ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd16o21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U49505.1|HVU49505 Hordeum vulgare profilin (Hvpro1) mRNA, com... 983 0.0
2emb|X89826.1|TAPRO2GEN T.aestivum mRNA for profilin (clone TaPRO2) 636 e-179
3emb|X89825.1|TAPRO1GEN T.aestivum mRNA for profilin (clone TaPRO1) 636 e-179
4emb|X89827.1|TAPRO3GEN T.aestivum mRNA for profilin (clone TaPRO3) 617 e-173
5ref|XM_550652.1| Oryza sativa (japonica cultivar-group), mRNA 424 e-115
6dbj|AK121519.1| Oryza sativa (japonica cultivar-group) cDNA clon... 424 e-115
7dbj|AK058798.1| Oryza sativa (japonica cultivar-group) cDNA clon... 424 e-115
8gb|AF201459.1|AF201459 Zea mays profilin 5 (PRO5) mRNA, complete... 385 e-103
9gb|AY103599.1| Zea mays PCO094927 mRNA sequence 367 3e-98
10gb|AF032370.1|AF032370 Zea mays profilin (PRO4) mRNA, complete cds 367 3e-98
11gb|BT018328.1| Zea mays clone EL01T0208F04.c mRNA sequence 323 4e-85
12dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 194 2e-46
13dbj|AP004806.3| Oryza sativa (japonica cultivar-group) genomic D... 194 2e-46
14dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic D... 194 2e-46
15emb|Y09458.1|PPPROFIL4 P.pratense mRNA for profilin 4 172 8e-40
16emb|Y09456.1|PPPROFIL2 P.pratense mRNA for profilin 2 172 8e-40
17emb|X73279.1|ZMPRO1MR Z.mays ZmPRO1 mRNA for profilin 1 172 8e-40
18gb|AY049013.1| Litchi chinensis profilin mRNA, complete cds 172 8e-40
19emb|Y09457.1|PPPROFIL3 P.pratense mRNA for profilin 3 165 2e-37
20emb|X77583.1|PPPROPXI P.pratense mRNA for profilin-Phl p XI 165 2e-37
21gb|AF377949.1|AF377949 Ananas comosus profilin mRNA, complete cds 165 2e-37
22gb|AF200185.1|AF200185 Lilium longiflorum profilin 2 mRNA, compl... 155 2e-34
23emb|AJ507459.1|MDO507459 Malus x domestica mRNA for apple allerg... 151 3e-33
24dbj|AK100089.1| Oryza sativa (japonica cultivar-group) cDNA clon... 151 3e-33
25gb|DQ309464.1| Litchi chinensis profilin mRNA, complete cds 149 1e-32
26gb|AC074354.8|AC074354 Genomic Sequence for Oryza sativa, Nippon... 145 2e-31
27dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 145 2e-31
28gb|AF310253.1|AF310253 Oryza sativa profilin A mRNA, complete cds 145 2e-31
29dbj|AK070595.1| Oryza sativa (japonica cultivar-group) cDNA clon... 145 2e-31
30gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 145 2e-31
31ref|NM_195688.1| Oryza sativa (japonica cultivar-group) Profilin... 143 7e-31
32ref|NM_195685.1| Oryza sativa (japonica cultivar-group) Profilin... 143 7e-31
33dbj|AK121412.1| Oryza sativa (japonica cultivar-group) cDNA clon... 143 7e-31
34gb|AF129428.1|AF129428 Malus domestica GD4-5 profilin mRNA, comp... 143 7e-31
35gb|AY109559.1| Zea mays CL2097_1 mRNA sequence 141 3e-30
36emb|Y08390.1|CDY08390 C.dactylon mRNA for profilin 1 133 7e-28
37emb|AJ491881.1|PPE491881 Prunus persica mRNA for profilin, aller... 131 3e-27
38gb|AF129425.1|AF129425 Prunus avium profilin mRNA, complete cds 131 3e-27
39gb|DQ400579.1| Mangifera indica profilin 2 mRNA, complete cds 127 4e-26
40emb|Y08389.1|CDY08389 C.dactylon mRNA for profilin 2 125 2e-25
41emb|AJ507458.1|MDO507458 Malus x domestica mRNA for apple allerg... 123 7e-25
42emb|X73281.1|ZMPRO3MR Z.mays ZmPRO3 mRNA for profilin 3 121 3e-24
43emb|AJ132397.1|HBR132397 Hevea brasiliensis mRNA for hevea brasi... 117 4e-23
44gb|AF377948.1|AF377948 Musa acuminata profilin mRNA, complete cds 117 4e-23
45gb|AF129427.1|AF129427 Malus domestica GD4-2 profilin mRNA, comp... 115 2e-22
46gb|AY792613.1| Malus x domestica clone M4-2-FS8 profilin 2 (Mal ... 113 7e-22
47gb|AY792612.1| Malus x domestica clone M4-2-PM2 profilin 2 (Mal ... 113 7e-22
48gb|AY792611.1| Malus x domestica clone M4-2-FS10 profilin 2 (Mal... 113 7e-22
49gb|AY792610.1| Malus x domestica clone M4-2-PM7 profilin 2 (Mal ... 113 7e-22
50gb|AF119365.1|AF119365 Hevea brasiliensis clone hevb 8.2 latex p... 113 7e-22
51gb|AY081850.1| Prunus dulcis profilin (pru du 4.1) mRNA, complet... 109 1e-20
52gb|DQ335252.1| Cinnamomum camphora profilin-like protein (Cin c ... 109 1e-20
53gb|AF129424.1|AF129424 Pyrus communis profilin mRNA, complete cds 105 2e-19
54gb|AY726606.1| Arachis hypogaea profilin (PROF) mRNA, complete cds 103 6e-19
55gb|AY792617.1| Malus x domestica clone M4-5-FS4 profilin 3 (Mal ... 101 2e-18
56gb|AY792616.1| Malus x domestica clone M4-5-FS5 profilin 3 (Mal ... 101 2e-18
57gb|AY792615.1| Malus x domestica clone M4-5-PM2 profilin 3 (Mal ... 101 2e-18
58gb|AY792614.1| Malus x domestica clone M4-5-PM7 profilin 3 (Mal ... 101 2e-18
59gb|AY550179.1| Elaeis oleifera profilin mRNA, partial cds 100 1e-17
60gb|AF200186.1|AF200186 Lilium longiflorum profilin 3 mRNA, compl... 100 1e-17
61emb|AJ565931.1|CME565931 Cucumis melo mRNA for profilin (cuc m 2... 98 4e-17
62emb|AJ417566.1|PDA417566 Phoenix dactylifera mRNA for profilin (... 98 4e-17
63gb|AY081852.1| Prunus dulcis profilin (pru du 4.2) mRNA, complet... 94 6e-16
64gb|AF119366.1|AF119366 Hevea brasiliensis clone hevb 8.8 latex p... 94 6e-16
65gb|AY109853.1| Zea mays CL2096_2 mRNA sequence 92 2e-15
66emb|Y15042.1|HBY15042 Hevea brasiliensis mRNA for profilin 90 9e-15
67emb|X81982.1|PVPROFILN P.vulgaris mRNA for profilin 90 9e-15
68emb|AJ865015.1| Citrus sinensis mRNA for profilin allergen Cit s... 90 9e-15
69gb|AF200184.1|AF200184 Lilium longiflorum profilin 1 mRNA, compl... 88 4e-14
70emb|AJ870450.1| Fragaria x ananassa microsatellite DNA, locus UF... 88 4e-14
71gb|AY268422.1| Humulus scandens profilin-like protein (LCS13) mR... 86 1e-13
72gb|AY268423.1| Humulus scandens profilin-like protein (LCM20) mR... 86 1e-13
73emb|X93465.1|NTPRO2MR N.tabacum mRNA for profilin (clone NTPRO2) 84 6e-13
74emb|X82120.1|NTPROFLN N.tabacum mRNA for profilin 84 6e-13
75emb|AJ491882.1|PPE491882 Prunus persica mRNA for profilin, aller... 84 6e-13
76gb|AY792609.1| Malus x domestica clone M4.01FS12 profilin 1 (Mal... 82 2e-12
77gb|AY792608.1| Malus x domestica clone M4.01PM9 profilin 1 (Mal ... 82 2e-12
78emb|AJ243325.1|HBR243325 Hevea brasiliensis mRNA for profilin (p... 82 2e-12
79gb|U50195.1|SLU50195 Solanum lycopersicum profilin (LePro1) mRNA... 82 2e-12
80gb|AY792607.1| Malus x domestica clone M4.01FS6 profilin 1 (Mal ... 80 9e-12
81gb|AY792606.1| Malus x domestica clone M4.01PM7 profilin 1 (Mal ... 80 9e-12
82gb|AY792605.1| Malus x domestica clone M4.01FS7 profilin 1 (Mal ... 80 9e-12
83emb|AJ507457.1|MDO507457 Malus x domestica mRNA for apple allerg... 80 9e-12
84dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
85dbj|AP002743.1| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
86ref|NM_127534.2| Arabidopsis thaliana PRF1 (PROFILIN 1); actin b... 76 1e-10
87gb|BT000264.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA,... 76 1e-10
88gb|AY072427.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA,... 76 1e-10
89gb|U43590.1|U43590 Arabidopsis thaliana profilin (PRF1) mRNA, co... 76 1e-10
90gb|U43325.1|ATU43325 Arabidopsis thaliana profilin 1 mRNA, compl... 76 1e-10
91gb|AY268424.1| Humulus scandens profilin-like protein (LCM9) mRN... 74 6e-10
92emb|AJ130969.1|NTA130969 Nicotiana tabacum pronp1 gene, exons 1-3 74 6e-10
93gb|AF119367.1|AF119367 Hevea brasiliensis clone hevb 8.10 latex ... 74 6e-10
94gb|M65179.1|BELPRFLN B.verrucosa profilin (BetvII) mRNA, complet... 74 6e-10
95gb|AF059616.1|AF059616 Arachis hypogaea profilin (Ara h 5) mRNA,... 72 2e-09
96gb|AF129426.1|AF129426 Malus domestica GD4-1 profilin mRNA, comp... 72 2e-09
97ref|NM_119080.2| Arabidopsis thaliana PRF2 (PROFILIN 2); actin b... 70 9e-09
98gb|AY074350.1| Arabidopsis thaliana putative profilin 2 protein ... 70 9e-09
99emb|AJ223982.1|GMPRO1 Glycine max mRNA for profilin, PRO1 70 9e-09
100gb|DQ270547.1| Mangifera indica profilin 1 (Man i 3.01) mRNA, co... 70 9e-09
101gb|U43591.1|U43591 Arabidopsis thaliana profilin (PRF2) mRNA, co... 70 9e-09
102gb|AY900014.1| Petroselinum crispum profilin 3 (PRF3) mRNA, comp... 70 9e-09
103gb|AY082337.1| Chenopodium album pollen allergen Che a 2 mRNA, c... 70 9e-09
104gb|U43326.1|ATU43326 Arabidopsis thaliana profilin 2 mRNA, compl... 70 9e-09
105gb|AY114048.1| Arabidopsis thaliana putative profilin 2 protein ... 68 3e-08
106emb|X73280.1|ZMPRO2MR Z.mays ZmPRO2 mRNA for profilin 2 68 3e-08
107emb|BX818797.1|CNS0A9XS Arabidopsis thaliana Full-length cDNA Co... 68 3e-08
108gb|AY086576.1| Arabidopsis thaliana clone 25886 mRNA, complete s... 66 1e-07
109gb|AF126263.1|AF126263 Phalaenopsis sp. 'KCbutterfly' putative p... 66 1e-07
110gb|AY898658.1| Crocus sativus profilin mRNA, complete cds 66 1e-07
111gb|AY268425.1| Ambrosia artemisiifolia profilin-like protein (A0... 64 5e-07
112gb|AY268426.1| Ambrosia artemisiifolia profilin-like protein (D1... 64 5e-07
113gb|AC149269.11| Medicago truncatula clone mth2-102b19, complete ... 62 2e-06
114emb|AJ223981.1|GMPRO2 Glycine max mRNA for profilin, PRO2 62 2e-06
115gb|AF456482.1| Daucus carota minor allergen Dau c 4 profilin mRN... 62 2e-06
116gb|AF092547.1|AF092547 Ricinus communis profilin (pro1) mRNA, co... 62 2e-06
117gb|AY900012.1| Petroselinum crispum profilin 1 (PRF1) mRNA, comp... 62 2e-06
118emb|Y15209.1|PJPROFIL2 Parietaria judaica mRNA for profilin 2 58 3e-05
119emb|Y13271.1|MAPROFILN Mercurialis annua mRNA for profilin 58 3e-05
120emb|Y12425.1|OEPROFIL1 Olea europaea mRNA for profilin 1 58 3e-05
121emb|AJ421030.1|AVU421030 Artemisia vulgaris mRNA for profilin, i... 56 1e-04
122gb|AF327623.1|AF327623 Corylus avellana clone 7 minor allergen h... 56 1e-04
123gb|AY292385.2| Cucumis melo var. reticulatus profilin (Cu m2) mR... 54 5e-04
124gb|AY292386.3| Cucumis melo var. reticulatus cultivar Mashadi pr... 54 5e-04
125gb|AY292387.3| Cucumis melo var. reticulatus cultivar Mashadi pr... 54 5e-04
126gb|AY271295.2| Cucumis melo var. reticulatus profilin (Cuc m2) m... 54 5e-04
127gb|DQ228336.1| Solanum tuberosum clone 145G03 profilin-like prot... 54 5e-04
128emb|Y15208.1|PJPROFIL1 Parietaria judaica mRNA for profilin 1 54 5e-04
129gb|AF129423.1|AF129423 Apium graveolens profilin mRNA, complete cds 54 5e-04
130gb|AF327622.1|AF327622 Corylus avellana clone 6 minor allergen h... 54 5e-04
131gb|AY900015.1| Petroselinum crispum profilin 4 (PRF4) mRNA, comp... 54 5e-04
132ref|NM_125043.2| Arabidopsis thaliana PRF3 (PROFILIN 3); actin b... 52 0.002
133gb|AY730591.1| Citrullus lanatus profilin mRNA, partial cds 52 0.002
134gb|BT000885.1| Arabidopsis thaliana clone C105361 putative profi... 52 0.002
135gb|AY034989.1| Arabidopsis thaliana putative profilin protein (A... 52 0.002
136emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, ... 52 0.002
137gb|U43592.1|U43592 Arabidopsis thaliana profilin (PRF3) mRNA, co... 52 0.002
138emb|BX833469.1|CNS0A0EA Arabidopsis thaliana Full-length cDNA Co... 52 0.002
139gb|AY084285.1| Arabidopsis thaliana clone 102364 mRNA, complete ... 52 0.002
140dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 52 0.002
141gb|U43323.1|ATU43323 Arabidopsis thaliana profilin 2 and profili... 52 0.002
142gb|AC005169.3| Arabidopsis thaliana chromosome 2 clone F6F22 map... 50 0.008
143gb|U43593.1|U43593 Arabidopsis thaliana profilin (PRF1) gene, co... 50 0.008
144gb|U43322.1|ATU43322 Arabidopsis thaliana profilin 1 gene, compl... 50 0.008
145emb|Y12430.1|OEPROFIL3 Olea europaea mRNA for profilin 3 48 0.032
146gb|AF049936.1|AF049936 Petunia x hybrida PGPS/NH20 (PGPS/NH20) m... 48 0.032
147ref|NM_119079.3| Arabidopsis thaliana PRF4; actin binding AT4G29... 46 0.13
148gb|DQ207877.1| Solanum tuberosum clone 092D10 profilin-like mRNA... 46 0.13
149gb|AY496123.1| Capsicum annuum profilin mRNA, complete cds 46 0.13
150gb|AC093530.2| Homo sapiens chromosome 5 clone RP11-401N6, compl... 46 0.13
151gb|BT024816.1| Arabidopsis thaliana At4g29340 gene, complete cds 46 0.13
152gb|AF414696.1|AF414696 Acanthamoeba castellanii profilin 1B mRNA... 46 0.13
153gb|AC099554.2| Homo sapiens chromosome 5 clone RP11-61G23, compl... 46 0.13
154gb|AY894660.1| Ambrosia artemisiifolia profilin isoallergen 1 mR... 46 0.13
155gb|BT003946.1| Arabidopsis thaliana clone RAFL15-14-D07 (R20752)... 46 0.13
156gb|AY085179.1| Arabidopsis thaliana clone 13601 mRNA, complete s... 46 0.13
157gb|AY900016.1| Petroselinum crispum profilin 5 (PRF5) mRNA, comp... 46 0.13
158gb|AY879597.1| Cucumis melo profilin (m2) mRNA, complete cds and... 46 0.13
159gb|AC142106.4| Mus musculus BAC clone RP24-180L10 from 1, comple... 46 0.13
160ref|NM_187950.1| Oryza sativa (japonica cultivar-group), Ozsa837... 44 0.50
161ref|XM_466029.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.50
162ref|NM_191374.1| Oryza sativa (japonica cultivar-group), predic... 44 0.50
163ref|XM_420896.1| PREDICTED: Gallus gallus nuclear protein NP220 ... 44 0.50
164gb|AY499654.1| Capsicum annuum profilin mRNA, partial cds 44 0.50
165ref|XM_862186.1| PREDICTED: Canis familiaris similar to LIM doma... 44 0.50
