7083
>gb|AC137843.15| Mus musculus chromosome 9, clone RP23-413J12, complete sequence Length = 197907 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 171 ccaaatccatccatccatccatcc 194 |||||||||||||||||||||||| Sbjct: 143132 ccaaatccatccatccatccatcc 143109 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143124 atccatccatccatccatcc 143105 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143100 atccatccatccatccatcc 143081 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143096 atccatccatccatccatcc 143077 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143092 atccatccatccatccatcc 143073 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143088 atccatccatccatccatcc 143069 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143084 atccatccatccatccatcc 143065 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143080 atccatccatccatccatcc 143061 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143076 atccatccatccatccatcc 143057
>dbj|D78272.1|CHKM1R Gallus gallus gene for melanocortin 1-receptor, complete cds Length = 1770 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 1441 atccatccatccatccatcctcct 1418
>dbj|AK137328.1| Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:9630011B07 product:unclassifiable, full insert sequence Length = 1723 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 171 ccaaatccatccatccatccatcc 194 |||||||||||||||||||||||| Sbjct: 921 ccaaatccatccatccatccatcc 944 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 977 atccatccatccatccatcc 996 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 973 atccatccatccatccatcc 992 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 969 atccatccatccatccatcc 988 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 965 atccatccatccatccatcc 984 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 961 atccatccatccatccatcc 980 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 957 atccatccatccatccatcc 976 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 953 atccatccatccatccatcc 972 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 929 atccatccatccatccatcc 948
>emb|BX897752.7| Chicken DNA sequence from clone WAG-88M21, complete sequence Length = 107816 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 95635 atccatccatccatccatcctcct 95612 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95659 atccatccatccatccatcc 95640 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95655 atccatccatccatccatcc 95636 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95651 atccatccatccatccatcc 95632 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95647 atccatccatccatccatcc 95628 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95643 atccatccatccatccatcc 95624 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95639 atccatccatccatccatcc 95620 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43867 atccatccatccatccatcc 43886 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43863 atccatccatccatccatcc 43882 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43859 atccatccatccatccatcc 43878 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43855 atccatccatccatccatcc 43874 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43851 atccatccatccatccatcc 43870 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43847 atccatccatccatccatcc 43866 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43843 atccatccatccatccatcc 43862 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43839 atccatccatccatccatcc 43858 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43835 atccatccatccatccatcc 43854 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37165 atccatccatccatccatcc 37146 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37161 atccatccatccatccatcc 37142 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37157 atccatccatccatccatcc 37138 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37153 atccatccatccatccatcc 37134 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37149 atccatccatccatccatcc 37130 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37145 atccatccatccatccatcc 37126 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37141 atccatccatccatccatcc 37122 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37137 atccatccatccatccatcc 37118 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37133 atccatccatccatccatcc 37114 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37129 atccatccatccatccatcc 37110 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37125 atccatccatccatccatcc 37106 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37121 atccatccatccatccatcc 37102 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 ||||||||||||||||||| |||| Sbjct: 37117 atccatccatccatccatcttcct 37094
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 27760538 atccatccatccatccatcctcct 27760561 Score = 46.1 bits (23), Expect = 0.090 Identities = 30/31 (96%), Gaps = 1/31 (3%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc-tcctccttct 204 |||||||||||||||||||| |||||||||| Sbjct: 27760534 atccatccatccatccatccatcctccttct 27760564 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 17271183 aatccatccatccatccatcc 17271203 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 173 aaatccatccatccatccatc 193 ||||||||||||||||||||| Sbjct: 1741836 aaatccatccatccatccatc 1741816 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27634222 atccatccatccatccatcc 27634203 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27186964 atccatccatccatccatcc 27186945 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27186960 atccatccatccatccatcc 27186941 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27186956 atccatccatccatccatcc 27186937 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5282342 atccatccatccatccatcc 5282323 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 4465178 atccatccatccatccatcc 4465197 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 4465174 atccatccatccatccatcc 4465193 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 4465170 atccatccatccatccatcc 4465189 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatc 193 |||||||||||||||||||| Sbjct: 4217354 aatccatccatccatccatc 4217373
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 170 accaaatccatccatccatccatc 193 |||||||||||||||||||||||| Sbjct: 40572669 accaaatccatccatccatccatc 40572692 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 4726051 aatccatccatccatccatcc 4726031 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 39168156 atccatccatccatccatcc 39168175 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 39168152 atccatccatccatccatcc 39168171 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38808306 atccatccatccatccatcc 38808287 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38610183 atccatccatccatccatcc 38610164 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 31845147 atccatccatccatccatcc 31845128 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 31845143 atccatccatccatccatcc 31845124 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 30536104 atccatccatccatccatcc 30536123 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 30536100 atccatccatccatccatcc 30536119 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22093663 atccatccatccatccatcc 22093682 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 21899295 atccatccatccatccatcc 21899276 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 21899291 atccatccatccatccatcc 21899272 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 21899287 atccatccatccatccatcc 21899268 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 21899283 atccatccatccatccatcc 21899264 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20704006 atccatccatccatccatcc 20703987 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18835178 atccatccatccatccatcc 18835197 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18835174 atccatccatccatccatcc 18835193 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7149183 atccatccatccatccatcc 7149164 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5104310 atccatccatccatccatcc 5104291 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 177 ccatccatccatccatcctc 196 |||||||||||||||||||| Sbjct: 4811936 ccatccatccatccatcctc 4811955 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 4802740 atccatccatccatccatcc 4802721 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 4802736 atccatccatccatccatcc 4802717
>emb|BX663530.7| Chicken DNA sequence from clone WAG-52G8, complete sequence Length = 123203 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 28363 atccatccatccatccatcctcct 28386 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 11374 atccatccatccatccatcctcct 11351 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86521 atccatccatccatccatcc 86540 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86517 atccatccatccatccatcc 86536 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86513 atccatccatccatccatcc 86532 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86509 atccatccatccatccatcc 86528 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86505 atccatccatccatccatcc 86524 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86501 atccatccatccatccatcc 86520 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86497 atccatccatccatccatcc 86516 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86493 atccatccatccatccatcc 86512 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86489 atccatccatccatccatcc 86508 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79819 atccatccatccatccatcc 79800 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79815 atccatccatccatccatcc 79796 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79811 atccatccatccatccatcc 79792 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79807 atccatccatccatccatcc 79788 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79803 atccatccatccatccatcc 79784 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79799 atccatccatccatccatcc 79780 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79795 atccatccatccatccatcc 79776 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79791 atccatccatccatccatcc 79772 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79787 atccatccatccatccatcc 79768 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79783 atccatccatccatccatcc 79764 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79779 atccatccatccatccatcc 79760 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79775 atccatccatccatccatcc 79756 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 ||||||||||||||||||| |||| Sbjct: 79771 atccatccatccatccatcttcct 79748 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28359 atccatccatccatccatcc 28378 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28355 atccatccatccatccatcc 28374 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28351 atccatccatccatccatcc 28370 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28347 atccatccatccatccatcc 28366 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28343 atccatccatccatccatcc 28362 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28339 atccatccatccatccatcc 28358 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 11410 atccatccatccatccatcc 11391 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 11406 atccatccatccatccatcc 11387 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 11402 atccatccatccatccatcc 11383 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 11398 atccatccatccatccatcc 11379 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 11394 atccatccatccatccatcc 11375 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 11390 atccatccatccatccatcc 11371 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 11386 atccatccatccatccatcc 11367 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 11382 atccatccatccatccatcc 11363 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 11378 atccatccatccatccatcc 11359
>emb|BX663527.6| Chicken DNA sequence from clone WAG-112A23, complete sequence Length = 111067 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 87170 atccatccatccatccatcctcct 87147 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87202 atccatccatccatccatcc 87183 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87198 atccatccatccatccatcc 87179 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87194 atccatccatccatccatcc 87175 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87190 atccatccatccatccatcc 87171 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87186 atccatccatccatccatcc 87167 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87182 atccatccatccatccatcc 87163 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87178 atccatccatccatccatcc 87159 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87174 atccatccatccatccatcc 87155 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 ||||||||||||||||||| |||| Sbjct: 46040 atccatccatccatccatcttcct 46063 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 46036 atccatccatccatccatcc 46055 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 46032 atccatccatccatccatcc 46051 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 46028 atccatccatccatccatcc 46047 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 46024 atccatccatccatccatcc 46043 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||| ||||||||||||||| Sbjct: 7791 atccatccctccatccatcctcct 7814 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7779 atccatccatccatccatcc 7798 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7775 atccatccatccatccatcc 7794 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7771 atccatccatccatccatcc 7790 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7767 atccatccatccatccatcc 7786 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7763 atccatccatccatccatcc 7782 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7759 atccatccatccatccatcc 7778 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7755 atccatccatccatccatcc 7774 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7751 atccatccatccatccatcc 7770 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7747 atccatccatccatccatcc 7766
>gb|AC013471.7| Homo sapiens BAC clone RP11-489A14 from 2, complete sequence Length = 145040 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 6227 atccatccatccatccatcctcct 6250 Score = 42.1 bits (21), Expect = 1.4 Identities = 28/29 (96%), Gaps = 1/29 (3%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc-tcctcctt 202 |||||||||||||||||||| |||||||| Sbjct: 6223 atccatccatccatccatccatcctcctt 6251 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6219 atccatccatccatccatcc 6238 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6215 atccatccatccatccatcc 6234 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6211 atccatccatccatccatcc 6230
>dbj|AP004332.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0093F16 Length = 160925 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 170 accaaatccatccatccatccatc 193 |||||||||||||||||||||||| Sbjct: 14647 accaaatccatccatccatccatc 14670
>dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1033B05 Length = 138882 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 170 accaaatccatccatccatccatc 193 |||||||||||||||||||||||| Sbjct: 134293 accaaatccatccatccatccatc 134316
>gb|AC055858.18| Homo sapiens chromosome 17, clone RP11-682M7, complete sequence Length = 167395 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 56832 atccatccatccatccatcctcct 56855 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 56716 atccatccatccatccatcctcc 56738 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 179 atccatccatccatcctcct 198 |||||||||||||||||||| Sbjct: 56903 atccatccatccatcctcct 56922 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 56828 atccatccatccatccatcc 56847 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 56712 atccatccatccatccatcc 56731 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 56708 atccatccatccatccatcc 56727 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 56704 atccatccatccatccatcc 56723 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 56700 atccatccatccatccatcc 56719 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 56696 atccatccatccatccatcc 56715 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 56692 atccatccatccatccatcc 56711 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 56688 atccatccatccatccatcc 56707 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 56684 atccatccatccatccatcc 56703 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 179 atccatccatccatcctcct 198 |||||||||||||||||||| Sbjct: 56641 atccatccatccatcctcct 56660 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26803 atccatccatccatccatcc 26784 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26799 atccatccatccatccatcc 26780 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26795 atccatccatccatccatcc 26776 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26791 atccatccatccatccatcc 26772 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26787 atccatccatccatccatcc 26768 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26313 atccatccatccatccatcc 26294
>gb|AC018552.6| Homo sapiens chromosome 16 clone RP11-405F3, complete sequence Length = 152156 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 174 aatccatccatccatccatcctcc 197 |||||||||||||||||||||||| Sbjct: 34700 aatccatccatccatccatcctcc 34677 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 177 ccatccatccatccatcctcc 197 ||||||||||||||||||||| Sbjct: 34439 ccatccatccatccatcctcc 34419 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 147998 atccatccatccatccatcc 147979 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 147994 atccatccatccatccatcc 147975 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 147990 atccatccatccatccatcc 147971 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 147986 atccatccatccatccatcc 147967 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 147982 atccatccatccatccatcc 147963 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10406 atccatccatccatccatcc 10425 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10402 atccatccatccatccatcc 10421 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10043 atccatccatccatccatcc 10062 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 9948 atccatccatccatccatcc 9967 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 9784 atccatccatccatccatcc 9803
>emb|AL840636.10| Zebrafish DNA sequence from clone CH211-262K7 in linkage group 20, complete sequence Length = 174999 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 171 ccaaatccatccatccatccatcc 194 |||||||||||||||||||||||| Sbjct: 7505 ccaaatccatccatccatccatcc 7528 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7537 atccatccatccatccatcc 7556 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7533 atccatccatccatccatcc 7552 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7529 atccatccatccatccatcc 7548 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7525 atccatccatccatccatcc 7544 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7521 atccatccatccatccatcc 7540 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7517 atccatccatccatccatcc 7536 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7513 atccatccatccatccatcc 7532 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7394 atccatccatccatccatcc 7413 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7124 atccatccatccatccatcc 7143 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7120 atccatccatccatccatcc 7139 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7116 atccatccatccatccatcc 7135 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7112 atccatccatccatccatcc 7131 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7108 atccatccatccatccatcc 7127 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7104 atccatccatccatccatcc 7123 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7100 atccatccatccatccatcc 7119 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7096 atccatccatccatccatcc 7115 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7092 atccatccatccatccatcc 7111 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7088 atccatccatccatccatcc 7107 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7084 atccatccatccatccatcc 7103 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7080 atccatccatccatccatcc 7099 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7076 atccatccatccatccatcc 7095 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7072 atccatccatccatccatcc 7091 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7068 atccatccatccatccatcc 7087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7064 atccatccatccatccatcc 7083
>dbj|AP004989.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B1153E06 Length = 174588 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 109793 atccatccatccatccatcctcct 109816 Score = 46.1 bits (23), Expect = 0.090 Identities = 30/31 (96%), Gaps = 1/31 (3%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc-tcctccttct 204 |||||||||||||||||||| |||||||||| Sbjct: 109789 atccatccatccatccatccatcctccttct 109819
>dbj|AP003728.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0710B08 Length = 186991 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 63047 atccatccatccatccatcctcct 63070 Score = 46.1 bits (23), Expect = 0.090 Identities = 30/31 (96%), Gaps = 1/31 (3%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc-tcctccttct 204 |||||||||||||||||||| |||||||||| Sbjct: 63043 atccatccatccatccatccatcctccttct 63073
>emb|AL772351.12| Mouse DNA sequence from clone RP24-199N10 on chromosome 4, complete sequence Length = 78426 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 171 ccaaatccatccatccatccatcc 194 |||||||||||||||||||||||| Sbjct: 22261 ccaaatccatccatccatccatcc 22284 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43160 atccatccatccatccatcc 43179 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22277 atccatccatccatccatcc 22296 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22273 atccatccatccatccatcc 22292 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22269 atccatccatccatccatcc 22288
>emb|BX663534.4| Chicken DNA sequence from clone WAG-58B13, complete sequence Length = 67055 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 64752 atccatccatccatccatcctcct 64729 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 42752 atccatccatccatccatcctcct 42775 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 64780 atccatccatccatccatcc 64761 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 64776 atccatccatccatccatcc 64757 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 64772 atccatccatccatccatcc 64753 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 64768 atccatccatccatccatcc 64749 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 64764 atccatccatccatccatcc 64745 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 64760 atccatccatccatccatcc 64741 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 64756 atccatccatccatccatcc 64737 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42748 atccatccatccatccatcc 42767 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20922 atccatccatccatccatcc 20903 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20918 atccatccatccatccatcc 20899 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20914 atccatccatccatccatcc 20895 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20910 atccatccatccatccatcc 20891 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20906 atccatccatccatccatcc 20887 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20902 atccatccatccatccatcc 20883 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7068 atccatccatccatccatcc 7087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7064 atccatccatccatccatcc 7083 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7060 atccatccatccatccatcc 7079 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7056 atccatccatccatccatcc 7075 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7052 atccatccatccatccatcc 7071 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7048 atccatccatccatccatcc 7067 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7044 atccatccatccatccatcc 7063
>emb|BX247945.6| Zebrafish DNA sequence from clone CH211-209L14 in linkage group 24, complete sequence Length = 199345 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 167129 atccatccatccatccatcctcct 167106 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167149 atccatccatccatccatcc 167130 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167145 atccatccatccatccatcc 167126 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167141 atccatccatccatccatcc 167122 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167137 atccatccatccatccatcc 167118 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167133 atccatccatccatccatcc 167114 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167052 atccatccatccatccatcc 167033 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167048 atccatccatccatccatcc 167029 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167044 atccatccatccatccatcc 167025 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167040 atccatccatccatccatcc 167021 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167036 atccatccatccatccatcc 167017 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167032 atccatccatccatccatcc 167013 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167028 atccatccatccatccatcc 167009 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167024 atccatccatccatccatcc 167005 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167020 atccatccatccatccatcc 167001 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167016 atccatccatccatccatcc 166997 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167012 atccatccatccatccatcc 166993 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167008 atccatccatccatccatcc 166989 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167004 atccatccatccatccatcc 166985 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 167000 atccatccatccatccatcc 166981 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 166996 atccatccatccatccatcc 166977 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 166911 atccatccatccatccatcc 166892 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 166907 atccatccatccatccatcc 166888 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 166903 atccatccatccatccatcc 166884 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 166899 atccatccatccatccatcc 166880 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 166895 atccatccatccatccatcc 166876
>emb|BX323558.7| Zebrafish DNA sequence from clone CH211-214J24 in linkage group 4, complete sequence Length = 160379 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 2759 atccatccatccatccatcctcct 2736 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3677 atccatccatccatccatcc 3658 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3673 atccatccatccatccatcc 3654 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3669 atccatccatccatccatcc 3650 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3665 atccatccatccatccatcc 3646 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3661 atccatccatccatccatcc 3642 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2871 atccatccatccatccatcc 2852 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2867 atccatccatccatccatcc 2848 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2863 atccatccatccatccatcc 2844 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2859 atccatccatccatccatcc 2840 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2855 atccatccatccatccatcc 2836 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2851 atccatccatccatccatcc 2832 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2847 atccatccatccatccatcc 2828 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2843 atccatccatccatccatcc 2824 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2839 atccatccatccatccatcc 2820
>emb|BX005185.5| Zebrafish DNA sequence from clone CH211-132N11 in linkage group 24, complete sequence Length = 164521 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 24953 atccatccatccatccatcctcct 24930 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 83927 aatccatccatccatccatcc 83907 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87553 atccatccatccatccatcc 87534 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87549 atccatccatccatccatcc 87530 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87545 atccatccatccatccatcc 87526 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87541 atccatccatccatccatcc 87522 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83922 atccatccatccatccatcc 83903 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83918 atccatccatccatccatcc 83899 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83914 atccatccatccatccatcc 83895 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83910 atccatccatccatccatcc 83891 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83906 atccatccatccatccatcc 83887 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83902 atccatccatccatccatcc 83883 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83761 atccatccatccatccatcc 83742 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83153 atccatccatccatccatcc 83134 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83149 atccatccatccatccatcc 83130 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83145 atccatccatccatccatcc 83126 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83141 atccatccatccatccatcc 83122 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83137 atccatccatccatccatcc 83118 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83133 atccatccatccatccatcc 83114 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83129 atccatccatccatccatcc 83110 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83125 atccatccatccatccatcc 83106 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83121 atccatccatccatccatcc 83102 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83117 atccatccatccatccatcc 83098 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83113 atccatccatccatccatcc 83094 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83109 atccatccatccatccatcc 83090 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83105 atccatccatccatccatcc 83086 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24977 atccatccatccatccatcc 24958 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24973 atccatccatccatccatcc 24954 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24969 atccatccatccatccatcc 24950 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24965 atccatccatccatccatcc 24946 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24961 atccatccatccatccatcc 24942 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24957 atccatccatccatccatcc 24938 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24876 atccatccatccatccatcc 24857 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24872 atccatccatccatccatcc 24853 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24868 atccatccatccatccatcc 24849 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24864 atccatccatccatccatcc 24845 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24860 atccatccatccatccatcc 24841 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24856 atccatccatccatccatcc 24837 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24852 atccatccatccatccatcc 24833 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24848 atccatccatccatccatcc 24829 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24844 atccatccatccatccatcc 24825 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24840 atccatccatccatccatcc 24821 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24836 atccatccatccatccatcc 24817 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24832 atccatccatccatccatcc 24813 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24828 atccatccatccatccatcc 24809 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24824 atccatccatccatccatcc 24805 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24820 atccatccatccatccatcc 24801 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24735 atccatccatccatccatcc 24716 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24731 atccatccatccatccatcc 24712 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24727 atccatccatccatccatcc 24708 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24723 atccatccatccatccatcc 24704 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24719 atccatccatccatccatcc 24700
>emb|CR925790.6| Zebrafish DNA sequence from clone DKEY-275J21 in linkage group 10, complete sequence Length = 136117 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 22335 atccatccatccatccatcctcct 22312 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22355 atccatccatccatccatcc 22336 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22351 atccatccatccatccatcc 22332 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22347 atccatccatccatccatcc 22328 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22343 atccatccatccatccatcc 22324 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22339 atccatccatccatccatcc 22320 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22311 atccatccatccatccatcc 22292 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22307 atccatccatccatccatcc 22288 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22303 atccatccatccatccatcc 22284 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22299 atccatccatccatccatcc 22280 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22295 atccatccatccatccatcc 22276 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22291 atccatccatccatccatcc 22272 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22287 atccatccatccatccatcc 22268 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22283 atccatccatccatccatcc 22264 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22279 atccatccatccatccatcc 22260 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22275 atccatccatccatccatcc 22256 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22271 atccatccatccatccatcc 22252 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22267 atccatccatccatccatcc 22248 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22263 atccatccatccatccatcc 22244 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22259 atccatccatccatccatcc 22240 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22255 atccatccatccatccatcc 22236 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22251 atccatccatccatccatcc 22232 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22247 atccatccatccatccatcc 22228 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22243 atccatccatccatccatcc 22224 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22239 atccatccatccatccatcc 22220 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22235 atccatccatccatccatcc 22216 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22231 atccatccatccatccatcc 22212 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22227 atccatccatccatccatcc 22208 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22223 atccatccatccatccatcc 22204
>gb|AC007759.1|AC007759 Homo sapiens chromosome 19, cosmid R27714, complete sequence Length = 40331 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 20311 atccatccatccatccatcctcct 20334
>gb|AC108805.15| Mus musculus chromosome 9, clone RP23-226G13, complete sequence Length = 242531 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 69446 atccatccatccatccatcctcct 69423 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69474 atccatccatccatccatcc 69455 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69470 atccatccatccatccatcc 69451 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69466 atccatccatccatccatcc 69447 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69462 atccatccatccatccatcc 69443 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69458 atccatccatccatccatcc 69439 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69454 atccatccatccatccatcc 69435 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69450 atccatccatccatccatcc 69431
>gb|AC113464.17| Mus musculus chromosome 8, clone RP23-183P1, complete sequence Length = 191444 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcct 198 |||||||||||||||||||||||| Sbjct: 10677 atccatccatccatccatcctcct 10654 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10697 atccatccatccatccatcc 10678 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10693 atccatccatccatccatcc 10674 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10689 atccatccatccatccatcc 10670 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10685 atccatccatccatccatcc 10666 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10681 atccatccatccatccatcc 10662 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10653 atccatccatccatccatcc 10634 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10649 atccatccatccatccatcc 10630 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10645 atccatccatccatccatcc 10626 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10641 atccatccatccatccatcc 10622 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10637 atccatccatccatccatcc 10618 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10633 atccatccatccatccatcc 10614 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10629 atccatccatccatccatcc 10610
>gb|AC135673.5| Mus musculus BAC clone RP24-279A17 from 16, complete sequence Length = 173965 Score = 48.1 bits (24), Expect = 0.023 Identities = 27/28 (96%) Strand = Plus / Minus Query: 167 cctaccaaatccatccatccatccatcc 194 |||||| ||||||||||||||||||||| Sbjct: 100070 cctacctaatccatccatccatccatcc 100043 Score = 48.1 bits (24), Expect = 0.023 Identities = 27/28 (96%) Strand = Plus / Minus Query: 167 cctaccaaatccatccatccatccatcc 194 |||||| ||||||||||||||||||||| Sbjct: 99802 cctacctaatccatccatccatccatcc 99775 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100058 atccatccatccatccatcc 100039 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100054 atccatccatccatccatcc 100035 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100050 atccatccatccatccatcc 100031 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99946 atccatccatccatccatcc 99927 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99942 atccatccatccatccatcc 99923 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99938 atccatccatccatccatcc 99919 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99934 atccatccatccatccatcc 99915 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99930 atccatccatccatccatcc 99911 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99790 atccatccatccatccatcc 99771 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99786 atccatccatccatccatcc 99767 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99782 atccatccatccatccatcc 99763
>emb|AL953866.5| Zebrafish DNA sequence from clone DKEY-60I9 in linkage group 21, complete sequence Length = 198925 Score = 48.1 bits (24), Expect = 0.023 Identities = 30/32 (93%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctccttctgt 206 ||||||||||||||||||||| ||||||||| Sbjct: 123416 atccatccatccatccatccttttccttctgt 123385 Score = 48.1 bits (24), Expect = 0.023 Identities = 30/32 (93%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctccttctgt 206 ||||||||||||||||||||| ||||||||| Sbjct: 123286 atccatccatccatccatccttttccttctgt 123255 Score = 48.1 bits (24), Expect = 0.023 Identities = 30/32 (93%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctccttctgt 206 ||||||||||||||||||||| ||||||||| Sbjct: 123105 atccatccatccatccatccttttccttctgt 123074 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 123225 atccatccatccatccatcct 123205 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123492 atccatccatccatccatcc 123473 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123488 atccatccatccatccatcc 123469 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123484 atccatccatccatccatcc 123465 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123480 atccatccatccatccatcc 123461 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123476 atccatccatccatccatcc 123457 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123472 atccatccatccatccatcc 123453 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123468 atccatccatccatccatcc 123449 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123464 atccatccatccatccatcc 123445 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123460 atccatccatccatccatcc 123441 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123456 atccatccatccatccatcc 123437 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123452 atccatccatccatccatcc 123433 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123448 atccatccatccatccatcc 123429 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123444 atccatccatccatccatcc 123425 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123440 atccatccatccatccatcc 123421 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123436 atccatccatccatccatcc 123417 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123432 atccatccatccatccatcc 123413 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123428 atccatccatccatccatcc 123409 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123424 atccatccatccatccatcc 123405 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123420 atccatccatccatccatcc 123401 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123378 atccatccatccatccatcc 123359 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123374 atccatccatccatccatcc 123355 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123370 atccatccatccatccatcc 123351 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123366 atccatccatccatccatcc 123347 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123362 atccatccatccatccatcc 123343 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123358 atccatccatccatccatcc 123339 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123354 atccatccatccatccatcc 123335 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123350 atccatccatccatccatcc 123331 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123346 atccatccatccatccatcc 123327 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123342 atccatccatccatccatcc 123323 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123338 atccatccatccatccatcc 123319 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123334 atccatccatccatccatcc 123315 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123330 atccatccatccatccatcc 123311 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123326 atccatccatccatccatcc 123307 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123322 atccatccatccatccatcc 123303 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123237 atccatccatccatccatcc 123218 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123233 atccatccatccatccatcc 123214 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123229 atccatccatccatccatcc 123210 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123177 atccatccatccatccatcc 123158 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123173 atccatccatccatccatcc 123154 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123149 atccatccatccatccatcc 123130 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123145 atccatccatccatccatcc 123126 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123121 atccatccatccatccatcc 123102 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123117 atccatccatccatccatcc 123098 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123113 atccatccatccatccatcc 123094 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123109 atccatccatccatccatcc 123090 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123056 atccatccatccatccatcc 123037 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123052 atccatccatccatccatcc 123033 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123048 atccatccatccatccatcc 123029 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123000 atccatccatccatccatcc 122981 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122996 atccatccatccatccatcc 122977 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122992 atccatccatccatccatcc 122973 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122988 atccatccatccatccatcc 122969 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122984 atccatccatccatccatcc 122965 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122980 atccatccatccatccatcc 122961 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122976 atccatccatccatccatcc 122957
