ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd19n06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 56 9e-05
2dbj|AK108757.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 9e-05
3gb|AY108296.1| Zea mays PCO074981 mRNA sequence 54 4e-04
4gb|AC149537.2| Xenopus tropicalis clone ISB-378C9, complete sequ... 42 1.4
5ref|NM_106447.2| Arabidopsis thaliana transcription factor AT1G7... 40 5.6
6gb|AC124504.3| Mus musculus BAC clone RP23-418E15 from chromosom... 40 5.6
7gb|DQ446441.1| Arabidopsis thaliana clone pENTR221-At1g77980 MAD... 40 5.6
8emb|AL139001.14| Human DNA sequence from clone RP11-1G3 on chrom... 40 5.6
9gb|AY141242.1| Arabidopsis thaliana MADS-box protein AGL66 mRNA,... 40 5.6
10ref|XM_785864.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 5.6
11gb|AC129555.29| Mus musculus chromosome 5, clone RP24-90F19, com... 40 5.6
12gb|AC157514.2| Mus musculus BAC clone RP24-281C16 from chromosom... 40 5.6
13gb|AC155820.2| Mus musculus BAC clone RP23-360J10 from chromosom... 40 5.6
14gb|AC009243.3|AC009243 Genomic sequence for Arabidopsis thaliana... 40 5.6
15dbj|AB094111.1| Arabidopsis thaliana At1g77980 mRNA for MADS-box... 40 5.6

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                        
Query: 1        gtaggtacgttagttgaccagtcaggaaggatgacataaa 40
                |||||||| ||||||||||| ||||||||||| |||||||
Sbjct: 20149922 gtaggtacattagttgaccaatcaggaaggattacataaa 20149961



to top

>dbj|AK108757.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-150-G02, full
           insert sequence
          Length = 1280

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 1   gtaggtacgttagttgaccagtcaggaaggatgacataaa 40
           |||||||| ||||||||||| ||||||||||| |||||||
Sbjct: 875 gtaggtacattagttgaccaatcaggaaggattacataaa 914



to top

>gb|AY108296.1| Zea mays PCO074981 mRNA sequence
          Length = 590

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 10  ttagttgaccagtcaggaaggatgacataaa 40
           ||||||||||||||||||||||| |||||||
Sbjct: 107 ttagttgaccagtcaggaaggatcacataaa 137



to top

>gb|AC149537.2| Xenopus tropicalis clone ISB-378C9, complete sequence
          Length = 80137

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 223  agaagttgtttgtttgtagtatctg 247
            |||| ||||||||||||||||||||
Sbjct: 4713 agaaattgtttgtttgtagtatctg 4689



to top

>ref|NM_106447.2| Arabidopsis thaliana transcription factor AT1G77980 mRNA, complete
           cds
          Length = 999

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 213 ctctgccatgagaagttgtt 232
           ||||||||||||||||||||
Sbjct: 432 ctctgccatgagaagttgtt 413



to top

>gb|AC124504.3| Mus musculus BAC clone RP23-418E15 from chromosome 10, complete sequence
          Length = 204133

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 17     accagtcaggaaggatgacataaa 40
              ||||||||||||| ||||||||||
Sbjct: 140710 accagtcaggaagcatgacataaa 140733



to top

>gb|DQ446441.1| Arabidopsis thaliana clone pENTR221-At1g77980 MADS-box family
           protein (At1g77980) mRNA, complete cds
          Length = 999

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 213 ctctgccatgagaagttgtt 232
           ||||||||||||||||||||
Sbjct: 432 ctctgccatgagaagttgtt 413



to top

>emb|AL139001.14| Human DNA sequence from clone RP11-1G3 on chromosome 13q21.31-22.2
              Contains the 5' end of a novel gene, complete sequence
          Length = 144569

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 123    tctttgtggatgggagagag 142
              ||||||||||||||||||||
Sbjct: 122547 tctttgtggatgggagagag 122528



to top

>gb|AY141242.1| Arabidopsis thaliana MADS-box protein AGL66 mRNA, complete cds
          Length = 999

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 213 ctctgccatgagaagttgtt 232
           ||||||||||||||||||||
Sbjct: 432 ctctgccatgagaagttgtt 413



to top

>ref|XM_785864.1| PREDICTED: Strongylocentrotus purpuratus similar to X-box binding
           protein 1 (LOC586069), mRNA
          Length = 1488

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 218 ccatgagaagttgtttgttt 237
           ||||||||||||||||||||
Sbjct: 474 ccatgagaagttgtttgttt 455



to top

>gb|AC129555.29| Mus musculus chromosome 5, clone RP24-90F19, complete sequence
          Length = 242141

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 115    tgcatggatctttgtggatg 134
              ||||||||||||||||||||
Sbjct: 176336 tgcatggatctttgtggatg 176355



to top

>gb|AC157514.2| Mus musculus BAC clone RP24-281C16 from chromosome 9, complete sequence
          Length = 191880

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 42    cacaagggcgattagctttg 61
             ||||||||||||||||||||
Sbjct: 50630 cacaagggcgattagctttg 50649



to top

>gb|AC155820.2| Mus musculus BAC clone RP23-360J10 from chromosome 10, complete sequence
          Length = 221801

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 17     accagtcaggaaggatgacataaa 40
              ||||||||||||| ||||||||||
Sbjct: 204968 accagtcaggaagcatgacataaa 204945



to top

>gb|AC009243.3|AC009243 Genomic sequence for Arabidopsis thaliana BAC F28K19 from chromosome I,
             complete sequence
          Length = 110565

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   ctctgccatgagaagttgtt 232
             ||||||||||||||||||||
Sbjct: 59303 ctctgccatgagaagttgtt 59322



to top

>dbj|AB094111.1| Arabidopsis thaliana At1g77980 mRNA for MADS-box protein, partial
           cds
          Length = 1297

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 213 ctctgccatgagaagttgtt 232
           ||||||||||||||||||||
Sbjct: 359 ctctgccatgagaagttgtt 340


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,820,642
Number of Sequences: 3902068
Number of extensions: 3820642
Number of successful extensions: 56326
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56283
Number of HSP's gapped (non-prelim): 43
length of query: 418
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 396
effective length of database: 17,147,199,772
effective search space: 6790291109712
effective search space used: 6790291109712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top