ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | basd20g05 |
|---|---|
| Clone Library Name | barley_pub |
>emb|CT009748.6| Mouse DNA sequence from clone RP23-120N6 on chromosome 9, complete sequence Length = 235839 Score = 42.1 bits (21), Expect = 1.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 55 tagatccagcctcctggcctccagt 79 |||||||||||| |||||||||||| Sbjct: 79180 tagatccagcctgctggcctccagt 79204
>gb|AC107635.16| Mus musculus chromosome 9, clone RP23-24C14, complete sequence Length = 214285 Score = 42.1 bits (21), Expect = 1.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 55 tagatccagcctcctggcctccagt 79 |||||||||||| |||||||||||| Sbjct: 16028 tagatccagcctgctggcctccagt 16004
>gb|AC137585.3| Mus musculus BAC clone RP23-355I23 from chromosome 18, complete sequence Length = 216041 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 52 ctctagatccagcctcctgg 71 |||||||||||||||||||| Sbjct: 106363 ctctagatccagcctcctgg 106344
>gb|AC159466.3| Mus musculus 10 BAC RP23-388A21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 190140 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 tctgttgctgatttgatgct 296 |||||||||||||||||||| Sbjct: 56500 tctgttgctgatttgatgct 56519
>emb|AL137073.13| Human DNA sequence from clone RP11-404F11 on chromosome 9p23-24.1 Contains a novel gene encoding a protein similar to bacterial N-acetylneuraminic acid condensing enzyme (NEUB) and 3' end of the TBCID2 gene, a TRIM14 gene encoding tripartite motif-containing 14 (KIAA0129), the CORO2A gene encoding Coronin 2A (actin-binding protein), TBC1D2 gene encoding TBC1 domain family, member 2 (PARIS1, PARIS-1,DKFZP761D1823, DKFZp761D1823), and 4 CpG islands, complete sequence Length = 201300 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 100 gatccctgggcaaggtgagg 119 |||||||||||||||||||| Sbjct: 160784 gatccctgggcaaggtgagg 160765
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 atcgaatccgcttcgatccc 105 |||||||||||||||||||| Sbjct: 4713500 atcgaatccgcttcgatccc 4713519
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 atcgaatccgcttcgatccc 105 |||||||||||||||||||| Sbjct: 18437712 atcgaatccgcttcgatccc 18437731
>gb|AC153568.5| Mus musculus 10 BAC RP23-66K22 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 186215 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 277 tctgttgctgatttgatgct 296 |||||||||||||||||||| Sbjct: 169521 tctgttgctgatttgatgct 169540
>dbj|AP006446.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1097H10 Length = 159732 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 atcgaatccgcttcgatccc 105 |||||||||||||||||||| Sbjct: 31104 atcgaatccgcttcgatccc 31123
>dbj|AP004861.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0001A11 Length = 153252 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 atcgaatccgcttcgatccc 105 |||||||||||||||||||| Sbjct: 100636 atcgaatccgcttcgatccc 100655
>gb|AC101944.16| Mus musculus chromosome 1, clone RP24-118B6, complete sequence Length = 174560 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 54 ctagatccagcctcctggcctcca 77 ||||||||||||||| |||||||| Sbjct: 107771 ctagatccagcctccgggcctcca 107794 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,949,541 Number of Sequences: 3902068 Number of extensions: 1949541 Number of successful extensions: 33300 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 33270 Number of HSP's gapped (non-prelim): 30 length of query: 337 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 315 effective length of database: 17,147,199,772 effective search space: 5401367928180 effective search space used: 5401367928180 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