>emb|AL808110.7| Mouse DNA sequence from clone RP23-62O13 on chromosome X, complete sequence Length = 175963 Score = 48.1 bits (24), Expect = 0.023 Identities = 27/28 (96%) Strand = Plus / Minus Query: 168 ctaccaaatccatccatccatccatcct 195 ||||| |||||||||||||||||||||| Sbjct: 52135 ctacccaatccatccatccatccatcct 52108
>dbj|AP003262.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0482D04 Length = 144583 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 170 accaaatccatccatccatccatc 193 |||||||||||||||||||||||| Sbjct: 52684 accaaatccatccatccatccatc 52707
>ref|NM_130166.2| Arabidopsis thaliana UBC6 (UBIQUITIN-CONJUGATING ENZYME 6); ubiquitin conjugating enzyme AT2G46030 (UBC6) mRNA, complete cds Length = 1482 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtgga 280 ||||||||||||||||||||||| Sbjct: 124 atgatgagtgattacaaggtgga 146
>gb|AC121498.12| Mus musculus chromosome 1, clone RP23-38P22, complete sequence Length = 152264 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 30533 atccatccatccatccatcctcc 30555 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 30529 atccatccatccatccatcc 30548 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 30525 atccatccatccatccatcc 30544 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 30521 atccatccatccatccatcc 30540 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 30517 atccatccatccatccatcc 30536
>gb|AC152978.1| Mus musculus BAC RP23-111A15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 180393 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 72702 atccatccatccatccatcctcc 72724 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 72698 atccatccatccatccatcc 72717 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 72694 atccatccatccatccatcc 72713 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 72690 atccatccatccatccatcc 72709 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 72686 atccatccatccatccatcc 72705 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 72654 atccatccatccatccatcc 72673 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 72650 atccatccatccatccatcc 72669
>gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome 17, complete sequence Length = 202649 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 185448 caaatccatccatccatccatcc 185470 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 185578 atccatccatccatccatcc 185597 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 185574 atccatccatccatccatcc 185593 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 185570 atccatccatccatccatcc 185589 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 185566 atccatccatccatccatcc 185585 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 185378 atccatccatccatccatcc 185397 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 185374 atccatccatccatccatcc 185393 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 185370 atccatccatccatccatcc 185389 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 185366 atccatccatccatccatcc 185385 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 185362 atccatccatccatccatcc 185381 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 185358 atccatccatccatccatcc 185377 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 51216 atccatccatccatccatcc 51197 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 51212 atccatccatccatccatcc 51193
>gb|AC115898.22| Mus musculus chromosome 7, clone RP24-444C13, complete sequence Length = 177754 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 2157 atccatccatccatccatcctcc 2135 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2161 atccatccatccatccatcc 2142
>gb|AF259072.1| Mus musculus T-cell receptor alpha locus BAC clone MBAC1058 from 14D1-D2, complete sequence Length = 170356 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 98296 caaatccatccatccatccatcc 98318 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98335 atccatccatccatccatcc 98354 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98331 atccatccatccatccatcc 98350 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98327 atccatccatccatccatcc 98346 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98323 atccatccatccatccatcc 98342 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98319 atccatccatccatccatcc 98338 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98315 atccatccatccatccatcc 98334 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98311 atccatccatccatccatcc 98330 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98307 atccatccatccatccatcc 98326 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98303 atccatccatccatccatcc 98322
>gb|AC124981.25| Mus musculus chromosome 5, clone RP24-170P20, complete sequence Length = 153767 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 16861 atccatccatccatccatcctcc 16883 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16857 atccatccatccatccatcc 16876 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16853 atccatccatccatccatcc 16872 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16849 atccatccatccatccatcc 16868 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16845 atccatccatccatccatcc 16864 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16841 atccatccatccatccatcc 16860 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16837 atccatccatccatccatcc 16856 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16833 atccatccatccatccatcc 16852
>gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 198520 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 22814 caaatccatccatccatccatcc 22792 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22807 atccatccatccatccatcc 22788 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22803 atccatccatccatccatcc 22784 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22799 atccatccatccatccatcc 22780
>gb|AC120986.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1781_H11, complete sequence Length = 204649 Score = 46.1 bits (23), Expect = 0.090 Identities = 26/27 (96%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctcct 201 ||||||||||||||||||||| ||||| Sbjct: 139257 atccatccatccatccatccttctcct 139231 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 79926 aatccatccatccatccatcc 79946
>gb|AC112361.5| Rattus norvegicus 9 BAC CH230-61F12 (Children's Hospital Oakland Research Institute) complete sequence Length = 216648 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 172359 atccatccatccatccatcctcc 172337 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 173462 atccatccatccatccatcc 173443 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 173458 atccatccatccatccatcc 173439 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 176 tccatccatccatccatcct 195 |||||||||||||||||||| Sbjct: 172275 tccatccatccatccatcct 172256
>gb|AF241735.2| Homo sapiens chromosome X clone CTD-2324A24 map p11.4, complete sequence Length = 39877 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 26689 atccatccatccatccatcctcc 26667 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 26645 atccatccatccatccatcctcc 26623 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 26597 atccatccatccatccatcctcc 26575 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26693 atccatccatccatccatcc 26674 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26657 atccatccatccatccatcc 26638 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26653 atccatccatccatccatcc 26634 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26649 atccatccatccatccatcc 26630 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26605 atccatccatccatccatcc 26586 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26601 atccatccatccatccatcc 26582 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6225 atccatccatccatccatcc 6206 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6123 atccatccatccatccatcc 6104 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6119 atccatccatccatccatcc 6100 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6115 atccatccatccatccatcc 6096 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6111 atccatccatccatccatcc 6092 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6107 atccatccatccatccatcc 6088 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6103 atccatccatccatccatcc 6084
>gb|AC091810.4| Homo sapiens chromosome X clone CTD-2324A24 map p11.4, complete sequence Length = 100442 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 27715 atccatccatccatccatcctcc 27693 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 27671 atccatccatccatccatcctcc 27649 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 27623 atccatccatccatccatcctcc 27601 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27719 atccatccatccatccatcc 27700 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27683 atccatccatccatccatcc 27664 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27679 atccatccatccatccatcc 27660 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27675 atccatccatccatccatcc 27656 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27631 atccatccatccatccatcc 27612 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27627 atccatccatccatccatcc 27608 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7256 atccatccatccatccatcc 7237 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7154 atccatccatccatccatcc 7135 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7150 atccatccatccatccatcc 7131 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7146 atccatccatccatccatcc 7127 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7142 atccatccatccatccatcc 7123 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7138 atccatccatccatccatcc 7119 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7134 atccatccatccatccatcc 7115
>gb|AE017263.1| Mesoplasma florum L1 complete genome Length = 793224 Score = 46.1 bits (23), Expect = 0.090 Identities = 29/31 (93%) Strand = Plus / Minus Query: 201 ttctgtttcattaattgtttctgatgctttt 231 |||||||||||||||| || ||||||||||| Sbjct: 236026 ttctgtttcattaattattactgatgctttt 235996
>gb|AC131336.9| Mus musculus chromosome 1, clone RP23-96A20, complete sequence Length = 121355 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 75900 atccatccatccatccatcctcc 75922 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75896 atccatccatccatccatcc 75915 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75892 atccatccatccatccatcc 75911 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75888 atccatccatccatccatcc 75907 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75884 atccatccatccatccatcc 75903 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75880 atccatccatccatccatcc 75899 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75876 atccatccatccatccatcc 75895
>gb|AC122457.4| Mus musculus BAC clone RP24-266P11 from chromosome 12, complete sequence Length = 159954 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 108680 atccatccatccatccatcctcc 108658 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109238 atccatccatccatccatcc 109219 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109234 atccatccatccatccatcc 109215 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109187 atccatccatccatccatcc 109168 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109183 atccatccatccatccatcc 109164 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109179 atccatccatccatccatcc 109160 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109175 atccatccatccatccatcc 109156 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109171 atccatccatccatccatcc 109152 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109167 atccatccatccatccatcc 109148 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109163 atccatccatccatccatcc 109144 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108696 atccatccatccatccatcc 108677 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108692 atccatccatccatccatcc 108673 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108688 atccatccatccatccatcc 108669 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108684 atccatccatccatccatcc 108665 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86718 atccatccatccatccatcc 86699 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86714 atccatccatccatccatcc 86695 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86710 atccatccatccatccatcc 86691 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86706 atccatccatccatccatcc 86687 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86702 atccatccatccatccatcc 86683 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86698 atccatccatccatccatcc 86679 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86694 atccatccatccatccatcc 86675
>gb|AF235096.5| Homo sapiens chromosome 8 clone RP11-562D1 map q24.13, complete sequence Length = 199966 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 32330 atccatccatccatccatcctcc 32352 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 32546 atccatccatccatccatcct 32566 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 32473 atccatccatccatccatcc 32492 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 32469 atccatccatccatccatcc 32488 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 32465 atccatccatccatccatcc 32484 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 32461 atccatccatccatccatcc 32480 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatc 193 |||||||||||||||||||| Sbjct: 31949 aatccatccatccatccatc 31968 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 31926 catccatccatccatcctcc 31945 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 31881 catccatccatccatcctcc 31900
>gb|AC158608.10| Mus musculus 10 BAC RP24-405N1 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 181588 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 97728 atccatccatccatccatcctcc 97706 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97812 atccatccatccatccatcc 97793 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97808 atccatccatccatccatcc 97789 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97804 atccatccatccatccatcc 97785 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97800 atccatccatccatccatcc 97781 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97796 atccatccatccatccatcc 97777 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97792 atccatccatccatccatcc 97773 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97748 atccatccatccatccatcc 97729 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97744 atccatccatccatccatcc 97725 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97740 atccatccatccatccatcc 97721 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97736 atccatccatccatccatcc 97717 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97732 atccatccatccatccatcc 97713 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20146 atccatccatccatccatcc 20127 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20142 atccatccatccatccatcc 20123 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20138 atccatccatccatccatcc 20119
>gb|AC155711.14| Mus musculus 10 BAC RP24-189K8 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 183897 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 8725 atccatccatccatccatcctcc 8703 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 8687 atccatccatccatccatcc 8668 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 8683 atccatccatccatccatcc 8664 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 8679 atccatccatccatccatcc 8660 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 8675 atccatccatccatccatcc 8656
>gb|AC113001.9| Mus musculus chromosome 7, clone RP23-184M4, complete sequence Length = 206940 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 135734 atccatccatccatccatcctcc 135712 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 135738 atccatccatccatccatcc 135719
>gb|AC157650.2| Mus musculus BAC clone RP24-573N21 from chromosome 14, complete sequence Length = 186859 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 61503 atccatccatccatccatcctcc 61481 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 61435 atccatccatccatccatcctcc 61413 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 61391 atccatccatccatccatcctcc 61369 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 61363 atccatccatccatccatcctcc 61341 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 61319 atccatccatccatccatcctcc 61297 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 61291 atccatccatccatccatcctcc 61269 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Minus Query: 169 taccaaatccatccatccatccatcc 194 ||||| |||||||||||||||||||| Sbjct: 61529 taccatatccatccatccatccatcc 61504 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 77508 atccatccatccatccatcct 77488 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 20449 atccatccatccatccatcct 20429 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 114216 atccatccatccatccatcc 114197 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 114212 atccatccatccatccatcc 114193 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 114208 atccatccatccatccatcc 114189 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 114204 atccatccatccatccatcc 114185 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 114200 atccatccatccatccatcc 114181 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 114196 atccatccatccatccatcc 114177 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77540 atccatccatccatccatcc 77521 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77536 atccatccatccatccatcc 77517 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77532 atccatccatccatccatcc 77513 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77528 atccatccatccatccatcc 77509 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77524 atccatccatccatccatcc 77505 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77520 atccatccatccatccatcc 77501 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77516 atccatccatccatccatcc 77497 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77512 atccatccatccatccatcc 77493 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77448 atccatccatccatccatcc 77429 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77376 atccatccatccatccatcc 77357 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77372 atccatccatccatccatcc 77353 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77368 atccatccatccatccatcc 77349 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77364 atccatccatccatccatcc 77345 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77360 atccatccatccatccatcc 77341 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77356 atccatccatccatccatcc 77337 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77352 atccatccatccatccatcc 77333 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 77320 atccatccatccatccatcc 77301 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61519 atccatccatccatccatcc 61500 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61515 atccatccatccatccatcc 61496 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61511 atccatccatccatccatcc 61492 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61507 atccatccatccatccatcc 61488 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61459 atccatccatccatccatcc 61440 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61411 atccatccatccatccatcc 61392 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61407 atccatccatccatccatcc 61388 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61403 atccatccatccatccatcc 61384 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61399 atccatccatccatccatcc 61380 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61395 atccatccatccatccatcc 61376 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61367 atccatccatccatccatcc 61348 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61339 atccatccatccatccatcc 61320 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61335 atccatccatccatccatcc 61316 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61331 atccatccatccatccatcc 61312 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61327 atccatccatccatccatcc 61308 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61323 atccatccatccatccatcc 61304 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 61295 atccatccatccatccatcc 61276 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57133 atccatccatccatccatcc 57114 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57129 atccatccatccatccatcc 57110 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57125 atccatccatccatccatcc 57106 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57121 atccatccatccatccatcc 57102 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57117 atccatccatccatccatcc 57098 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57113 atccatccatccatccatcc 57094 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57109 atccatccatccatccatcc 57090 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57081 atccatccatccatccatcc 57062 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57077 atccatccatccatccatcc 57058 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57073 atccatccatccatccatcc 57054 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57069 atccatccatccatccatcc 57050 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57065 atccatccatccatccatcc 57046 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57061 atccatccatccatccatcc 57042 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23304 atccatccatccatccatcc 23285 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23300 atccatccatccatccatcc 23281 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23296 atccatccatccatccatcc 23277 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23267 atccatccatccatccatcc 23248 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23218 atccatccatccatccatcc 23199 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23214 atccatccatccatccatcc 23195 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23135 atccatccatccatccatcc 23116 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23131 atccatccatccatccatcc 23112 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23106 atccatccatccatccatcc 23087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23049 atccatccatccatccatcc 23030 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23045 atccatccatccatccatcc 23026 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20469 atccatccatccatccatcc 20450 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20465 atccatccatccatccatcc 20446 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20461 atccatccatccatccatcc 20442 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20457 atccatccatccatccatcc 20438 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20453 atccatccatccatccatcc 20434
>gb|AC118540.15| Mus musculus strain 129/SvJ clone mgs1-169d12 map 3, complete sequence Length = 191014 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 17016 atccatccatccatccatcctcc 16994 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 172567 atccatccatccatccatcc 172586 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 17020 atccatccatccatccatcc 17001
>gb|AC183833.2| Pan troglodytes BAC clone CH251-141C5 from chromosome 7, complete sequence Length = 155911 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 60148 atccatccatccatccatcctcc 60170 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 177 ccatccatccatccatcctcc 197 ||||||||||||||||||||| Sbjct: 60526 ccatccatccatccatcctcc 60546 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 60652 atccatccatccatccatcc 60671 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 60648 atccatccatccatccatcc 60667 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 60252 atccatccatccatccatcc 60271 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 60076 atccatccatccatccatcc 60095 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 60072 atccatccatccatccatcc 60091 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 60068 atccatccatccatccatcc 60087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59894 atccatccatccatccatcc 59913 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59890 atccatccatccatccatcc 59909 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59844 atccatccatccatccatcc 59863 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59840 atccatccatccatccatcc 59859
>gb|AC131679.2| Mus musculus BAC clone RP23-339I6 from chromosome 5, complete sequence Length = 198890 Score = 46.1 bits (23), Expect = 0.090 Identities = 26/27 (96%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctcct 201 |||||||||||||||||||| |||||| Sbjct: 91105 atccatccatccatccatccccctcct 91079 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 183526 atccatccatccatccatcc 183507 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91125 atccatccatccatccatcc 91106 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91121 atccatccatccatccatcc 91102 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91117 atccatccatccatccatcc 91098 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91113 atccatccatccatccatcc 91094 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91109 atccatccatccatccatcc 91090
>gb|AC093168.3| Homo sapiens BAC clone RP11-148M21 from 7, complete sequence Length = 148689 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 101911 atccatccatccatccatcctcc 101933 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 177 ccatccatccatccatcctcc 197 ||||||||||||||||||||| Sbjct: 102285 ccatccatccatccatcctcc 102305 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102403 atccatccatccatccatcc 102422 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102399 atccatccatccatccatcc 102418 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102395 atccatccatccatccatcc 102414 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101839 atccatccatccatccatcc 101858 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101835 atccatccatccatccatcc 101854 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101831 atccatccatccatccatcc 101850 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101827 atccatccatccatccatcc 101846 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101823 atccatccatccatccatcc 101842 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101819 atccatccatccatccatcc 101838 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101815 atccatccatccatccatcc 101834 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101641 atccatccatccatccatcc 101660 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101637 atccatccatccatccatcc 101656 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101633 atccatccatccatccatcc 101652 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101629 atccatccatccatccatcc 101648 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101625 atccatccatccatccatcc 101644 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101621 atccatccatccatccatcc 101640
>gb|AC145199.3| Mus musculus BAC clone RP23-173N12 from chromosome 7, complete sequence Length = 220892 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 14430 atccatccatccatccatcctcc 14452 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143720 atccatccatccatccatcc 143701 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 14426 atccatccatccatccatcc 14445 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 14422 atccatccatccatccatcc 14441 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 14418 atccatccatccatccatcc 14437
>gb|AC124449.3| Mus musculus BAC clone RP24-212N10 from chromosome 15, complete sequence Length = 165858 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 59611 caaatccatccatccatccatcc 59589 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140875 atccatccatccatccatcc 140894 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140871 atccatccatccatccatcc 140890 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140867 atccatccatccatccatcc 140886 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140863 atccatccatccatccatcc 140882 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140859 atccatccatccatccatcc 140878 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140855 atccatccatccatccatcc 140874 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140851 atccatccatccatccatcc 140870 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140847 atccatccatccatccatcc 140866 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140799 atccatccatccatccatcc 140818 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140795 atccatccatccatccatcc 140814 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140739 atccatccatccatccatcc 140758 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140735 atccatccatccatccatcc 140754 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140692 atccatccatccatccatcc 140711 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140688 atccatccatccatccatcc 140707 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140684 atccatccatccatccatcc 140703 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140680 atccatccatccatccatcc 140699 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140676 atccatccatccatccatcc 140695 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140672 atccatccatccatccatcc 140691 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140629 atccatccatccatccatcc 140648 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140625 atccatccatccatccatcc 140644 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140621 atccatccatccatccatcc 140640 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140617 atccatccatccatccatcc 140636 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140613 atccatccatccatccatcc 140632 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140609 atccatccatccatccatcc 140628 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140605 atccatccatccatccatcc 140624 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109576 atccatccatccatccatcc 109595 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109572 atccatccatccatccatcc 109591 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109568 atccatccatccatccatcc 109587 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109564 atccatccatccatccatcc 109583 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109560 atccatccatccatccatcc 109579 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109556 atccatccatccatccatcc 109575 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109358 atccatccatccatccatcc 109377 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109354 atccatccatccatccatcc 109373 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109350 atccatccatccatccatcc 109369 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109346 atccatccatccatccatcc 109365 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109342 atccatccatccatccatcc 109361 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109338 atccatccatccatccatcc 109357 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 78511 atccatccatccatccatcc 78530 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15581 atccatccatccatccatcc 15600 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15577 atccatccatccatccatcc 15596 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15573 atccatccatccatccatcc 15592 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15569 atccatccatccatccatcc 15588 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15565 atccatccatccatccatcc 15584 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15178 atccatccatccatccatcc 15197 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15174 atccatccatccatccatcc 15193 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15170 atccatccatccatccatcc 15189 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15166 atccatccatccatccatcc 15185 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15162 atccatccatccatccatcc 15181 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15158 atccatccatccatccatcc 15177 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15154 atccatccatccatccatcc 15173 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15102 atccatccatccatccatcc 15121 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15098 atccatccatccatccatcc 15117
>gb|AC140782.4| Mus musculus BAC clone RP24-417N13 from chromosome 7, complete sequence Length = 196282 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 63961 atccatccatccatccatcctcc 63939 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 64029 atccatccatccatccatcc 64010 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 64025 atccatccatccatccatcc 64006 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 64021 atccatccatccatccatcc 64002 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 64017 atccatccatccatccatcc 63998 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 63965 atccatccatccatccatcc 63946
>gb|DQ483433.1| Gymnogyps californianus clone 136H microsatellite sequence Length = 613 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 424 atccatccatccatccatcctcc 402 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 436 atccatccatccatccatcc 417 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 432 atccatccatccatccatcc 413 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 428 atccatccatccatccatcc 409
>gb|DQ483431.1| Gymnogyps californianus clone 134H microsatellite sequence Length = 1710 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 983 atccatccatccatccatcctcc 961 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1479 atccatccatccatccatcc 1460 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1475 atccatccatccatccatcc 1456 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1471 atccatccatccatccatcc 1452 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 995 atccatccatccatccatcc 976 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 991 atccatccatccatccatcc 972 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 987 atccatccatccatccatcc 968
>gb|DQ483369.1| Gymnogyps californianus clone 72H microsatellite sequence Length = 962 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 522 atccatccatccatccatcctcc 544 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 518 atccatccatccatccatcc 537 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 514 atccatccatccatccatcc 533 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 510 atccatccatccatccatcc 529 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 193 atccatccatccatccatcc 174 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 189 atccatccatccatccatcc 170 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 185 atccatccatccatccatcc 166 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 181 atccatccatccatccatcc 162 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 177 atccatccatccatccatcc 158 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 173 atccatccatccatccatcc 154
>gb|DQ483367.1| Gymnogyps californianus clone 70H microsatellite sequence Length = 609 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 424 atccatccatccatccatcctcc 402 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 432 atccatccatccatccatcc 413 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 428 atccatccatccatccatcc 409
