ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd19o05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY107559.1| Zea mays PCO061815 mRNA sequence 105 2e-19
2ref|NM_185426.2| Oryza sativa (japonica cultivar-group), mRNA 101 3e-18
3dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
4dbj|AP001389.1| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
5dbj|AP002837.2| Oryza sativa (japonica cultivar-group) genomic D... 101 3e-18
6dbj|AK122142.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 3e-18
7dbj|AK098848.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 3e-18
8dbj|AK061552.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 3e-18
9gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 44 0.62
10dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.62
11gb|AC134234.3| Oryza sativa (japonica cultivar-group) chromosome... 44 0.62
12gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 44 0.62
13ref|NM_196516.1| Oryza sativa (japonica cultivar-group) putative... 42 2.4
14emb|AL663099.7| Mouse DNA sequence from clone DN-384L23 on chrom... 42 2.4
15gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica culti... 42 2.4
16dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
17gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb00... 42 2.4
18gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 42 2.4
19emb|AL606757.11| Mouse DNA sequence from clone RP23-356K2 on chr... 42 2.4
20ref|XM_465565.1| Oryza sativa (japonica cultivar-group), mRNA 40 9.6
21ref|NM_196957.1| Oryza sativa (japonica cultivar-group) putative... 40 9.6
22gb|AC132404.5| Mus musculus BAC clone RP23-328O21 from chromosom... 40 9.6
23gb|AY659042.1| Synthetic construct Peudomonas aeruginosa clone F... 40 9.6
24gb|AC107764.11| Mus musculus chromosome 15, clone RP23-179A6, co... 40 9.6
25gb|AY352013.1| Elettariopsis smithiae 18S ribosomal RNA gene, pa... 40 9.6
26gb|AY352009.1| Amomum villosum 18S ribosomal RNA gene, partial s... 40 9.6
27gb|AY352008.1| Amomum uliginosum 18S ribosomal RNA gene, partial... 40 9.6
28gb|AY352007.1| Amomum tsao-ko 18S ribosomal RNA gene, partial se... 40 9.6
29gb|AY352005.1| Amomum sericeum 18S ribosomal RNA gene, partial s... 40 9.6
30gb|AY352003.1| Amomum quadratolaminare 18S ribosomal RNA gene, p... 40 9.6
31gb|AY352001.1| Amomum aff. purpureorubrum Kress 98-6187 18S ribo... 40 9.6
32gb|AY352000.1| Amomum purpureorubrum 18S ribosomal RNA gene, par... 40 9.6
33gb|AY351998.1| Amomum aff. paratsao-ko Kress 98-6197 18S ribosom... 40 9.6
34gb|AY351997.1| Amomum paratsao-ko 18S ribosomal RNA gene, partia... 40 9.6
35gb|AY351996.1| Amomum menglaense 18S ribosomal RNA gene, partial... 40 9.6
36gb|AY351994.1| Amomum laxesquamosum 18S ribosomal RNA gene, part... 40 9.6
37gb|AY351992.1| Amomum aff. krervahn Xia-724 18S ribosomal RNA ge... 40 9.6
38gb|AY351990.1| Amomum aff. glabrum Xia-73 18S ribosomal RNA gene... 40 9.6
39gb|AY351989.1| Amomum glabrum 18S ribosomal RNA gene, partial se... 40 9.6
40gb|AY351988.1| Amomum aff. coriandriodorum Kress 99-6305 18S rib... 40 9.6
41gb|AY351987.1| Amomum coriandriodorum 18S ribosomal RNA gene, pa... 40 9.6
42gb|AY769844.1| Hornstedtia sanhan 18S ribosomal RNA gene, partia... 40 9.6
43gb|AY769843.1| Geostachys sp. Newman 1035 18S ribosomal RNA gene... 40 9.6
44gb|AY769842.1| Geostachys sp. Newman 928 18S ribosomal RNA gene,... 40 9.6
45gb|AY769831.1| Elettariopsis triloba 18S ribosomal RNA gene, par... 40 9.6
46gb|AY769828.1| Amomum villosum 18S ribosomal RNA gene, partial s... 40 9.6
47gb|AY769827.1| Amomum uliginosum 18S ribosomal RNA gene, partial... 40 9.6
48gb|AC115911.14| Mus musculus chromosome 6, clone RP24-481I20, co... 40 9.6
49gb|AC127334.3| Mus musculus BAC clone RP23-137P16 from chromosom... 40 9.6
50gb|AY424739.1| Alpinia galanga internal transcribed spacer 1, 5.... 40 9.6
51gb|AC091783.9| Genomic sequence for Mus musculus, clone RP23-16G... 40 9.6
52gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 9.6
53gb|AF414511.1| Etlingera venusta 18S ribosomal RNA gene, partial... 40 9.6
54gb|AF414510.1| Etlingera sessilanthera 18S ribosomal RNA gene, p... 40 9.6
55gb|AF414509.1| Etlingera punicea 18S ribosomal RNA gene, partial... 40 9.6
56gb|AF414508.1| Etlingera maingayi 18S ribosomal RNA gene, partia... 40 9.6
57gb|AF414506.1| Etlingera fimbriobracteata 18S ribosomal RNA gene... 40 9.6
58gb|AF414504.1| Etlingera aff. muluensis Mood and Pedersen 1402 1... 40 9.6
59gb|AF414493.1| Aframomum luteoalbum 18S ribosomal RNA gene, part... 40 9.6
60gb|AF414492.1| Aframomum verrucosum 18S ribosomal RNA gene, part... 40 9.6
61gb|AF414486.1| Etlingera fimbriobracteata 18S ribosomal RNA gene... 40 9.6
62gb|AF414484.1| Etlingera cf. brachychila Pedersen 1146 18S ribos... 40 9.6
63gb|AF414483.1| Etlingera aff. muluensis Mood and Pedersen 1402 1... 40 9.6
64gb|AF414482.1| Hornstedtia gracilis 18S ribosomal RNA gene, part... 40 9.6
65gb|AF414481.1| Hornstedtia conica 18S ribosomal RNA gene, partia... 40 9.6
66gb|AF414480.1| Hornstedtia scottiana 18S ribosomal RNA gene, par... 40 9.6
67gb|AF414479.1| Hornstedtia havilandii 18S ribosomal RNA gene, pa... 40 9.6