166ref|XM_537086.2| PREDICTED: Canis familiaris similar to LIM doma... 44 0.50
167gb|AC101882.14| Mus musculus chromosome 10, clone RP23-394M6, co... 44 0.50
168emb|AJ417553.1|LES417553 Lycopersicon esculentum mRNA for profil... 44 0.50
169emb|AL773519.5| Mouse DNA sequence from clone RP23-42C15 on chro... 44 0.50
170gb|AC136191.5| Rattus norvegicus BAC CH230-52I17 (Children's Ho... 44 0.50
171dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
172dbj|AP003239.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
173gb|U43594.1|U43594 Arabidopsis thaliana profilin (PRF4) gene, co... 44 0.50
174dbj|AP002817.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
175gb|AC155286.8| Mus musculus 10 BAC RP23-213N17 (Roswell Park Can... 44 0.50
176dbj|AP004758.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
177dbj|AP004772.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
178dbj|AK108944.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.50
179gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome... 42 2.0
180gb|AC144926.6| Mus musculus chromosome 8, clone RP23-8E24, compl... 42 2.0
181ref|NM_187849.1| Oryza sativa (japonica cultivar-group), Ozsa829... 42 2.0
182gb|AC161528.14| Mus musculus chromosome 8, clone RP23-369H18, co... 42 2.0
183gb|AY652590.1| Oryza sativa (japonica cultivar-group) cell death... 42 2.0
184gb|AY652589.1| Oryza sativa (japonica cultivar-group) cell death... 42 2.0
185gb|AY657883.1| Synthetic construct Peudomonas aeruginosa clone F... 42 2.0
186gb|AC125028.8| Mus musculus chromosome 16, clone RP24-85G10, com... 42 2.0
187gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 42 2.0
188gb|AF254983.3| Homo sapiens chromosome 21 clone RP11-589M2 map p... 42 2.0
189gb|AC113110.17| Mus musculus chromosome 16, clone RP23-328A9, co... 42 2.0
190gb|AC125056.3| Mus musculus BAC clone RP23-398G2 from chromosome... 42 2.0
191gb|AC163618.4| Mus musculus BAC clone RP24-158G13 from chromosom... 42 2.0
192emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 42 2.0
193emb|AL939125.1|SCO939125 Streptomyces coelicolor A3(2) complete ... 42 2.0
194emb|AL163201.2|HS21C001 Homo sapiens chromosome 21 segment HS21C001 42 2.0
195emb|CR354591.13| Zebrafish DNA sequence from clone DKEY-18L4 in ... 42 2.0
196gb|AC069366.8| Homo sapiens chromosome 17, clone RP11-720N19, co... 42 2.0
197gb|AC091682.26| Mus musculus strain C57BL/6J chromosome 3 clone ... 42 2.0
198gb|AC154913.4| Ornithorhynchus anatinus BAC clone OABb-535A1 fro... 42 2.0
199dbj|AK133754.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 42 2.0
200ref|XM_688822.1| PREDICTED: Danio rerio similar to RING finger p... 42 2.0
201gb|AC158222.6| Mus musculus chromosome 8, clone RP23-117M15, com... 42 2.0
202gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 42 2.0
203gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome 42 2.0
204gb|AF352180.1|AF352180 Mus musculus pericentriolar material gene... 42 2.0
205dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
206gb|AC004596.2| Homo sapiens chromosome 17, clone CTB-175E5, comp... 42 2.0
207gb|AC102022.8| Mus musculus chromosome 8, clone RP24-67K5, compl... 42 2.0
208gb|AC010686.9| Homo sapiens BAC clone RP11-504L12 from 2, comple... 42 2.0
209gb|AE004477.1| Pseudomonas aeruginosa PAO1, section 38 of 529 of... 42 2.0
210dbj|AP001278.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
211gb|AC098718.5| Mus musculus BAC clone RP23-2K11 from chromosome ... 42 2.0
212emb|BX897672.1| Neurospora crassa DNA linkage group III BAC clon... 42 2.0
213emb|AL929009.5| Zebrafish DNA sequence from clone CH211-202A8 in... 42 2.0
214gb|AY900013.1| Petroselinum crispum profilin 2 (PRF2) mRNA, comp... 42 2.0
215gb|AF148692.1|AF148692 Pseudomonas aeruginosa pyrimidine regulat... 42 2.0
216emb|AJ308589.1|HSA308589 Homo sapiens partial UBTF for upstream ... 42 2.0
217gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 42 2.0
218gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 42 2.0
219emb|AL845346.4|CNS08CB8 Oryza sativa chromosome 12, . BAC OSJNBa... 42 2.0
220emb|AL954730.15| Mouse DNA sequence from clone RP23-461C4 on chr... 42 2.0
221emb|CT030251.8| Mouse DNA sequence from clone RP24-284K11 on chr... 42 2.0
222ref|NM_023662.1| Mus musculus pericentriolar material 1 (Pcm1), ... 42 2.0
223emb|AL670114.17| Mouse DNA sequence from clone RP23-7C19 on chro... 42 2.0
224emb|CT010571.7| Mouse DNA sequence from clone RP23-300L8 on chro... 42 2.0
225gb|U14937.1|RNU14937 Rattus norvegicus S-adenosyl-L-homocysteine... 42 2.0
226emb|AL844149.4| Mouse DNA sequence from clone RP23-194D5 on chro... 42 2.0
227dbj|AB029291.1| Mus musculus pcm-1 mRNA for pericentriolar mater... 42 2.0
228emb|AL671877.15| Mouse DNA sequence from clone RP23-214E3 on chr... 42 2.0
229emb|AL359399.3|CNS05TEV Human chromosome 14 DNA sequence BAC C-2... 42 2.0
230gb|AC102324.9| Mus musculus chromosome 1, clone RP24-476A18, com... 40 7.8
231gb|AC116384.9| Mus musculus chromosome 3, clone RP23-20L19, comp... 40 7.8
232gb|AC171406.3| Mus musculus BAC RP24-475O6 (Roswell Park Cancer... 40 7.8
233gb|AC131995.14| Mus musculus chromosome 1, clone RP24-338G10, co... 40 7.8
234gb|AC108413.4| Mus musculus chromosome 8, clone RP23-472M11, com... 40 7.8
235gb|AC152944.2| Mus musculus 10 BAC RP23-427I4 (Roswell Park Canc... 40 7.8
236gb|AC164079.11| Mus musculus chromosome 1, clone RP23-15E12, com... 40 7.8
237gb|AC169036.3| Mus musculus BAC clone RP23-382O15 from chromosom... 40 7.8
238gb|AC116671.14| Mus musculus chromosome 3, clone RP23-111L16, co... 40 7.8
239gb|AC151958.2| Homo sapiens chromosome X clone RP11-76K17 map q2... 40 7.8
240ref|XM_466698.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.8
241ref|XM_466344.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.8
242ref|NM_006769.2| Homo sapiens LIM domain only 4 (LMO4), mRNA 40 7.8
243gb|AC166985.4| Mus musculus chromosome 1, clone RP23-14I20, comp... 40 7.8
244gb|AC166986.4| Mus musculus chromosome 1, clone RP24-184H22, com... 40 7.8
245gb|AC164075.4| Mus musculus chromosome 7, clone RP24-259P13, com... 40 7.8
246gb|AC152006.1| Homo sapiens chromosome X clone RP11-76K17 map q2... 40 7.8
247gb|AC123645.7| Mus musculus chromosome 15, clone RP23-99N19, com... 40 7.8
248gb|AY591643.1| Mus musculus clone IgK24-113 immunoglobulin kappa... 40 7.8
249gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome... 40 7.8