>emb|CR626875.10| Zebrafish DNA sequence from clone DKEY-31J4 in linkage group 15, complete sequence Length = 212742 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 80937 caaatccatccatccatccatcc 80915 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 173 aaatccatccatccatccatcc 194 |||||||||||||||||||||| Sbjct: 91510 aaatccatccatccatccatcc 91531 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 173 aaatccatccatccatccatcc 194 |||||||||||||||||||||| Sbjct: 91134 aaatccatccatccatccatcc 91155 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 173 aaatccatccatccatccatcc 194 |||||||||||||||||||||| Sbjct: 90922 aaatccatccatccatccatcc 90943 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 173 aaatccatccatccatccatcc 194 |||||||||||||||||||||| Sbjct: 90556 aaatccatccatccatccatcc 90577 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 141630 atccatccatccatccatcc 141611 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 141626 atccatccatccatccatcc 141607 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 141622 atccatccatccatccatcc 141603 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 141618 atccatccatccatccatcc 141599 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 141614 atccatccatccatccatcc 141595 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 141610 atccatccatccatccatcc 141591 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 141606 atccatccatccatccatcc 141587 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 141602 atccatccatccatccatcc 141583 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 141598 atccatccatccatccatcc 141579 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 141340 atccatccatccatccatcc 141321 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 141336 atccatccatccatccatcc 141317 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140980 atccatccatccatccatcc 140961 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140976 atccatccatccatccatcc 140957 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140972 atccatccatccatccatcc 140953 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140968 atccatccatccatccatcc 140949 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140964 atccatccatccatccatcc 140945 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140960 atccatccatccatccatcc 140941 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140956 atccatccatccatccatcc 140937 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140952 atccatccatccatccatcc 140933 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140948 atccatccatccatccatcc 140929 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140944 atccatccatccatccatcc 140925 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140940 atccatccatccatccatcc 140921 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140936 atccatccatccatccatcc 140917 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140932 atccatccatccatccatcc 140913 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140928 atccatccatccatccatcc 140909 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140924 atccatccatccatccatcc 140905 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140920 atccatccatccatccatcc 140901 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140916 atccatccatccatccatcc 140897 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140912 atccatccatccatccatcc 140893 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140908 atccatccatccatccatcc 140889 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140904 atccatccatccatccatcc 140885 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140900 atccatccatccatccatcc 140881 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 139482 atccatccatccatccatcc 139463 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatc 193 |||||||||||||||||||| Sbjct: 91627 aatccatccatccatccatc 91646 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91528 atccatccatccatccatcc 91547 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91524 atccatccatccatccatcc 91543 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91520 atccatccatccatccatcc 91539 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91516 atccatccatccatccatcc 91535 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91172 atccatccatccatccatcc 91191 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91168 atccatccatccatccatcc 91187 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91164 atccatccatccatccatcc 91183 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91160 atccatccatccatccatcc 91179 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91156 atccatccatccatccatcc 91175 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91152 atccatccatccatccatcc 91171 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91148 atccatccatccatccatcc 91167 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91144 atccatccatccatccatcc 91163 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 91140 atccatccatccatccatcc 91159 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90928 atccatccatccatccatcc 90947 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90562 atccatccatccatccatcc 90581 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90137 atccatccatccatccatcc 90156 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90133 atccatccatccatccatcc 90152 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89989 atccatccatccatccatcc 90008 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89985 atccatccatccatccatcc 90004 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89981 atccatccatccatccatcc 90000 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89977 atccatccatccatccatcc 89996 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89973 atccatccatccatccatcc 89992 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89969 atccatccatccatccatcc 89988 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89965 atccatccatccatccatcc 89984 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89961 atccatccatccatccatcc 89980 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89957 atccatccatccatccatcc 89976 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89953 atccatccatccatccatcc 89972 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81454 atccatccatccatccatcc 81435 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81450 atccatccatccatccatcc 81431 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81446 atccatccatccatccatcc 81427 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81442 atccatccatccatccatcc 81423 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81331 atccatccatccatccatcc 81312 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81327 atccatccatccatccatcc 81308 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81323 atccatccatccatccatcc 81304 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81040 atccatccatccatccatcc 81021 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81036 atccatccatccatccatcc 81017 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81032 atccatccatccatccatcc 81013 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81028 atccatccatccatccatcc 81009 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81024 atccatccatccatccatcc 81005 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81020 atccatccatccatccatcc 81001 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80930 atccatccatccatccatcc 80911 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80926 atccatccatccatccatcc 80907 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80922 atccatccatccatccatcc 80903 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80918 atccatccatccatccatcc 80899 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80914 atccatccatccatccatcc 80895 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80757 atccatccatccatccatcc 80738 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80753 atccatccatccatccatcc 80734 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80749 atccatccatccatccatcc 80730 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80745 atccatccatccatccatcc 80726 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80741 atccatccatccatccatcc 80722 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80737 atccatccatccatccatcc 80718 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80733 atccatccatccatccatcc 80714 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80729 atccatccatccatccatcc 80710 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80725 atccatccatccatccatcc 80706 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80721 atccatccatccatccatcc 80702 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80717 atccatccatccatccatcc 80698 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80713 atccatccatccatccatcc 80694 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80709 atccatccatccatccatcc 80690 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80705 atccatccatccatccatcc 80686 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80701 atccatccatccatccatcc 80682 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80697 atccatccatccatccatcc 80678 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80693 atccatccatccatccatcc 80674 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80689 atccatccatccatccatcc 80670 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80685 atccatccatccatccatcc 80666 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80681 atccatccatccatccatcc 80662 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80677 atccatccatccatccatcc 80658 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80673 atccatccatccatccatcc 80654 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80669 atccatccatccatccatcc 80650 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80665 atccatccatccatccatcc 80646 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80661 atccatccatccatccatcc 80642 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80657 atccatccatccatccatcc 80638 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80653 atccatccatccatccatcc 80634 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80649 atccatccatccatccatcc 80630 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80645 atccatccatccatccatcc 80626 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80641 atccatccatccatccatcc 80622 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80637 atccatccatccatccatcc 80618 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80633 atccatccatccatccatcc 80614 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80629 atccatccatccatccatcc 80610 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80625 atccatccatccatccatcc 80606 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80621 atccatccatccatccatcc 80602 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80617 atccatccatccatccatcc 80598 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80613 atccatccatccatccatcc 80594 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80609 atccatccatccatccatcc 80590 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80605 atccatccatccatccatcc 80586 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80601 atccatccatccatccatcc 80582 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80597 atccatccatccatccatcc 80578 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80593 atccatccatccatccatcc 80574 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80589 atccatccatccatccatcc 80570 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80585 atccatccatccatccatcc 80566 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80581 atccatccatccatccatcc 80562 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80577 atccatccatccatccatcc 80558 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80573 atccatccatccatccatcc 80554 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80569 atccatccatccatccatcc 80550 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80565 atccatccatccatccatcc 80546 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80561 atccatccatccatccatcc 80542 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80557 atccatccatccatccatcc 80538 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80553 atccatccatccatccatcc 80534 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80549 atccatccatccatccatcc 80530 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33434 atccatccatccatccatcc 33453 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33430 atccatccatccatccatcc 33449 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33426 atccatccatccatccatcc 33445 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33392 atccatccatccatccatcc 33411 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33388 atccatccatccatccatcc 33407
>gb|AC127259.3| Mus musculus BAC clone RP24-304A20 from chromosome 9, complete sequence Length = 162717 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 67614 atccatccatccatccatcctcc 67592 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 67042 atccatccatccatccatcc 67023 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 67038 atccatccatccatccatcc 67019 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 67034 atccatccatccatccatcc 67015 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 67030 atccatccatccatccatcc 67011 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 67026 atccatccatccatccatcc 67007 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 67022 atccatccatccatccatcc 67003 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 67018 atccatccatccatccatcc 66999
>gb|AC121909.3| Mus musculus BAC clone RP24-179L9 from chromosome 5, complete sequence Length = 155771 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 120910 atccatccatccatccatcctcc 120888 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121181 atccatccatccatccatcc 121162 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121057 atccatccatccatccatcc 121038 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121053 atccatccatccatccatcc 121034 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121049 atccatccatccatccatcc 121030 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121045 atccatccatccatccatcc 121026 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121041 atccatccatccatccatcc 121022 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120914 atccatccatccatccatcc 120895 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120811 atccatccatccatccatcc 120792 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120807 atccatccatccatccatcc 120788 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92904 atccatccatccatccatcc 92885 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82947 atccatccatccatccatcc 82928 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82943 atccatccatccatccatcc 82924 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82939 atccatccatccatccatcc 82920 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82935 atccatccatccatccatcc 82916 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82931 atccatccatccatccatcc 82912 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82927 atccatccatccatccatcc 82908 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82923 atccatccatccatccatcc 82904 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82835 atccatccatccatccatcc 82816 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82831 atccatccatccatccatcc 82812 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82827 atccatccatccatccatcc 82808 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82823 atccatccatccatccatcc 82804 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 60719 atccatccatccatccatcc 60700
>gb|AC122414.4| Mus musculus BAC clone RP24-150D8 from chromosome 5, complete sequence Length = 186986 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 13045 atccatccatccatccatcctcc 13023 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42012 atccatccatccatccatcc 41993 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42008 atccatccatccatccatcc 41989 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42004 atccatccatccatccatcc 41985 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42000 atccatccatccatccatcc 41981 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41996 atccatccatccatccatcc 41977 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41992 atccatccatccatccatcc 41973 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41988 atccatccatccatccatcc 41969 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41984 atccatccatccatccatcc 41965 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41980 atccatccatccatccatcc 41961 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41731 atccatccatccatccatcc 41712 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41727 atccatccatccatccatcc 41708 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41723 atccatccatccatccatcc 41704 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41719 atccatccatccatccatcc 41700 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41715 atccatccatccatccatcc 41696 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41711 atccatccatccatccatcc 41692 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41707 atccatccatccatccatcc 41688 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 41703 atccatccatccatccatcc 41684 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13049 atccatccatccatccatcc 13030
>gb|AC127414.4| Mus musculus BAC clone RP23-246P24 from chromosome 7, complete sequence Length = 218222 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 36139 atccatccatccatccatcctcc 36117 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 36207 atccatccatccatccatcc 36188 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 36203 atccatccatccatccatcc 36184 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 36199 atccatccatccatccatcc 36180 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 36195 atccatccatccatccatcc 36176 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 36143 atccatccatccatccatcc 36124
>emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 in linkage group 16, complete sequence Length = 179375 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 133901 caaatccatccatccatccatcc 133923 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 122994 aatccatccatccatccatcc 123014 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 28578 atccatccatccatccatcct 28558 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 28454 atccatccatccatccatcct 28434 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 28342 atccatccatccatccatcct 28322 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 28222 atccatccatccatccatcct 28202 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 28026 atccatccatccatccatcct 28006 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 27918 atccatccatccatccatcct 27898 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176133 atccatccatccatccatcc 176114 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176129 atccatccatccatccatcc 176110 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176125 atccatccatccatccatcc 176106 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176121 atccatccatccatccatcc 176102 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176117 atccatccatccatccatcc 176098 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176113 atccatccatccatccatcc 176094 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176109 atccatccatccatccatcc 176090 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176105 atccatccatccatccatcc 176086 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176101 atccatccatccatccatcc 176082 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176097 atccatccatccatccatcc 176078 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176093 atccatccatccatccatcc 176074 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176089 atccatccatccatccatcc 176070 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176085 atccatccatccatccatcc 176066 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176081 atccatccatccatccatcc 176062 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176077 atccatccatccatccatcc 176058 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176073 atccatccatccatccatcc 176054 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176069 atccatccatccatccatcc 176050 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176065 atccatccatccatccatcc 176046 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176061 atccatccatccatccatcc 176042 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176057 atccatccatccatccatcc 176038 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176053 atccatccatccatccatcc 176034 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176049 atccatccatccatccatcc 176030 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176045 atccatccatccatccatcc 176026 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176041 atccatccatccatccatcc 176022 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176037 atccatccatccatccatcc 176018 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176033 atccatccatccatccatcc 176014 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176029 atccatccatccatccatcc 176010 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176025 atccatccatccatccatcc 176006 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176021 atccatccatccatccatcc 176002 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176017 atccatccatccatccatcc 175998 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175672 atccatccatccatccatcc 175653 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175632 atccatccatccatccatcc 175613 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175628 atccatccatccatccatcc 175609 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175624 atccatccatccatccatcc 175605 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175620 atccatccatccatccatcc 175601 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175616 atccatccatccatccatcc 175597 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134632 atccatccatccatccatcc 134651 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134164 atccatccatccatccatcc 134183 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133998 atccatccatccatccatcc 134017 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133994 atccatccatccatccatcc 134013 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133990 atccatccatccatccatcc 134009 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133986 atccatccatccatccatcc 134005 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133982 atccatccatccatccatcc 134001 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133908 atccatccatccatccatcc 133927 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133341 atccatccatccatccatcc 133360 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133337 atccatccatccatccatcc 133356 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133333 atccatccatccatccatcc 133352 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133329 atccatccatccatccatcc 133348 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133325 atccatccatccatccatcc 133344 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132683 atccatccatccatccatcc 132702 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132679 atccatccatccatccatcc 132698 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132675 atccatccatccatccatcc 132694 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132555 atccatccatccatccatcc 132574 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132319 atccatccatccatccatcc 132338 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132315 atccatccatccatccatcc 132334 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132033 atccatccatccatccatcc 132052 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132029 atccatccatccatccatcc 132048 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131867 atccatccatccatccatcc 131886 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131863 atccatccatccatccatcc 131882 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131453 atccatccatccatccatcc 131472 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131449 atccatccatccatccatcc 131468 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130889 atccatccatccatccatcc 130908 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130607 atccatccatccatccatcc 130626 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130603 atccatccatccatccatcc 130622 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130445 atccatccatccatccatcc 130464 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130441 atccatccatccatccatcc 130460 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130031 atccatccatccatccatcc 130050 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130027 atccatccatccatccatcc 130046 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129484 atccatccatccatccatcc 129503 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129460 atccatccatccatccatcc 129479 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129456 atccatccatccatccatcc 129475 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129452 atccatccatccatccatcc 129471 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129448 atccatccatccatccatcc 129467 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129444 atccatccatccatccatcc 129463 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129440 atccatccatccatccatcc 129459 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129436 atccatccatccatccatcc 129455 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 123147 atccatccatccatccatcc 123166 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28618 atccatccatccatccatcc 28599 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28614 atccatccatccatccatcc 28595 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28610 atccatccatccatccatcc 28591 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28606 atccatccatccatccatcc 28587 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28602 atccatccatccatccatcc 28583 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28598 atccatccatccatccatcc 28579 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28594 atccatccatccatccatcc 28575 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28590 atccatccatccatccatcc 28571 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28586 atccatccatccatccatcc 28567 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28582 atccatccatccatccatcc 28563 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28462 atccatccatccatccatcc 28443 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28458 atccatccatccatccatcc 28439 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28350 atccatccatccatccatcc 28331 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28346 atccatccatccatccatcc 28327 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28258 atccatccatccatccatcc 28239 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28254 atccatccatccatccatcc 28235 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28250 atccatccatccatccatcc 28231 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28246 atccatccatccatccatcc 28227 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28242 atccatccatccatccatcc 28223 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28238 atccatccatccatccatcc 28219 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28234 atccatccatccatccatcc 28215 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28230 atccatccatccatccatcc 28211 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28226 atccatccatccatccatcc 28207 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28034 atccatccatccatccatcc 28015 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28030 atccatccatccatccatcc 28011 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27938 atccatccatccatccatcc 27919 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27934 atccatccatccatccatcc 27915 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27930 atccatccatccatccatcc 27911 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27926 atccatccatccatccatcc 27907 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27922 atccatccatccatccatcc 27903
>emb|BX649517.15| Zebrafish DNA sequence from clone DKEY-174D5 in linkage group 8, complete sequence Length = 194350 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 174 aatccatccatccatccatcctc 196 ||||||||||||||||||||||| Sbjct: 169114 aatccatccatccatccatcctc 169092 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctc 196 |||||||||||||||||||||| Sbjct: 169140 atccatccatccatccatcctc 169119 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 169148 atccatccatccatccatcc 169129 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 169144 atccatccatccatccatcc 169125
>gb|AY330727.1| Corcorax melanorhamphos microsatellite CmeG5 sequence Length = 163 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 59 atccatccatccatccatcctcc 81
>gb|AC103968.11| Homo sapiens chromosome 15, clone RP11-719C20, complete sequence Length = 162470 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 86114 atccatccatccatccatcctcc 86092 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 176 tccatccatccatccatcctcc 197 |||||||||||||||||||||| Sbjct: 85834 tccatccatccatccatcctcc 85813 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 85980 atccatccatccatccatcct 85960 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 86149 catccatccatccatcctcc 86130 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86122 atccatccatccatccatcc 86103 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86118 atccatccatccatccatcc 86099 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 86011 catccatccatccatcctcc 85992 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85984 atccatccatccatccatcc 85965 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85862 atccatccatccatccatcc 85843
>gb|AC129202.3| Mus musculus BAC clone RP24-225J1 from chromosome 13, complete sequence Length = 168558 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 30699 atccatccatccatccatcctcc 30721 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 30695 atccatccatccatccatcc 30714 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 30691 atccatccatccatccatcc 30710 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 30687 atccatccatccatccatcc 30706 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 30683 atccatccatccatccatcc 30702 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 30679 atccatccatccatccatcc 30698
>gb|AC124684.3| Mus musculus BAC clone RP24-375D13 from chromosome 1, complete sequence Length = 167927 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 173 aaatccatccatccatccatcct 195 ||||||||||||||||||||||| Sbjct: 26781 aaatccatccatccatccatcct 26803 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 26883 atccatccatccatccatcct 26903 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26879 atccatccatccatccatcc 26898 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26875 atccatccatccatccatcc 26894 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26871 atccatccatccatccatcc 26890 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26867 atccatccatccatccatcc 26886 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26839 atccatccatccatccatcc 26858
>gb|AC127283.2| Mus musculus BAC clone RP23-323E20 from chromosome 3, complete sequence Length = 210014 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 45382 atccatccatccatccatcctcc 45360 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 200935 atccatccatccatccatcc 200954 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45386 atccatccatccatccatcc 45367
>gb|AC115797.16| Mus musculus chromosome 17, clone RP23-405J10, complete sequence Length = 193909 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 182282 caaatccatccatccatccatcc 182260 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 182275 atccatccatccatccatcc 182256 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 182271 atccatccatccatccatcc 182252 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 182267 atccatccatccatccatcc 182248 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 182263 atccatccatccatccatcc 182244 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 182259 atccatccatccatccatcc 182240 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 182255 atccatccatccatccatcc 182236
>emb|CR713789.2|CNS0GDPL Tetraodon nigroviridis full-length cDNA Length = 690 Score = 46.1 bits (23), Expect = 0.090 Identities = 26/27 (96%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcctcct 201 |||||||||||||||||||| |||||| Sbjct: 238 atccatccatccatccatccgcctcct 264 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 234 atccatccatccatccatcc 253
>gb|AC110237.8| Mus musculus chromosome 5, clone RP23-104B24, complete sequence Length = 243323 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 96230 atccatccatccatccatcctcc 96252 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96226 atccatccatccatccatcc 96245 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96222 atccatccatccatccatcc 96241 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96218 atccatccatccatccatcc 96237 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96214 atccatccatccatccatcc 96233
>gb|AC120544.9| Mus musculus chromosome 1, clone RP23-299N6, complete sequence Length = 223752 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 198892 atccatccatccatccatcctcc 198870 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 198896 atccatccatccatccatcc 198877
>emb|BX901913.8| Zebrafish DNA sequence from clone CH211-241E15 in linkage group 1, complete sequence Length = 142370 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 87802 atccatccatccatccatcctcc 87780 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 87738 atccatccatccatccatcctcc 87716 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctc 196 |||||||||||||||||||||| Sbjct: 87287 atccatccatccatccatcctc 87266 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88456 atccatccatccatccatcc 88437 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88452 atccatccatccatccatcc 88433 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88268 atccatccatccatccatcc 88249 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88264 atccatccatccatccatcc 88245 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88208 atccatccatccatccatcc 88189 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88204 atccatccatccatccatcc 88185 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88200 atccatccatccatccatcc 88181 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88196 atccatccatccatccatcc 88177 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88101 atccatccatccatccatcc 88082 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88097 atccatccatccatccatcc 88078 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88093 atccatccatccatccatcc 88074 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88001 atccatccatccatccatcc 87982 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87818 atccatccatccatccatcc 87799 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87814 atccatccatccatccatcc 87795 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87810 atccatccatccatccatcc 87791 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87806 atccatccatccatccatcc 87787 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87746 atccatccatccatccatcc 87727 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87742 atccatccatccatccatcc 87723 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87682 atccatccatccatccatcc 87663 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87678 atccatccatccatccatcc 87659 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87674 atccatccatccatccatcc 87655 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87670 atccatccatccatccatcc 87651 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87666 atccatccatccatccatcc 87647 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87547 atccatccatccatccatcc 87528 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87503 atccatccatccatccatcc 87484 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87499 atccatccatccatccatcc 87480 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87495 atccatccatccatccatcc 87476 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87491 atccatccatccatccatcc 87472 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87487 atccatccatccatccatcc 87468 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87483 atccatccatccatccatcc 87464 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87479 atccatccatccatccatcc 87460 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87475 atccatccatccatccatcc 87456 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87471 atccatccatccatccatcc 87452 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87467 atccatccatccatccatcc 87448 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87463 atccatccatccatccatcc 87444 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87459 atccatccatccatccatcc 87440 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87455 atccatccatccatccatcc 87436 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87451 atccatccatccatccatcc 87432 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87447 atccatccatccatccatcc 87428 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87383 atccatccatccatccatcc 87364 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87379 atccatccatccatccatcc 87360 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87347 atccatccatccatccatcc 87328 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87343 atccatccatccatccatcc 87324 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87303 atccatccatccatccatcc 87284 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87299 atccatccatccatccatcc 87280 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87295 atccatccatccatccatcc 87276 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87291 atccatccatccatccatcc 87272
>emb|CR933557.2| Human DNA sequence from clone XX-FW1777B19L on chromosome 22, complete sequence Length = 10249 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 1211 caaatccatccatccatccatcc 1189 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 1184 atccatccatccatccatcct 1164 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 1068 atccatccatccatccatcct 1048 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 948 atccatccatccatccatcct 928 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 832 atccatccatccatccatcct 812 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1204 atccatccatccatccatcc 1185 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1200 atccatccatccatccatcc 1181 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1196 atccatccatccatccatcc 1177 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1192 atccatccatccatccatcc 1173 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1188 atccatccatccatccatcc 1169 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1138 atccatccatccatccatcc 1119 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1080 atccatccatccatccatcc 1061 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1076 atccatccatccatccatcc 1057 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1072 atccatccatccatccatcc 1053 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1022 atccatccatccatccatcc 1003 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1018 atccatccatccatccatcc 999 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 1014 atccatccatccatccatcc 995 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 964 atccatccatccatccatcc 945 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 960 atccatccatccatccatcc 941 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 956 atccatccatccatccatcc 937 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 952 atccatccatccatccatcc 933 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 902 atccatccatccatccatcc 883 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 848 atccatccatccatccatcc 829 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 844 atccatccatccatccatcc 825 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 840 atccatccatccatccatcc 821 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 836 atccatccatccatccatcc 817 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 783 catccatccatccatcctcc 764
>emb|BX927158.14| Zebrafish DNA sequence from clone DKEY-106K1 in linkage group 5, complete sequence Length = 144909 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 39157 atccatccatccatccatcctcc 39179 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcct 195 |||||||||||||||||||||| Sbjct: 39417 aatccatccatccatccatcct 39438 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 39513 atccatccatccatccatcct 39533 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 39319 atccatccatccatccatcct 39339 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143836 atccatccatccatccatcc 143855 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143832 atccatccatccatccatcc 143851 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143544 atccatccatccatccatcc 143563 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143264 atccatccatccatccatcc 143283 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143260 atccatccatccatccatcc 143279 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 176 tccatccatccatccatcct 195 |||||||||||||||||||| Sbjct: 142965 tccatccatccatccatcct 142984 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 142883 atccatccatccatccatcc 142902 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 142807 atccatccatccatccatcc 142826 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 142803 atccatccatccatccatcc 142822 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 142661 atccatccatccatccatcc 142680 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 39691 atccatccatccatccatcc 39710 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 39509 atccatccatccatccatcc 39528 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 39505 atccatccatccatccatcc 39524 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 176 tccatccatccatccatcct 195 |||||||||||||||||||| Sbjct: 39229 tccatccatccatccatcct 39248 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 39063 atccatccatccatccatcc 39082
>emb|BX546033.1| Human DNA sequence from clone XX-FW80414D10L on chromosome 22, complete sequence Length = 9070 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 6816 atccatccatccatccatcctcc 6838 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 176 tccatccatccatccatcct 195 |||||||||||||||||||| Sbjct: 7618 tccatccatccatccatcct 7637 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6812 atccatccatccatccatcc 6831 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6201 atccatccatccatccatcc 6220 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6197 atccatccatccatccatcc 6216 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6193 atccatccatccatccatcc 6212 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6121 atccatccatccatccatcc 6140
>emb|AL589702.8| Human DNA sequence from clone RP5-907A6 on chromosome 1, complete sequence Length = 107103 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 100313 atccatccatccatccatcctcc 100335 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 100165 atccatccatccatccatcctcc 100187 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103804 atccatccatccatccatcc 103823 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103800 atccatccatccatccatcc 103819 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103796 atccatccatccatccatcc 103815 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103792 atccatccatccatccatcc 103811 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103788 atccatccatccatccatcc 103807 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103784 atccatccatccatccatcc 103803 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100375 atccatccatccatccatcc 100394 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100371 atccatccatccatccatcc 100390 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100367 atccatccatccatccatcc 100386 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100309 atccatccatccatccatcc 100328 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100161 atccatccatccatccatcc 100180 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79693 atccatccatccatccatcc 79712 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79566 atccatccatccatccatcc 79585 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79411 atccatccatccatccatcc 79430 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79111 atccatccatccatccatcc 79130 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79107 atccatccatccatccatcc 79126 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79103 atccatccatccatccatcc 79122 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 79099 atccatccatccatccatcc 79118 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 78875 atccatccatccatccatcc 78894 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 78871 atccatccatccatccatcc 78890 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 78867 atccatccatccatccatcc 78886 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 78863 atccatccatccatccatcc 78882
>emb|AL929420.9| Human DNA sequence from clone CITF22-123F2 on chromosome 22, complete sequence Length = 15041 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 986 atccatccatccatccatcctcc 1008 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 176 tccatccatccatccatcct 195 |||||||||||||||||||| Sbjct: 1788 tccatccatccatccatcct 1807 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 982 atccatccatccatccatcc 1001 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 371 atccatccatccatccatcc 390 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 367 atccatccatccatccatcc 386 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 363 atccatccatccatccatcc 382 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 359 atccatccatccatccatcc 378 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 287 atccatccatccatccatcc 306
