| Clone Name | basd19c15 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK120353.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013066C10, full insert sequence Length = 1652 Score = 490 bits (247), Expect = e-135 Identities = 394/443 (88%) Strand = Plus / Plus Query: 53 ggagaggagccagtcgcagagcccgcggtcgcccggggcggcggccggggcgccgttcct 112 |||||||||||||||||||||||| |||||||| | | ||||||| |||| ||||||||| Sbjct: 203 ggagaggagccagtcgcagagcccccggtcgccggcgtcggcggctggggtgccgttcct 262 Query: 113 gtcgatctgcgtcacggatcccgtcaagatgggcaccggcgtccagtcctacatctccta 172 |||||||| |||||| ||||| || |||||||| ||||| |||||| ||||||||||||| Sbjct: 263 gtcgatctccgtcacagatcctgtgaagatgggtaccggagtccaggcctacatctccta 322 Query: 173 ccgcgtcatcaccaagactaacctacctgaattcgagggagcagagaaaattgttatcag 232 ||||||||||||||||| ||||| ||||| || ||||| |||||||||||||||| | Sbjct: 323 tcgcgtcatcaccaagaccaacctgcctgactttgaggggcaagagaaaattgttatccg 382 Query: 233 gcgctatagtgattttgagtggctgcacgatcggctagctgagaagtacaaaggcatttt 292 |||||||||||| ||||||||| |||| ||||| || ||||||||||||||||||||||| Sbjct: 383 gcgctatagtgactttgagtggttgcatgatcgtcttgctgagaagtacaaaggcatttt 442 Query: 293 tatacctcctcttccagagaagaatgctgttgagaaattccggtttagcaaagaattcat 352 ||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||| Sbjct: 443 tatacctccccttccagagaagaatgctgttgaaaaattccggtttagcaaagagttcat 502 Query: 353 tgaattgaggcgccaagctctggacctattcatcaacagactagcttcacacccggaact 412 |||||| |||| ||||| ||||| ||||| |||| ||| |||||||||| || ||||| Sbjct: 503 tgaattacggcgtcaagccctggatctatttgtcaatagaatagcttcacatcctgaact 562 Query: 413 taagcaaagcgaagatttgaggacatttttacaggcagatgaagagaaaatggatagagc 472 |||||||| | |||||||| || |||||| |||||||||||||||||||||||||||| Sbjct: 563 caagcaaagtggagatttgaagatatttttgcaggcagatgaagagaaaatggatagaga 622 Query: 473 aaggtcttatgagactggtatat 495 |||||||||||| |||||||||| Sbjct: 623 aaggtcttatgaaactggtatat 645
>dbj|AK102304.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033089O16, full insert sequence Length = 1610 Score = 490 bits (247), Expect = e-135 Identities = 394/443 (88%) Strand = Plus / Plus Query: 53 ggagaggagccagtcgcagagcccgcggtcgcccggggcggcggccggggcgccgttcct 112 |||||||||||||||||||||||| |||||||| | | ||||||| |||| ||||||||| Sbjct: 167 ggagaggagccagtcgcagagcccccggtcgccggcgtcggcggctggggtgccgttcct 226 Query: 113 gtcgatctgcgtcacggatcccgtcaagatgggcaccggcgtccagtcctacatctccta 172 |||||||| |||||| ||||| || |||||||| ||||| |||||| ||||||||||||| Sbjct: 227 gtcgatctccgtcacagatcctgtgaagatgggtaccggagtccaggcctacatctccta 286 Query: 173 ccgcgtcatcaccaagactaacctacctgaattcgagggagcagagaaaattgttatcag 232 ||||||||||||||||| ||||| ||||| || ||||| |||||||||||||||| | Sbjct: 287 tcgcgtcatcaccaagaccaacctgcctgactttgaggggcaagagaaaattgttatccg 346 Query: 233 gcgctatagtgattttgagtggctgcacgatcggctagctgagaagtacaaaggcatttt 292 |||||||||||| ||||||||| |||| ||||| || ||||||||||||||||||||||| Sbjct: 347 gcgctatagtgactttgagtggttgcatgatcgtcttgctgagaagtacaaaggcatttt 406 Query: 293 tatacctcctcttccagagaagaatgctgttgagaaattccggtttagcaaagaattcat 352 ||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||| Sbjct: 407 tatacctccccttccagagaagaatgctgttgaaaaattccggtttagcaaagagttcat 466 Query: 353 tgaattgaggcgccaagctctggacctattcatcaacagactagcttcacacccggaact 412 |||||| |||| ||||| ||||| ||||| |||| ||| |||||||||| || ||||| Sbjct: 467 tgaattacggcgtcaagccctggatctatttgtcaatagaatagcttcacatcctgaact 526 Query: 413 taagcaaagcgaagatttgaggacatttttacaggcagatgaagagaaaatggatagagc 472 |||||||| | |||||||| || |||||| |||||||||||||||||||||||||||| Sbjct: 527 caagcaaagtggagatttgaagatatttttgcaggcagatgaagagaaaatggatagaga 586 Query: 473 aaggtcttatgagactggtatat 495 |||||||||||| |||||||||| Sbjct: 587 aaggtcttatgaaactggtatat 609
>ref|NM_190716.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 987 Score = 432 bits (218), Expect = e-118 Identities = 359/406 (88%) Strand = Plus / Plus Query: 53 ggagaggagccagtcgcagagcccgcggtcgcccggggcggcggccggggcgccgttcct 112 |||||||||||||||||||||||| |||||||| | | ||||||| |||| ||||||||| Sbjct: 9 ggagaggagccagtcgcagagcccccggtcgccggcgtcggcggctggggtgccgttcct 68 Query: 113 gtcgatctgcgtcacggatcccgtcaagatgggcaccggcgtccagtcctacatctccta 172 |||||||| |||||| ||||| || |||||||| ||||| |||||| ||||||||||||| Sbjct: 69 gtcgatctccgtcacagatcctgtgaagatgggtaccggagtccaggcctacatctccta 128 Query: 173 ccgcgtcatcaccaagactaacctacctgaattcgagggagcagagaaaattgttatcag 232 ||||||||||||||||| ||||| ||||| || ||||| |||||||||||||||| | Sbjct: 129 tcgcgtcatcaccaagaccaacctgcctgactttgaggggcaagagaaaattgttatccg 188 Query: 233 