250gb|AC166331.5| Mus musculus chromosome 3, clone RP23-277D9, comp... 40 7.8
251gb|AC121144.11| Mus musculus chromosome 3, clone RP24-202D19, co... 40 7.8
252gb|BC028996.1| Mus musculus RAB3 GTPase activating protein subun... 40 7.8
253gb|AC128597.3| Rattus norvegicus BAC CH230-62C6 (Children's Hos... 40 7.8
254gb|BC046297.1| Mus musculus RAB3 GTPase activating protein subun... 40 7.8
255gb|BC038485.1| Mus musculus RAB3 GTPase activating protein subun... 40 7.8
256gb|AC135421.3| Oryza sativa (japonica cultivar-group) chromosome... 40 7.8
257gb|AC125688.6| Rattus norvegicus 20 BAC CH230-186I2 (Children's ... 40 7.8
258gb|AC113332.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.8
259gb|AC115878.12| Mus musculus chromosome 15, clone RP24-358G9, co... 40 7.8
260ref|XM_417128.1| PREDICTED: Gallus gallus similar to Wiskott-Ald... 40 7.8
261ref|XM_324065.1| Neurospora crassa OR74A predicted protein (NCU0... 40 7.8
262gb|AC108835.8| Mus musculus chromosome 6, clone RP23-274E24, com... 40 7.8
263gb|AC113158.3| Mus musculus BAC clone RP23-101D11 from chromosom... 40 7.8
264gb|AC119382.7| Rattus norvegicus 4 BAC CH230-125G2 (Children's H... 40 7.8
265ref|XM_951877.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.8
266ref|XM_955147.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.8
267gb|AC113957.8| Mus musculus chromosome 15, clone RP23-452M1, com... 40 7.8
268ref|XM_327959.1| Neurospora crassa OR74A hypothetical protein (N... 40 7.8
269gb|AC130605.3| Oryza sativa (japonica cultivar-group) chromosome... 40 7.8
270gb|AC109232.17| Mus musculus chromosome 7, clone RP23-423P21, co... 40 7.8
271gb|AC068501.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 7.8
272ref|NM_153587.1| Mus musculus ribosomal protein S6 kinase, polyp... 40 7.8
273gb|AC125105.3| Mus musculus BAC clone RP24-220B7 from chromosome... 40 7.8
274gb|BC015621.2| Homo sapiens chromosome 14 open reading frame 32,... 40 7.8
275gb|AC110387.6| Rattus norvegicus 1 BAC CH230-209H8 (Children's H... 40 7.8
276gb|AC128571.4| Rattus norvegicus 6 BAC CH230-424O13 (Children's ... 40 7.8
277gb|AC166349.4| Mus musculus BAC clone RP24-192I21 from chromosom... 40 7.8
278gb|AC156556.8| Mus musculus chromosome 7, clone RP23-92E8, compl... 40 7.8
279gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 7.8
280gb|AC158589.7| Mus musculus chromosome 5, clone RP24-388A6, comp... 40 7.8
281gb|AC164306.3| Mus musculus BAC clone RP23-190A21 from chromosom... 40 7.8
282gb|AC163690.4| Mus musculus BAC clone RP23-470F9 from chromosome... 40 7.8
283gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ... 40 7.8
284gb|AC154768.2| Mus musculus BAC clone RP24-444E21 from chromosom... 40 7.8
285gb|AC112942.11| Mus musculus chromosome 7, clone RP23-449N21, co... 40 7.8
286gb|BC038372.1| Mus musculus ribosomal protein S6 kinase, polypep... 40 7.8
287gb|AC121604.3| Mus musculus BAC clone RP23-312E2 from chromosome... 40 7.8
288gb|AC007237.3| Homo sapiens PAC clone RP5-911M23 from 7, complet... 40 7.8
289gb|AC102352.9| Mus musculus chromosome 14, clone RP23-30H7, comp... 40 7.8
290gb|AC110563.4| Mus musculus chromosome 3, clone RP23-287O4, comp... 40 7.8
291ref|NM_144578.3| Homo sapiens chromosome 14 open reading frame 3... 40 7.8
292ref|XM_569216.1| Cryptococcus neoformans var. neoformans JEC21 h... 40 7.8
293ref|XM_798738.1| Trypanosoma cruzi strain CL Brener delta tubuli... 40 7.8
294gb|AC137511.3| Mus musculus BAC clone RP24-313I8 from chromosome... 40 7.8
295gb|AC122015.3| Mus musculus BAC clone RP24-358M18 from chromosom... 40 7.8
296gb|AC132392.3| Mus musculus BAC clone RP23-386F15 from chromosom... 40 7.8
297gb|AC132386.3| Mus musculus BAC clone RP23-438O22 from chromosom... 40 7.8
298gb|AC118020.11| Mus musculus, clone RP23-459B19, complete sequence 40 7.8
299gb|AC131773.3| Mus musculus BAC clone RP24-308A19 from chromosom... 40 7.8
300gb|AC124369.4| Mus musculus BAC clone RP24-549O12 from chromosom... 40 7.8
301gb|AC122322.4| Mus musculus BAC clone RP23-321G20 from chromosom... 40 7.8
302gb|AC123921.3| Mus musculus BAC clone RP24-180J14 from chromosom... 40 7.8
303gb|AC121919.3| Mus musculus BAC clone RP24-195I15 from chromosom... 40 7.8
304gb|AC122913.4| Mus musculus BAC clone RP23-25J21 from 3, complet... 40 7.8
305gb|AC125245.4| Homo sapiens BAC clone RP11-236P13 from 4, comple... 40 7.8
306gb|AC123957.4| Mus musculus BAC clone RP23-302N2 from 12, comple... 40 7.8
307ref|NM_178690.2| Mus musculus RAB3 GTPase activating protein sub... 40 7.8
308gb|AC122023.3| Mus musculus BAC clone RP24-372O13 from 12, compl... 40 7.8
309gb|AC117211.3| Mus musculus BAC clone RP23-287M3 from 3, complet... 40 7.8
310gb|AC113249.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.8
311gb|AC084438.5| Homo sapiens BAC clone RP11-89D15 from 7, complet... 40 7.8
312gb|AC004936.2| Homo sapiens PAC clone RP5-959C21 from 7, complet... 40 7.8
313gb|AC004892.2| Homo sapiens PAC clone RP4-802A9 from 7, complete... 40 7.8
314gb|AC116748.8| Mus musculus chromosome 9, clone RP23-80L8, compl... 40 7.8
315gb|AC116468.13| Mus musculus chromosome 16, clone RP23-166G21, c... 40 7.8
316gb|AC165355.3| Mus musculus BAC clone RP23-129P10 from chromosom... 40 7.8
317gb|AC147635.4| Mus musculus BAC clone RP23-290C4 from chromosome... 40 7.8
318gb|AC163225.4| Mus musculus chromosome 8, clone RP23-319L22, com... 40 7.8
319gb|AC162802.4| Mus musculus BAC clone RP23-363M4 from chromosome... 40 7.8
320gb|AC137267.2| Genomic sequence for Oryza sativa, Nipponbare str... 40 7.8
321gb|AY341881.1| Mus musculus ribosomal protein S6 kinase splice v... 40 7.8
322gb|AY341873.1| Mus musculus ribosomal protein S6 kinase splice v... 40 7.8
323emb|AL672311.26| Human DNA sequence from clone RP13-167H21 on ch... 40 7.8
324emb|AL683807.22| Human DNA sequence from clone RP13-297E16 on ch... 40 7.8
325gb|DQ450945.1| Streptomyces sp. 98-62 polyketide synthase I prot... 40 7.8
326ref|XM_776294.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 7.8
327emb|AL442065.11| Human DNA sequence from clone RP11-541M23 on ch... 40 7.8
328gb|AC090122.26| Mus musculus strain C57BL/6J clone rp23-28a7 map... 40 7.8
329emb|AL357143.13| Human DNA sequence from clone RP11-71G12 on chr... 40 7.8
330emb|AL354776.15| Human DNA sequence from clone RP11-196N14 on ch... 40 7.8
331emb|AL159171.15| Human DNA sequence from clone RP11-280G19 on ch... 40 7.8
332ref|XM_795695.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 40 7.8
333gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 ma... 40 7.8
334emb|Y12429.1|OEPROFIL2 Olea europaea mRNA for profilin 2 40 7.8
335gb|AC127357.5| Mus musculus BAC clone RP23-103P11 from chromosom... 40 7.8
336emb|AL662806.20| Mouse DNA sequence from clone RP23-273O7 on chr... 40 7.8
337gb|AC161928.4| Mus musculus chromosome 1, clone RP23-293P15, com... 40 7.8
338gb|DQ445258.1| Chlamydomonas reinhardtii 2-succinyl-6-hydroxy-2,... 40 7.8
339emb|AL670003.1|NCB9G16 Neurospora crassa DNA linkage group II BA... 40 7.8
340emb|AL355932.1|NCB5O22 Neurospora crassa DNA linkage group II BA... 40 7.8
341gb|BC035298.1| Mus musculus ribosomal protein S6 kinase, polypep... 40 7.8
342gb|AC157542.11| Mus musculus chromosome 1, clone RP23-115I1, com... 40 7.8
343gb|AC140778.15| Mus musculus chromosome 1, clone RP24-446J17, co... 40 7.8
344gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 7.8
345gb|AC125165.5| Mus musculus BAC clone RP24-429K13 from chromosom... 40 7.8
346emb|CR860677.1| Pongo pygmaeus mRNA; cDNA DKFZp459K0915 (from cl... 40 7.8
347gb|AC161880.5| Mus musculus BAC clone RP23-261N13 from chromosom... 40 7.8
348gb|AC139528.16| Botryllus schlosseri clone subsf-555i12, complet... 40 7.8
349gb|AC138022.14| Botryllus schlosseri clone subsf-533i14, complet... 40 7.8
350gb|AC097633.2| Homo sapiens chromosome 3 clone RP11-96F15, compl... 40 7.8
351gb|AC124043.2| Homo sapiens chromosome 3 clone RP11-143A18, comp... 40 7.8
352gb|AC151617.2| Emiliania huxleyi clone JGIACCU-13M3, complete se... 40 7.8
353emb|AL844605.5| Mouse DNA sequence from clone RP24-115D19 on chr... 40 7.8
354emb|AL834316.1|HSM805358 Homo sapiens mRNA; cDNA DKFZp434G1729 (... 40 7.8
355emb|AL834285.1|HSM805320 Homo sapiens mRNA; cDNA DKFZp566M173 (f... 40 7.8
356dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 40 7.8
357dbj|AK128284.1| Homo sapiens cDNA FLJ46422 fis, clone THYMU3013241 40 7.8
358dbj|AK127979.1| Homo sapiens cDNA FLJ46094 fis, clone TESTI2018687 40 7.8
359emb|CR610161.1| full-length cDNA clone CS0DG001YM24 of B cells (... 40 7.8
360emb|CR605386.1| full-length cDNA clone CS0DI037YD14 of Placenta ... 40 7.8
361emb|CR595805.1| full-length cDNA clone CS0DF005YM18 of Fetal bra... 40 7.8
362gb|AC080145.8| Homo sapiens chromosome 15, clone CTD-2298D17, co... 40 7.8
363gb|AC027004.15| Homo sapiens chromosome 15, clone RP11-143C19, c... 40 7.8
364dbj|AB158486.1| Sus scrofa PPP1R11, ZNRD1, RNF39, GABBR1, MOG, U... 40 7.8
365gb|AC026758.8| Oryza sativa chromosome 10 BAC OSJNBa0015J15 geno... 40 7.8
366gb|AC091997.3| Homo sapiens chromosome 5 clone RP11-96K8, comple... 40 7.8
367dbj|AK134604.1| Mus musculus adult male medulla oblongata cDNA, ... 40 7.8
368gb|AC068944.5| Homo sapiens BAC clone RP11-769N22 from 4, comple... 40 7.8
369gb|AC009287.17| Mus musculus strain 129S6/SvEvTac chromosome 10 ... 40 7.8
370gb|AC159633.2| Mus musculus BAC clone RP24-159L15 from chromosom... 40 7.8
371dbj|AK164523.1| Mus musculus 13 days embryo heart cDNA, RIKEN fu... 40 7.8
372ref|XM_938028.1| PREDICTED: Homo sapiens chromosome 19 open read... 40 7.8
373ref|XM_371195.4| PREDICTED: Homo sapiens chromosome 19 open read... 40 7.8
374gb|AC092392.2| Homo sapiens chromosome 1 clone RP4-544H6, comple... 40 7.8
375gb|AC026427.4| Homo sapiens chromosome 5 clone CTD-2193P3, compl... 40 7.8
376dbj|AK160758.1| Mus musculus 13 days embryo head cDNA, RIKEN ful... 40 7.8
377dbj|AK170768.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 7.8
378dbj|AB168623.1| Macaca fascicularis testis cDNA clone: QtsA-1356... 40 7.8
379gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 7.8
380emb|CR387188.1| Gallus gallus finished cDNA, clone ChEST782n12 40 7.8
381dbj|AK032316.1| Mus musculus adult male olfactory brain cDNA, RI... 40 7.8
382dbj|AK080432.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 40 7.8
383dbj|AK076244.1| Mus musculus 0 day neonate skin cDNA, RIKEN full... 40 7.8
384dbj|AK076399.1| Mus musculus 10 days neonate skin cDNA, RIKEN fu... 40 7.8
385tpg|BK001240.1| TPA: TPA_exp: Homo sapiens growth arrest-specifi... 40 7.8
386gb|AC148701.1| Macaca mulatta Major Histocompatibility Complex B... 40 7.8
387gb|AC148681.1| Macaca mulatta Major Histocompatibility Complex M... 40 7.8
388dbj|AK030051.1| Mus musculus adult male testis cDNA, RIKEN full-... 40 7.8
389gb|AC158609.10| Mus musculus 6 BAC RP24-89F5 (Roswell Park Cance... 40 7.8
390gb|AC160000.9| Mus musculus 6 BAC RP24-340J19 (Roswell Park Canc... 40 7.8
391gb|AC153870.8| Mus musculus 10 BAC RP23-473J14 (Roswell Park Can... 40 7.8
392dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
393dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
394dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
395dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
396dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
397dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
398dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 40 7.8
399gb|AC155831.7| Mus musculus 10 BAC RP24-189B10 (Roswell Park Can... 40 7.8
400gb|AC153525.12| Mus musculus 10 BAC RP23-440I21 (Roswell Park Ca... 40 7.8
401gb|AC151581.2| Pan troglodytes BAC clone RP43-166C19 from chromo... 40 7.8
402gb|AC146064.4| Pan troglodytes BAC clone RP43-59B14 from chromos... 40 7.8
403dbj|AK172881.1| Mus musculus mRNA for mKIAA0066 protein 40 7.8
404gb|AF490843.1| Homo sapiens clone PAC 70L19, HOXC gene cluster 40 7.8
405gb|AC012531.11|AC012531 Homo sapiens, clone RP11-83K1, complete ... 40 7.8
406gb|AC100865.5| Homo sapiens chromosome 11, clone RP11-449L13, co... 40 7.8
407gb|AC105186.14| Homo sapiens chromosome 8, clone CTD-2323A1, com... 40 7.8
408gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, com... 40 7.8
409ref|XM_234468.3| PREDICTED: Rattus norvegicus ribosomal protein ... 40 7.8
410dbj|AP005882.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
411gb|AC027318.5| Homo sapiens chromosome 5 clone CTC-347K15, compl... 40 7.8
412gb|AC137674.2| Homo sapiens chromosome 3 clone RP11-348I13, comp... 40 7.8
413gb|AC090652.32| Mus musculus strain C57BL/6J chromosome 7 clone ... 40 7.8
414gb|AC112643.12| Homo sapiens 3 BAC RP11-328G15 (Roswell Park Can... 40 7.8
415gb|AC167467.1| Mus musculus BAC clone RP23-158E17 from chromosom... 40 7.8
416gb|AC171014.3| Gallus gallus BAC clone CH261-89A18 from chromoso... 40 7.8
417gb|AC132145.3| Mus musculus BAC clone RP23-44H21 from chromosome... 40 7.8
418dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome 40 7.8
419dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 40 7.8
420gb|AC008518.3|AC008518 Homo sapiens chromosome 5 clone CTC-459I6... 40 7.8
421dbj|AP003225.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
422dbj|AP003613.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
423dbj|AP005286.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
424dbj|AP005835.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
425dbj|AP005114.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
426emb|AL731729.10| Mouse DNA sequence from clone RP23-92L12 on chr... 40 7.8
427gb|AC102898.15| Mus musculus chromosome 7, clone RP24-321O23, co... 40 7.8
428dbj|AP005483.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
429dbj|AK025580.1| Homo sapiens cDNA: FLJ21927 fis, clone HEP04178,... 40 7.8
430ref|XM_318419.2| Anopheles gambiae str. PEST ENSANGP00000002762 ... 40 7.8
431gb|U24576.1|U24576 Homo sapiens breast tumor autoantigen (LMO4) ... 40 7.8
432gb|AC107650.19| Mus musculus chromosome 6, clone RP23-133I9, com... 40 7.8
433gb|AC154862.2| Mus musculus BAC clone RP23-8G7 from 13, complete... 40 7.8
434gb|AC004825.2|AC004825 Homo sapiens PAC clone RP1-292L20 from 14... 40 7.8
435ref|NM_211926.1| Eremothecium gossypii AGR198Cp (AGR198C), mRNA 40 7.8
436dbj|AK066756.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.8
437gb|AC131101.3| Mus musculus BAC clone RP23-60O18 from 6, complet... 40 7.8
438emb|BX248326.14| Zebrafish DNA sequence from clone DKEY-260N20 i... 40 7.8
439gb|AC140071.4| Mus musculus BAC clone RP23-394K8 from 3, complet... 40 7.8
440gb|AC125319.5| Mus musculus BAC clone RP23-472L3 from 5, complet... 40 7.8
441gb|AC124119.7| Mus musculus chromosome 12, clone RP23-220M9, com... 40 7.8
442gb|AC144461.33| Mus musculus strain C57BL/6J clone rp23-427m23, ... 40 7.8
443gb|AC153369.4| Mus musculus 10 BAC RP23-103E4 (Roswell Park Canc... 40 7.8
444gb|AC133209.4| Mus musculus BAC clone RP23-21E5 from chromosome ... 40 7.8
445gb|AC153877.5| Mus musculus 6 BAC RP23-258E21 (Roswell Park Canc... 40 7.8
446gb|AC154011.3| Mus musculus 6 BAC RP24-261O15 (Roswell Park Canc... 40 7.8
447emb|AL358293.4|CNS05TE0 Human chromosome 14 DNA sequence BAC R-3... 40 7.8
448emb|AL139316.5|CNS01DXH Human chromosome 14 DNA sequence BAC R-6... 40 7.8
449gb|AC099713.5| Mus musculus chromosome 15, clone RP23-447B6, com... 40 7.8
450gb|AC113964.18| Mus musculus chromosome 16, clone RP23-31O16, co... 40 7.8
451gb|AC123705.12| Mus musculus chromosome 12, clone RP23-355K21, c... 40 7.8
452gb|AC123682.13| Mus musculus chromosome 15, clone RP23-288J22, c... 40 7.8
453gb|AC118684.9| Mus musculus chromosome 17, clone RP23-414B17, co... 40 7.8
454gb|AC106833.10| Mus musculus chromosome 19, clone RP24-503K22, c... 40 7.8
455gb|AC102657.13| Mus musculus chromosome 10, clone RP23-15N10, co... 40 7.8
456gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 40 7.8
457dbj|AP003900.1| Homo sapiens genomic DNA, chromosome 21q, clone:... 40 7.8
458emb|BX284111.7| Mouse DNA sequence from clone RP23-217B8 on chro... 40 7.8
459emb|AJ535043.1|OSA535043 Oryza sativa (japonica cultivar-group) ... 40 7.8
460gb|AC153484.4| Mus musculus 10 BAC RP23-388B8 (Roswell Park Canc... 40 7.8
461gb|DQ196109.1| Chlamydomonas reinhardtii pherophorin-C3 protein ... 40 7.8
462gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 7.8
463emb|AL845297.15| Mouse DNA sequence from clone RP23-207P16 on ch... 40 7.8
464emb|AL731590.4|OSJN00233 Oryza sativa genomic DNA, chromosome 4,... 40 7.8
465emb|AL935072.4|CNS08CCO Oryza sativa chromosome 12, . BAC OSJNBa... 40 7.8
466emb|AL935070.3|CNS08CCM Oryza sativa chromosome 12, . BAC OSJNBa... 40 7.8
467emb|BX072579.14| Human DNA sequence from clone RP11-199F6 on chr... 40 7.8
468emb|AL607002.3|OSJN00117 Oryza sativa genomic DNA, chromosome 4,... 40 7.8
469emb|AL713946.3|CNS07YPP Oryza sativa chromosome 12, . BAC OJ1005... 40 7.8
470gb|AC140374.3| Mus musculus BAC clone RP24-76K4 from 6, complete... 40 7.8
471gb|AC155254.1| Mus musculus BAC clone RP24-174G4 from 16, comple... 40 7.8
472gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 7.8
473gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, comple... 40 7.8
474gb|AC122504.4| Mus musculus BAC clone RP24-419J13 from 9, comple... 40 7.8
475gb|AC004231.1|AC004231 Homo sapiens chromosome 17, clone hRPC.11... 40 7.8
476gb|AC114921.5| Mus musculus BAC clone RP23-202P9 from 6, complet... 40 7.8
477gb|AC138721.4| Mus musculus BAC clone RP23-157G22 from 6, comple... 40 7.8
478gb|AC140217.3| Mus musculus BAC clone RP23-279O5 from 8, complet... 40 7.8
479gb|AC131184.4| Mus musculus BAC clone RP23-347G20 from 3, comple... 40 7.8
480gb|AC134907.5| Mus musculus BAC clone RP23-362K17 from 8, comple... 40 7.8
481gb|AC140299.2| Mus musculus BAC clone RP23-363J15 from 10, compl... 40 7.8
482gb|AC125066.5| Mus musculus BAC clone RP23-430N17 from 16, compl... 40 7.8
483gb|AC128704.4| Mus musculus BAC clone RP23-436H14 from 3, comple... 40 7.8
484emb|CT030247.6| Mouse DNA sequence from clone RP23-340G24 on chr... 40 7.8
485gb|AC113035.21| Mus musculus chromosome 8, clone RP23-222J21, co... 40 7.8
486gb|AC161214.4| Mus musculus chromosome 8, clone RP23-78A10, comp... 40 7.8
487emb|AL732311.13| Mouse DNA sequence from clone RP23-125H15 on ch... 40 7.8
488emb|AL590429.9| Mouse DNA sequence from clone RP23-462O16 on chr... 40 7.8
489emb|AL845161.5| Mouse DNA sequence from clone RP23-214I20 on chr... 40 7.8
490emb|AL929473.7| Mouse DNA sequence from clone RP23-143P21 on chr... 40 7.8
491emb|AL591884.11| Mouse DNA sequence from clone RP23-183N8 on chr... 40 7.8
492emb|AL732564.12| Mouse DNA sequence from clone RP23-442G9 on chr... 40 7.8
493emb|AL731810.20| Mouse DNA sequence from clone RP23-465B20 on ch... 40 7.8
494emb|AL671914.9| Mouse DNA sequence from clone RP23-1A3 on chromo... 40 7.8
495emb|X15209.1|OCRYAN O.cuniculus mRNA for skeletal muscle ryanodi... 40 7.8
496emb|X15750.1|OCRRR Rabbit skeletal muscle mRNA for ryanodine rec... 40 7.8
497gb|M80412.1|MUSIGKVAF Mouse Ig germline kappa-chain V region (Vk... 40 7.8
498gb|AC009994.10| Homo sapiens chromosome 17, clone RP11-87N3, com... 40 7.8
499gb|L27486.1|ACAPROFIIA Acanthamoeba castellanii profilin II gene... 40 7.8
500gb|L27485.1|ACAPROFIA Acanthamoeba castellanii profilin I gene, ... 40 7.8