>emb|AL583848.9| Human DNA sequence from clone RP11-259F4 on chromosome 13 Contains a novel transcript and a CpG island, complete sequence Length = 70527 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 25045 caaatccatccatccatccatcc 25067 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 25056 atccatccatccatccatcc 25075 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 25052 atccatccatccatccatcc 25071
>emb|AL583882.6| Human DNA sequence from clone RP5-1098C18 on chromosome 1p36.23-36.33 Contains GSSs, STSs and a CpG island, complete sequence Length = 90582 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 49898 atccatccatccatccatcctcc 49876 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50307 atccatccatccatccatcc 50288 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49922 atccatccatccatccatcc 49903 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49918 atccatccatccatccatcc 49899 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49914 atccatccatccatccatcc 49895 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49910 atccatccatccatccatcc 49891 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49906 atccatccatccatccatcc 49887 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49902 atccatccatccatccatcc 49883 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49306 atccatccatccatccatcc 49287
>emb|AL513206.6| Human DNA sequence from clone RP11-382F13 on chromosome 1 Contains part of the VAV3 gene for VAV3 oncogene, complete sequence Length = 108124 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 12145 atccatccatccatccatcctcc 12123 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 12157 atccatccatccatccatcc 12138 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 12153 atccatccatccatccatcc 12134 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 12149 atccatccatccatccatcc 12130
>emb|AL445305.11| Human DNA sequence from clone RP11-365D23 on chromosome 1 Contains an adaptor-related protein complex 3 pseudogene, a keratin 18 (KRT18) pseudogene, a novel pseudogene, a ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1) pseudogene, the 5' end of the CENPF gene for centromere protein F 350/400ka (mitosin), the 5' end of the PTPN14 gene for protein tyrosine phosphatase, non-receptor type 14 protein and a CpG island, complete sequence Length = 193256 Score = 46.1 bits (23), Expect = 0.090 Identities = 32/35 (91%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctccttctgtttc 209 ||||||||||||||||||||| || ||||||||| Sbjct: 109159 atccatccatccatccatcctactggttctgtttc 109125 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109171 atccatccatccatccatcc 109152 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109167 atccatccatccatccatcc 109148 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109163 atccatccatccatccatcc 109144
>emb|AL450026.10| Human DNA sequence from clone RP11-439A18 on chromosome 9 Contains the 5' UTR of a variant of a novel gene (MGC20553) and a CpG island, complete sequence Length = 84632 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 37006 atccatccatccatccatcctcc 36984 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37026 atccatccatccatccatcc 37007 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37022 atccatccatccatccatcc 37003 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37018 atccatccatccatccatcc 36999 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37014 atccatccatccatccatcc 36995 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37010 atccatccatccatccatcc 36991
>emb|AL358593.22| Human DNA sequence from clone RP11-473A10 on chromosome 1 Contains the 3' end of the gene for a novel protein (KIAA1626, FLJ34701, FLJ44929, FLJ10521) and the 5' end of a novel gene, complete sequence Length = 142454 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 27042 atccatccatccatccatcctcc 27064 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70510 atccatccatccatccatcc 70529 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70506 atccatccatccatccatcc 70525 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70502 atccatccatccatccatcc 70521 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70498 atccatccatccatccatcc 70517 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70494 atccatccatccatccatcc 70513 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27038 atccatccatccatccatcc 27057 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27034 atccatccatccatccatcc 27053 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26611 atccatccatccatccatcc 26630 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26607 atccatccatccatccatcc 26626 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26603 atccatccatccatccatcc 26622 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26599 atccatccatccatccatcc 26618 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26595 atccatccatccatccatcc 26614 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26591 atccatccatccatccatcc 26610 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26587 atccatccatccatccatcc 26606
>emb|AL354984.17| Human DNA sequence from clone RP13-379L11 on chromosome 20 Contains a putative novel gene, ESTs, STSs and GSSs, complete sequence Length = 207694 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 66304 atccatccatccatccatcctcc 66282 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 43344 atccatccatccatccatcct 43324 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66324 atccatccatccatccatcc 66305 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66320 atccatccatccatccatcc 66301 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66316 atccatccatccatccatcc 66297 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66312 atccatccatccatccatcc 66293 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66308 atccatccatccatccatcc 66289 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43924 atccatccatccatccatcc 43905 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43920 atccatccatccatccatcc 43901 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43916 atccatccatccatccatcc 43897 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43912 atccatccatccatccatcc 43893 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43908 atccatccatccatccatcc 43889 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43844 atccatccatccatccatcc 43825 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43840 atccatccatccatccatcc 43821 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43836 atccatccatccatccatcc 43817 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43672 atccatccatccatccatcc 43653 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43668 atccatccatccatccatcc 43649 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43664 atccatccatccatccatcc 43645 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43636 atccatccatccatccatcc 43617 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43588 atccatccatccatccatcc 43569 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43584 atccatccatccatccatcc 43565 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43580 atccatccatccatccatcc 43561 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43576 atccatccatccatccatcc 43557 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43572 atccatccatccatccatcc 43553 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43524 atccatccatccatccatcc 43505 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43520 atccatccatccatccatcc 43501 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43516 atccatccatccatccatcc 43497 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43512 atccatccatccatccatcc 43493 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43508 atccatccatccatccatcc 43489 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43504 atccatccatccatccatcc 43485 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43394 atccatccatccatccatcc 43375 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43390 atccatccatccatccatcc 43371 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43386 atccatccatccatccatcc 43367 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43360 atccatccatccatccatcc 43341 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43356 atccatccatccatccatcc 43337 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43352 atccatccatccatccatcc 43333 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43348 atccatccatccatccatcc 43329
>emb|AL354898.10| Human DNA sequence from clone RP11-618A20 on chromosome 9 Contains a novel gene (DKFZp434P0216), the ASS gene for argininosuccinate synthetase (ASS1,CTLN1) and three CpG islands, complete sequence Length = 173023 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 9406 atccatccatccatccatcctcc 9384 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 25913 atccatccatccatccatcct 25893 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107115 atccatccatccatccatcc 107134 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26240 atccatccatccatccatcc 26221 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26236 atccatccatccatccatcc 26217 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26232 atccatccatccatccatcc 26213 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26228 atccatccatccatccatcc 26209 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26057 atccatccatccatccatcc 26038 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26017 atccatccatccatccatcc 25998 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 26013 atccatccatccatccatcc 25994 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 25965 atccatccatccatccatcc 25946 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 25961 atccatccatccatccatcc 25942 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 25957 atccatccatccatccatcc 25938 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 25953 atccatccatccatccatcc 25934 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 25917 atccatccatccatccatcc 25898 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13202 atccatccatccatccatcc 13221 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13097 atccatccatccatccatcc 13116 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13093 atccatccatccatccatcc 13112 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13089 atccatccatccatccatcc 13108 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13085 atccatccatccatccatcc 13104 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13081 atccatccatccatccatcc 13100 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 9422 atccatccatccatccatcc 9403 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 9418 atccatccatccatccatcc 9399 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 9414 atccatccatccatccatcc 9395 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 9410 atccatccatccatccatcc 9391
>emb|AL158151.16| Human DNA sequence from clone RP11-247A12 on chromosome 9 Contains the CRAT gene for carnitine acetyltransferase (CAT1), the PPP2R4 gene for protein phosphatase 2A, regulatory subunit B' (PR 53) (PTPA), the IER5L gene for immediate early response 5-like, a novel gene and three CpG islands, complete sequence Length = 162445 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 140585 atccatccatccatccatcctcc 140607 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 140269 atccatccatccatccatcctcc 140291 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctc 196 |||||||||||||||||||||| Sbjct: 140385 atccatccatccatccatcctc 140406 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140669 atccatccatccatccatcc 140688 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140665 atccatccatccatccatcc 140684 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140661 atccatccatccatccatcc 140680 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140581 atccatccatccatccatcc 140600 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140577 atccatccatccatccatcc 140596 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140573 atccatccatccatccatcc 140592 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140457 atccatccatccatccatcc 140476 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140453 atccatccatccatccatcc 140472 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140381 atccatccatccatccatcc 140400 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140377 atccatccatccatccatcc 140396 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140373 atccatccatccatccatcc 140392 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140265 atccatccatccatccatcc 140284 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140261 atccatccatccatccatcc 140280 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140257 atccatccatccatccatcc 140276 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140253 atccatccatccatccatcc 140272 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140249 atccatccatccatccatcc 140268 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140245 atccatccatccatccatcc 140264 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140241 atccatccatccatccatcc 140260
>emb|AL133343.23| Human DNA sequence from clone RP11-410N8 on chromosome 20 Contains the 5' end of two variants of the C20orf112 gene for a novel protein similar to nucleolar protein 4 (NOL4), three novel genes and a CpG island, complete sequence Length = 63609 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 59933 atccatccatccatccatcctcc 59911 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59949 atccatccatccatccatcc 59930 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59945 atccatccatccatccatcc 59926 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59941 atccatccatccatccatcc 59922 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59937 atccatccatccatccatcc 59918 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59429 atccatccatccatccatcc 59410 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59425 atccatccatccatccatcc 59406 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59421 atccatccatccatccatcc 59402 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59417 atccatccatccatccatcc 59398 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59413 atccatccatccatccatcc 59394 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59409 atccatccatccatccatcc 59390 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59373 atccatccatccatccatcc 59354 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59369 atccatccatccatccatcc 59350 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59365 atccatccatccatccatcc 59346 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59361 atccatccatccatccatcc 59342 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59357 atccatccatccatccatcc 59338
>emb|AL121901.20|HSBA49G10 Human DNA sequence from clone RP11-49G10 on chromosome 20 Contains the C20orf70 gene, the SOCS2P1 gene for suppressor of cytokine signalling 2 pseudogene 1, a novel gene, the C20orf71 gene, the PLUNC gene for palate, lung and nasal epithelium carcinoma associated, the 5' end of the C20orf114 gene encoding a protein similar to murine von ebner minor salivary gland protein, the RPL12P3 gene for ribosomal protein L12 pseudogene 3, the gene for breast cancer and salivary gland expression protein (BASE) and a CpG island, complete sequence Length = 161593 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 16311 atccatccatccatccatcctcc 16289 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107953 atccatccatccatccatcc 107934 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107949 atccatccatccatccatcc 107930 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107945 atccatccatccatccatcc 107926 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107941 atccatccatccatccatcc 107922 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107937 atccatccatccatccatcc 107918 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107933 atccatccatccatccatcc 107914 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107929 atccatccatccatccatcc 107910 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90045 atccatccatccatccatcc 90026 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90041 atccatccatccatccatcc 90022 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90037 atccatccatccatccatcc 90018 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90033 atccatccatccatccatcc 90014 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89981 atccatccatccatccatcc 89962 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89977 atccatccatccatccatcc 89958 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89973 atccatccatccatccatcc 89954 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89969 atccatccatccatccatcc 89950 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89965 atccatccatccatccatcc 89946 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89961 atccatccatccatccatcc 89942 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89957 atccatccatccatccatcc 89938 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89953 atccatccatccatccatcc 89934 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 16315 atccatccatccatccatcc 16296
>gb|AC158923.4| Mus musculus chromosome 5, clone RP24-118B12, complete sequence Length = 167699 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 70492 caaatccatccatccatccatcc 70514 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70499 atccatccatccatccatcc 70518
>emb|AL035070.3|HS1043L13 Human DNA sequence from clone RP5-1043L13 on chromosome 20q13.2-13.33 Contains part of a novel gene (LOC284757), complete sequence Length = 156666 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 147251 atccatccatccatccatcctcc 147273 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 146825 atccatccatccatccatcctcc 146847 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 147247 atccatccatccatccatcc 147266 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 147243 atccatccatccatccatcc 147262 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 147087 atccatccatccatccatcc 147106
>emb|AL008721.1|HS390C10 Human DNA sequence from clone CTA-390C10 on chromosome 22q11.21-12.1, complete sequence Length = 114231 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 72007 atccatccatccatccatcctcc 72029 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 72269 atccatccatccatccatcc 72288 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 72265 atccatccatccatccatcc 72284 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 72261 atccatccatccatccatcc 72280 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71795 atccatccatccatccatcc 71814 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71791 atccatccatccatccatcc 71810 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71787 atccatccatccatccatcc 71806 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71783 atccatccatccatccatcc 71802 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71779 atccatccatccatccatcc 71798 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71775 atccatccatccatccatcc 71794 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52620 atccatccatccatccatcc 52601
>emb|BX908784.6| Zebrafish DNA sequence from clone DKEY-69I13, complete sequence Length = 116059 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 11646 caaatccatccatccatccatcc 11668 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 10398 atccatccatccatccatcct 10418 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58265 atccatccatccatccatcc 58284 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58261 atccatccatccatccatcc 58280 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58257 atccatccatccatccatcc 58276 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 12500 atccatccatccatccatcc 12519 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 12496 atccatccatccatccatcc 12515 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 12492 atccatccatccatccatcc 12511 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 12488 atccatccatccatccatcc 12507 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 12484 atccatccatccatccatcc 12503 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10797 atccatccatccatccatcc 10816 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10793 atccatccatccatccatcc 10812 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10394 atccatccatccatccatcc 10413 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10390 atccatccatccatccatcc 10409 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10386 atccatccatccatccatcc 10405 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10382 atccatccatccatccatcc 10401 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10378 atccatccatccatccatcc 10397
>emb|BX897743.8| Zebrafish DNA sequence from clone CH211-164N21 in linkage group 10, complete sequence Length = 112314 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 87518 atccatccatccatccatcctcc 87540 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 84360 caaatccatccatccatccatcc 84382 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 87251 aatccatccatccatccatcc 87271 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87288 atccatccatccatccatcc 87307 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87284 atccatccatccatccatcc 87303 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87280 atccatccatccatccatcc 87299 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87276 atccatccatccatccatcc 87295 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87272 atccatccatccatccatcc 87291 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87268 atccatccatccatccatcc 87287 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87264 atccatccatccatccatcc 87283 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87260 atccatccatccatccatcc 87279 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87256 atccatccatccatccatcc 87275 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87220 atccatccatccatccatcc 87239 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84730 atccatccatccatccatcc 84749 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84443 atccatccatccatccatcc 84462 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84439 atccatccatccatccatcc 84458 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84435 atccatccatccatccatcc 84454 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84431 atccatccatccatccatcc 84450 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84427 atccatccatccatccatcc 84446 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84423 atccatccatccatccatcc 84442 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84419 atccatccatccatccatcc 84438 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84415 atccatccatccatccatcc 84434 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84411 atccatccatccatccatcc 84430 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84407 atccatccatccatccatcc 84426 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84403 atccatccatccatccatcc 84422 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84399 atccatccatccatccatcc 84418 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84395 atccatccatccatccatcc 84414 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84391 atccatccatccatccatcc 84410 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84367 atccatccatccatccatcc 84386
>gb|AC175363.2| Pan troglodytes chromosome X clone CH251-7A1 map human ortholog p11.4, complete sequence Length = 221738 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 175595 atccatccatccatccatcctcc 175573 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 175543 atccatccatccatccatcctcc 175521 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175631 atccatccatccatccatcc 175612 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175627 atccatccatccatccatcc 175608 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175623 atccatccatccatccatcc 175604 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175619 atccatccatccatccatcc 175600 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175615 atccatccatccatccatcc 175596 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175611 atccatccatccatccatcc 175592 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175607 atccatccatccatccatcc 175588 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175603 atccatccatccatccatcc 175584 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175599 atccatccatccatccatcc 175580 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175555 atccatccatccatccatcc 175536 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175551 atccatccatccatccatcc 175532 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175547 atccatccatccatccatcc 175528 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 155473 atccatccatccatccatcc 155454 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 155469 atccatccatccatccatcc 155450 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 155465 atccatccatccatccatcc 155446 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 155461 atccatccatccatccatcc 155442 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 155457 atccatccatccatccatcc 155438 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 155453 atccatccatccatccatcc 155434
>emb|X71381.1|ATUBC6 A.thaliana gene for ubiquitin carrier protein Length = 1548 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtgga 280 ||||||||||||||||||||||| Sbjct: 456 atgatgagtgattacaaggtgga 478
>gb|AC153517.8| Mus musculus 10 BAC RP23-22E18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 203981 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 105294 atccatccatccatccatcctcc 105316 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 105344 atccatccatccatccatcc 105363 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 105340 atccatccatccatccatcc 105359 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 105336 atccatccatccatccatcc 105355 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 105332 atccatccatccatccatcc 105351
>emb|BX640588.5| Zebrafish DNA sequence from clone DKEY-110L7 in linkage group 6, complete sequence Length = 117506 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 103604 caaatccatccatccatccatcc 103626 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 103494 aatccatccatccatccatcc 103514 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103390 atccatccatccatccatcc 103409 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103254 atccatccatccatccatcc 103273 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103250 atccatccatccatccatcc 103269 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103246 atccatccatccatccatcc 103265 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103242 atccatccatccatccatcc 103261 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103238 atccatccatccatccatcc 103257 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102988 atccatccatccatccatcc 103007 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102984 atccatccatccatccatcc 103003 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102980 atccatccatccatccatcc 102999 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102976 atccatccatccatccatcc 102995 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102972 atccatccatccatccatcc 102991 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102968 atccatccatccatccatcc 102987 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102964 atccatccatccatccatcc 102983 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102960 atccatccatccatccatcc 102979 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100513 atccatccatccatccatcc 100532 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100509 atccatccatccatccatcc 100528 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100505 atccatccatccatccatcc 100524 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100501 atccatccatccatccatcc 100520 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100497 atccatccatccatccatcc 100516 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100493 atccatccatccatccatcc 100512 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100489 atccatccatccatccatcc 100508 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100485 atccatccatccatccatcc 100504
>gb|AY254848.1| Pongo pygmaeus non-coding region upstream of COX8H pseudogene Length = 2132 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 899 atccatccatccatccatcctcc 921 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 977 atccatccatccatccatcc 996 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 973 atccatccatccatccatcc 992 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 969 atccatccatccatccatcc 988
>emb|BX322565.11| Zebrafish DNA sequence from clone CH211-262K18 in linkage group 24, complete sequence Length = 158981 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 59551 atccatccatccatccatcctcc 59529 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 59391 atccatccatccatccatcct 59371 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 59171 atccatccatccatccatcct 59151 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 59079 atccatccatccatccatcct 59059 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 59019 atccatccatccatccatcct 58999 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115093 atccatccatccatccatcc 115112 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115089 atccatccatccatccatcc 115108 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115085 atccatccatccatccatcc 115104 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115081 atccatccatccatccatcc 115100 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115077 atccatccatccatccatcc 115096 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115073 atccatccatccatccatcc 115092 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115069 atccatccatccatccatcc 115088 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115065 atccatccatccatccatcc 115084 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115061 atccatccatccatccatcc 115080 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115057 atccatccatccatccatcc 115076 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71658 atccatccatccatccatcc 71639 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71654 atccatccatccatccatcc 71635 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71650 atccatccatccatccatcc 71631 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71646 atccatccatccatccatcc 71627 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71642 atccatccatccatccatcc 71623 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71566 atccatccatccatccatcc 71547 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71502 atccatccatccatccatcc 71483 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71498 atccatccatccatccatcc 71479 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71494 atccatccatccatccatcc 71475 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71490 atccatccatccatccatcc 71471 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71426 atccatccatccatccatcc 71407 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71362 atccatccatccatccatcc 71343 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71310 atccatccatccatccatcc 71291 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71306 atccatccatccatccatcc 71287 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71302 atccatccatccatccatcc 71283 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71298 atccatccatccatccatcc 71279 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71294 atccatccatccatccatcc 71275 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71290 atccatccatccatccatcc 71271 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71286 atccatccatccatccatcc 71267 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71282 atccatccatccatccatcc 71263 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71178 atccatccatccatccatcc 71159 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71110 atccatccatccatccatcc 71091 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71106 atccatccatccatccatcc 71087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71082 atccatccatccatccatcc 71063 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71078 atccatccatccatccatcc 71059 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71074 atccatccatccatccatcc 71055 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71070 atccatccatccatccatcc 71051 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71066 atccatccatccatccatcc 71047 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71062 atccatccatccatccatcc 71043 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71058 atccatccatccatccatcc 71039 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71054 atccatccatccatccatcc 71035 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71050 atccatccatccatccatcc 71031 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71046 atccatccatccatccatcc 71027 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71042 atccatccatccatccatcc 71023 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 71038 atccatccatccatccatcc 71019 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70994 atccatccatccatccatcc 70975 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70990 atccatccatccatccatcc 70971 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70802 atccatccatccatccatcc 70783 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70798 atccatccatccatccatcc 70779 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70794 atccatccatccatccatcc 70775 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70790 atccatccatccatccatcc 70771 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59407 atccatccatccatccatcc 59388 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59403 atccatccatccatccatcc 59384 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59399 atccatccatccatccatcc 59380 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59395 atccatccatccatccatcc 59376 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59244 atccatccatccatccatcc 59225 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59240 atccatccatccatccatcc 59221 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59236 atccatccatccatccatcc 59217 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59232 atccatccatccatccatcc 59213 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59179 atccatccatccatccatcc 59160 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59175 atccatccatccatccatcc 59156 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59123 atccatccatccatccatcc 59104 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59119 atccatccatccatccatcc 59100 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59083 atccatccatccatccatcc 59064 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59055 atccatccatccatccatcc 59036 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59051 atccatccatccatccatcc 59032 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59047 atccatccatccatccatcc 59028 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59043 atccatccatccatccatcc 59024 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59039 atccatccatccatccatcc 59020 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59035 atccatccatccatccatcc 59016 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59031 atccatccatccatccatcc 59012 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59027 atccatccatccatccatcc 59008 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59023 atccatccatccatccatcc 59004 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58777 atccatccatccatccatcc 58758 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58773 atccatccatccatccatcc 58754 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58769 atccatccatccatccatcc 58750 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58765 atccatccatccatccatcc 58746 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58761 atccatccatccatccatcc 58742 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58757 atccatccatccatccatcc 58738 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58753 atccatccatccatccatcc 58734 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58749 atccatccatccatccatcc 58730
>emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 in linkage group 24, complete sequence Length = 152545 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 133891 atccatccatccatccatcctcc 133913 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 134625 atccatccatccatccatcct 134645 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 134585 atccatccatccatccatcct 134605 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 134497 atccatccatccatccatcct 134517 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 134409 atccatccatccatccatcct 134429 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 134369 atccatccatccatccatcct 134389 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 134289 atccatccatccatccatcct 134309 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134910 atccatccatccatccatcc 134929 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134621 atccatccatccatccatcc 134640 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134617 atccatccatccatccatcc 134636 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134613 atccatccatccatccatcc 134632 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134581 atccatccatccatccatcc 134600 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134577 atccatccatccatccatcc 134596 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134573 atccatccatccatccatcc 134592 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134569 atccatccatccatccatcc 134588 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134405 atccatccatccatccatcc 134424 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134401 atccatccatccatccatcc 134420 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134397 atccatccatccatccatcc 134416 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134393 atccatccatccatccatcc 134412 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134365 atccatccatccatccatcc 134384 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134285 atccatccatccatccatcc 134304 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134281 atccatccatccatccatcc 134300 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134277 atccatccatccatccatcc 134296 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134273 atccatccatccatccatcc 134292 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134269 atccatccatccatccatcc 134288 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134265 atccatccatccatccatcc 134284 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134261 atccatccatccatccatcc 134280 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134257 atccatccatccatccatcc 134276 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134253 atccatccatccatccatcc 134272 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134249 atccatccatccatccatcc 134268 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134245 atccatccatccatccatcc 134264 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134241 atccatccatccatccatcc 134260 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134237 atccatccatccatccatcc 134256 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134233 atccatccatccatccatcc 134252 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134229 atccatccatccatccatcc 134248 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134225 atccatccatccatccatcc 134244 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134221 atccatccatccatccatcc 134240 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134217 atccatccatccatccatcc 134236 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134213 atccatccatccatccatcc 134232 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134177 atccatccatccatccatcc 134196 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134062 atccatccatccatccatcc 134081 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134058 atccatccatccatccatcc 134077 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134054 atccatccatccatccatcc 134073 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134050 atccatccatccatccatcc 134069 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133887 atccatccatccatccatcc 133906 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 133883 atccatccatccatccatcc 133902 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121547 atccatccatccatccatcc 121566 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121543 atccatccatccatccatcc 121562 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121539 atccatccatccatccatcc 121558 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121535 atccatccatccatccatcc 121554 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121531 atccatccatccatccatcc 121550 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121527 atccatccatccatccatcc 121546 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121523 atccatccatccatccatcc 121542 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121519 atccatccatccatccatcc 121538 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121515 atccatccatccatccatcc 121534 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121511 atccatccatccatccatcc 121530 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121507 atccatccatccatccatcc 121526 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121477 atccatccatccatccatcc 121496 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121473 atccatccatccatccatcc 121492 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121445 atccatccatccatccatcc 121464 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121224 atccatccatccatccatcc 121243 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121220 atccatccatccatccatcc 121239 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121216 atccatccatccatccatcc 121235 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121172 atccatccatccatccatcc 121191 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121168 atccatccatccatccatcc 121187 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121164 atccatccatccatccatcc 121183 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121160 atccatccatccatccatcc 121179 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121156 atccatccatccatccatcc 121175 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121132 atccatccatccatccatcc 121151 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120952 atccatccatccatccatcc 120971 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120856 atccatccatccatccatcc 120875 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120852 atccatccatccatccatcc 120871 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120848 atccatccatccatccatcc 120867 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120844 atccatccatccatccatcc 120863 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120840 atccatccatccatccatcc 120859 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120836 atccatccatccatccatcc 120855 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120832 atccatccatccatccatcc 120851 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120828 atccatccatccatccatcc 120847 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120824 atccatccatccatccatcc 120843 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120820 atccatccatccatccatcc 120839 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120816 atccatccatccatccatcc 120835 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120812 atccatccatccatccatcc 120831 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120808 atccatccatccatccatcc 120827 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120744 atccatccatccatccatcc 120763 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120740 atccatccatccatccatcc 120759 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120736 atccatccatccatccatcc 120755 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120732 atccatccatccatccatcc 120751 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120728 atccatccatccatccatcc 120747 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120724 atccatccatccatccatcc 120743 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120720 atccatccatccatccatcc 120739