gcgctatagtgattttgagtggctgcacgatcggctagctgagaagtacaaaggcatttt 292 |||||||||||| ||||||||| |||| ||||| || ||||||||||||||||||||||| Sbjct: 189 gcgctatagtgactttgagtggttgcatgatcgtcttgctgagaagtacaaaggcatttt 248 Query: 293 tatacctcctcttccagagaagaatgctgttgagaaattccggtttagcaaagaattcat 352 ||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||| Sbjct: 249 tatacctccccttccagagaagaatgctgttgaaaaattccggtttagcaaagagttcat 308 Query: 353 tgaattgaggcgccaagctctggacctattcatcaacagactagcttcacacccggaact 412 |||||| |||| ||||| ||||| ||||| |||| ||| |||||||||| || ||||| Sbjct: 309 tgaattacggcgtcaagccctggatctatttgtcaatagaatagcttcacatcctgaact 368 Query: 413 taagcaaagcgaagatttgaggacatttttacaggcagatgaagag 458 |||||||| | |||||||| || |||||| ||||||||||||||| Sbjct: 369 caagcaaagtggagatttgaagatatttttgcaggcagatgaagag 414
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 163 bits (82), Expect = 7e-37 Identities = 103/110 (93%) Strand = Plus / Minus Query: 215 agagaaaattgttatcaggcgctatagtgattttgagtggctgcacgatcggctagctga 274 |||||||||||||||| ||||||||||||| ||||||||| |||| ||||| || ||||| Sbjct: 37312495 agagaaaattgttatccggcgctatagtgactttgagtggttgcatgatcgtcttgctga 37312436 Query: 275 gaagtacaaaggcatttttatacctcctcttccagagaagaatgctgttg 324 ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 37312435 gaagtacaaaggcatttttatacctccccttccagagaagaatgctgttg 37312386 Score = 159 bits (80), Expect = 1e-35 Identities = 122/136 (89%) Strand = Plus / Minus Query: 53 ggagaggagccagtcgcagagcccgcggtcgcccggggcggcggccggggcgccgttcct 112 |||||||||||||||||||||||| |||||||| | | ||||||| |||| ||||||||| Sbjct: 37313408 ggagaggagccagtcgcagagcccccggtcgccggcgtcggcggctggggtgccgttcct 37313349 Query: 113 gtcgatctgcgtcacggatcccgtcaagatgggcaccggcgtccagtcctacatctccta 172 |||||||| |||||| ||||| || |||||||| ||||| |||||| ||||||||||||| Sbjct: 37313348 gtcgatctccgtcacagatcctgtgaagatgggtaccggagtccaggcctacatctccta 37313289 Query: 173 ccgcgtcatcaccaag 188 ||||||||||||||| Sbjct: 37313288 tcgcgtcatcaccaag 37313273 Score = 119 bits (60), Expect = 9e-24 Identities = 114/132 (86%) Strand = Plus / Minus Query: 327 aaattccggtttagcaaagaattcattgaattgaggcgccaagctctggacctattcatc 386 |||||||||||||||||||| ||||||||||| |||| ||||| ||||| ||||| || Sbjct: 37312244 aaattccggtttagcaaagagttcattgaattacggcgtcaagccctggatctatttgtc 37312185 Query: 387 aacagactagcttcacacccggaacttaagcaaagcgaagatttgaggacatttttacag 446 || ||| |||||||||| || ||||| |||||||| | |||||||| || |||||| ||| Sbjct: 37312184 aatagaatagcttcacatcctgaactcaagcaaagtggagatttgaagatatttttgcag 37312125 Query: 447 gcagatgaagag 458 |||||||||||| Sbjct: 37312124 gcagatgaagag 37312113 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 457 agaaaatggatagagcaaggtcttatgagactggtatat 495 ||||||||||||||| |||||||||||| |||||||||| Sbjct: 37311556 agaaaatggatagagaaaggtcttatgaaactggtatat 37311518
>dbj|AP003611.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0423B08 Length = 151490 Score = 163 bits (82), Expect = 7e-37 Identities = 103/110 (93%) Strand = Plus / Minus Query: 215 agagaaaattgttatcaggcgctatagtgattttgagtggctgcacgatcggctagctga 274 |||||||||||||||| ||||||||||||| ||||||||| |||| ||||| || ||||| Sbjct: 24529 agagaaaattgttatccggcgctatagtgactttgagtggttgcatgatcgtcttgctga 24470 Query: 275 gaagtacaaaggcatttttatacctcctcttccagagaagaatgctgttg 324 ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 24469 gaagtacaaaggcatttttatacctccccttccagagaagaatgctgttg 24420 Score = 159 bits (80), Expect = 1e-35 Identities = 122/136 (89%) Strand = Plus / Minus Query: 53 ggagaggagccagtcgcagagcccgcggtcgcccggggcggcggccggggcgccgttcct 112 |||||||||||||||||||||||| |||||||| | | ||||||| |||| ||||||||| Sbjct: 25442 ggagaggagccagtcgcagagcccccggtcgccggcgtcggcggctggggtgccgttcct 25383 Query: 113 gtcgatctgcgtcacggatcccgtcaagatgggcaccggcgtccagtcctacatctccta 172 |||||||| |||||| ||||| || |||||||| ||||| |||||| ||||||||||||| Sbjct: 25382 gtcgatctccgtcacagatcctgtgaagatgggtaccggagtccaggcctacatctccta 25323 Query: 173 ccgcgtcatcaccaag 188 ||||||||||||||| Sbjct: 25322 tcgcgtcatcaccaag 25307 Score = 119 bits (60), Expect = 9e-24 Identities = 114/132 (86%) Strand = Plus / Minus Query: 327 aaattccggtttagcaaagaattcattgaattgaggcgccaagctctggacctattcatc 386 |||||||||||||||||||| ||||||||||| |||| ||||| ||||| ||||| || Sbjct: 24278 aaattccggtttagcaaagagttcattgaattacggcgtcaagccctggatctatttgtc 24219 Query: 387 aacagactagcttcacacccggaacttaagcaaagcgaagatttgaggacatttttacag 446 || ||| |||||||||| || ||||| |||||||| | |||||||| || |||||| ||| Sbjct: 24218 aatagaatagcttcacatcctgaactcaagcaaagtggagatttgaagatatttttgcag 24159 Query: 447 gcagatgaagag 458 |||||||||||| Sbjct: 24158 gcagatgaagag 24147 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 457 agaaaatggatagagcaaggtcttatgagactggtatat 495 ||||||||||||||| |||||||||||| |||||||||| Sbjct: 23590 agaaaatggatagagaaaggtcttatgaaactggtatat 23552