68gb|AF414478.1| Etlingera sp. nov. 'albiflora' 18S ribosomal RNA ... 40 9.6
69gb|AF414477.1| Etlingera corrugata 18S ribosomal RNA gene, parti... 40 9.6
70gb|AF414474.1| Etlingera corneri 18S ribosomal RNA gene, partial... 40 9.6
71gb|AF414473.1| Etlingera sessilanthera 18S ribosomal RNA gene, p... 40 9.6
72gb|AF414472.1| Etlingera punicea 18S ribosomal RNA gene, partial... 40 9.6
73gb|AF414469.1| Etlingera velutina 18S ribosomal RNA gene, partia... 40 9.6
74gb|AF414467.1| Etlingera metriocheilos 18S ribosomal RNA gene, p... 40 9.6
75gb|AF414466.1| Etlingera belalongensis 18S ribosomal RNA gene, p... 40 9.6
76gb|AF414463.1| Etlingera rubromarginata 18S ribosomal RNA gene, ... 40 9.6
77gb|AF414462.1| Etlingera aff. pauciflora Mood and Pedersen 1414 ... 40 9.6
78gb|AF414460.1| Etlingera maingayi 18S ribosomal RNA gene, partia... 40 9.6
79gb|AF414459.1| Etlingera venusta 18S ribosomal RNA gene, partial... 40 9.6
80emb|BX571872.1| Photorhabdus luminescens subsp. laumondii TTO1 c... 40 9.6
81gb|J02459.1|LAMCG Bacteriophage lambda, complete genome 40 9.6
82gb|AF254462.1|AF254462 Alpinia galanga 18S ribosomal RNA gene, p... 40 9.6
83gb|AF254461.1|AF254461 Alpinia conchigera 18S ribosomal RNA gene... 40 9.6
84gb|AF435964.1|AF435964 Botryotinia fuckeliana two-component osmo... 40 9.6
85dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.6
86gb|AC069154.5| Homo sapiens BAC clone RP11-689F8 from 2, complet... 40 9.6
87gb|AC026815.8|AC026815 Oryza sativa chromosome 10 BAC OSJNBa0079... 40 9.6
88gb|AE004691.1| Pseudomonas aeruginosa PAO1, section 252 of 529 o... 40 9.6
89gb|AY742376.1| Alpinia rafflesiana 18S ribosomal RNA gene, parti... 40 9.6
90gb|AY742367.1| Alpinia nigra 18S ribosomal RNA gene, partial seq... 40 9.6
91gb|AY742358.1| Alpinia javanica 18S ribosomal RNA gene, partial ... 40 9.6
92gb|AY742347.1| Alpinia eubractea 18S ribosomal RNA gene, partial... 40 9.6
93gb|AY742334.1| Alpinia abundiflora 18S ribosomal RNA gene, parti... 40 9.6
94dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 9.6
95dbj|AP004852.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.6
96dbj|AK120962.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.6
97gb|AF192734.1|ARAFFITS2 Alpinia rafflesiana internal transcribed... 40 9.6
98gb|AF192730.1|ANIGRITS2 Alpinia nigra internal transcribed space... 40 9.6
99gb|AF192724.1|AJAVAITS2 Alpinia javanica internal transcribed sp... 40 9.6
100gb|AF192718.1|AGALAITS2 Alpinia galanga internal transcribed spa... 40 9.6
101gb|AF192714.1|ACONCITS2 Alpinia conchigera internal transcribed ... 40 9.6
102gb|AC142452.5| Mus musculus BAC clone RP24-266E20 from 3, comple... 40 9.6
103gb|AY210462.1| Myzostoma polycyclus 28S ribosomal RNA gene, part... 40 9.6
104gb|AY925161.1| Amomum villosum internal transcribed spacer 2, pa... 40 9.6
105dbj|AB097241.1| Amomum durum genes for 18S ribosomal RNA, ITS1, ... 40 9.6
106dbj|AB097240.1| Amomum coriaceum genes for 18S ribosomal RNA, IT... 40 9.6
107dbj|AB097239.1| Amomum calyptratum genes for 18S ribosomal RNA, ... 40 9.6
108dbj|AB097238.1| Hornstedtia minor genes for 18S ribosomal RNA, I... 40 9.6
109dbj|AB097237.1| Hornstedtia leonurus genes for 18S ribosomal RNA... 40 9.6
110dbj|AB097234.1| Etlingera baramensis genes for 18S ribosomal RNA... 40 9.6
111dbj|AB097233.1| Etlingera inundata genes for 18S ribosomal RNA, ... 40 9.6
112dbj|AB097232.1| Etlingera punicea genes for 18S ribosomal RNA, I... 40 9.6
113dbj|AB097231.1| Etlingera subrecta genes for 18S ribosomal RNA, ... 40 9.6
114dbj|AB064962.1| Botryotinia fuckeliana BcOS1 gene for histidine ... 40 9.6
115gb|U39286.1|CVU39286 Cloning vector TLF97-3, phage lambda lacZ t... 40 9.6
116gb|U39285.1|CVU39285 Cloning vector TLF97-2, phage lambda lacZ t... 40 9.6
117gb|U39284.1|CVU39284 Cloning vector TLF97-1, lambda phage lacZ t... 40 9.6
118gb|U37692.1|CVU37692 Cloning vector lambda TXF97, lacZ transcrip... 40 9.6
119gb|AF396827.2| Botryotinia fuckeliana two-component osmosensing ... 40 9.6
120emb|AL772258.9| Mouse DNA sequence from clone RP23-337P24 on chr... 40 9.6
121gb|AF478791.1| Siliquamomum tonkinense 18S ribosomal RNA gene, p... 40 9.6
122gb|AF478750.1| Etlingera littoralis 18S ribosomal RNA gene, part... 40 9.6
123gb|AF478748.1| Elettariopsis stenosiphon 18S ribosomal RNA gene,... 40 9.6
124gb|AF478747.1| Elettariopsis sp. Kress 00-6720 18S ribosomal RNA... 40 9.6
125gb|AF478724.1| Amomum villosum 18S ribosomal RNA gene, partial s... 40 9.6
126gb|AF478721.1| Amomum glabrum 18S ribosomal RNA gene, partial se... 40 9.6
127gb|AF478717.1| Alpinia luteocarpa 18S ribosomal RNA gene, partia... 40 9.6
128gb|AF478715.1| Alpinia galanga 18S ribosomal RNA gene, partial s... 40 9.6
129gb|AF478712.1| Alpinia conchigera 18S ribosomal RNA gene, partia... 40 9.6
130gb|AF478708.1| Aframomum sp. Waimea W86S127 18S ribosomal RNA ge... 40 9.6
131gb|AF478706.1| Aframomum sceptrum 18S ribosomal RNA gene, partia... 40 9.6
132gb|AF478705.1| Aframomum daniellii 18S ribosomal RNA gene, parti... 40 9.6
133gb|AF478704.1| Aframomum angustifolium 18S ribosomal RNA gene, p... 40 9.6 
>gb|AY107559.1| Zea mays PCO061815 mRNA sequence
          Length = 827