>emb|AL645969.20| Mouse DNA sequence from clone RP23-101H2 on chromosome 11 Contains a novel gene, complete sequence Length = 154687 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 96793 atccatccatccatccatcctcc 96771 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96954 atccatccatccatccatcc 96935 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96950 atccatccatccatccatcc 96931 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96946 atccatccatccatccatcc 96927 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96942 atccatccatccatccatcc 96923 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96829 atccatccatccatccatcc 96810
>emb|AL645965.8| Mouse DNA sequence from clone RP23-65I14 on chromosome 11 Contains the 5' end of the gene for a novel protein (330000P08Rik) (Luc7a), the gene for a novel protein (5530600A18Rik), the Abcc3 gene for ATP-binding cassette sub-family C (CFTR/MRP) member 3, the Cacna1g gene for calcium channel voltage-dependent T type alpha 1G subunit, the 3' end of the Tisp78 gene for transcript increased in spermiogenesis 78 and one CpG island, complete sequence Length = 161978 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 136315 atccatccatccatccatcctcc 136293 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 136327 atccatccatccatccatcc 136308 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 136323 atccatccatccatccatcc 136304 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 136319 atccatccatccatccatcc 136300 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 136183 catccatccatccatcctcc 136164 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 37267 atccatccatccatccatcc 37248
>emb|CR293518.13| Zebrafish DNA sequence from clone CH211-129L10 in linkage group 12, complete sequence Length = 196374 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 175585 atccatccatccatccatcctcc 175563 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 116100 aatccatccatccatccatcc 116080 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 115986 aatccatccatccatccatcc 115966 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175823 atccatccatccatccatcc 175804 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175819 atccatccatccatccatcc 175800 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175815 atccatccatccatccatcc 175796 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175811 atccatccatccatccatcc 175792 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175807 atccatccatccatccatcc 175788 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175605 atccatccatccatccatcc 175586 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175601 atccatccatccatccatcc 175582 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175597 atccatccatccatccatcc 175578 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175593 atccatccatccatccatcc 175574 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175589 atccatccatccatccatcc 175570 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175562 atccatccatccatccatcc 175543 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175558 atccatccatccatccatcc 175539 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175554 atccatccatccatccatcc 175535 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175465 atccatccatccatccatcc 175446 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175461 atccatccatccatccatcc 175442 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175457 atccatccatccatccatcc 175438 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175453 atccatccatccatccatcc 175434 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175415 atccatccatccatccatcc 175396 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175411 atccatccatccatccatcc 175392 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175407 atccatccatccatccatcc 175388 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116363 atccatccatccatccatcc 116344 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116359 atccatccatccatccatcc 116340 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116355 atccatccatccatccatcc 116336 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116351 atccatccatccatccatcc 116332 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116347 atccatccatccatccatcc 116328 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116343 atccatccatccatccatcc 116324 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116339 atccatccatccatccatcc 116320 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116184 atccatccatccatccatcc 116165 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116180 atccatccatccatccatcc 116161 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116095 atccatccatccatccatcc 116076 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116091 atccatccatccatccatcc 116072 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116087 atccatccatccatccatcc 116068 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116083 atccatccatccatccatcc 116064 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 116079 atccatccatccatccatcc 116060 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115981 atccatccatccatccatcc 115962 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115977 atccatccatccatccatcc 115958 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115973 atccatccatccatccatcc 115954 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115969 atccatccatccatccatcc 115950 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115876 atccatccatccatccatcc 115857 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115872 atccatccatccatccatcc 115853 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115868 atccatccatccatccatcc 115849 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115864 atccatccatccatccatcc 115845 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115860 atccatccatccatccatcc 115841 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115856 atccatccatccatccatcc 115837 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115852 atccatccatccatccatcc 115833 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115848 atccatccatccatccatcc 115829 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115844 atccatccatccatccatcc 115825 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115840 atccatccatccatccatcc 115821 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115836 atccatccatccatccatcc 115817 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115832 atccatccatccatccatcc 115813 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115828 atccatccatccatccatcc 115809 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115824 atccatccatccatccatcc 115805 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115820 atccatccatccatccatcc 115801 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115571 atccatccatccatccatcc 115552 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115567 atccatccatccatccatcc 115548 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115563 atccatccatccatccatcc 115544 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115559 atccatccatccatccatcc 115540 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115555 atccatccatccatccatcc 115536 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115551 atccatccatccatccatcc 115532 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115547 atccatccatccatccatcc 115528 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115543 atccatccatccatccatcc 115524 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115539 atccatccatccatccatcc 115520 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115535 atccatccatccatccatcc 115516 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115479 atccatccatccatccatcc 115460 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115475 atccatccatccatccatcc 115456 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115471 atccatccatccatccatcc 115452 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115467 atccatccatccatccatcc 115448 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115463 atccatccatccatccatcc 115444 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115459 atccatccatccatccatcc 115440 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115455 atccatccatccatccatcc 115436 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115385 atccatccatccatccatcc 115366 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115381 atccatccatccatccatcc 115362 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115377 atccatccatccatccatcc 115358 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115373 atccatccatccatccatcc 115354 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115369 atccatccatccatccatcc 115350 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 115365 atccatccatccatccatcc 115346
>emb|AL592443.2| Mouse DNA sequence from clone RP23-142M3 on chromosome 13, complete sequence Length = 164416 Score = 46.1 bits (23), Expect = 0.090 Identities = 26/27 (96%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctcct 201 |||||||||||||||||||| |||||| Sbjct: 28941 atccatccatccatccatccacctcct 28915
>emb|BX294100.11| Zebrafish DNA sequence from clone DKEYP-2G11 in linkage group 12, complete sequence Length = 173405 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 176 tccatccatccatccatcctcct 198 ||||||||||||||||||||||| Sbjct: 155165 tccatccatccatccatcctcct 155143 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 155705 atccatccatccatccatcct 155685 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 176 tccatccatccatccatcct 195 |||||||||||||||||||| Sbjct: 155555 tccatccatccatccatcct 155536 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134992 atccatccatccatccatcc 135011 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134988 atccatccatccatccatcc 135007 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134984 atccatccatccatccatcc 135003 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134980 atccatccatccatccatcc 134999 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134976 atccatccatccatccatcc 134995 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134972 atccatccatccatccatcc 134991 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134968 atccatccatccatccatcc 134987 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 134964 atccatccatccatccatcc 134983
>gb|AC121541.31| Mus musculus chromosome 5, clone RP24-132B11, complete sequence Length = 171770 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 76046 atccatccatccatccatcctcc 76068
>gb|AC116105.12| Mus musculus chromosome 1, clone RP23-23A4, complete sequence Length = 214780 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 208649 atccatccatccatccatcctcc 208627 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 208673 atccatccatccatccatcc 208654 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 208669 atccatccatccatccatcc 208650 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 208665 atccatccatccatccatcc 208646 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 208661 atccatccatccatccatcc 208642 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 208657 atccatccatccatccatcc 208638 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 208653 atccatccatccatccatcc 208634
>emb|BX901978.14| Zebrafish DNA sequence from clone DKEY-155M6 in linkage group 18, complete sequence Length = 168101 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 173 aaatccatccatccatccatcct 195 ||||||||||||||||||||||| Sbjct: 17218 aaatccatccatccatccatcct 17196 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 173 aaatccatccatccatccatc 193 ||||||||||||||||||||| Sbjct: 17164 aaatccatccatccatccatc 17144 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111593 atccatccatccatccatcc 111574 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111589 atccatccatccatccatcc 111570 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111585 atccatccatccatccatcc 111566 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111581 atccatccatccatccatcc 111562 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111577 atccatccatccatccatcc 111558 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111573 atccatccatccatccatcc 111554 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111569 atccatccatccatccatcc 111550 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111565 atccatccatccatccatcc 111546 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111561 atccatccatccatccatcc 111542 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50908 atccatccatccatccatcc 50889 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28630 atccatccatccatccatcc 28649 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28626 atccatccatccatccatcc 28645 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28622 atccatccatccatccatcc 28641 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28618 atccatccatccatccatcc 28637 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28614 atccatccatccatccatcc 28633 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28110 atccatccatccatccatcc 28129 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28106 atccatccatccatccatcc 28125 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28102 atccatccatccatccatcc 28121 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28098 atccatccatccatccatcc 28117 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28094 atccatccatccatccatcc 28113 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28090 atccatccatccatccatcc 28109
>emb|BX470245.8| Zebrafish DNA sequence from clone DKEY-249O24 in linkage group 9, complete sequence Length = 132054 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 65614 atccatccatccatccatcctcc 65592 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 113607 atccatccatccatccatcc 113588 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 113603 atccatccatccatccatcc 113584 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 113599 atccatccatccatccatcc 113580 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 113595 atccatccatccatccatcc 113576 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 113591 atccatccatccatccatcc 113572 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 113587 atccatccatccatccatcc 113568 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 113583 atccatccatccatccatcc 113564 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 113579 atccatccatccatccatcc 113560 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69921 atccatccatccatccatcc 69902 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69917 atccatccatccatccatcc 69898 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69913 atccatccatccatccatcc 69894 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69486 atccatccatccatccatcc 69505 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69482 atccatccatccatccatcc 69501 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69478 atccatccatccatccatcc 69497 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69474 atccatccatccatccatcc 69493 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69470 atccatccatccatccatcc 69489 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69442 atccatccatccatccatcc 69461 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66137 atccatccatccatccatcc 66118 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66106 atccatccatccatccatcc 66087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65884 atccatccatccatccatcc 65865 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65880 atccatccatccatccatcc 65861 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65876 atccatccatccatccatcc 65857 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65872 atccatccatccatccatcc 65853 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65868 atccatccatccatccatcc 65849 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65864 atccatccatccatccatcc 65845 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65860 atccatccatccatccatcc 65841 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65742 atccatccatccatccatcc 65723 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65280 atccatccatccatccatcc 65261 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65276 atccatccatccatccatcc 65257 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65130 atccatccatccatccatcc 65111 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65126 atccatccatccatccatcc 65107 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 65122 atccatccatccatccatcc 65103
>emb|BX927295.6| Zebrafish DNA sequence from clone DKEY-7P3 in linkage group 18, complete sequence Length = 71075 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 39307 atccatccatccatccatcctcc 39285 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 39327 atccatccatccatccatcc 39308 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 39323 atccatccatccatccatcc 39304 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 39319 atccatccatccatccatcc 39300 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 39315 atccatccatccatccatcc 39296 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 39311 atccatccatccatccatcc 39292
>emb|BX324148.9| Zebrafish DNA sequence from clone RP71-17G11 in linkage group 23, complete sequence Length = 127356 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 95236 atccatccatccatccatcctcc 95214 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 95675 aatccatccatccatccatcc 95655 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96102 atccatccatccatccatcc 96083 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96098 atccatccatccatccatcc 96079 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95808 atccatccatccatccatcc 95789 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95804 atccatccatccatccatcc 95785 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95800 atccatccatccatccatcc 95781 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95796 atccatccatccatccatcc 95777 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95792 atccatccatccatccatcc 95773 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95788 atccatccatccatccatcc 95769 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95784 atccatccatccatccatcc 95765 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95780 atccatccatccatccatcc 95761 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95670 atccatccatccatccatcc 95651 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95666 atccatccatccatccatcc 95647 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95662 atccatccatccatccatcc 95643 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95452 atccatccatccatccatcc 95433
>gb|AC118207.13| Mus musculus chromosome 8, clone RP24-215A12, complete sequence Length = 187453 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 78793 atccatccatccatccatcctcc 78815 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 162641 atccatccatccatccatcc 162622 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 162530 atccatccatccatccatcc 162511 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 162526 atccatccatccatccatcc 162507 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 162522 atccatccatccatccatcc 162503 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 162518 atccatccatccatccatcc 162499 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 162514 atccatccatccatccatcc 162495 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 162510 atccatccatccatccatcc 162491 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111069 atccatccatccatccatcc 111050 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88506 atccatccatccatccatcc 88525 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88502 atccatccatccatccatcc 88521 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 78656 atccatccatccatccatcc 78675 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5132 atccatccatccatccatcc 5151 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5128 atccatccatccatccatcc 5147
>gb|AC044792.6| Homo sapiens chromosome 19 clone CTC-258N23, complete sequence Length = 201939 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 78179 atccatccatccatccatcctcc 78201 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 78175 atccatccatccatccatcc 78194
>gb|AC008737.11| Homo sapiens chromosome 19 clone CTD-2538G9, complete sequence Length = 248281 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 90065 atccatccatccatccatcctcc 90087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89882 atccatccatccatccatcc 89901 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89691 atccatccatccatccatcc 89710 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89687 atccatccatccatccatcc 89706 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89683 atccatccatccatccatcc 89702 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89679 atccatccatccatccatcc 89698 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89675 atccatccatccatccatcc 89694 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80208 atccatccatccatccatcc 80227 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80204 atccatccatccatccatcc 80223 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80116 atccatccatccatccatcc 80135 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80112 atccatccatccatccatcc 80131 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80108 atccatccatccatccatcc 80127 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80104 atccatccatccatccatcc 80123 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80100 atccatccatccatccatcc 80119 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 80065 atccatccatccatccatcc 80084 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70535 atccatccatccatccatcc 70554 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70531 atccatccatccatccatcc 70550 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70527 atccatccatccatccatcc 70546 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70221 atccatccatccatccatcc 70240 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70217 atccatccatccatccatcc 70236 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70213 atccatccatccatccatcc 70232 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70209 atccatccatccatccatcc 70228 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70205 atccatccatccatccatcc 70224 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 70201 atccatccatccatccatcc 70220 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69770 atccatccatccatccatcc 69789 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69766 atccatccatccatccatcc 69785 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69762 atccatccatccatccatcc 69781 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69582 atccatccatccatccatcc 69601 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69578 atccatccatccatccatcc 69597 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69574 atccatccatccatccatcc 69593 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69570 atccatccatccatccatcc 69589 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69566 atccatccatccatccatcc 69585
>emb|BX784034.8| Zebrafish DNA sequence from clone CH211-194O4 in linkage group 20, complete sequence Length = 187846 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 130706 caaatccatccatccatccatcc 130728 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130846 atccatccatccatccatcc 130865 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130842 atccatccatccatccatcc 130861 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130838 atccatccatccatccatcc 130857 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130834 atccatccatccatccatcc 130853 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130830 atccatccatccatccatcc 130849 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130826 atccatccatccatccatcc 130845 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130822 atccatccatccatccatcc 130841 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130737 atccatccatccatccatcc 130756 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130733 atccatccatccatccatcc 130752 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130729 atccatccatccatccatcc 130748 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130725 atccatccatccatccatcc 130744 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130721 atccatccatccatccatcc 130740 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130717 atccatccatccatccatcc 130736 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130713 atccatccatccatccatcc 130732 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130601 atccatccatccatccatcc 130620 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130597 atccatccatccatccatcc 130616 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130593 atccatccatccatccatcc 130612 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130589 atccatccatccatccatcc 130608 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130585 atccatccatccatccatcc 130604 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130581 atccatccatccatccatcc 130600 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130577 atccatccatccatccatcc 130596 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130573 atccatccatccatccatcc 130592 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130569 atccatccatccatccatcc 130588 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130565 atccatccatccatccatcc 130584 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130561 atccatccatccatccatcc 130580 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130557 atccatccatccatccatcc 130576 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130553 atccatccatccatccatcc 130572 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130549 atccatccatccatccatcc 130568 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130545 atccatccatccatccatcc 130564 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130541 atccatccatccatccatcc 130560 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130537 atccatccatccatccatcc 130556 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130533 atccatccatccatccatcc 130552 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130529 atccatccatccatccatcc 130548 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130525 atccatccatccatccatcc 130544 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130521 atccatccatccatccatcc 130540 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130517 atccatccatccatccatcc 130536 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 63327 atccatccatccatccatcc 63346 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 63323 atccatccatccatccatcc 63342
>gb|AC008646.7| Homo sapiens chromosome 5 clone CTB-182O9, complete sequence Length = 174928 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 12665 atccatccatccatccatcctcc 12643
>gb|AC011333.7| Homo sapiens chromosome 5 clone CTC-229L21, complete sequence Length = 159964 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 36228 atccatccatccatccatcctcc 36250 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 158352 atccatccatccatccatcct 158372 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 158348 atccatccatccatccatcc 158367 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 158101 atccatccatccatccatcc 158120 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 158097 atccatccatccatccatcc 158116 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 158093 atccatccatccatccatcc 158112 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 158089 atccatccatccatccatcc 158108 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 158085 atccatccatccatccatcc 158104 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 158081 atccatccatccatccatcc 158100 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42914 atccatccatccatccatcc 42933 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42910 atccatccatccatccatcc 42929 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42906 atccatccatccatccatcc 42925 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42902 atccatccatccatccatcc 42921 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42898 atccatccatccatccatcc 42917 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42894 atccatccatccatccatcc 42913 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42890 atccatccatccatccatcc 42909 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42754 atccatccatccatccatcc 42773 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42750 atccatccatccatccatcc 42769 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 36224 atccatccatccatccatcc 36243 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 36220 atccatccatccatccatcc 36239 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 36216 atccatccatccatccatcc 36235 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 36212 atccatccatccatccatcc 36231 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 36208 atccatccatccatccatcc 36227 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 36204 atccatccatccatccatcc 36223 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18384 atccatccatccatccatcc 18403 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18380 atccatccatccatccatcc 18399
>gb|AF192304.6| Homo sapiens chromosome 8 clone CTC-458A3 map 8q24.3, complete sequence Length = 177028 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 60062 atccatccatccatccatcctcc 60040 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 59593 aatccatccatccatccatcc 59573 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 60273 catccatccatccatcctcc 60254 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 60066 atccatccatccatccatcc 60047
>gb|AC104849.2| Homo sapiens chromosome 3 clone RP11-154D3, complete sequence Length = 165849 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 122124 atccatccatccatccatcctcc 122102 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122152 atccatccatccatccatcc 122133 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122148 atccatccatccatccatcc 122129 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122144 atccatccatccatccatcc 122125 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122140 atccatccatccatccatcc 122121 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122136 atccatccatccatccatcc 122117 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122132 atccatccatccatccatcc 122113 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122128 atccatccatccatccatcc 122109
>emb|BX511218.9| Zebrafish DNA sequence from clone DKEY-37K14 in linkage group 17, complete sequence Length = 152316 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 82884 atccatccatccatccatcctcc 82906 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 82880 atccatccatccatccatcc 82899
>emb|AL954696.17| Zebrafish DNA sequence from clone CH211-234K4, complete sequence Length = 149858 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 107849 atccatccatccatccatcctcc 107871
>gb|AC091211.3| Drosophila melanogaster 3L BAC RP98-26E12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 194589 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 192757 atccatccatccatccatcctcc 192735
>gb|AC091228.3| Drosophila melanogaster 3L BAC RP98-10L9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 156142 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 51628 atccatccatccatccatcctcc 51650
>dbj|AK097062.1| Homo sapiens cDNA FLJ39743 fis, clone SMINT2017319 Length = 3376 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 2815 atccatccatccatccatcctcc 2837 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 2474 atccatccatccatccatcctcc 2496 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 2608 atccatccatccatccatcct 2628 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2865 atccatccatccatccatcc 2884 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2861 atccatccatccatccatcc 2880 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2857 atccatccatccatccatcc 2876 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2853 atccatccatccatccatcc 2872 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2849 atccatccatccatccatcc 2868 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2845 atccatccatccatccatcc 2864 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2784 atccatccatccatccatcc 2803 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2780 atccatccatccatccatcc 2799 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2776 atccatccatccatccatcc 2795 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2772 atccatccatccatccatcc 2791 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2768 atccatccatccatccatcc 2787 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2726 atccatccatccatccatcc 2745 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2604 atccatccatccatccatcc 2623 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 2577 catccatccatccatcctcc 2596 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2470 atccatccatccatccatcc 2489 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2466 atccatccatccatccatcc 2485 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2462 atccatccatccatccatcc 2481 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 2435 catccatccatccatcctcc 2454
>gb|AC116559.30| Papio anubis clone rp41-339c10, complete sequence Length = 162030 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 151934 atccatccatccatccatcctcc 151912 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 153396 atccatccatccatccatcc 153377 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 153392 atccatccatccatccatcc 153373 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 153388 atccatccatccatccatcc 153369 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 153384 atccatccatccatccatcc 153365 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151264 atccatccatccatccatcc 151245 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151260 atccatccatccatccatcc 151241 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151256 atccatccatccatccatcc 151237
>gb|AC116558.21| Papio anubis clone rp41-273g19, complete sequence Length = 188182 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 7045 atccatccatccatccatcctcc 7067 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 6121 atccatccatccatccatcct 6141 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7747 atccatccatccatccatcc 7766 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7743 atccatccatccatccatcc 7762 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7739 atccatccatccatccatcc 7758 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7735 atccatccatccatccatcc 7754 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7731 atccatccatccatccatcc 7750 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7727 atccatccatccatccatcc 7746 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7723 atccatccatccatccatcc 7742 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7719 atccatccatccatccatcc 7738 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7715 atccatccatccatccatcc 7734 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5595 atccatccatccatccatcc 5614 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5591 atccatccatccatccatcc 5610 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5587 atccatccatccatccatcc 5606
>gb|AC083841.9| Homo sapiens chromosome 8, clone RP11-706C16, complete sequence Length = 203375 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 141142 atccatccatccatccatcctcc 141164 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 141092 atccatccatccatccatcctcc 141114 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140643 atccatccatccatccatcc 140662 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140639 atccatccatccatccatcc 140658 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140635 atccatccatccatccatcc 140654 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 140631 atccatccatccatccatcc 140650
>gb|AC105939.2| Homo sapiens chromosome 3 clone RP11-241A5, complete sequence Length = 97387 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 34349 atccatccatccatccatcctcc 34327 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 34377 atccatccatccatccatcc 34358 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 34373 atccatccatccatccatcc 34354 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 34369 atccatccatccatccatcc 34350 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 34365 atccatccatccatccatcc 34346 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 34361 atccatccatccatccatcc 34342 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 34357 atccatccatccatccatcc 34338 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 34353 atccatccatccatccatcc 34334
>gb|AC007541.9| Homo sapiens 12q24.1 BAC RPCI11-412D9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 143444 Score = 46.1 bits (23), Expect = 0.090 Identities = 35/38 (92%), Gaps = 2/38 (5%) Strand = Plus / Minus Query: 176 tccatccatccatccatcctcc--tccttctgtttcat 211 |||||||||||||||||| ||| |||||||||||||| Sbjct: 56240 tccatccatccatccatcatcctttccttctgtttcat 56203
>gb|AC087894.15| Homo sapiens 12 BAC RP11-749H20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 169117 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 94704 caaatccatccatccatccatcc 94726 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94671 atccatccatccatccatcc 94690 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94667 atccatccatccatccatcc 94686 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94663 atccatccatccatccatcc 94682 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94659 atccatccatccatccatcc 94678
>gb|AC090064.3| Homo sapiens chromosome 5 clone CTB-43C3, complete sequence Length = 124882 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 34518 atccatccatccatccatcctcc 34540 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44733 atccatccatccatccatcc 44752 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44729 atccatccatccatccatcc 44748 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44725 atccatccatccatccatcc 44744 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44721 atccatccatccatccatcc 44740 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44717 atccatccatccatccatcc 44736 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44713 atccatccatccatccatcc 44732
>gb|AC005397.3| Arabidopsis thaliana chromosome 2 clone T3F17 map CIC02E07, complete sequence Length = 110149 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtgga 280 ||||||||||||||||||||||| Sbjct: 90322 atgatgagtgattacaaggtgga 90344
>gb|AC011407.6| Homo sapiens chromosome 5 clone CTB-54I1, complete sequence Length = 240957 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 8407 atccatccatccatccatcctcc 8429 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 211925 atccatccatccatccatcc 211906 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 211921 atccatccatccatccatcc 211902 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 211917 atccatccatccatccatcc 211898 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 211913 atccatccatccatccatcc 211894 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18829 atccatccatccatccatcc 18848 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18825 atccatccatccatccatcc 18844 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18821 atccatccatccatccatcc 18840 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18817 atccatccatccatccatcc 18836 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18813 atccatccatccatccatcc 18832 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18809 atccatccatccatccatcc 18828