>dbj|AP003287.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0679C12 Length = 153666 Score = 163 bits (82), Expect = 7e-37 Identities = 103/110 (93%) Strand = Plus / Minus Query: 215 agagaaaattgttatcaggcgctatagtgattttgagtggctgcacgatcggctagctga 274 |||||||||||||||| ||||||||||||| ||||||||| |||| ||||| || ||||| Sbjct: 149484 agagaaaattgttatccggcgctatagtgactttgagtggttgcatgatcgtcttgctga 149425 Query: 275 gaagtacaaaggcatttttatacctcctcttccagagaagaatgctgttg 324 ||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 149424 gaagtacaaaggcatttttatacctccccttccagagaagaatgctgttg 149375 Score = 159 bits (80), Expect = 1e-35 Identities = 122/136 (89%) Strand = Plus / Minus Query: 53 ggagaggagccagtcgcagagcccgcggtcgcccggggcggcggccggggcgccgttcct 112 |||||||||||||||||||||||| |||||||| | | ||||||| |||| ||||||||| Sbjct: 150397 ggagaggagccagtcgcagagcccccggtcgccggcgtcggcggctggggtgccgttcct 150338 Query: 113 gtcgatctgcgtcacggatcccgtcaagatgggcaccggcgtccagtcctacatctccta 172 |||||||| |||||| ||||| || |||||||| ||||| |||||| ||||||||||||| Sbjct: 150337 gtcgatctccgtcacagatcctgtgaagatgggtaccggagtccaggcctacatctccta 150278 Query: 173 ccgcgtcatcaccaag 188 ||||||||||||||| Sbjct: 150277 tcgcgtcatcaccaag 150262 Score = 119 bits (60), Expect = 9e-24 Identities = 114/132 (86%) Strand = Plus / Minus Query: 327 aaattccggtttagcaaagaattcattgaattgaggcgccaagctctggacctattcatc 386 |||||||||||||||||||| ||||||||||| |||| ||||| ||||| ||||| || Sbjct: 149233 aaattccggtttagcaaagagttcattgaattacggcgtcaagccctggatctatttgtc 149174 Query: 387 aacagactagcttcacacccggaacttaagcaaagcgaagatttgaggacatttttacag 446 || ||| |||||||||| || ||||| |||||||| | |||||||| || |||||| ||| Sbjct: 149173 aatagaatagcttcacatcctgaactcaagcaaagtggagatttgaagatatttttgcag 149114 Query: 447 gcagatgaagag 458 |||||||||||| Sbjct: 149113 gcagatgaagag 149102 Score = 61.9 bits (31), Expect = 2e-06 Identities = 37/39 (94%) Strand = Plus / Minus Query: 457 agaaaatggatagagcaaggtcttatgagactggtatat 495 ||||||||||||||| |||||||||||| |||||||||| Sbjct: 148545 agaaaatggatagagaaaggtcttatgaaactggtatat 148507
>gb|AF162682.1|AF162682 Zea mays mutant sh2-7527 alien mRNA sequence Length = 1210 Score = 89.7 bits (45), Expect = 8e-15 Identities = 60/65 (92%) Strand = Plus / Plus Query: 429 ttgaggacatttttacaggcagatgaagagaaaatggatagagcaaggtcttatgagact 488 |||||||||||||| |||||||||||||||| ||||||||| ||||| ||||||||||| Sbjct: 430 ttgaggacatttttgcaggcagatgaagagataatggatagggcaagatcttatgagacc 489 Query: 489 ggtat 493 ||||| Sbjct: 490 ggtat 494
>ref|NM_120696.2| Arabidopsis thaliana unknown protein AT5G06140 mRNA, complete cds Length = 1427 Score = 73.8 bits (37), Expect = 5e-10 Identities = 58/65 (89%) Strand = Plus / Plus Query: 276 aagtacaaaggcatttttatacctcctcttccagagaagaatgctgttgagaaattccgg 335 |||||||| |||||||| || ||||||||||||||||||| |||||| || |||||||| Sbjct: 255 aagtacaagggcattttcattcctcctcttccagagaagagtgctgtagaaaaattccgc 314 Query: 336 tttag 340 ||||| Sbjct: 315 tttag 319
>emb|BX830901.1|CNS0A0TB Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS38ZC11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1384 Score = 73.8 bits (37), Expect = 5e-10 Identities = 58/65 (89%) Strand = Plus / Plus Query: 276 aagtacaaaggcatttttatacctcctcttccagagaagaatgctgttgagaaattccgg 335 |||||||| |||||||| || ||||||||||||||||||| |||||| || |||||||| Sbjct: 255 aagtacaagggcattttcattcctcctcttccagagaagagtgctgtagaaaaattccgc 314 Query: 336 tttag 340 ||||| Sbjct: 315 tttag 319
>emb|AJ441072.1|BOL441072 Brassica oleracea mRNA for sorting nexin 1 Length = 1216 Score = 65.9 bits (33), Expect = 1e-07 Identities = 102/125 (81%) Strand = Plus / Plus Query: 216 gagaaaattgttatcaggcgctatagtgattttgagtggctgcacgatcggctagctgag 275 ||||| ||||||||||| || || |||||||| | ||||||| ||||| || ||| Sbjct: 175 gagaagattgttatcagacggtacagtgatttcgtgtggctgagggatcgccttttcgag 234 Query: 276 aagtacaaaggcatttttatacctcctcttccagagaagaatgctgttgagaaattccgg 335 |||||||| ||| |||| | |||||||| || ||||||| |||||||||||||||||| Sbjct: 235 aagtacaagggcgttttcgttcctcctctccctgagaagagtgctgttgagaaattccgc 294 Query: 336 tttag 340 ||||| Sbjct: 295 tttag 299
>dbj|AP002544.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBL20 Length = 35301 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 276 aagtacaaaggcatttttatacctcctcttccagagaagaatgctgt 322 |||||||| |||||||| || ||||||||||||||||||| |||||| Sbjct: 2068 aagtacaagggcattttcattcctcctcttccagagaagagtgctgt 2022