 Score =  105 bits (53), Expect = 2e-19
 Identities = 80/89 (89%)
 Strand = Plus / Plus

                                                                       
Query: 18  aaggcgatggtggtgtgcgcgctggtcggcttcctcggcgtcctctccgccgcgctaggg 77
           |||||| |||||||||||||| ||||||||||||||||||||||||| || ||||| || 
Sbjct: 259 aaggcggtggtggtgtgcgcggtggtcggcttcctcggcgtcctctcggcggcgctcggc 318

                                        
Query: 78  ttcgccgccgagggcacccgcgtcaaggt 106
           ||||| || |||| |||||||||||||||
Sbjct: 319 ttcgcggcggaggccacccgcgtcaaggt 347
to top
>ref|NM_185426.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 960

 Score =  101 bits (51), Expect = 3e-18
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                       
Query: 16  ggaaggcgatggtggtgtgcgcgctggtcggcttcctcggcgtcctctccgccgcgctag 75
           |||||| | |||||||||||||| ||||||||||||||||||||||||| || ||||| |
Sbjct: 139 ggaaggtggtggtggtgtgcgcggtggtcggcttcctcggcgtcctctcggcggcgctcg 198

                                          
Query: 76  ggttcgccgccgagggcacccgcgtcaaggt 106
           | ||||| || |||||||| |||||||||||
Sbjct: 199 gcttcgcggcggagggcacacgcgtcaaggt 229
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
              complete sequence
          Length = 30731886

 Score =  101 bits (51), Expect = 3e-18
 Identities = 81/91 (89%)
 Strand = Plus / Minus

                                                                          
Query: 16     ggaaggcgatggtggtgtgcgcgctggtcggcttcctcggcgtcctctccgccgcgctag 75
              |||||| | |||||||||||||| ||||||||||||||||||||||||| || ||||| |
Sbjct: 842973 ggaaggtggtggtggtgtgcgcggtggtcggcttcctcggcgtcctctcggcggcgctcg 842914

                                             
Query: 76     ggttcgccgccgagggcacccgcgtcaaggt 106
              | ||||| || |||||||| |||||||||||
Sbjct: 842913 gcttcgcggcggagggcacacgcgtcaaggt 842883
to top
>dbj|AP001389.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0541H01
          Length = 157519

 Score =  101 bits (51), Expect = 3e-18
 Identities = 81/91 (89%)
 Strand = Plus / Minus