>gb|AF470043.1| Oncorhynchus mykiss microsatellite OMM1279 sequence Length = 495 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 259 atccatccatccatccatcctcc 281 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 255 atccatccatccatccatcc 274 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 251 atccatccatccatccatcc 270 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 247 atccatccatccatccatcc 266 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 243 atccatccatccatccatcc 262 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 239 atccatccatccatccatcc 258 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 235 atccatccatccatccatcc 254 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 231 atccatccatccatccatcc 250
>gb|AC008415.6| Homo sapiens chromosome 5 clone CTC-283O18, complete sequence Length = 168368 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 96731 atccatccatccatccatcctcc 96709
>emb|AL954357.16| Zebrafish DNA sequence from clone DKEY-46A10 in linkage group 8, complete sequence Length = 199804 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcctc 196 ||||||||||||||||||||||| Sbjct: 111529 aatccatccatccatccatcctc 111551 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctc 196 |||||||||||||||||||||| Sbjct: 111503 atccatccatccatccatcctc 111524 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111499 atccatccatccatccatcc 111518 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111495 atccatccatccatccatcc 111514 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 872 atccatccatccatccatcc 853 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 868 atccatccatccatccatcc 849 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 864 atccatccatccatccatcc 845 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 860 atccatccatccatccatcc 841 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 856 atccatccatccatccatcc 837 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 852 atccatccatccatccatcc 833 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 848 atccatccatccatccatcc 829 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 844 atccatccatccatccatcc 825 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 840 atccatccatccatccatcc 821
>gb|AC025470.5| Homo sapiens chromosome 5 clone CTD-2516K3, complete sequence Length = 201687 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 410 atccatccatccatccatcctcc 388 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 418 atccatccatccatccatcc 399 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 414 atccatccatccatccatcc 395
>gb|AC160760.4| Mus musculus BAC clone RP23-449G13 from chromosome 17, complete sequence Length = 174449 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 13874 caaatccatccatccatccatcc 13896 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 14004 atccatccatccatccatcc 14023 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 14000 atccatccatccatccatcc 14019 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13996 atccatccatccatccatcc 14015 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13992 atccatccatccatccatcc 14011 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13804 atccatccatccatccatcc 13823 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13800 atccatccatccatccatcc 13819 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13796 atccatccatccatccatcc 13815 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13792 atccatccatccatccatcc 13811 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13788 atccatccatccatccatcc 13807 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 13784 atccatccatccatccatcc 13803
>gb|AE008683.1|AE008683 Mus musculus T-cell receptor alpha/delta locus section 1 of 4 of the complete region Length = 404892 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 98296 caaatccatccatccatccatcc 98318 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98335 atccatccatccatccatcc 98354 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98331 atccatccatccatccatcc 98350 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98327 atccatccatccatccatcc 98346 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98323 atccatccatccatccatcc 98342 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98319 atccatccatccatccatcc 98338 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98315 atccatccatccatccatcc 98334 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98311 atccatccatccatccatcc 98330 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98307 atccatccatccatccatcc 98326 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98303 atccatccatccatccatcc 98322
>emb|BX537152.15| Zebrafish DNA sequence from clone DKEY-61N7 in linkage group 14, complete sequence Length = 243729 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 173029 caaatccatccatccatccatcc 173051 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 173080 atccatccatccatccatcc 173099 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 173076 atccatccatccatccatcc 173095 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 173072 atccatccatccatccatcc 173091 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 173068 atccatccatccatccatcc 173087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 173064 atccatccatccatccatcc 173083 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 173060 atccatccatccatccatcc 173079 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 173056 atccatccatccatccatcc 173075
>gb|AC008780.7| Homo sapiens chromosome 5 clone CTD-2023N9, complete sequence Length = 178203 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 174690 atccatccatccatccatcctcc 174668 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 174698 atccatccatccatccatcc 174679 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 174694 atccatccatccatccatcc 174675 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131124 atccatccatccatccatcc 131105 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131120 atccatccatccatccatcc 131101 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131116 atccatccatccatccatcc 131097 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131112 atccatccatccatccatcc 131093 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131108 atccatccatccatccatcc 131089 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131104 atccatccatccatccatcc 131085 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131100 atccatccatccatccatcc 131081 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131096 atccatccatccatccatcc 131077 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131092 atccatccatccatccatcc 131073 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131088 atccatccatccatccatcc 131069
>gb|AC153150.5| Mus musculus BAC clone RP23-181B14 from chromosome 13, complete sequence Length = 212639 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 5087 atccatccatccatccatcctcc 5065 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 112100 atccatccatccatccatcc 112081 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 112096 atccatccatccatccatcc 112077 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 112092 atccatccatccatccatcc 112073 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 112088 atccatccatccatccatcc 112069 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5107 atccatccatccatccatcc 5088 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5103 atccatccatccatccatcc 5084 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5099 atccatccatccatccatcc 5080 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5095 atccatccatccatccatcc 5076 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5091 atccatccatccatccatcc 5072
>gb|AC007481.6|AC007481 Homo sapiens chromosome 8, clone RP11-50A1, complete sequence Length = 137032 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 122678 atccatccatccatccatcctcc 122656
>gb|AC011454.6|AC011454 Homo sapiens chromosome 19 clone CTC-347E6, complete sequence Length = 163120 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 117926 atccatccatccatccatcctcc 117948 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121920 atccatccatccatccatcc 121939 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 118066 atccatccatccatccatcc 118085 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 118062 atccatccatccatccatcc 118081 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 118058 atccatccatccatccatcc 118077 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 117985 catccatccatccatcctcc 118004 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 117922 atccatccatccatccatcc 117941 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 117802 atccatccatccatccatcc 117821 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 117798 atccatccatccatccatcc 117817 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 117794 atccatccatccatccatcc 117813 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103995 atccatccatccatccatcc 104014 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103951 atccatccatccatccatcc 103970 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103947 atccatccatccatccatcc 103966 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 103943 atccatccatccatccatcc 103962
>dbj|AK034483.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched library, clone:9330198P08 product:hypothetical protein, full insert sequence Length = 3071 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 2389 atccatccatccatccatcctcc 2411 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2385 atccatccatccatccatcc 2404
>emb|BX120011.13| Zebrafish DNA sequence from clone DKEY-18O5 in linkage group 25, complete sequence Length = 225675 Score = 46.1 bits (23), Expect = 0.090 Identities = 26/27 (96%) Strand = Plus / Minus Query: 168 ctaccaaatccatccatccatccatcc 194 ||||| ||||||||||||||||||||| Sbjct: 19558 ctacctaatccatccatccatccatcc 19532 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 73901 aatccatccatccatccatcc 73921 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 19863 aatccatccatccatccatcc 19843 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 73910 atccatccatccatccatcc 73929 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 73906 atccatccatccatccatcc 73925 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 32289 atccatccatccatccatcc 32270 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 32285 atccatccatccatccatcc 32266 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 32281 atccatccatccatccatcc 32262 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 32277 atccatccatccatccatcc 32258 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19547 atccatccatccatccatcc 19528 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19543 atccatccatccatccatcc 19524 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19539 atccatccatccatccatcc 19520 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19535 atccatccatccatccatcc 19516 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19415 atccatccatccatccatcc 19396 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 19411 atccatccatccatccatcc 19392
>emb|BX255929.7| Zebrafish DNA sequence from clone CH211-271P5 in linkage group 14, complete sequence Length = 147460 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 62606 atccatccatccatccatcctcc 62628 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 62555 atccatccatccatccatcctcc 62577 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69821 atccatccatccatccatcc 69840 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69817 atccatccatccatccatcc 69836 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69813 atccatccatccatccatcc 69832 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69809 atccatccatccatccatcc 69828 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69805 atccatccatccatccatcc 69824 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69801 atccatccatccatccatcc 69820 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69797 atccatccatccatccatcc 69816 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69793 atccatccatccatccatcc 69812 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69789 atccatccatccatccatcc 69808 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69785 atccatccatccatccatcc 69804 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69781 atccatccatccatccatcc 69800 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69777 atccatccatccatccatcc 69796 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69773 atccatccatccatccatcc 69792 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69769 atccatccatccatccatcc 69788 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69765 atccatccatccatccatcc 69784 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69761 atccatccatccatccatcc 69780 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69757 atccatccatccatccatcc 69776 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69753 atccatccatccatccatcc 69772 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 69749 atccatccatccatccatcc 69768 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62649 atccatccatccatccatcc 62668 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62645 atccatccatccatccatcc 62664 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62641 atccatccatccatccatcc 62660 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62602 atccatccatccatccatcc 62621 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62598 atccatccatccatccatcc 62617 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62594 atccatccatccatccatcc 62613 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62551 atccatccatccatccatcc 62570 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62547 atccatccatccatccatcc 62566 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62543 atccatccatccatccatcc 62562 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62539 atccatccatccatccatcc 62558 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62535 atccatccatccatccatcc 62554 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 62531 atccatccatccatccatcc 62550 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59080 atccatccatccatccatcc 59099 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59076 atccatccatccatccatcc 59095 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59072 atccatccatccatccatcc 59091 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59068 atccatccatccatccatcc 59087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59064 atccatccatccatccatcc 59083 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59060 atccatccatccatccatcc 59079 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 59056 atccatccatccatccatcc 59075 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3334 atccatccatccatccatcc 3353 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3330 atccatccatccatccatcc 3349 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3326 atccatccatccatccatcc 3345 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3257 atccatccatccatccatcc 3276 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3253 atccatccatccatccatcc 3272 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3171 atccatccatccatccatcc 3190 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3135 atccatccatccatccatcc 3154 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 3007 atccatccatccatccatcc 3026 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2921 atccatccatccatccatcc 2940 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2917 atccatccatccatccatcc 2936 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2913 atccatccatccatccatcc 2932 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2909 atccatccatccatccatcc 2928 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2905 atccatccatccatccatcc 2924 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2901 atccatccatccatccatcc 2920
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 46.1 bits (23), Expect = 0.090 Identities = 26/27 (96%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcctcct 201 ||||||||||||||||||||| ||||| Sbjct: 28059092 atccatccatccatccatccttctcct 28059066 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 173 aaatccatccatccatccatcc 194 |||||||||||||||||||||| Sbjct: 6156006 aaatccatccatccatccatcc 6155985 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 27999761 aatccatccatccatccatcc 27999781 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 20095250 atccatccatccatccatcct 20095230 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 29468174 atccatccatccatccatcc 29468155 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27828978 atccatccatccatccatcc 27828959 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 27828974 atccatccatccatccatcc 27828955 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20279959 atccatccatccatccatcc 20279940 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 20095254 atccatccatccatccatcc 20095235 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18902682 atccatccatccatccatcc 18902701 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 11609762 atccatccatccatccatcc 11609743 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7352596 atccatccatccatccatcc 7352615 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7352592 atccatccatccatccatcc 7352611 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 7352588 atccatccatccatccatcc 7352607 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 6226304 atccatccatccatccatcc 6226285
>gb|AC005064.3|AC005064 Homo sapiens clone CTB-107G13, complete sequence Length = 119484 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 83830 atccatccatccatccatcctcc 83852
>emb|BX821930.1|CNS0A94H Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL85ZE12 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 745 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtgga 280 ||||||||||||||||||||||| Sbjct: 97 atgatgagtgattacaaggtgga 119
>gb|AC157497.3| Pan troglodytes BAC clone CH251-490K17 from chromosome unknown, complete sequence Length = 207664 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 87054 atccatccatccatccatcctcc 87076 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 86886 atccatccatccatccatcctcc 86908 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 86574 atccatccatccatccatcctcc 86596 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctc 196 |||||||||||||||||||||| Sbjct: 86942 atccatccatccatccatcctc 86963 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctc 196 |||||||||||||||||||||| Sbjct: 86774 atccatccatccatccatcctc 86795 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 86694 atccatccatccatccatcct 86714 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87134 atccatccatccatccatcc 87153 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87130 atccatccatccatccatcc 87149 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 87050 atccatccatccatccatcc 87069 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86938 atccatccatccatccatcc 86957 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86934 atccatccatccatccatcc 86953 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86930 atccatccatccatccatcc 86949 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86926 atccatccatccatccatcc 86945 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86922 atccatccatccatccatcc 86941 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86918 atccatccatccatccatcc 86937 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86914 atccatccatccatccatcc 86933 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86882 atccatccatccatccatcc 86901 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86770 atccatccatccatccatcc 86789 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86766 atccatccatccatccatcc 86785 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86762 atccatccatccatccatcc 86781 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86758 atccatccatccatccatcc 86777 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86690 atccatccatccatccatcc 86709 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86686 atccatccatccatccatcc 86705 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86682 atccatccatccatccatcc 86701 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86678 atccatccatccatccatcc 86697 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86674 atccatccatccatccatcc 86693 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 86570 atccatccatccatccatcc 86589
>gb|AC154733.2| Mus musculus BAC clone RP24-380I6 from chromosome 13, complete sequence Length = 209751 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 126173 atccatccatccatccatcctcc 126195 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 129769 atccatccatccatccatcct 129749 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 126137 atccatccatccatccatcct 126157 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129773 atccatccatccatccatcc 129754 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129741 atccatccatccatccatcc 129722 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129737 atccatccatccatccatcc 129718 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129733 atccatccatccatccatcc 129714 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129729 atccatccatccatccatcc 129710 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129725 atccatccatccatccatcc 129706 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129721 atccatccatccatccatcc 129702 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 129717 atccatccatccatccatcc 129698 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126301 atccatccatccatccatcc 126320 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126297 atccatccatccatccatcc 126316 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126293 atccatccatccatccatcc 126312 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126289 atccatccatccatccatcc 126308 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126285 atccatccatccatccatcc 126304 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126281 atccatccatccatccatcc 126300 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126277 atccatccatccatccatcc 126296 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126245 atccatccatccatccatcc 126264 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126241 atccatccatccatccatcc 126260 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126237 atccatccatccatccatcc 126256 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126233 atccatccatccatccatcc 126252 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126229 atccatccatccatccatcc 126248 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126225 atccatccatccatccatcc 126244 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126221 atccatccatccatccatcc 126240 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126133 atccatccatccatccatcc 126152 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126129 atccatccatccatccatcc 126148 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126097 atccatccatccatccatcc 126116 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126093 atccatccatccatccatcc 126112 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126089 atccatccatccatccatcc 126108 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126085 atccatccatccatccatcc 126104 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126081 atccatccatccatccatcc 126100 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126077 atccatccatccatccatcc 126096 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126045 atccatccatccatccatcc 126064 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126041 atccatccatccatccatcc 126060 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126037 atccatccatccatccatcc 126056 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126033 atccatccatccatccatcc 126052 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126029 atccatccatccatccatcc 126048 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 126025 atccatccatccatccatcc 126044
>dbj|AP000056.1| Homo sapiens genomic DNA, chromosome 21q22.1, segment 27/28, complete sequence Length = 100000 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 51597 caaatccatccatccatccatcc 51619 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 51608 atccatccatccatccatcc 51627 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 51604 atccatccatccatccatcc 51623 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 51391 atccatccatccatccatcc 51410
>ref|NM_182562.1| Homo sapiens hypothetical protein FLJ39743 (FLJ39743), mRNA Length = 3376 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 2815 atccatccatccatccatcctcc 2837 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 2474 atccatccatccatccatcctcc 2496 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 2608 atccatccatccatccatcct 2628 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2865 atccatccatccatccatcc 2884 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2861 atccatccatccatccatcc 2880 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2857 atccatccatccatccatcc 2876 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2853 atccatccatccatccatcc 2872 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2849 atccatccatccatccatcc 2868 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2845 atccatccatccatccatcc 2864 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2784 atccatccatccatccatcc 2803 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2780 atccatccatccatccatcc 2799 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2776 atccatccatccatccatcc 2795 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2772 atccatccatccatccatcc 2791 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2768 atccatccatccatccatcc 2787 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2726 atccatccatccatccatcc 2745 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2604 atccatccatccatccatcc 2623 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 2577 catccatccatccatcctcc 2596 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2470 atccatccatccatccatcc 2489 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2466 atccatccatccatccatcc 2485 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 2462 atccatccatccatccatcc 2481 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 catccatccatccatcctcc 197 |||||||||||||||||||| Sbjct: 2435 catccatccatccatcctcc 2454
>gb|AC117376.3| Homo sapiens 12 BAC RP11-349K16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 177041 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 159799 caaatccatccatccatccatcc 159777 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 159844 atccatccatccatccatcc 159825 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 159840 atccatccatccatccatcc 159821 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 159836 atccatccatccatccatcc 159817 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 159832 atccatccatccatccatcc 159813
>gb|AC018802.8| Homo sapiens BAC clone RP11-315L16 from 2, complete sequence Length = 123993 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 99587 atccatccatccatccatcctcc 99565 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99595 atccatccatccatccatcc 99576 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99591 atccatccatccatccatcc 99572 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99440 atccatccatccatccatcc 99421
>gb|BT005208.1| Arabidopsis thaliana At2g46030 mRNA, complete cds Length = 552 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 258 atgatgagtgattacaaggtgga 280 ||||||||||||||||||||||| Sbjct: 46 atgatgagtgattacaaggtgga 68
>gb|AC113611.3| Homo sapiens BAC clone RP11-421M20 from 4, complete sequence Length = 60597 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 43060 atccatccatccatccatcctcc 43082 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43056 atccatccatccatccatcc 43075 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43052 atccatccatccatccatcc 43071 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33840 atccatccatccatccatcc 33859 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33836 atccatccatccatccatcc 33855 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33832 atccatccatccatccatcc 33851 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33828 atccatccatccatccatcc 33847 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33824 atccatccatccatccatcc 33843 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33820 atccatccatccatccatcc 33839 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33816 atccatccatccatccatcc 33835 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33812 atccatccatccatccatcc 33831 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33808 atccatccatccatccatcc 33827 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33804 atccatccatccatccatcc 33823 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33800 atccatccatccatccatcc 33819 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33796 atccatccatccatccatcc 33815 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33792 atccatccatccatccatcc 33811 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33788 atccatccatccatccatcc 33807 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33784 atccatccatccatccatcc 33803 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33780 atccatccatccatccatcc 33799 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33776 atccatccatccatccatcc 33795 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33772 atccatccatccatccatcc 33791 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33768 atccatccatccatccatcc 33787 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33764 atccatccatccatccatcc 33783 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33760 atccatccatccatccatcc 33779 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33756 atccatccatccatccatcc 33775 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33752 atccatccatccatccatcc 33771 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33748 atccatccatccatccatcc 33767 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33744 atccatccatccatccatcc 33763 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33740 atccatccatccatccatcc 33759 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33736 atccatccatccatccatcc 33755
>emb|BX248331.8| Zebrafish DNA sequence from clone CH211-236D3 in linkage group 11, complete sequence Length = 174071 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 173 aaatccatccatccatccatcct 195 ||||||||||||||||||||||| Sbjct: 143177 aaatccatccatccatccatcct 143155 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85077 atccatccatccatccatcc 85096 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85073 atccatccatccatccatcc 85092 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85069 atccatccatccatccatcc 85088 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85065 atccatccatccatccatcc 85084 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42982 atccatccatccatccatcc 42963
>emb|BX294160.6| Zebrafish DNA sequence from clone CH211-285I13 in linkage group 2, complete sequence Length = 151660 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 23754 caaatccatccatccatccatcc 23776 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 23487 aatccatccatccatccatcc 23507 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 145246 atccatccatccatccatcc 145265 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 145242 atccatccatccatccatcc 145261 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 145238 atccatccatccatccatcc 145257 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144894 atccatccatccatccatcc 144913 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144890 atccatccatccatccatcc 144909 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144866 atccatccatccatccatcc 144885 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144862 atccatccatccatccatcc 144881 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144722 atccatccatccatccatcc 144741 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144718 atccatccatccatccatcc 144737 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144714 atccatccatccatccatcc 144733 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144710 atccatccatccatccatcc 144729 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144706 atccatccatccatccatcc 144725 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144702 atccatccatccatccatcc 144721 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144569 atccatccatccatccatcc 144588 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144565 atccatccatccatccatcc 144584 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144561 atccatccatccatccatcc 144580 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144557 atccatccatccatccatcc 144576 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144553 atccatccatccatccatcc 144572 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144549 atccatccatccatccatcc 144568 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144545 atccatccatccatccatcc 144564 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144541 atccatccatccatccatcc 144560 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144537 atccatccatccatccatcc 144556 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 144533 atccatccatccatccatcc 144552 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97879 atccatccatccatccatcc 97860 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97875 atccatccatccatccatcc 97856 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97871 atccatccatccatccatcc 97852 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97867 atccatccatccatccatcc 97848 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97863 atccatccatccatccatcc 97844 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97859 atccatccatccatccatcc 97840 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97855 atccatccatccatccatcc 97836 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97851 atccatccatccatccatcc 97832 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97847 atccatccatccatccatcc 97828 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97843 atccatccatccatccatcc 97824 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97839 atccatccatccatccatcc 97820 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97835 atccatccatccatccatcc 97816 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97831 atccatccatccatccatcc 97812 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97827 atccatccatccatccatcc 97808 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97823 atccatccatccatccatcc 97804 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97819 atccatccatccatccatcc 97800 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97815 atccatccatccatccatcc 97796 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97811 atccatccatccatccatcc 97792 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97807 atccatccatccatccatcc 97788 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97803 atccatccatccatccatcc 97784 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97799 atccatccatccatccatcc 97780 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97795 atccatccatccatccatcc 97776 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97791 atccatccatccatccatcc 97772 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97787 atccatccatccatccatcc 97768 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97783 atccatccatccatccatcc 97764 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97779 atccatccatccatccatcc 97760 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97775 atccatccatccatccatcc 97756 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97622 atccatccatccatccatcc 97603 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97618 atccatccatccatccatcc 97599 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97614 atccatccatccatccatcc 97595 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97610 atccatccatccatccatcc 97591 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97606 atccatccatccatccatcc 97587 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97602 atccatccatccatccatcc 97583 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97598 atccatccatccatccatcc 97579 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97594 atccatccatccatccatcc 97575 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97590 atccatccatccatccatcc 97571 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 97586 atccatccatccatccatcc 97567 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23765 atccatccatccatccatcc 23784 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23761 atccatccatccatccatcc 23780 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23516 atccatccatccatccatcc 23535 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23512 atccatccatccatccatcc 23531 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23301 atccatccatccatccatcc 23320 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23297 atccatccatccatccatcc 23316
>gb|AC079587.4| Homo sapiens BAC clone RP11-245G13 from 2, complete sequence Length = 53801 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 32335 atccatccatccatccatcctcc 32357 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 32331 atccatccatccatccatcc 32350
>gb|AC092758.3| Papio anubis clone RP41-22J16, complete sequence Length = 171690 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 31733 atccatccatccatccatcctcc 31755 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 31729 atccatccatccatccatcc 31748 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 31725 atccatccatccatccatcc 31744 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 31721 atccatccatccatccatcc 31740
>gb|AC021636.16| Homo sapiens chromosome 8, clone RP11-637F16, complete sequence Length = 148687 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 101399 atccatccatccatccatcctcc 101377 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 101403 atccatccatccatccatcc 101384 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100060 atccatccatccatccatcc 100041
>gb|AC007406.1| Homo sapiens 12 BAC RPCI11-283I3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 177402 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 44153 atccatccatccatccatcctcc 44131 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44317 atccatccatccatccatcc 44298 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44269 atccatccatccatccatcc 44250 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44265 atccatccatccatccatcc 44246 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44261 atccatccatccatccatcc 44242 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44257 atccatccatccatccatcc 44238 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44253 atccatccatccatccatcc 44234 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44249 atccatccatccatccatcc 44230 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44197 atccatccatccatccatcc 44178 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44193 atccatccatccatccatcc 44174 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44189 atccatccatccatccatcc 44170 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44185 atccatccatccatccatcc 44166 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44157 atccatccatccatccatcc 44138 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24098 atccatccatccatccatcc 24117 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24094 atccatccatccatccatcc 24113 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24090 atccatccatccatccatcc 24109 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24086 atccatccatccatccatcc 24105 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24082 atccatccatccatccatcc 24101 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24078 atccatccatccatccatcc 24097 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24074 atccatccatccatccatcc 24093 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24070 atccatccatccatccatcc 24089 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24066 atccatccatccatccatcc 24085 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24062 atccatccatccatccatcc 24081 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24058 atccatccatccatccatcc 24077 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24054 atccatccatccatccatcc 24073 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24050 atccatccatccatccatcc 24069 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24046 atccatccatccatccatcc 24065 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24042 atccatccatccatccatcc 24061 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24038 atccatccatccatccatcc 24057 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24034 atccatccatccatccatcc 24053 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24030 atccatccatccatccatcc 24049 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24026 atccatccatccatccatcc 24045 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24022 atccatccatccatccatcc 24041 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24018 atccatccatccatccatcc 24037 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24014 atccatccatccatccatcc 24033 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24010 atccatccatccatccatcc 24029 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24006 atccatccatccatccatcc 24025 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 24002 atccatccatccatccatcc 24021 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 23998 atccatccatccatccatcc 24017