>gb|AF293457.1|AF293457S1 Zea mays truncated insertion sequence VADER mutant shrunken-2 (sh2) pseudogene, complete sequence Length = 6873 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 429 ttgaggacatttttacaggcagatgaagag 458 |||||||||||||| ||||||||||||||| Sbjct: 3944 ttgaggacatttttgcaggcagatgaagag 3973 Score = 42.1 bits (21), Expect = 1.7 Identities = 30/33 (90%) Strand = Plus / Plus Query: 461 aatggatagagcaaggtcttatgagactggtat 493 ||||||||| ||||| ||||||||||| ||||| Sbjct: 4560 aatggatagggcaagatcttatgagaccggtat 4592
>ref|XM_363699.1| Magnaporthe grisea 70-15 hypothetical protein (MG01625.4) partial mRNA Length = 19761 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 54 gagaggagccagtcgcagagcc 75 |||||||||||||||||||||| Sbjct: 9746 gagaggagccagtcgcagagcc 9767
>ref|XM_523203.1| PREDICTED: Pan troglodytes LOC467808 (LOC467808), mRNA Length = 1047 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 296 acctcctcttccagagaagaa 316 ||||||||||||||||||||| Sbjct: 46 acctcctcttccagagaagaa 66
>ref|XM_609325.2| PREDICTED: Bos taurus similar to sterile alpha motif domain containing 6 (LOC530846), mRNA Length = 2595 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 83 gcccggggcggcggccggggcgccg 107 |||||||||||||||||| |||||| Sbjct: 168 gcccggggcggcggccggagcgccg 192
>ref|XM_715638.1| Candida albicans SC5314 hypothetical protein (CaO19_11771), mRNA Length = 3054 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 422 cgaagatttgaggacattttt 442 ||||||||||||||||||||| Sbjct: 2292 cgaagatttgaggacattttt 2272
>ref|XM_715510.1| Candida albicans SC5314 hypothetical protein (CaO19_4295), mRNA Length = 2289 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 422 cgaagatttgaggacattttt 442 ||||||||||||||||||||| Sbjct: 1527 cgaagatttgaggacattttt 1507
>gb|AC132595.3| Mus musculus BAC clone RP24-229G7 from chromosome 7, complete sequence Length = 155547 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 63664 gcccggggcggcggccggggc 63684
>ref|XM_974658.1| PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 6, transcript variant 1 (Pcsk6), mRNA Length = 4256 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 85 gcccggggcggcggccggggc 65
>ref|XM_974760.1| PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 6, transcript variant 4 (Pcsk6), mRNA Length = 4259 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 85 gcccggggcggcggccggggc 65
>ref|XM_974726.1| PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 6, transcript variant 3 (Pcsk6), mRNA Length = 4298 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 85 gcccggggcggcggccggggc 65
>ref|XM_919480.2| PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 6, transcript variant 2 (Pcsk6), mRNA Length = 4256 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 85 gcccggggcggcggccggggc 65
>ref|XM_975540.1| PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 6, transcript variant 5 (Pcsk6), mRNA Length = 4298 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 85 gcccggggcggcggccggggc 65
>ref|XM_905687.2| PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 6, transcript variant 1 (Pcsk6), mRNA Length = 4259 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 85 gcccggggcggcggccggggc 65
>ref|XM_919493.2| PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 6, transcript variant 4 (Pcsk6), mRNA Length = 4298 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 85 gcccggggcggcggccggggc 65
>ref|XM_896608.2| PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 6, transcript variant 3 (Pcsk6), mRNA Length = 4256 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 85 gcccggggcggcggccggggc 65
>ref|XM_886136.2| PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 6, transcript variant 2 (Pcsk6), mRNA Length = 4259 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 85 gcccggggcggcggccggggc 65
>ref|XM_355911.4| PREDICTED: Mus musculus proprotein convertase subtilisin/kexin type 6, transcript variant 1 (Pcsk6), mRNA Length = 4298 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 85 gcccggggcggcggccggggc 65
>gb|AC165968.3| Mus musculus BAC clone RP23-181K4 from chromosome 7, complete sequence Length = 190840 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 32814 gcccggggcggcggccggggc 32834