                                                                          
Query: 16     ggaaggcgatggtggtgtgcgcgctggtcggcttcctcggcgtcctctccgccgcgctag 75
              |||||| | |||||||||||||| ||||||||||||||||||||||||| || ||||| |
Sbjct: 126107 ggaaggtggtggtggtgtgcgcggtggtcggcttcctcggcgtcctctcggcggcgctcg 126048

                                             
Query: 76     ggttcgccgccgagggcacccgcgtcaaggt 106
              | ||||| || |||||||| |||||||||||
Sbjct: 126047 gcttcgcggcggagggcacacgcgtcaaggt 126017
to top
>dbj|AP002837.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0019F11
          Length = 123673

 Score =  101 bits (51), Expect = 3e-18
 Identities = 81/91 (89%)
 Strand = Plus / Minus

                                                                         
Query: 16    ggaaggcgatggtggtgtgcgcgctggtcggcttcctcggcgtcctctccgccgcgctag 75
             |||||| | |||||||||||||| ||||||||||||||||||||||||| || ||||| |
Sbjct: 23868 ggaaggtggtggtggtgtgcgcggtggtcggcttcctcggcgtcctctcggcggcgctcg 23809

                                            
Query: 76    ggttcgccgccgagggcacccgcgtcaaggt 106
             | ||||| || |||||||| |||||||||||
Sbjct: 23808 gcttcgcggcggagggcacacgcgtcaaggt 23778
to top
>dbj|AK122142.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033136J12, full
           insert sequence
          Length = 1035

 Score =  101 bits (51), Expect = 3e-18
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                       
Query: 16  ggaaggcgatggtggtgtgcgcgctggtcggcttcctcggcgtcctctccgccgcgctag 75
           |||||| | |||||||||||||| ||||||||||||||||||||||||| || ||||| |
Sbjct: 192 ggaaggtggtggtggtgtgcgcggtggtcggcttcctcggcgtcctctcggcggcgctcg 251

                                          
Query: 76  ggttcgccgccgagggcacccgcgtcaaggt 106
           | ||||| || |||||||| |||||||||||
Sbjct: 252 gcttcgcggcggagggcacacgcgtcaaggt 282
to top
>dbj|AK098848.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000D16, full
           insert sequence
          Length = 960

 Score =  101 bits (51), Expect = 3e-18
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                       
Query: 16  ggaaggcgatggtggtgtgcgcgctggtcggcttcctcggcgtcctctccgccgcgctag 75
           |||||| | |||||||||||||| ||||||||||||||||||||||||| || ||||| |
Sbjct: 139 ggaaggtggtggtggtgtgcgcggtggtcggcttcctcggcgtcctctcggcggcgctcg 198

                                          
Query: 76  ggttcgccgccgagggcacccgcgtcaaggt 106
           | ||||| || |||||||| |||||||||||
Sbjct: 199 gcttcgcggcggagggcacacgcgtcaaggt 229
to top
>dbj|AK061552.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-B09, full
           insert sequence
          Length = 1057

 Score =  101 bits (51), Expect = 3e-18
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                       
Query: 16  ggaaggcgatggtggtgtgcgcgctggtcggcttcctcggcgtcctctccgccgcgctag 75
           |||||| | |||||||||||||| ||||||||||||||||||||||||| || ||||| |
Sbjct: 214 ggaaggtggtggtggtgtgcgcggtggtcggcttcctcggcgtcctctcggcggcgctcg 273

                                          
Query: 76  ggttcgccgccgagggcacccgcgtcaaggt 106
           | ||||| || |||||||| |||||||||||
Sbjct: 274 gcttcgcggcggagggcacacgcgtcaaggt 304
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 162     cttttgcttcgcttcgcttcgc 183
               ||||||||||||||||||||||
Sbjct: 8231465 cttttgcttcgcttcgcttcgc 8231444
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 162     cttttgcttcgcttcgcttcgc 183
               ||||||||||||||||||||||
Sbjct: 8229300 cttttgcttcgcttcgcttcgc 8229279
to top
>gb|AC134234.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0019J12,
              complete sequence
          Length = 195583

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 162    cttttgcttcgcttcgcttcgc 183
              ||||||||||||||||||||||
Sbjct: 162895 cttttgcttcgcttcgcttcgc 162874
to top
>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 248    gaaacgccggtgggcacgcgcg 269
              ||||||||||||||||||||||
Sbjct: 167144 gaaacgccggtgggcacgcgcg 167165
to top
>ref|NM_196516.1| Oryza sativa (japonica cultivar-group) putative
           calcium-transporting ATPase (OSJNBa0061K21.21), mRNA
          Length = 3108

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 50  cctcggcgtcctctccgccgc 70
           |||||||||||||||||||||
Sbjct: 144 cctcggcgtcctctccgccgc 164
to top
>emb|AL663099.7| Mouse DNA sequence from clone DN-384L23 on chromosome 3 Contains a
              glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene,
              two novel genes (4930406D18RIK) (4930431B09Rik), the 5' end
              of a novel gene (E130019M14RIK) and a CpG island, complete
              sequence
          Length = 177135

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    tttgcttcgcttcgcttcgcg 184
              |||||||||||||||||||||
Sbjct: 173965 tttgcttcgcttcgcttcgcg 173985
to top
>gb|AC016780.6| Genomic Sequence For Oryza sativa (japonica cultivar-group) cultivar
              Nipponbare Clone OSJNBa0061K21 From Chromosome 10, complete
              sequence
          Length = 112721