>gb|AC108448.12| Homo sapiens chromosome 11, clone CTD-2544D21, complete sequence Length = 198599 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 92782 atccatccatccatccatcctcc 92804 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176047 atccatccatccatccatcc 176066 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176043 atccatccatccatccatcc 176062 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176039 atccatccatccatccatcc 176058 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176035 atccatccatccatccatcc 176054 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176031 atccatccatccatccatcc 176050 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176027 atccatccatccatccatcc 176046 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176023 atccatccatccatccatcc 176042 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 176019 atccatccatccatccatcc 176038 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175995 atccatccatccatccatcc 176014 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175991 atccatccatccatccatcc 176010 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175987 atccatccatccatccatcc 176006 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175983 atccatccatccatccatcc 176002 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175907 atccatccatccatccatcc 175926 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175903 atccatccatccatccatcc 175922 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175899 atccatccatccatccatcc 175918 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175895 atccatccatccatccatcc 175914 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 175891 atccatccatccatccatcc 175910 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93097 atccatccatccatccatcc 93116 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93093 atccatccatccatccatcc 93112 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93089 atccatccatccatccatcc 93108 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93085 atccatccatccatccatcc 93104 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93081 atccatccatccatccatcc 93100 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93077 atccatccatccatccatcc 93096 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93021 atccatccatccatccatcc 93040 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93017 atccatccatccatccatcc 93036 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93013 atccatccatccatccatcc 93032 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93009 atccatccatccatccatcc 93028 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93005 atccatccatccatccatcc 93024 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 93001 atccatccatccatccatcc 93020 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92997 atccatccatccatccatcc 93016 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92925 atccatccatccatccatcc 92944 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92837 atccatccatccatccatcc 92856 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92778 atccatccatccatccatcc 92797 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92774 atccatccatccatccatcc 92793 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92770 atccatccatccatccatcc 92789 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92766 atccatccatccatccatcc 92785 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92631 atccatccatccatccatcc 92650 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92595 atccatccatccatccatcc 92614 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatc 193 |||||||||||||||||||| Sbjct: 92495 aatccatccatccatccatc 92514 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92449 atccatccatccatccatcc 92468 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 92413 atccatccatccatccatcc 92432 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85903 atccatccatccatccatcc 85884 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85899 atccatccatccatccatcc 85880
>gb|AC016138.8| Homo sapiens 3 BAC RP11-91B3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 179680 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 95902 caaatccatccatccatccatcc 95880 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95895 atccatccatccatccatcc 95876 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95891 atccatccatccatccatcc 95872 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95887 atccatccatccatccatcc 95868 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95883 atccatccatccatccatcc 95864 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 95879 atccatccatccatccatcc 95860
>gb|AC147220.3| Mus musculus BAC clone RP23-51A20 from chromosome 18, complete sequence Length = 208705 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 195873 caaatccatccatccatccatcc 195851 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 195866 atccatccatccatccatcc 195847 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 195862 atccatccatccatccatcc 195843 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 195858 atccatccatccatccatcc 195839 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 195854 atccatccatccatccatcc 195835
>gb|AC127285.4| Mus musculus BAC clone RP23-336P20 from chromosome 8, complete sequence Length = 232127 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 111669 atccatccatccatccatcctcc 111691 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 194077 atccatccatccatccatcc 194096 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 193994 atccatccatccatccatcc 194013 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111665 atccatccatccatccatcc 111684 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111661 atccatccatccatccatcc 111680 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111657 atccatccatccatccatcc 111676 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111653 atccatccatccatccatcc 111672 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111649 atccatccatccatccatcc 111668 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111645 atccatccatccatccatcc 111664 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111641 atccatccatccatccatcc 111660 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111170 atccatccatccatccatcc 111189 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111166 atccatccatccatccatcc 111185 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 104080 atccatccatccatccatcc 104061 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 104076 atccatccatccatccatcc 104057 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 104072 atccatccatccatccatcc 104053
>gb|AC073934.1|AC073934 Human Chromosome 7 clone SCb-354C16, complete sequence Length = 131165 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 111267 atccatccatccatccatcctcc 111289 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111733 atccatccatccatccatcc 111752 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111729 atccatccatccatccatcc 111748 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111725 atccatccatccatccatcc 111744 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111721 atccatccatccatccatcc 111740 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111717 atccatccatccatccatcc 111736 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111713 atccatccatccatccatcc 111732 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111709 atccatccatccatccatcc 111728 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111263 atccatccatccatccatcc 111282 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111259 atccatccatccatccatcc 111278 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111255 atccatccatccatccatcc 111274 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111251 atccatccatccatccatcc 111270 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111247 atccatccatccatccatcc 111266 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 111243 atccatccatccatccatcc 111262
>gb|AC116769.11| Mus musculus chromosome 15, clone RP23-415L16, complete sequence Length = 201535 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 55571 atccatccatccatccatcctcc 55593 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 171 ccaaatccatccatccatccat 192 |||||||||||||||||||||| Sbjct: 131358 ccaaatccatccatccatccat 131379 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131427 atccatccatccatccatcc 131446 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131423 atccatccatccatccatcc 131442 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131419 atccatccatccatccatcc 131438 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131398 atccatccatccatccatcc 131417 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131277 atccatccatccatccatcc 131296 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131253 atccatccatccatccatcc 131272 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131249 atccatccatccatccatcc 131268 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131245 atccatccatccatccatcc 131264 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131241 atccatccatccatccatcc 131260 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131237 atccatccatccatccatcc 131256 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131233 atccatccatccatccatcc 131252 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 55949 atccatccatccatccatcc 55968 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 55945 atccatccatccatccatcc 55964 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 55941 atccatccatccatccatcc 55960 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 55937 atccatccatccatccatcc 55956 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 55933 atccatccatccatccatcc 55952 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 55567 atccatccatccatccatcc 55586 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 55563 atccatccatccatccatcc 55582 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 55559 atccatccatccatccatcc 55578 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 55555 atccatccatccatccatcc 55574 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 55531 atccatccatccatccatcc 55550
>emb|AL954710.27| Mouse DNA sequence from clone RP23-275J10 on chromosome 4, complete sequence Length = 202551 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 10320 atccatccatccatccatcctcc 10298 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 10798 atccatccatccatccatcct 10778 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 10537 atccatccatccatccatcct 10517 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143623 atccatccatccatccatcc 143604 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52574 atccatccatccatccatcc 52555 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52570 atccatccatccatccatcc 52551 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52566 atccatccatccatccatcc 52547 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52562 atccatccatccatccatcc 52543 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52558 atccatccatccatccatcc 52539 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52554 atccatccatccatccatcc 52535 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52550 atccatccatccatccatcc 52531 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52546 atccatccatccatccatcc 52527 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52542 atccatccatccatccatcc 52523 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52538 atccatccatccatccatcc 52519 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52514 atccatccatccatccatcc 52495 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52510 atccatccatccatccatcc 52491 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 52506 atccatccatccatccatcc 52487 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10826 atccatccatccatccatcc 10807 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10822 atccatccatccatccatcc 10803 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10818 atccatccatccatccatcc 10799 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10814 atccatccatccatccatcc 10795 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10810 atccatccatccatccatcc 10791 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10806 atccatccatccatccatcc 10787 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10802 atccatccatccatccatcc 10783 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10766 atccatccatccatccatcc 10747 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10762 atccatccatccatccatcc 10743 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10758 atccatccatccatccatcc 10739 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10754 atccatccatccatccatcc 10735 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10750 atccatccatccatccatcc 10731 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10702 atccatccatccatccatcc 10683 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10698 atccatccatccatccatcc 10679 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10694 atccatccatccatccatcc 10675 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10690 atccatccatccatccatcc 10671 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10686 atccatccatccatccatcc 10667 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10682 atccatccatccatccatcc 10663 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10678 atccatccatccatccatcc 10659 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10674 atccatccatccatccatcc 10655 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10549 atccatccatccatccatcc 10530 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10545 atccatccatccatccatcc 10526 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10541 atccatccatccatccatcc 10522 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10505 atccatccatccatccatcc 10486 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10501 atccatccatccatccatcc 10482 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10497 atccatccatccatccatcc 10478 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10493 atccatccatccatccatcc 10474 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10489 atccatccatccatccatcc 10470 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10485 atccatccatccatccatcc 10466 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10481 atccatccatccatccatcc 10462 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10477 atccatccatccatccatcc 10458 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10433 atccatccatccatccatcc 10414 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10429 atccatccatccatccatcc 10410 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10425 atccatccatccatccatcc 10406 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10421 atccatccatccatccatcc 10402 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10417 atccatccatccatccatcc 10398 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10340 atccatccatccatccatcc 10321 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10336 atccatccatccatccatcc 10317 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10332 atccatccatccatccatcc 10313 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10328 atccatccatccatccatcc 10309 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10324 atccatccatccatccatcc 10305
>emb|BX005045.10| Zebrafish DNA sequence from clone CH211-69C9 in linkage group 19, complete sequence Length = 161812 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 151057 caaatccatccatccatccatcc 151079 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 108220 aatccatccatccatccatcc 108240 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157899 atccatccatccatccatcc 157918 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157895 atccatccatccatccatcc 157914 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157891 atccatccatccatccatcc 157910 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157887 atccatccatccatccatcc 157906 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157859 atccatccatccatccatcc 157878 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157855 atccatccatccatccatcc 157874 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157851 atccatccatccatccatcc 157870 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157847 atccatccatccatccatcc 157866 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157843 atccatccatccatccatcc 157862 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157839 atccatccatccatccatcc 157858 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157766 atccatccatccatccatcc 157785 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157762 atccatccatccatccatcc 157781 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157758 atccatccatccatccatcc 157777 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157754 atccatccatccatccatcc 157773 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157750 atccatccatccatccatcc 157769 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157746 atccatccatccatccatcc 157765 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157742 atccatccatccatccatcc 157761 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157738 atccatccatccatccatcc 157757 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157734 atccatccatccatccatcc 157753 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157730 atccatccatccatccatcc 157749 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157726 atccatccatccatccatcc 157745 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 157722 atccatccatccatccatcc 157741 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151213 atccatccatccatccatcc 151232 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151209 atccatccatccatccatcc 151228 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151205 atccatccatccatccatcc 151224 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151201 atccatccatccatccatcc 151220 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151197 atccatccatccatccatcc 151216 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151193 atccatccatccatccatcc 151212 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151189 atccatccatccatccatcc 151208 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151185 atccatccatccatccatcc 151204 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151124 atccatccatccatccatcc 151143 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151120 atccatccatccatccatcc 151139 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151116 atccatccatccatccatcc 151135 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151112 atccatccatccatccatcc 151131 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151108 atccatccatccatccatcc 151127 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151104 atccatccatccatccatcc 151123 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151100 atccatccatccatccatcc 151119 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 151096 atccatccatccatccatcc 151115 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109138 atccatccatccatccatcc 109157 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109134 atccatccatccatccatcc 109153 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109130 atccatccatccatccatcc 109149 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109126 atccatccatccatccatcc 109145 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109122 atccatccatccatccatcc 109141 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109118 atccatccatccatccatcc 109137 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109114 atccatccatccatccatcc 109133 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109110 atccatccatccatccatcc 109129 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109106 atccatccatccatccatcc 109125 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108932 atccatccatccatccatcc 108951 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108904 atccatccatccatccatcc 108923 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108656 atccatccatccatccatcc 108675 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108652 atccatccatccatccatcc 108671 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108648 atccatccatccatccatcc 108667 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108644 atccatccatccatccatcc 108663 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108640 atccatccatccatccatcc 108659 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108636 atccatccatccatccatcc 108655 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108632 atccatccatccatccatcc 108651 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108628 atccatccatccatccatcc 108647 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108624 atccatccatccatccatcc 108643 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108620 atccatccatccatccatcc 108639 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108616 atccatccatccatccatcc 108635 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108612 atccatccatccatccatcc 108631 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108608 atccatccatccatccatcc 108627 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108604 atccatccatccatccatcc 108623 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108600 atccatccatccatccatcc 108619 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108596 atccatccatccatccatcc 108615 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108592 atccatccatccatccatcc 108611 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108588 atccatccatccatccatcc 108607 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108584 atccatccatccatccatcc 108603 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108580 atccatccatccatccatcc 108599 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108576 atccatccatccatccatcc 108595 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108572 atccatccatccatccatcc 108591 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108432 atccatccatccatccatcc 108451 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108337 atccatccatccatccatcc 108356 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108333 atccatccatccatccatcc 108352 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108261 atccatccatccatccatcc 108280 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108257 atccatccatccatccatcc 108276 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108253 atccatccatccatccatcc 108272 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108249 atccatccatccatccatcc 108268 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108245 atccatccatccatccatcc 108264 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108241 atccatccatccatccatcc 108260 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108237 atccatccatccatccatcc 108256 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108233 atccatccatccatccatcc 108252 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108229 atccatccatccatccatcc 108248 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108225 atccatccatccatccatcc 108244 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108101 atccatccatccatccatcc 108120 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108097 atccatccatccatccatcc 108116 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108093 atccatccatccatccatcc 108112 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108089 atccatccatccatccatcc 108108 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108085 atccatccatccatccatcc 108104 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108081 atccatccatccatccatcc 108100 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108077 atccatccatccatccatcc 108096 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108073 atccatccatccatccatcc 108092 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108069 atccatccatccatccatcc 108088 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108065 atccatccatccatccatcc 108084 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108061 atccatccatccatccatcc 108080 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107969 atccatccatccatccatcc 107988 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107965 atccatccatccatccatcc 107984 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107961 atccatccatccatccatcc 107980 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107957 atccatccatccatccatcc 107976 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107953 atccatccatccatccatcc 107972 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107949 atccatccatccatccatcc 107968 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107945 atccatccatccatccatcc 107964 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107941 atccatccatccatccatcc 107960 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107579 atccatccatccatccatcc 107598 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107305 atccatccatccatccatcc 107324 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107301 atccatccatccatccatcc 107320 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107297 atccatccatccatccatcc 107316 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107176 atccatccatccatccatcc 107195 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 107172 atccatccatccatccatcc 107191 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96502 atccatccatccatccatcc 96521 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96498 atccatccatccatccatcc 96517 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96494 atccatccatccatccatcc 96513 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96490 atccatccatccatccatcc 96509 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96486 atccatccatccatccatcc 96505 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96482 atccatccatccatccatcc 96501 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96478 atccatccatccatccatcc 96497 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96474 atccatccatccatccatcc 96493 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96470 atccatccatccatccatcc 96489 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96466 atccatccatccatccatcc 96485 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96462 atccatccatccatccatcc 96481 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96458 atccatccatccatccatcc 96477 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96454 atccatccatccatccatcc 96473 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96450 atccatccatccatccatcc 96469 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96446 atccatccatccatccatcc 96465 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96442 atccatccatccatccatcc 96461 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96438 atccatccatccatccatcc 96457 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96434 atccatccatccatccatcc 96453 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96430 atccatccatccatccatcc 96449 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96426 atccatccatccatccatcc 96445 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96422 atccatccatccatccatcc 96441 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96418 atccatccatccatccatcc 96437 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96414 atccatccatccatccatcc 96433 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96410 atccatccatccatccatcc 96429 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96406 atccatccatccatccatcc 96425 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96402 atccatccatccatccatcc 96421 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96398 atccatccatccatccatcc 96417 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 96394 atccatccatccatccatcc 96413 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83854 atccatccatccatccatcc 83873 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 83850 atccatccatccatccatcc 83869
>gb|AC158669.3| Mus musculus 6 BAC RP23-66K6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 242779 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 132838 atccatccatccatccatcctcc 132860 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132834 atccatccatccatccatcc 132853 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132830 atccatccatccatccatcc 132849 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132826 atccatccatccatccatcc 132845 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 132794 atccatccatccatccatcc 132813
>emb|AL772132.6| Zebrafish DNA sequence from clone CH211-196N11, complete sequence Length = 205802 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 165742 atccatccatccatccatcctcc 165764 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 165738 atccatccatccatccatcc 165757 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 165734 atccatccatccatccatcc 165753 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43222 atccatccatccatccatcc 43203 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43218 atccatccatccatccatcc 43199 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43214 atccatccatccatccatcc 43195 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43210 atccatccatccatccatcc 43191 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42909 atccatccatccatccatcc 42890 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42905 atccatccatccatccatcc 42886 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33054 atccatccatccatccatcc 33035 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 33050 atccatccatccatccatcc 33031
>dbj|BS000192.1| Pan troglodytes chromosome 22 clone:PTB-125M11, map 22, complete sequences Length = 189269 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 74785 caaatccatccatccatccatcc 74807
>dbj|AK119596.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-117-D11, full insert sequence Length = 2378 Score = 46.1 bits (23), Expect = 0.090 Identities = 26/27 (96%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcctcct 201 ||||||||||||||||||||| ||||| Sbjct: 1818 atccatccatccatccatccttctcct 1844
>gb|AC000359.1|HSAC000359 Human cosmid g1572c264, complete sequence Length = 43394 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 28479 atccatccatccatccatcctcc 28457 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28499 atccatccatccatccatcc 28480 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28495 atccatccatccatccatcc 28476 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28491 atccatccatccatccatcc 28472 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28487 atccatccatccatccatcc 28468 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28483 atccatccatccatccatcc 28464 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28037 atccatccatccatccatcc 28018 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28033 atccatccatccatccatcc 28014 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28029 atccatccatccatccatcc 28010 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28025 atccatccatccatccatcc 28006 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28021 atccatccatccatccatcc 28002 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 28017 atccatccatccatccatcc 27998
>emb|AJ340231.1|HSA340231 Homo sapiens genomic sequence surrounding NotI site, clone NR1-SJ22C Length = 681 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 535 atccatccatccatccatcctcc 557 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 531 atccatccatccatccatcc 550
>dbj|AK101103.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033025C07, full insert sequence Length = 2356 Score = 46.1 bits (23), Expect = 0.090 Identities = 26/27 (96%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcctcct 201 ||||||||||||||||||||| ||||| Sbjct: 1819 atccatccatccatccatccttctcct 1845
>gb|AC155305.2| Mus musculus BAC clone RP24-182I21 from 12, complete sequence Length = 172724 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 66860 atccatccatccatccatcctcc 66882 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66856 atccatccatccatccatcc 66875 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66852 atccatccatccatccatcc 66871 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66848 atccatccatccatccatcc 66867 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66844 atccatccatccatccatcc 66863 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66840 atccatccatccatccatcc 66859 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66836 atccatccatccatccatcc 66855 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66832 atccatccatccatccatcc 66851 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66828 atccatccatccatccatcc 66847 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66824 atccatccatccatccatcc 66843 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 66796 atccatccatccatccatcc 66815
>emb|AL391153.3|CNS06C7Z Human chromosome 14 DNA sequence BAC C-2576L4 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 172336 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 114930 atccatccatccatccatcctcc 114952 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 58295 atccatccatccatccatcct 58315 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 114906 atccatccatccatccatcc 114925 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 114902 atccatccatccatccatcc 114921 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 114898 atccatccatccatccatcc 114917 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58507 atccatccatccatccatcc 58526 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58503 atccatccatccatccatcc 58522 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58291 atccatccatccatccatcc 58310 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58287 atccatccatccatccatcc 58306 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58283 atccatccatccatccatcc 58302 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58279 atccatccatccatccatcc 58298 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58275 atccatccatccatccatcc 58294 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58271 atccatccatccatccatcc 58290
>gb|AC008000.7|AC008000 Homo sapiens 3q25-26 BAC CITB-371O18 (California Institute of Technology BAC Library) complete sequence Length = 131105 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 10386 caaatccatccatccatccatcc 10364 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 177 ccatccatccatccatcctcc 197 ||||||||||||||||||||| Sbjct: 10585 ccatccatccatccatcctcc 10565 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 44754 atccatccatccatccatcc 44735 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10503 atccatccatccatccatcc 10484 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10471 atccatccatccatccatcc 10452 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10467 atccatccatccatccatcc 10448 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10463 atccatccatccatccatcc 10444 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10459 atccatccatccatccatcc 10440 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10455 atccatccatccatccatcc 10436 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10451 atccatccatccatccatcc 10432 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 10379 atccatccatccatccatcc 10360
>emb|BX950197.23| Zebrafish DNA sequence from clone CH211-123N8 in linkage group 10, complete sequence Length = 155683 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 45862 atccatccatccatccatcctcc 45884 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 42728 caaatccatccatccatccatcc 42750 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcct 195 |||||||||||||||||||||| Sbjct: 81318 aatccatccatccatccatcct 81339 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 45555 aatccatccatccatccatcc 45575 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81211 atccatccatccatccatcc 81230 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81207 atccatccatccatccatcc 81226 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81203 atccatccatccatccatcc 81222 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81161 atccatccatccatccatcc 81180 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81157 atccatccatccatccatcc 81176 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81153 atccatccatccatccatcc 81172 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81149 atccatccatccatccatcc 81168 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81145 atccatccatccatccatcc 81164 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81141 atccatccatccatccatcc 81160 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81137 atccatccatccatccatcc 81156 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81133 atccatccatccatccatcc 81152 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81129 atccatccatccatccatcc 81148 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 81125 atccatccatccatccatcc 81144 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45640 atccatccatccatccatcc 45659 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45636 atccatccatccatccatcc 45655 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45632 atccatccatccatccatcc 45651 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45628 atccatccatccatccatcc 45647 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45624 atccatccatccatccatcc 45643 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45620 atccatccatccatccatcc 45639 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45616 atccatccatccatccatcc 45635 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45612 atccatccatccatccatcc 45631 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45608 atccatccatccatccatcc 45627 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45604 atccatccatccatccatcc 45623 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45600 atccatccatccatccatcc 45619 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45596 atccatccatccatccatcc 45615 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45592 atccatccatccatccatcc 45611 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45588 atccatccatccatccatcc 45607 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45584 atccatccatccatccatcc 45603 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45580 atccatccatccatccatcc 45599 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45576 atccatccatccatccatcc 45595 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45572 atccatccatccatccatcc 45591 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45568 atccatccatccatccatcc 45587 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45564 atccatccatccatccatcc 45583 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45560 atccatccatccatccatcc 45579 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 45516 atccatccatccatccatcc 45535 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 43018 atccatccatccatccatcc 43037 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42811 atccatccatccatccatcc 42830 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42807 atccatccatccatccatcc 42826 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42803 atccatccatccatccatcc 42822 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42799 atccatccatccatccatcc 42818 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42795 atccatccatccatccatcc 42814 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42791 atccatccatccatccatcc 42810 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42787 atccatccatccatccatcc 42806 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42783 atccatccatccatccatcc 42802 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42779 atccatccatccatccatcc 42798 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42775 atccatccatccatccatcc 42794 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42771 atccatccatccatccatcc 42790 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42767 atccatccatccatccatcc 42786 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42763 atccatccatccatccatcc 42782 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42759 atccatccatccatccatcc 42778 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 42735 atccatccatccatccatcc 42754
>gb|AC151716.5| Mus musculus BAC clone RP23-316A23 from 5, complete sequence Length = 193466 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 190009 atccatccatccatccatcctcc 190031 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190112 atccatccatccatccatcc 190131 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190108 atccatccatccatccatcc 190127 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 190005 atccatccatccatccatcc 190024 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 189878 atccatccatccatccatcc 189897 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 189874 atccatccatccatccatcc 189893 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 189870 atccatccatccatccatcc 189889 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 189866 atccatccatccatccatcc 189885 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 189862 atccatccatccatccatcc 189881 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 189738 atccatccatccatccatcc 189757 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 18577 atccatccatccatccatcc 18558