>ref|NM_138322.2| Homo sapiens proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 3, mRNA Length = 2302 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 364 gcccggggcggcggccggggc 344
>ref|NM_138323.1| Homo sapiens proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 5, mRNA Length = 3208 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 364 gcccggggcggcggccggggc 344
>ref|NM_138324.1| Homo sapiens proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 4, mRNA Length = 3254 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 364 gcccggggcggcggccggggc 344
>gb|AC093835.3| Homo sapiens BAC clone RP11-425A23 from 4, complete sequence Length = 197225 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 341 caaagaattcattgaattgag 361 ||||||||||||||||||||| Sbjct: 121765 caaagaattcattgaattgag 121745
>ref|NM_138325.2| Homo sapiens proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 6, mRNA Length = 2358 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 364 gcccggggcggcggccggggc 344
>ref|NM_138319.2| Homo sapiens proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 2, mRNA Length = 4520 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 364 gcccggggcggcggccggggc 344
>ref|NM_138321.1| Homo sapiens proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 8, mRNA Length = 3333 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 364 gcccggggcggcggccggggc 344
>gb|AC011847.9| Homo sapiens chromosome 15, clone RP11-348J6, complete sequence Length = 178862 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 296 acctcctcttccagagaagaa 316 ||||||||||||||||||||| Sbjct: 46874 acctcctcttccagagaagaa 46894
>ref|NM_002570.3| Homo sapiens proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 1, mRNA Length = 4559 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 364 gcccggggcggcggccggggc 344
>ref|NM_138320.1| Homo sapiens proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 7, mRNA Length = 3372 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 364 gcccggggcggcggccggggc 344
>gb|AC009433.11| Homo sapiens, clone RP11-108N14, complete sequence Length = 169638 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 296 acctcctcttccagagaagaa 316 ||||||||||||||||||||| Sbjct: 20229 acctcctcttccagagaagaa 20249
>gb|AC087528.15| Homo sapiens chromosome 15, clone RP11-497M17, complete sequence Length = 142965 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 3721 gcccggggcggcggccggggc 3701
>dbj|AB001914.2| Homo sapiens genes for PACE4A-I, PACE4A-II, PACE4E-II, PACE4E-I, PACE4C, PACE4CS, PACE4B, PACE4D, complete cds Length = 55640 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 1202 gcccggggcggcggccggggc 1182
>gb|AC090164.22| Homo sapiens chromosome 15, clone RP11-14C10, complete sequence Length = 204674 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 15837 gcccggggcggcggccggggc 15857
>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome Length = 3147090 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 40 ccatgatctccgcggagagga 60 ||||||||||||||||||||| Sbjct: 1202068 ccatgatctccgcggagagga 1202088
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome Length = 3551823 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 85 ccggggcggcggccggggcgc 105 ||||||||||||||||||||| Sbjct: 1548630 ccggggcggcggccggggcgc 1548610
>ref|NM_012999.1| Rattus norvegicus proprotein convertase subtilisin/kexin type 6 (Pcsk6), mRNA Length = 4153 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 78 gcccggggcggcggccggggc 58
>gb|L31894.1|RATPACE4A Rattus norvegicus PACE4 mRNA, complete cds Length = 4153 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 78 gcccggggcggcggccggggc 58
>gb|M80482.1|HUMPACE4A Human subtilisin-like protein (PACE4) mRNA, complete cds Length = 4403 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 219 gcccggggcggcggccggggc 199
>gb|L01060.1|DOGIDUA03 Dog alpha-L-iduronidase (IDUA) gene, exons 7-12 Length = 1557 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 87 ggggcggcggccggggcgccg 107 ||||||||||||||||||||| Sbjct: 903 ggggcggcggccggggcgccg 923
>dbj|D28513.1|HUMPACE4C Homo sapiens PACE4C mRNA for kexin-like protease, complete cds Length = 2968 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 77 gcccggggcggcggccggggc 57
>dbj|D87995.1| Homo sapiens mRNA for PACE4A-II, complete cds Length = 4269 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 124 gcccggggcggcggccggggc 104
>dbj|D87994.1| Homo sapiens mRNA for PACE4E-II, complete cds Length = 3093 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 124 gcccggggcggcggccggggc 104