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 50     cctcggcgtcctctccgccgc 70
              |||||||||||||||||||||
Sbjct: 110444 cctcggcgtcctctccgccgc 110424
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 50       cctcggcgtcctctccgccgc 70
                |||||||||||||||||||||
Sbjct: 14170916 cctcggcgtcctctccgccgc 14170896



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 67       ccgcgctagggttcgccgcc 86
                ||||||||||||||||||||
Sbjct: 16916794 ccgcgctagggttcgccgcc 16916775
to top
>gb|AC027658.1| Oryza sativa (japonica cultivar-group) BAC nbxb0006I13 chromosome 10,
             complete sequence
          Length = 142737

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 50    cctcggcgtcctctccgccgc 70
             |||||||||||||||||||||
Sbjct: 42989 cctcggcgtcctctccgccgc 42969
to top
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 50       cctcggcgtcctctccgccgc 70
                |||||||||||||||||||||
Sbjct: 14179158 cctcggcgtcctctccgccgc 14179138



 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 67       ccgcgctagggttcgccgcc 86
                ||||||||||||||||||||
Sbjct: 16925834 ccgcgctagggttcgccgcc 16925815
to top
>emb|AL606757.11| Mouse DNA sequence from clone RP23-356K2 on chromosome 3, complete
             sequence
          Length = 127113

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   tttgcttcgcttcgcttcgcg 184
             |||||||||||||||||||||
Sbjct: 27061 tttgcttcgcttcgcttcgcg 27081
to top
>ref|XM_465565.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 969

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                  
Query: 13 ggcggaaggcgatggtggtgtgcg 36
          ||||| ||||||||||||||||||
Sbjct: 76 ggcgggaggcgatggtggtgtgcg 53
to top
>ref|NM_196957.1| Oryza sativa (japonica cultivar-group) putative RNA-binding protein
           (OSJNBa0079L16.15), mRNA
          Length = 1395

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 67  ccgcgctagggttcgccgcc 86
           ||||||||||||||||||||
Sbjct: 289 ccgcgctagggttcgccgcc 270
to top
>gb|AC132404.5| Mus musculus BAC clone RP23-328O21 from chromosome 17, complete
             sequence
          Length = 207685

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   tttgcttcgcttcgcttcgc 183
             ||||||||||||||||||||
Sbjct: 50451 tttgcttcgcttcgcttcgc 50470
to top
>gb|AY659042.1| Synthetic construct Peudomonas aeruginosa clone FLH035795.01F
           PA2628 gene, partial cds
          Length = 891

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 39  ctggtcggcttcctcggcgt 58
           ||||||||||||||||||||
Sbjct: 409 ctggtcggcttcctcggcgt 428
to top
>gb|AC107764.11| Mus musculus chromosome 15, clone RP23-179A6, complete sequence
          Length = 196178

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 164   tttgcttcgcttcgcttcgc 183
             ||||||||||||||||||||
Sbjct: 88930 tttgcttcgcttcgcttcgc 88911
to top
>gb|AY352013.1| Elettariopsis smithiae 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 630

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AY352009.1| Amomum villosum 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 633

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AY352008.1| Amomum uliginosum 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 633

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AY352007.1| Amomum tsao-ko 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 633

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AY352005.1| Amomum sericeum 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 635

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AY352003.1| Amomum quadratolaminare 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 632

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AY352001.1| Amomum aff. purpureorubrum Kress 98-6187 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 635

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AY352000.1| Amomum purpureorubrum 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 635

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AY351998.1| Amomum aff. paratsao-ko Kress 98-6197 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 634

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AY351997.1| Amomum paratsao-ko 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 634

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AY351996.1| Amomum menglaense 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 635

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AY351994.1| Amomum laxesquamosum 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 634

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AY351992.1| Amomum aff. krervahn Xia-724 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 633

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AY351990.1| Amomum aff. glabrum Xia-73 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 635

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AY351989.1| Amomum glabrum 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 635

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AY351988.1| Amomum aff. coriandriodorum Kress 99-6305 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 634

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AY351987.1| Amomum coriandriodorum 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 634

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AY769844.1| Hornstedtia sanhan 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 615

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 355 ctttgctccttgctttgctg 374
to top
>gb|AY769843.1| Geostachys sp. Newman 1035 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 693

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 355 ctttgctccttgctttgctg 374
to top
>gb|AY769842.1| Geostachys sp. Newman 928 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 608

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 355 ctttgctccttgctttgctg 374
to top
>gb|AY769831.1| Elettariopsis triloba 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 606

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 354 ctttgctccttgctttgctg 373
to top
>gb|AY769828.1| Amomum villosum 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 582

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 355 ctttgctccttgctttgctg 374
to top
>gb|AY769827.1| Amomum uliginosum 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 692

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 355 ctttgctccttgctttgctg 374
to top
>gb|AC115911.14| Mus musculus chromosome 6, clone RP24-481I20, complete sequence
          Length = 168641

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tttgcttcgcttcgcttcgc 183
              ||||||||||||||||||||
Sbjct: 114972 tttgcttcgcttcgcttcgc 114953
to top
>gb|AC127334.3| Mus musculus BAC clone RP23-137P16 from chromosome 3, complete
            sequence
          Length = 180760