>emb|AL954149.19| Zebrafish DNA sequence from clone CH211-146G19 in linkage group 2, complete sequence Length = 163971 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 56770 atccatccatccatccatcctcc 56792 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58573 atccatccatccatccatcc 58592 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58569 atccatccatccatccatcc 58588 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58565 atccatccatccatccatcc 58584 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58561 atccatccatccatccatcc 58580 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58557 atccatccatccatccatcc 58576 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58284 atccatccatccatccatcc 58303 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57283 atccatccatccatccatcc 57302 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57279 atccatccatccatccatcc 57298 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57275 atccatccatccatccatcc 57294 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57271 atccatccatccatccatcc 57290 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57267 atccatccatccatccatcc 57286 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57263 atccatccatccatccatcc 57282 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57259 atccatccatccatccatcc 57278 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57255 atccatccatccatccatcc 57274 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57251 atccatccatccatccatcc 57270 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57247 atccatccatccatccatcc 57266 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57065 atccatccatccatccatcc 57084 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57061 atccatccatccatccatcc 57080 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57057 atccatccatccatccatcc 57076 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57053 atccatccatccatccatcc 57072 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57049 atccatccatccatccatcc 57068 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57045 atccatccatccatccatcc 57064 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57041 atccatccatccatccatcc 57060 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57037 atccatccatccatccatcc 57056 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 54688 atccatccatccatccatcc 54707 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 54684 atccatccatccatccatcc 54703 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 54680 atccatccatccatccatcc 54699
>emb|BX247899.17| Zebrafish DNA sequence from clone CH211-229B6 in linkage group 19, complete sequence Length = 150160 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 15306 atccatccatccatccatcctcc 15284 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15334 atccatccatccatccatcc 15315 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15330 atccatccatccatccatcc 15311 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15326 atccatccatccatccatcc 15307 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15322 atccatccatccatccatcc 15303 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15318 atccatccatccatccatcc 15299 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15314 atccatccatccatccatcc 15295 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 15310 atccatccatccatccatcc 15291
>emb|BX465846.14| Zebrafish DNA sequence from clone CH211-215B21 in linkage group 18, complete sequence Length = 109342 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 96203 atccatccatccatccatcctcc 96225 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 103330 atccatccatccatccatcct 103310 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 103059 atccatccatccatccatcct 103039 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 102798 atccatccatccatccatcct 102778 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102498 atccatccatccatccatcc 102479 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 102494 atccatccatccatccatcc 102475 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22078 atccatccatccatccatcc 22097 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 22074 atccatccatccatccatcc 22093
>emb|BX004834.13| Zebrafish DNA sequence from clone CH211-42E22 in linkage group 18, complete sequence Length = 188895 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 4952 atccatccatccatccatcctcc 4974 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5081 atccatccatccatccatcc 5100 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5077 atccatccatccatccatcc 5096 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5073 atccatccatccatccatcc 5092 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5069 atccatccatccatccatcc 5088 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5065 atccatccatccatccatcc 5084 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5061 atccatccatccatccatcc 5080 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5057 atccatccatccatccatcc 5076 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5053 atccatccatccatccatcc 5072 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5049 atccatccatccatccatcc 5068 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5045 atccatccatccatccatcc 5064 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5041 atccatccatccatccatcc 5060 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5037 atccatccatccatccatcc 5056 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5033 atccatccatccatccatcc 5052 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5029 atccatccatccatccatcc 5048 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5025 atccatccatccatccatcc 5044 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5021 atccatccatccatccatcc 5040 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5017 atccatccatccatccatcc 5036 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5013 atccatccatccatccatcc 5032 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5009 atccatccatccatccatcc 5028 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5005 atccatccatccatccatcc 5024 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 5001 atccatccatccatccatcc 5020 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 4997 atccatccatccatccatcc 5016
>emb|BX004766.9| Zebrafish DNA sequence from clone DKEY-5P1 in linkage group 20, complete sequence Length = 214782 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 120681 caaatccatccatccatccatcc 120659 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 120986 atccatccatccatccatcct 120966 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 186120 atccatccatccatccatcc 186101 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121090 atccatccatccatccatcc 121071 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121086 atccatccatccatccatcc 121067 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121082 atccatccatccatccatcc 121063 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121078 atccatccatccatccatcc 121059 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121074 atccatccatccatccatcc 121055 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121070 atccatccatccatccatcc 121051 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 121066 atccatccatccatccatcc 121047 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120998 atccatccatccatccatcc 120979 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120994 atccatccatccatccatcc 120975 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120990 atccatccatccatccatcc 120971 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120926 atccatccatccatccatcc 120907 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120806 atccatccatccatccatcc 120787 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120802 atccatccatccatccatcc 120783 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120798 atccatccatccatccatcc 120779 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120794 atccatccatccatccatcc 120775 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120790 atccatccatccatccatcc 120771 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120786 atccatccatccatccatcc 120767 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120782 atccatccatccatccatcc 120763 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120778 atccatccatccatccatcc 120759 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120774 atccatccatccatccatcc 120755 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120770 atccatccatccatccatcc 120751 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120766 atccatccatccatccatcc 120747 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120762 atccatccatccatccatcc 120743 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120758 atccatccatccatccatcc 120739 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120754 atccatccatccatccatcc 120735 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120750 atccatccatccatccatcc 120731 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 120746 atccatccatccatccatcc 120727
>emb|BX470160.9| Zebrafish DNA sequence from clone DKEY-25F3 in linkage group 18, complete sequence Length = 207501 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 4536 atccatccatccatccatcctcc 4558 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 4532 atccatccatccatccatcc 4551
>emb|AL928707.5| Zebrafish DNA sequence from clone CH211-207M2 in linkage group 21, complete sequence Length = 206304 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 84873 caaatccatccatccatccatcc 84895 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 165124 atccatccatccatccatcc 165105 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 165120 atccatccatccatccatcc 165101 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 165116 atccatccatccatccatcc 165097 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85472 atccatccatccatccatcc 85491 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85200 atccatccatccatccatcc 85219 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85196 atccatccatccatccatcc 85215 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85192 atccatccatccatccatcc 85211 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85188 atccatccatccatccatcc 85207 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85184 atccatccatccatccatcc 85203 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85180 atccatccatccatccatcc 85199 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85176 atccatccatccatccatcc 85195 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85172 atccatccatccatccatcc 85191 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85168 atccatccatccatccatcc 85187 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85164 atccatccatccatccatcc 85183 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85160 atccatccatccatccatcc 85179 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85156 atccatccatccatccatcc 85175 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85152 atccatccatccatccatcc 85171 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85148 atccatccatccatccatcc 85167 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85144 atccatccatccatccatcc 85163 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85140 atccatccatccatccatcc 85159 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85136 atccatccatccatccatcc 85155 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85132 atccatccatccatccatcc 85151 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85128 atccatccatccatccatcc 85147 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85124 atccatccatccatccatcc 85143 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85120 atccatccatccatccatcc 85139 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85116 atccatccatccatccatcc 85135 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85112 atccatccatccatccatcc 85131 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85108 atccatccatccatccatcc 85127 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85104 atccatccatccatccatcc 85123 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85100 atccatccatccatccatcc 85119 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85096 atccatccatccatccatcc 85115 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85092 atccatccatccatccatcc 85111 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85088 atccatccatccatccatcc 85107 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85084 atccatccatccatccatcc 85103 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85080 atccatccatccatccatcc 85099 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85076 atccatccatccatccatcc 85095 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85072 atccatccatccatccatcc 85091 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85068 atccatccatccatccatcc 85087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85064 atccatccatccatccatcc 85083 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85060 atccatccatccatccatcc 85079 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85056 atccatccatccatccatcc 85075 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85052 atccatccatccatccatcc 85071 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85048 atccatccatccatccatcc 85067 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85044 atccatccatccatccatcc 85063 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85040 atccatccatccatccatcc 85059 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85036 atccatccatccatccatcc 85055 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85032 atccatccatccatccatcc 85051 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85028 atccatccatccatccatcc 85047 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85024 atccatccatccatccatcc 85043 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85020 atccatccatccatccatcc 85039 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 85016 atccatccatccatccatcc 85035 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84884 atccatccatccatccatcc 84903 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 84880 atccatccatccatccatcc 84899 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 58106 atccatccatccatccatcc 58087 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57209 atccatccatccatccatcc 57190 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 57205 atccatccatccatccatcc 57186 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 176 tccatccatccatccatcct 195 |||||||||||||||||||| Sbjct: 56366 tccatccatccatccatcct 56347
>emb|BX294095.13| Zebrafish DNA sequence from clone CH211-248L17 in linkage group 24, complete sequence Length = 147604 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 38677 atccatccatccatccatcctcc 38655 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 122357 aatccatccatccatccatcc 122377 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 38517 atccatccatccatccatcct 38497 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122434 atccatccatccatccatcc 122453 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122430 atccatccatccatccatcc 122449 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122426 atccatccatccatccatcc 122445 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122422 atccatccatccatccatcc 122441 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122418 atccatccatccatccatcc 122437 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122414 atccatccatccatccatcc 122433 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122410 atccatccatccatccatcc 122429 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122406 atccatccatccatccatcc 122425 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122402 atccatccatccatccatcc 122421 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122398 atccatccatccatccatcc 122417 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122394 atccatccatccatccatcc 122413 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122390 atccatccatccatccatcc 122409 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122386 atccatccatccatccatcc 122405 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122382 atccatccatccatccatcc 122401 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122378 atccatccatccatccatcc 122397 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122374 atccatccatccatccatcc 122393 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122370 atccatccatccatccatcc 122389 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122366 atccatccatccatccatcc 122385 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 122362 atccatccatccatccatcc 122381 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94259 atccatccatccatccatcc 94278 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94255 atccatccatccatccatcc 94274 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94251 atccatccatccatccatcc 94270 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94247 atccatccatccatccatcc 94266 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94243 atccatccatccatccatcc 94262 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94239 atccatccatccatccatcc 94258 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94235 atccatccatccatccatcc 94254 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94231 atccatccatccatccatcc 94250 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94227 atccatccatccatccatcc 94246 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94223 atccatccatccatccatcc 94242 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 94219 atccatccatccatccatcc 94238 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50259 atccatccatccatccatcc 50240 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50255 atccatccatccatccatcc 50236 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50167 atccatccatccatccatcc 50148 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50119 atccatccatccatccatcc 50100 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50115 atccatccatccatccatcc 50096 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50111 atccatccatccatccatcc 50092 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50107 atccatccatccatccatcc 50088 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50103 atccatccatccatccatcc 50084 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50099 atccatccatccatccatcc 50080 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50095 atccatccatccatccatcc 50076 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50091 atccatccatccatccatcc 50072 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50087 atccatccatccatccatcc 50068 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50083 atccatccatccatccatcc 50064 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50079 atccatccatccatccatcc 50060 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50075 atccatccatccatccatcc 50056 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50071 atccatccatccatccatcc 50052 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50067 atccatccatccatccatcc 50048 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 50063 atccatccatccatccatcc 50044 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49999 atccatccatccatccatcc 49980 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49995 atccatccatccatccatcc 49976 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49991 atccatccatccatccatcc 49972 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49967 atccatccatccatccatcc 49948 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49859 atccatccatccatccatcc 49840 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49855 atccatccatccatccatcc 49836 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49851 atccatccatccatccatcc 49832 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49667 atccatccatccatccatcc 49648 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49623 atccatccatccatccatcc 49604 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49619 atccatccatccatccatcc 49600 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49615 atccatccatccatccatcc 49596 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49340 atccatccatccatccatcc 49321 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49336 atccatccatccatccatcc 49317 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49332 atccatccatccatccatcc 49313 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49328 atccatccatccatccatcc 49309 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49324 atccatccatccatccatcc 49305 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49320 atccatccatccatccatcc 49301 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49316 atccatccatccatccatcc 49297 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49312 atccatccatccatccatcc 49293 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49308 atccatccatccatccatcc 49289 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49304 atccatccatccatccatcc 49285 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49300 atccatccatccatccatcc 49281 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49296 atccatccatccatccatcc 49277 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49292 atccatccatccatccatcc 49273 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49288 atccatccatccatccatcc 49269 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49284 atccatccatccatccatcc 49265 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49280 atccatccatccatccatcc 49261 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49276 atccatccatccatccatcc 49257 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38701 atccatccatccatccatcc 38682 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38697 atccatccatccatccatcc 38678 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38693 atccatccatccatccatcc 38674 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38689 atccatccatccatccatcc 38670 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38685 atccatccatccatccatcc 38666 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38681 atccatccatccatccatcc 38662 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38529 atccatccatccatccatcc 38510 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38525 atccatccatccatccatcc 38506 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38521 atccatccatccatccatcc 38502
>emb|CR388140.8| Zebrafish DNA sequence from clone CH211-190G11, complete sequence Length = 160541 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 88937 caaatccatccatccatccatcc 88959 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90098 atccatccatccatccatcc 90117 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90094 atccatccatccatccatcc 90113 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90090 atccatccatccatccatcc 90109 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90086 atccatccatccatccatcc 90105 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90082 atccatccatccatccatcc 90101 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 90078 atccatccatccatccatcc 90097 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89804 atccatccatccatccatcc 89823 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89800 atccatccatccatccatcc 89819 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89796 atccatccatccatccatcc 89815 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89792 atccatccatccatccatcc 89811 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89788 atccatccatccatccatcc 89807 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89784 atccatccatccatccatcc 89803 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89780 atccatccatccatccatcc 89799 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89543 atccatccatccatccatcc 89562 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89539 atccatccatccatccatcc 89558 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89535 atccatccatccatccatcc 89554 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89531 atccatccatccatccatcc 89550 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89527 atccatccatccatccatcc 89546 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 89523 atccatccatccatccatcc 89542 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88964 atccatccatccatccatcc 88983 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88960 atccatccatccatccatcc 88979 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88956 atccatccatccatccatcc 88975 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88952 atccatccatccatccatcc 88971 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88948 atccatccatccatccatcc 88967 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88944 atccatccatccatccatcc 88963 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38761 atccatccatccatccatcc 38742 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38757 atccatccatccatccatcc 38738 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38645 atccatccatccatccatcc 38626 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 38641 atccatccatccatccatcc 38622
>emb|CR388051.22| Zebrafish DNA sequence from clone CH211-239B6 in linkage group 15, complete sequence Length = 120027 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccatcc 194 ||||||||||||||||||||||| Sbjct: 75156 caaatccatccatccatccatcc 75178 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcctc 196 |||||||||||||||||||||| Sbjct: 75603 atccatccatccatccatcctc 75624 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 109080 atccatccatccatccatcct 109060 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 174 aatccatccatccatccatcc 194 ||||||||||||||||||||| Sbjct: 108499 aatccatccatccatccatcc 108479 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 108450 atccatccatccatccatcct 108430 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccat 192 ||||||||||||||||||||| Sbjct: 74976 caaatccatccatccatccat 74996 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 74897 atccatccatccatccatcct 74917 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccat 192 ||||||||||||||||||||| Sbjct: 74756 caaatccatccatccatccat 74776 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcct 195 ||||||||||||||||||||| Sbjct: 74677 atccatccatccatccatcct 74697 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 172 caaatccatccatccatccat 192 ||||||||||||||||||||| Sbjct: 74552 caaatccatccatccatccat 74572 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109220 atccatccatccatccatcc 109201 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109216 atccatccatccatccatcc 109197 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109212 atccatccatccatccatcc 109193 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109208 atccatccatccatccatcc 109189 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109204 atccatccatccatccatcc 109185 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109200 atccatccatccatccatcc 109181 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109196 atccatccatccatccatcc 109177 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109192 atccatccatccatccatcc 109173 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109188 atccatccatccatccatcc 109169 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109184 atccatccatccatccatcc 109165 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109180 atccatccatccatccatcc 109161 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109176 atccatccatccatccatcc 109157 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109172 atccatccatccatccatcc 109153 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109168 atccatccatccatccatcc 109149 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109164 atccatccatccatccatcc 109145 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109160 atccatccatccatccatcc 109141 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109156 atccatccatccatccatcc 109137 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109152 atccatccatccatccatcc 109133 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109148 atccatccatccatccatcc 109129 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109144 atccatccatccatccatcc 109125 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109140 atccatccatccatccatcc 109121 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109136 atccatccatccatccatcc 109117 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109132 atccatccatccatccatcc 109113 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109128 atccatccatccatccatcc 109109 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109124 atccatccatccatccatcc 109105 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109120 atccatccatccatccatcc 109101 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109116 atccatccatccatccatcc 109097 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109112 atccatccatccatccatcc 109093 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109108 atccatccatccatccatcc 109089 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109104 atccatccatccatccatcc 109085 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109100 atccatccatccatccatcc 109081 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109096 atccatccatccatccatcc 109077 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109092 atccatccatccatccatcc 109073 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109088 atccatccatccatccatcc 109069 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109084 atccatccatccatccatcc 109065 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109036 atccatccatccatccatcc 109017 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109032 atccatccatccatccatcc 109013 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 109028 atccatccatccatccatcc 109009 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108814 atccatccatccatccatcc 108795 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108810 atccatccatccatccatcc 108791 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108806 atccatccatccatccatcc 108787 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108802 atccatccatccatccatcc 108783 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108798 atccatccatccatccatcc 108779 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 108746 atccatccatccatccatcc 108727 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100742 atccatccatccatccatcc 100723 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 100738 atccatccatccatccatcc 100719 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99761 atccatccatccatccatcc 99742 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99757 atccatccatccatccatcc 99738 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99753 atccatccatccatccatcc 99734 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99749 atccatccatccatccatcc 99730 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99745 atccatccatccatccatcc 99726 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99741 atccatccatccatccatcc 99722 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99737 atccatccatccatccatcc 99718 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99733 atccatccatccatccatcc 99714 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99729 atccatccatccatccatcc 99710 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99725 atccatccatccatccatcc 99706 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99721 atccatccatccatccatcc 99702 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99717 atccatccatccatccatcc 99698 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99713 atccatccatccatccatcc 99694 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99709 atccatccatccatccatcc 99690 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99705 atccatccatccatccatcc 99686 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 99701 atccatccatccatccatcc 99682 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98919 atccatccatccatccatcc 98900 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98915 atccatccatccatccatcc 98896 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98710 atccatccatccatccatcc 98691 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98706 atccatccatccatccatcc 98687 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98702 atccatccatccatccatcc 98683 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98698 atccatccatccatccatcc 98679 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 98694 atccatccatccatccatcc 98675 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75599 atccatccatccatccatcc 75618 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75464 atccatccatccatccatcc 75483 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75460 atccatccatccatccatcc 75479 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75420 atccatccatccatccatcc 75439 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75416 atccatccatccatccatcc 75435 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75265 atccatccatccatccatcc 75284 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75261 atccatccatccatccatcc 75280 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75257 atccatccatccatccatcc 75276 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75167 atccatccatccatccatcc 75186 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 75163 atccatccatccatccatcc 75182 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74893 atccatccatccatccatcc 74912 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74889 atccatccatccatccatcc 74908 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74885 atccatccatccatccatcc 74904 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74881 atccatccatccatccatcc 74900 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74877 atccatccatccatccatcc 74896 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74873 atccatccatccatccatcc 74892 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74849 atccatccatccatccatcc 74868 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74845 atccatccatccatccatcc 74864 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74673 atccatccatccatccatcc 74692 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74669 atccatccatccatccatcc 74688 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74665 atccatccatccatccatcc 74684 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74661 atccatccatccatccatcc 74680 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74657 atccatccatccatccatcc 74676 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74653 atccatccatccatccatcc 74672 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74649 atccatccatccatccatcc 74668 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74645 atccatccatccatccatcc 74664 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74641 atccatccatccatccatcc 74660 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74637 atccatccatccatccatcc 74656 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74469 atccatccatccatccatcc 74488 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74465 atccatccatccatccatcc 74484 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74461 atccatccatccatccatcc 74480 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74457 atccatccatccatccatcc 74476 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74453 atccatccatccatccatcc 74472 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74449 atccatccatccatccatcc 74468 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74445 atccatccatccatccatcc 74464 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74441 atccatccatccatccatcc 74460 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74384 atccatccatccatccatcc 74403 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74380 atccatccatccatccatcc 74399 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74376 atccatccatccatccatcc 74395 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74372 atccatccatccatccatcc 74391 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74368 atccatccatccatccatcc 74387 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74364 atccatccatccatccatcc 74383 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 74360 atccatccatccatccatcc 74379
>gb|AC145869.2| Pan troglodytes BAC clone RP43-39F14 from chromosome 7, complete sequence Length = 201977 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 131220 atccatccatccatccatcctcc 131198 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131236 atccatccatccatccatcc 131217 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131232 atccatccatccatccatcc 131213 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131228 atccatccatccatccatcc 131209 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 131224 atccatccatccatccatcc 131205 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130933 atccatccatccatccatcc 130914 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130929 atccatccatccatccatcc 130910 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 130925 atccatccatccatccatcc 130906 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88378 atccatccatccatccatcc 88359 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88374 atccatccatccatccatcc 88355 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88370 atccatccatccatccatcc 88351 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88366 atccatccatccatccatcc 88347 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88362 atccatccatccatccatcc 88343 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88358 atccatccatccatccatcc 88339 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 88354 atccatccatccatccatcc 88335
>gb|AC122205.6| Mus musculus BAC clone RP23-76C13 from chromosome 8, complete sequence Length = 249808 Score = 46.1 bits (23), Expect = 0.090 Identities = 23/23 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcctcc 197 ||||||||||||||||||||||| Sbjct: 168831 atccatccatccatccatcctcc 168809 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 214304 atccatccatccatccatcc 214285 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 214300 atccatccatccatccatcc 214281 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 214296 atccatccatccatccatcc 214277 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 214292 atccatccatccatccatcc 214273 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 214288 atccatccatccatccatcc 214269 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 214284 atccatccatccatccatcc 214265 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 213087 atccatccatccatccatcc 213068 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 213083 atccatccatccatccatcc 213064 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 213079 atccatccatccatccatcc 213060 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 213075 atccatccatccatccatcc 213056 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 213071 atccatccatccatccatcc 213052 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 213067 atccatccatccatccatcc 213048 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 213063 atccatccatccatccatcc 213044 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 212881 atccatccatccatccatcc 212862 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 212877 atccatccatccatccatcc 212858 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 212873 atccatccatccatccatcc 212854 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 212869 atccatccatccatccatcc 212850 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 212865 atccatccatccatccatcc 212846 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 212861 atccatccatccatccatcc 212842 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 212815 atccatccatccatccatcc 212796 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 212811 atccatccatccatccatcc 212792 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 199901 atccatccatccatccatcc 199882 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 199897 atccatccatccatccatcc 199878 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 199893 atccatccatccatccatcc 199874 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 199889 atccatccatccatccatcc 199870 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 199885 atccatccatccatccatcc 199866 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 169059 atccatccatccatccatcc 169040 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 169055 atccatccatccatccatcc 169036 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 169051 atccatccatccatccatcc 169032 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 168941 atccatccatccatccatcc 168922 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 168937 atccatccatccatccatcc 168918 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 168895 atccatccatccatccatcc 168876 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 168839 atccatccatccatccatcc 168820 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 168835 atccatccatccatccatcc 168816 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143996 atccatccatccatccatcc 144015 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143992 atccatccatccatccatcc 144011 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143988 atccatccatccatccatcc 144007 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143984 atccatccatccatccatcc 144003 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 143980 atccatccatccatccatcc 143999 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 49122 atccatccatccatccatcc 49141 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48579 atccatccatccatccatcc 48560 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48506 atccatccatccatccatcc 48487 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48502 atccatccatccatccatcc 48483 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48498 atccatccatccatccatcc 48479 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48494 atccatccatccatccatcc 48475 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48490 atccatccatccatccatcc 48471 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48463 atccatccatccatccatcc 48444 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48459 atccatccatccatccatcc 48440 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48455 atccatccatccatccatcc 48436 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48451 atccatccatccatccatcc 48432 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48447 atccatccatccatccatcc 48428 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 175 atccatccatccatccatcc 194 |||||||||||||||||||| Sbjct: 48443 atccatccatccatccatcc 48424 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,205,475 Number of Sequences: 3902068 Number of extensions: 5205475 Number of successful extensions: 489073 Number of sequences better than 10.0: 12787 Number of HSP's better than 10.0 without gapping: 12845 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 151832 Number of HSP's gapped (non-prelim): 293825 length of query: 414 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 392 effective length of database: 17,147,199,772 effective search space: 6721702310624 effective search space used: 6721702310624 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