>gb|U49505.1|HVU49505 Hordeum vulgare profilin (Hvpro1) mRNA, complete cds
          Length = 780

 Score =  983 bits (496), Expect = 0.0
 Identities = 543/557 (97%), Gaps = 2/557 (0%)
 Strand = Plus / Plus

                                                                       
Query: 21  catccccagccgan-accgcgtgcgctccacgcagccganagtagtcgtcgccggnanaa 79
           |||||||||||||  |||||||||||||||||||||||| ||||||||||||||| | ||
Sbjct: 2   catccccagccgagcaccgcgtgcgctccacgcagccgagagtagtcgtcgccgg-agaa 60

                                                                       
Query: 80  gggggaggaggaggagcgggaggcgaccgaggatgtcgtggcagacgtacgtcgacgacc 139
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  gggggaggaggaggagcgggaggcgaccgaggatgtcgtggcagacgtacgtcgacgacc 120

                                                                       
Query: 140 acctgtgctgcgagatcgacggccagcacctcacctccgccgccatcctcggccacgacg 199
           |||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||
Sbjct: 121 acctgtgctgcgagatcgacgggcagcacctcacctccgccgccatcctcggtcacgacg 180

                                                                       
Query: 200 gcagcgtctgggcccagtcccccaacttcccccagttcaagcctgaggagattgctggca 259
           | || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 ggagagtctgggtccagtcccccaacttcccccagttcaagcctgaggagattgctggca 240

                                                                       
Query: 260 tcattaaggactttgacgaacccggacatcttgcaccaactggtcttttccttggaggca 319
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 tcattaaggactttgacgaacccggacatcttgcaccaactggtcttttccttggaggca 300

                                                                       
Query: 320 caaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccg 379
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 caaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccg 360

                                                                       
Query: 380 gtggcattactatcaagaagacgggcatggccctgattcttggtatctacgatgagccca 439
           ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||
Sbjct: 361 gtggcattactatcaagaagacgggcatgcccctgattctcggtatctacgatgagccca 420

                                                                       
Query: 440 tgactcctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcagg 499
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421 tgactcctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcagg 480

                                                                       
Query: 500 gtttctaagcccaccctgatatgttgttattttggtcgtctgggactaagtttgctcctg 559
           |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 481 gtttctaagcctcccctgatatgttgttattttggtcgtctgggactaagtttgctcctg 540

                            
Query: 560 tgggctttgcatctatc 576
           |||||||||||||||||
Sbjct: 541 tgggctttgcatctatc 557



to top

>emb|X89826.1|TAPRO2GEN T.aestivum mRNA for profilin (clone TaPRO2)
          Length = 492

 Score =  636 bits (321), Expect = e-179
 Identities = 363/377 (96%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| | || |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 51  atgtcgtggcaggcatatgtcgacgaccacctgtgctgcgagatcgacggtcagcacctc 110

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 111 acctccgccgccatcctcggccacgacggcagcgtctgggccgagtcccccaacttcccc 170

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
            ||||||||||||||||||||||||||||| |||| |||||||| ||||| ||||| |||
Sbjct: 171 aagttcaagcctgaggagattgctggcatcgttaaagactttgaagaacctggacacctt 230

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 231 gcaccaactggtcttttccttggaggcacaaagtacatggtcatccaaggtgaacctggg 290

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 291 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagaccggcatggcc 350

                                                                       
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 471
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 351 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 410

                            
Query: 472 aggcttggcgactacct 488
           ||||| |||||||||||
Sbjct: 411 aggctcggcgactacct 427



to top

>emb|X89825.1|TAPRO1GEN T.aestivum mRNA for profilin (clone TaPRO1)
          Length = 454

 Score =  636 bits (321), Expect = e-179
 Identities = 363/377 (96%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 42  atgtcgtggcagacatatgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 101

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||
Sbjct: 102 acctccgccgccatcctcggccacgacggcagcgtctggaccgagtcccccaacttcccc 161

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
            ||||||||||||||||||||||||||||| |||| |||||||| ||||| ||||| |||
Sbjct: 162 aagttcaagcctgaggagattgctggcatcgttaaagactttgaagaacctggacacctt 221

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 222 gcaccaactggtcttttccttggaggcacaaagtacatggtcatccaaggtgaacctggg 281

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 282 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagaccggcatggcc 341

                                                                       
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 471
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 342 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 401

                            
Query: 472 aggcttggcgactacct 488
           ||||| ||||| |||||
Sbjct: 402 aggctcggcgattacct 418



to top

>emb|X89827.1|TAPRO3GEN T.aestivum mRNA for profilin (clone TaPRO3)
          Length = 489

 Score =  617 bits (311), Expect = e-173
 Identities = 371/391 (94%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           ||||||||| || |||||||||||||||||||||| |||||||||||||||||| |||||
Sbjct: 51  atgtcgtggaaggcgtacgtcgacgaccacctgtgttgcgagatcgacggccagaacctc 110

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 111 acctccgccgccatcctcggccacgacggcagcgtctgggcgcagtcccccaacttcccc 170

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           ||||||||||| ||||||| |||||||||| |||| |||||||| ||||| ||||| |||
Sbjct: 171 cagttcaagcccgaggagaatgctggcatcgttaaagactttgaagaacctggacacctt 230

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 231 gcaccaactggtcttttccttggaggcacaaagtacatggtcatccaaggtgaacctggg 290

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 291 gttgtcatccgaggaaagaagggcaccggtggcatcactatcaagaagaccggcatggcc 350

                                                                       
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 471
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 351 ctgattcttggtatctacgatgaacccatgactcctggccagtgcaatttggtcgtggag 410