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 164  tttgcttcgcttcgcttcgc 183
            ||||||||||||||||||||
Sbjct: 5083 tttgcttcgcttcgcttcgc 5064
to top
>gb|AY424739.1| Alpinia galanga internal transcribed spacer 1, 5.8S ribosomal RNA
           gene, and internal transcribed spacer 2, complete
           sequence
          Length = 591

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 355 ctttgctccttgctttgctg 374
to top
>gb|AC091783.9| Genomic sequence for Mus musculus, clone RP23-16G10, complete sequence
          Length = 228160

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    tttgcttcgcttcgcttcgc 183
              ||||||||||||||||||||
Sbjct: 219183 tttgcttcgcttcgcttcgc 219202
to top
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 35      cgcgctggtcggcttcctcg 54
               ||||||||||||||||||||
Sbjct: 2476125 cgcgctggtcggcttcctcg 2476144
to top
>gb|AF414511.1| Etlingera venusta 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 782

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 504 ctttgctccttgctttgctg 523
to top
>gb|AF414510.1| Etlingera sessilanthera 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 777

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 501 ctttgctccttgctttgctg 520
to top
>gb|AF414509.1| Etlingera punicea 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 804

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 502 ctttgctccttgctttgctg 521
to top
>gb|AF414508.1| Etlingera maingayi 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 809

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 507 ctttgctccttgctttgctg 526
to top
>gb|AF414506.1| Etlingera fimbriobracteata 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 753

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 503 ctttgctccttgctttgctg 522
to top
>gb|AF414504.1| Etlingera aff. muluensis Mood and Pedersen 1402 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1,
           5.8S ribosomal RNA gene and internal transcribed spacer
           2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 785

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 503 ctttgctccttgctttgctg 522
to top
>gb|AF414493.1| Aframomum luteoalbum 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 787

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 500 ctttgctccttgctttgctg 519
to top
>gb|AF414492.1| Aframomum verrucosum 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 787

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 500 ctttgctccttgctttgctg 519
to top
>gb|AF414486.1| Etlingera fimbriobracteata 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 710

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 408 ctttgctccttgctttgctg 427
to top
>gb|AF414484.1| Etlingera cf. brachychila Pedersen 1146 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene and internal transcribed spacer 2,
           complete sequence; and 26S ribosomal RNA gene, partial
           sequence
          Length = 785

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 505 ctttgctccttgctttgctg 524
to top
>gb|AF414483.1| Etlingera aff. muluensis Mood and Pedersen 1402 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1,
           5.8S ribosomal RNA gene and internal transcribed spacer
           2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 804

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 503 ctttgctccttgctttgctg 522
to top
>gb|AF414482.1| Hornstedtia gracilis 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 794

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 501 ctttgctccttgctttgctg 520
to top
>gb|AF414481.1| Hornstedtia conica 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 708

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 406 ctttgctccttgctttgctg 425
to top
>gb|AF414480.1| Hornstedtia scottiana 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 775

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 501 ctttgctccttgctttgctg 520
to top
>gb|AF414479.1| Hornstedtia havilandii 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 803

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 501 ctttgctccttgctttgctg 520
to top
>gb|AF414478.1| Etlingera sp. nov. 'albiflora' 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 767

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 503 ctttgctccttgctttgctg 522
to top
>gb|AF414477.1| Etlingera corrugata 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 754

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 503 ctttgctccttgctttgctg 522
to top
>gb|AF414474.1| Etlingera corneri 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 711

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 409 ctttgctccttgctttgctg 428
to top
>gb|AF414473.1| Etlingera sessilanthera 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 783

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 501 ctttgctccttgctttgctg 520
to top
>gb|AF414472.1| Etlingera punicea 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 804

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 502 ctttgctccttgctttgctg 521
to top
>gb|AF414469.1| Etlingera velutina 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 781

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 505 ctttgctccttgctttgctg 524
to top
>gb|AF414467.1| Etlingera metriocheilos 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 808

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 506 ctttgctccttgctttgctg 525
to top
>gb|AF414466.1| Etlingera belalongensis 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 783

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 502 ctttgctccttgctttgctg 521
to top
>gb|AF414463.1| Etlingera rubromarginata 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 776

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 502 ctttgctccttgctttgctg 521
to top
>gb|AF414462.1| Etlingera aff. pauciflora Mood and Pedersen 1414 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1,
           5.8S ribosomal RNA gene and internal transcribed spacer
           2, complete sequence; and 26S ribosomal RNA gene,
           partial sequence
          Length = 804

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 502 ctttgctccttgctttgctg 521
to top
>gb|AF414460.1| Etlingera maingayi 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 714

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 412 ctttgctccttgctttgctg 431
to top
>gb|AF414459.1| Etlingera venusta 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 701

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 399 ctttgctccttgctttgctg 418
to top
>emb|BX571872.1| Photorhabdus luminescens subsp. laumondii TTO1 complete genome; segment
              14/17
          Length = 348498

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 330    ttgctgatgttggtgtcgat 349
              ||||||||||||||||||||
Sbjct: 275574 ttgctgatgttggtgtcgat 275555
to top
>gb|J02459.1|LAMCG Bacteriophage lambda, complete genome
          Length = 48502

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   tggggatttgtcttcattag 409
             ||||||||||||||||||||
Sbjct: 29476 tggggatttgtcttcattag 29495
to top
>gb|AF254462.1|AF254462 Alpinia galanga 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 609