>dbj|D87993.1| Homo sapiens mRNA for PACE4E-I, complete cds Length = 3132 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 83 gcccggggcggcggccggggc 103 ||||||||||||||||||||| Sbjct: 124 gcccggggcggcggccggggc 104
>ref|NM_013045.1| Rattus norvegicus tenascin R (Tnr), mRNA Length = 6455 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 gagggagcagagaaaattgt 226 |||||||||||||||||||| Sbjct: 4558 gagggagcagagaaaattgt 4539
>gb|AF521177.1| Hordeum vulgare contig 211252, complete sequence Length = 211664 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 cggggcggcggccggggcgc 105 |||||||||||||||||||| Sbjct: 127097 cggggcggcggccggggcgc 127116 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 cggggcggcggccggggcgc 105 |||||||||||||||||||| Sbjct: 127037 cggggcggcggccggggcgc 127056 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 86 cggggcggcggccggggcgc 105 |||||||||||||||||||| Sbjct: 126977 cggggcggcggccggggcgc 126996
>ref|XM_420095.1| PREDICTED: Gallus gallus procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55) (P4HB), mRNA Length = 3503 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 ccggggcggcggccggggcg 104 |||||||||||||||||||| Sbjct: 163 ccggggcggcggccggggcg 182
>gb|AC139321.4| Mus musculus BAC clone RP24-425N6 from chromosome 1, complete sequence Length = 148379 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 tttttatacctcctcttcca 308 |||||||||||||||||||| Sbjct: 30945 tttttatacctcctcttcca 30964
>ref|NM_018875.1| Mus musculus sorting nexin 12 (Snx12), mRNA Length = 617 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 275 cgctatagtgactttgagtggctg 298
>ref|XM_540918.2| PREDICTED: Canis familiaris similar to Serdin1 (LOC483797), mRNA Length = 931 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 ccggggcggcggccggggcg 104 |||||||||||||||||||| Sbjct: 802 ccggggcggcggccggggcg 783
>gb|AC115805.12| Mus musculus chromosome 10, clone RP23-412P24, complete sequence Length = 193434 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 432 aggacatttttacaggcaga 451 |||||||||||||||||||| Sbjct: 138316 aggacatttttacaggcaga 138297
>gb|AC121584.2| Mus musculus BAC clone RP23-265D17 from 1, complete sequence Length = 130455 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 tttttatacctcctcttcca 308 |||||||||||||||||||| Sbjct: 118426 tttttatacctcctcttcca 118445
>gb|AY366501.1| Homo sapiens clone BAC44d21 BCSC-1 (LOH11CR2A) gene, complete cds; alternatively spliced isoforms Length = 219836 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 283 aaggcatttttatacctcct 302 |||||||||||||||||||| Sbjct: 75024 aaggcatttttatacctcct 75005
>ref|XM_739968.1| Plasmodium chabaudi chabaudi protein phosphatase (PC000719.01.0) partial mRNA Length = 1599 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 ggagcagagaaaattgttat 229 |||||||||||||||||||| Sbjct: 923 ggagcagagaaaattgttat 904
>ref|XM_779921.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein LOC579826 (LOC579826), mRNA Length = 2357 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 443 acaggcagatgaagagaaaa 462 |||||||||||||||||||| Sbjct: 1044 acaggcagatgaagagaaaa 1063
>emb|AL512378.7| Human DNA sequence from clone RP1-34L19 on chromosome 6 Contains a CHC1 pseudogene and a high mobility group protein pseudogene, complete sequence Length = 66585 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 agagaaaattgttatcaggc 234 |||||||||||||||||||| Sbjct: 17156 agagaaaattgttatcaggc 17137
>emb|AL160287.18| Human DNA sequence from clone RP11-128B16 on chromosome 10p11.1-11.23 Contains the 3' end of the APBB1IP gene for amyloid beta (A4) precursor protein-binding family B member 1 interacting protein and two novel genes, complete sequence Length = 144666 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 281 caaaggcatttttatacctcctct 304 ||||| |||||||||||||||||| Sbjct: 15300 caaagtcatttttatacctcctct 15323
>emb|AL157389.12| Human DNA sequence from clone RP11-248C1 on chromosome 10 Contains the 3' end of the MPHOSPH1 gene for M-phase phosphoprotein 1, a novel gene (DKFZp434P0810) and a CpG island, complete sequence Length = 134267 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 342 aaagaattcattgaattgag 361 |||||||||||||||||||| Sbjct: 1992 aaagaattcattgaattgag 2011
>emb|Z18630.1|RNJ1NRM R.norvegicus mRNA for J1-160/180 neural recognition molecule Length = 6455 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 gagggagcagagaaaattgt 226 |||||||||||||||||||| Sbjct: 4558 gagggagcagagaaaattgt 4539