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 360 ctttgctccttgctttgctg 379
to top
>gb|AF254461.1|AF254461 Alpinia conchigera 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 618

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 369 ctttgctccttgctttgctg 388
to top
>gb|AF435964.1|AF435964 Botryotinia fuckeliana two-component osmosensing histidine kinase
            gene (Bos1) complete cds
          Length = 5675

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 77   gttcgccgccgagggcacccgcgt 100
            |||||||||||||| |||||||||
Sbjct: 2110 gttcgccgccgaggtcacccgcgt 2133
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 13       ggcggaaggcgatggtggtgtgcg 36
                ||||| ||||||||||||||||||
Sbjct: 15979301 ggcgggaggcgatggtggtgtgcg 15979324
to top
>gb|AC069154.5| Homo sapiens BAC clone RP11-689F8 from 2, complete sequence
          Length = 167132

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   tcacccgccacccaccaaca 246
             ||||||||||||||||||||
Sbjct: 71870 tcacccgccacccaccaaca 71851
to top
>gb|AC026815.8|AC026815 Oryza sativa chromosome 10 BAC OSJNBa0079L16 genomic sequence, complete
              sequence
          Length = 147452

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     ccgcgctagggttcgccgcc 86
              ||||||||||||||||||||
Sbjct: 101246 ccgcgctagggttcgccgcc 101227
to top
>gb|AE004691.1| Pseudomonas aeruginosa PAO1, section 252 of 529 of the complete
            genome
          Length = 12497

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 39   ctggtcggcttcctcggcgt 58
            ||||||||||||||||||||
Sbjct: 7151 ctggtcggcttcctcggcgt 7170
to top
>gb|AY742376.1| Alpinia rafflesiana 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 597

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 365 ctttgctccttgctttgctg 384
to top
>gb|AY742367.1| Alpinia nigra 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 423

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 197 ctttgctccttgctttgctg 216
to top
>gb|AY742358.1| Alpinia javanica 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 414

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 197 ctttgctccttgctttgctg 216
to top
>gb|AY742347.1| Alpinia eubractea 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 436

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 200 ctttgctccttgctttgctg 219
to top
>gb|AY742334.1| Alpinia abundiflora 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 413

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 196 ctttgctccttgctttgctg 215
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 36      gcgctggtcggcttcctcgg 55
               ||||||||||||||||||||
Sbjct: 5597288 gcgctggtcggcttcctcgg 5597307
to top
>dbj|AP004852.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1371_D04
          Length = 105468

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 13    ggcggaaggcgatggtggtgtgcg 36
             ||||| ||||||||||||||||||
Sbjct: 10236 ggcgggaggcgatggtggtgtgcg 10259
to top
>dbj|AK120962.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039O15, full
           insert sequence
          Length = 5254

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 67  ccgcgctagggttcgccgcc 86
           ||||||||||||||||||||
Sbjct: 419 ccgcgctagggttcgccgcc 400
to top
>gb|AF192734.1|ARAFFITS2 Alpinia rafflesiana internal transcribed spacer 2, complete
           sequence
          Length = 226

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 9   ctttgctccttgctttgctg 28
to top
>gb|AF192730.1|ANIGRITS2 Alpinia nigra internal transcribed spacer 2, complete sequence
          Length = 235

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 9   ctttgctccttgctttgctg 28
to top
>gb|AF192724.1|AJAVAITS2 Alpinia javanica internal transcribed spacer 2, complete sequence
          Length = 226

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 9   ctttgctccttgctttgctg 28
to top
>gb|AF192718.1|AGALAITS2 Alpinia galanga internal transcribed spacer 2, complete sequence
          Length = 235

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 9   ctttgctccttgctttgctg 28
to top
>gb|AF192714.1|ACONCITS2 Alpinia conchigera internal transcribed spacer 2, complete sequence
          Length = 235

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 9   ctttgctccttgctttgctg 28
to top
>gb|AC142452.5| Mus musculus BAC clone RP24-266E20 from 3, complete sequence
          Length = 149936

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 164    tttgcttcgcttcgcttcgc 183
              ||||||||||||||||||||
Sbjct: 149753 tttgcttcgcttcgcttcgc 149734
to top
>gb|AY210462.1| Myzostoma polycyclus 28S ribosomal RNA gene, partial sequence
          Length = 3127

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 473  cgcgaggcagagtggagcgg 492
            ||||||||||||||||||||
Sbjct: 1380 cgcgaggcagagtggagcgg 1399
to top
>gb|AY925161.1| Amomum villosum internal transcribed spacer 2, partial sequence
          Length = 225

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 10  ctttgctccttgctttgctg 29
to top
>dbj|AB097241.1| Amomum durum genes for 18S ribosomal RNA, ITS1, 5.8S ribosomal RNA,
           ITS2, 26S ribosomal RNA, partial and complete sequence
          Length = 639

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>dbj|AB097240.1| Amomum coriaceum genes for 18S ribosomal RNA, ITS1, 5.8S ribosomal
           RNA, ITS2, 26S ribosomal RNA, partial and complete
           sequence
          Length = 639

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>dbj|AB097239.1| Amomum calyptratum genes for 18S ribosomal RNA, ITS1, 5.8S
           ribosomal RNA, ITS2, 26S ribosomal RNA, partial and
           complete sequence
          Length = 640

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>dbj|AB097238.1| Hornstedtia minor genes for 18S ribosomal RNA, ITS1, 5.8S ribosomal
           RNA, ITS2, 26S ribosomal RNA, partial and complete
           sequence
          Length = 643

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>dbj|AB097237.1| Hornstedtia leonurus genes for 18S ribosomal RNA, ITS1, 5.8S
           ribosomal RNA, ITS2, 26S ribosomal RNA, partial and
           complete sequence
          Length = 642

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>dbj|AB097234.1| Etlingera baramensis genes for 18S ribosomal RNA, ITS1, 5.8S
           ribosomal RNA, ITS2, 26S ribosomal RNA, partial and
           complete sequence
          Length = 647

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>dbj|AB097233.1| Etlingera inundata genes for 18S ribosomal RNA, ITS1, 5.8S
           ribosomal RNA, ITS2, 26S ribosomal RNA, partial and
           complete sequence
          Length = 643

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>dbj|AB097232.1| Etlingera punicea genes for 18S ribosomal RNA, ITS1, 5.8S ribosomal
           RNA, ITS2, 26S ribosomal RNA, partial and complete
           sequence
          Length = 643

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>dbj|AB097231.1| Etlingera subrecta genes for 18S ribosomal RNA, ITS1, 5.8S
           ribosomal RNA, ITS2, 26S ribosomal RNA, partial and
           complete sequence
          Length = 646

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 387 ctttgctccttgctttgctg 406
to top
>dbj|AB064962.1| Botryotinia fuckeliana BcOS1 gene for histidine kinase, partial cds
          Length = 2180

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 77  gttcgccgccgagggcacccgcgt 100
           |||||||||||||| |||||||||
Sbjct: 576 gttcgccgccgaggtcacccgcgt 599
to top
>gb|U39286.1|CVU39286 Cloning vector TLF97-3, phage lambda lacZ translational fusion vector,
             complete sequence
          Length = 42531

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   tggggatttgtcttcattag 409
             ||||||||||||||||||||
Sbjct: 28709 tggggatttgtcttcattag 28728
to top
>gb|U39285.1|CVU39285 Cloning vector TLF97-2, phage lambda lacZ translational fusion vector,
             complete sequence
          Length = 42530

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   tggggatttgtcttcattag 409
             ||||||||||||||||||||
Sbjct: 28708 tggggatttgtcttcattag 28727
to top
>gb|U39284.1|CVU39284 Cloning vector TLF97-1, lambda phage lacZ translational fusion vector,
             complete sequence
          Length = 42529

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   tggggatttgtcttcattag 409
             ||||||||||||||||||||
Sbjct: 28707 tggggatttgtcttcattag 28726
to top
>gb|U37692.1|CVU37692 Cloning vector lambda TXF97, lacZ transcriptional fusion vector,
             complete sequence
          Length = 42704

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   tggggatttgtcttcattag 409
             ||||||||||||||||||||
Sbjct: 28882 tggggatttgtcttcattag 28901
to top
>gb|AF396827.2| Botryotinia fuckeliana two-component osmosensing histidine-kinase
            (bos1) gene, complete cds
          Length = 5752

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 77   gttcgccgccgagggcacccgcgt 100
            |||||||||||||| |||||||||
Sbjct: 2320 gttcgccgccgaggtcacccgcgt 2343
to top
>emb|AL772258.9| Mouse DNA sequence from clone RP23-337P24 on chromosome 2, complete
            sequence
          Length = 200480

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 164  tttgcttcgcttcgcttcgc 183
            ||||||||||||||||||||
Sbjct: 7878 tttgcttcgcttcgcttcgc 7897
to top
>gb|AF478791.1| Siliquamomum tonkinense 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 638

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AF478750.1| Etlingera littoralis 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 638

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AF478748.1| Elettariopsis stenosiphon 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 638

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AF478747.1| Elettariopsis sp. Kress 00-6720 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 637

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AF478724.1| Amomum villosum 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 638

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AF478721.1| Amomum glabrum 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 640

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AF478717.1| Alpinia luteocarpa 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 648

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AF478715.1| Alpinia galanga 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene and
           internal transcribed spacer 2, complete sequence; and
           26S ribosomal RNA gene, partial sequence
          Length = 647

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AF478712.1| Alpinia conchigera 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 647

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 384 ctttgctccttgctttgctg 403
to top
>gb|AF478708.1| Aframomum sp. Waimea W86S127 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 627

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AF478706.1| Aframomum sceptrum 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 627

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AF478705.1| Aframomum daniellii 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 627

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402
to top
>gb|AF478704.1| Aframomum angustifolium 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 26S ribosomal RNA gene, partial sequence
          Length = 627

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 316 ctttgctccttgctttgctg 335
           ||||||||||||||||||||
Sbjct: 383 ctttgctccttgctttgctg 402


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,943,322
Number of Sequences: 3902068
Number of extensions: 3943322
Number of successful extensions: 68354
Number of sequences better than 10.0: 134
Number of HSP's better than 10.0 without gapping: 136
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67751
Number of HSP's gapped (non-prelim): 603
length of query: 702
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 679
effective length of database: 17,143,297,704
effective search space: 11640299141016
effective search space used: 11640299141016
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top