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 93 gcggccggggcgccgttcct 112 |||||||||||||||||||| Sbjct: 1570994 gcggccggggcgccgttcct 1571013
>gb|AC153499.7| Mus musculus 10 BAC RP23-478J15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 207222 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 81 tcgcccggggcggcggccggggcg 104 ||||||||||||||||||| |||| Sbjct: 143594 tcgcccggggcggcggccgaggcg 143571
>gb|AC117377.9| Homo sapiens 12 BAC RP11-406H4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 107100 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 445 aggcagatgaagagaaaatg 464 |||||||||||||||||||| Sbjct: 1499 aggcagatgaagagaaaatg 1480
>gb|AC126616.4| Homo sapiens 12 BAC RP11-149L3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 14790 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 445 aggcagatgaagagaaaatg 464 |||||||||||||||||||| Sbjct: 14265 aggcagatgaagagaaaatg 14246
>dbj|AK131838.1| Mus musculus 10 day old male pancreas cDNA, RIKEN full-length enriched library, clone:1810035A22 product:sorting nexin 12, full insert sequence Length = 1114 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 338 cgctatagtgactttgagtggctg 361
>dbj|AK148235.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched library, clone:G370062J16 product:sorting nexin 12, full insert sequence Length = 2138 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 301 cgctatagtgactttgagtggctg 324
>gb|AC109136.1| Homo sapiens chromosome 16 clone RP11-629D22, complete sequence Length = 183080 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 343 aagaattcattgaattgagg 362 |||||||||||||||||||| Sbjct: 91602 aagaattcattgaattgagg 91583
>dbj|AK146833.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN full-length enriched library, clone:I920062H12 product:sorting nexin 12, full insert sequence Length = 920 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 268 cgctatagtgactttgagtggctg 291
>dbj|AK144727.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730027H15 product:hypothetical protein, full insert sequence Length = 695 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 cccggggcggcggccggggcgccg 107 |||||||||||||| ||||||||| Sbjct: 67 cccggggcggcggcgggggcgccg 90
>dbj|AK168604.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN full-length enriched library, clone:I920037O14 product:sorting nexin 12, full insert sequence Length = 891 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 239 cgctatagtgactttgagtggctg 262
>dbj|AK170992.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630215G01 product:sorting nexin 12, full insert sequence Length = 2413 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 335 cgctatagtgactttgagtggctg 358
>dbj|AK169569.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:C920008G02 product:sorting nexin 12, full insert sequence Length = 1101 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 323 cgctatagtgactttgagtggctg 346
>dbj|AK166044.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730030K23 product:unclassifiable, full insert sequence Length = 2669 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 cccggggcggcggccggggcgccg 107 |||||||||||||| ||||||||| Sbjct: 49 cccggggcggcggcgggggcgccg 72
>gb|U49737.1|RNU49737 Rattus norvegicus histone H10 gene, promotor region and partial cds Length = 756 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 87 ggggcggcggccggggcgcc 106 |||||||||||||||||||| Sbjct: 217 ggggcggcggccggggcgcc 236
>dbj|AK170403.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630102J02 product:sorting nexin 12, full insert sequence Length = 2310 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 239 cgctatagtgactttgagtggctg 262
>dbj|AB169211.1| Macaca fascicularis testis cDNA, clone: QtsA-18050, similar to human spermatogenesis associated 5-like 1 (SPATA5L1), mRNA, RefSeq: NM_024063.1 Length = 2679 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 cccggggcggcggccggggcgccg 107 ||||||||||||| |||||||||| Sbjct: 162 cccggggcggcggtcggggcgccg 185
>dbj|AK052663.1| Mus musculus 0 day neonate kidney cDNA, RIKEN full-length enriched library, clone:D630017B18 product:unclassifiable, full insert sequence Length = 2159 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 ggggcggcggccggggcgcc 106 |||||||||||||||||||| Sbjct: 407 ggggcggcggccggggcgcc 388
>dbj|AK080263.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630004A15 product:hypothetical Arginine-rich region containing protein, full insert sequence Length = 1356 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 84 cccggggcggcggccggggcgccg 107 |||||||||||||| ||||||||| Sbjct: 565 cccggggcggcggcgggggcgccg 542
>gb|AC153419.13| Mus musculus 10 BAC RP23-291D21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 199606 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 432 aggacatttttacaggcaga 451 |||||||||||||||||||| Sbjct: 17366 aggacatttttacaggcaga 17347
>dbj|AK083990.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length enriched library, clone:D130073L02 product:unclassifiable, full insert sequence Length = 1369 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 cccggggcggcggccggggcgccg 107 |||||||||||||| ||||||||| Sbjct: 54 cccggggcggcggcgggggcgccg 77
>dbj|AK049561.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length enriched library, clone:C430040E05 product:sorting nexin 12, full insert sequence Length = 2319 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 241 cgctatagtgactttgagtggctg 264
>gb|AC155940.6| Mus musculus 10 BAC RP24-94O5 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 211515 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 84 cccggggcggcggccggggcgccg 107 |||||||||||||| ||||||||| Sbjct: 41441 cccggggcggcggcgggggcgccg 41464
>dbj|AK011257.1| Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610001F05 product:sorting nexin 12, full insert sequence Length = 887 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 239 cgctatagtgactttgagtggctg 262
>gb|M29260.1|MUSHIS10PR Mouse histone 1-0 gene, 5' end, and promoter region Length = 969 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 87 ggggcggcggccggggcgcc 106 |||||||||||||||||||| Sbjct: 458 ggggcggcggccggggcgcc 477
>ref|XM_343799.2| PREDICTED: Rattus norvegicus similar to sorting nexin 12 (LOC363478), mRNA Length = 1055 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 259 cgctatagtgactttgagtggctg 282
>emb|AL671926.11| Mouse DNA sequence from clone RP23-356J7 on chromosome X, complete sequence Length = 153310 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 106409 cgctatagtgactttgagtggctg 106386
>gb|BC002009.1| Mus musculus sorting nexin 12, mRNA (cDNA clone MGC:5791 IMAGE:3592627), complete cds Length = 963 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 277 cgctatagtgactttgagtggctg 300
>dbj|AP000818.4| Homo sapiens genomic DNA, chromosome 11q clone:CMB9-44A17, complete sequence Length = 134973 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 283 aaggcatttttatacctcct 302 |||||||||||||||||||| Sbjct: 52230 aaggcatttttatacctcct 52249
>dbj|AB085745.1| Streptomyces griseus orf1, orf2, sgmA, orf4 genes for putative mono-oxygenase, hypothetical protein, metalloendopeptidase, possible secreted protein, partial and complete cds Length = 5194 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 ccggggcggcggccggggcg 104 |||||||||||||||||||| Sbjct: 5056 ccggggcggcggccggggcg 5075
>gb|AF062484.1|AF062484 Mus musculus SDP8 mRNA, complete cds Length = 617 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 234 cgctatagtgattttgagtggctg 257 ||||||||||| |||||||||||| Sbjct: 275 cgctatagtgactttgagtggctg 298
>gb|U23762.1|SPU23762 Streptomyces phaeochromogenes plasmid pJV1, complete sequence Length = 11143 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 ccggggcggcggccggggcg 104 |||||||||||||||||||| Sbjct: 265 ccggggcggcggccggggcg 246
>gb|U18295.1|MMU18295 Mus musculus histone H1(0) gene, complete cds Length = 2893 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 87 ggggcggcggccggggcgcc 106 |||||||||||||||||||| Sbjct: 501 ggggcggcggccggggcgcc 520
>emb|AL589670.21| Mouse DNA sequence from clone RP23-414K1 on chromosome 15, complete sequence Length = 203230 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 87 ggggcggcggccggggcgcc 106 |||||||||||||||||||| Sbjct: 109711 ggggcggcggccggggcgcc 109692 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,023,929 Number of Sequences: 3902068 Number of extensions: 4023929 Number of successful extensions: 82961 Number of sequences better than 10.0: 101 Number of HSP's better than 10.0 without gapping: 101 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 82663 Number of HSP's gapped (non-prelim): 298 length of query: 495 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 473 effective length of database: 17,147,199,772 effective search space: 8110625492156 effective search space used: 8110625492156 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)