                                          
Query: 472 aggcttggcgactacctggtcgagcagggtt 502
           ||||| ||||| |||||| |||| |||||||
Sbjct: 411 aggctcggcgattacctgatcgatcagggtt 441



to top

>ref|XM_550652.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 775

 Score =  424 bits (214), Expect = e-115
 Identities = 352/398 (88%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||| ||||||||||||||||||||   |||||||| |||||| | |||||
Sbjct: 106 gatgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgagattgacggcaaccacct 165

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 166 caccgccgccgccatcgtcggccacgacggcagcgtctgggcgcagtcccccaacttccc 225

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
            |||| |||||||||||||||| |||||||||| ||||||||||| ||||||||   |||
Sbjct: 226 gcagtacaagcctgaggagattactggcatcatgaaggactttgatgaacccggcagtct 285

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
            ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||
Sbjct: 286 cgcaccaactggtcttttccttgggggcacaaaatacatggtgatccaaggtgaaccagg 345

                                                                       
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggc 410
           ||||||||||||||||||||||||||| || |||||   | |||||||||| ||| || |
Sbjct: 346 ggttgtcatccgaggaaagaagggcactggaggcatatgtgtcaagaagactggcctgtc 405

                                                                       
Query: 411 cctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtgga 470
             |||||||||| ||||| |||||||| ||||| || |||||||||||  || | |||||
Sbjct: 406 gttgattcttggaatctatgatgagccgatgaccccaggccagtgcaacatgattgtgga 465

                                                 
Query: 471 gaggcttggcgactacctggtcgagcagggtttctaag 508
           |||||||||||| || ||| |||||||||||| |||||
Sbjct: 466 gaggcttggcgattatctgatcgagcagggttgctaag 503



to top

>dbj|AK121519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028A03, full
           insert sequence
          Length = 776

 Score =  424 bits (214), Expect = e-115
 Identities = 352/398 (88%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||| ||||||||||||||||||||   |||||||| |||||| | |||||
Sbjct: 107 gatgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgagattgacggcaaccacct 166

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 167 caccgccgccgccatcgtcggccacgacggcagcgtctgggcgcagtcccccaacttccc 226

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
            |||| |||||||||||||||| |||||||||| ||||||||||| ||||||||   |||
Sbjct: 227 gcagtacaagcctgaggagattactggcatcatgaaggactttgatgaacccggcagtct 286

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
            ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||
Sbjct: 287 cgcaccaactggtcttttccttgggggcacaaaatacatggtgatccaaggtgaaccagg 346

                                                                       
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggc 410
           ||||||||||||||||||||||||||| || |||||   | |||||||||| ||| || |
Sbjct: 347 ggttgtcatccgaggaaagaagggcactggaggcatatgtgtcaagaagactggcctgtc 406

                                                                       
Query: 411 cctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtgga 470
             |||||||||| ||||| |||||||| ||||| || |||||||||||  || | |||||
Sbjct: 407 gttgattcttggaatctatgatgagccgatgaccccaggccagtgcaacatgattgtgga 466

                                                 
Query: 471 gaggcttggcgactacctggtcgagcagggtttctaag 508
           |||||||||||| || ||| |||||||||||| |||||
Sbjct: 467 gaggcttggcgattatctgatcgagcagggttgctaag 504



to top

>dbj|AK058798.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-H10, full
           insert sequence
          Length = 775

 Score =  424 bits (214), Expect = e-115
 Identities = 352/398 (88%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||| ||||||||||||||||||||   |||||||| |||||| | |||||
Sbjct: 106 gatgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgagattgacggcaaccacct 165

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 166 caccgccgccgccatcgtcggccacgacggcagcgtctgggcgcagtcccccaacttccc 225

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
            |||| |||||||||||||||| |||||||||| ||||||||||| ||||||||   |||
Sbjct: 226 gcagtacaagcctgaggagattactggcatcatgaaggactttgatgaacccggcagtct 285

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
            ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||
Sbjct: 286 cgcaccaactggtcttttccttgggggcacaaaatacatggtgatccaaggtgaaccagg 345

                                                                       
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggc 410
           ||||||||||||||||||||||||||| || |||||   | |||||||||| ||| || |
Sbjct: 346 ggttgtcatccgaggaaagaagggcactggaggcatatgtgtcaagaagactggcctgtc 405

                                                                       
Query: 411 cctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtgga 470
             |||||||||| ||||| |||||||| ||||| || |||||||||||  || | |||||
Sbjct: 406 gttgattcttggaatctatgatgagccgatgaccccaggccagtgcaacatgattgtgga 465

                                                 
Query: 471 gaggcttggcgactacctggtcgagcagggtttctaag 508
           |||||||||||| || ||| |||||||||||| |||||
Sbjct: 466 gaggcttggcgattatctgatcgagcagggttgctaag 503



to top

>gb|AF201459.1|AF201459 Zea mays profilin 5 (PRO5) mRNA, complete cds
          Length = 703

 Score =  385 bits (194), Expect = e-103
 Identities = 347/398 (87%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||| |||||||||| |||||||||   ||||| ||||| |||||||||||
Sbjct: 78  gatgtcgtggcaggcgtacgtcgatgaccacctgctgtgcgacatcgaaggccagcacct 137

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           || | ||||||||||| ||||||||||||||||||||||||| ||||||   ||||||||
Sbjct: 138 cagcgccgccgccatcgtcggccacgacggcagcgtctgggcacagtccgagaacttccc 197

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
           | |||| |||||||||||| ||||||| || || ||||||||||| ||||| |||  |||
Sbjct: 198 cgagttaaagcctgaggaggttgctgggatgataaaggactttgatgaacctggaactct 257

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
           ||||||||||||||||||  ||||||| || || |||||||| |||||||||||||||||
Sbjct: 258 tgcaccaactggtctttttgttggaggtacgaagtacatggtgatccaaggtgaacctgg 317

                                                                       
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggc 410
            |||||||||||||||||||||||||| || ||||||||||||||||| || |||||| |
Sbjct: 318 agttgtcatccgaggaaagaagggcactggaggcattactatcaagaaaactggcatgtc 377

                                                                       
Query: 411 cctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtgga 470
           | ||||| | |||||||| |||||||| |||||||| || || |||||| |||| |||||
Sbjct: 378 cttgattatcggtatctatgatgagccaatgactccagggcaatgcaatatggtggtgga 437

                                                 
Query: 471 gaggcttggcgactacctggtcgagcagggtttctaag 508
           |||||| ||||| |||||| |||| ||||| |||||||
Sbjct: 438 gaggctcggcgattacctgatcgaacagggcttctaag 475



to top

>gb|AY103599.1| Zea mays PCO094927 mRNA sequence
          Length = 883

 Score =  367 bits (185), Expect = 3e-98
 Identities = 344/397 (86%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||| ||||||||||||| ||||||   ||||||||||| || ||||| ||
Sbjct: 134 gatgtcgtggcaggcgtacgtcgacgagcacctgatgtgcgagatcgaaggacagcatct 193

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           || | ||||||||||| |||| |||||||||||||| ||||| ||||||   | ||||||
Sbjct: 194 cagcgccgccgccatcgtcggtcacgacggcagcgtttgggcgcagtccgagagcttccc 253

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
           | |||| |||||||||||| ||||||| ||||| ||||||||||| ||||| ||   |||
Sbjct: 254 cgagttaaagcctgaggaggttgctggtatcataaaggactttgatgaacctggtactct 313

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
           ||||||||||||||||||| ||||||| ||||| |||||||| |||||||||||||||||
Sbjct: 314 tgcaccaactggtcttttcgttggaggtacaaagtacatggtgatccaaggtgaacctgg 373

                                                                       
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggc 410
            |||||||||||||||||||||||||| || ||||||||||||||||| || |||||| |
Sbjct: 374 agttgtcatccgaggaaagaagggcactgggggcattactatcaagaaaaccggcatgtc 433

                                                                       
Query: 411 cctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtgga 470
           | ||||| ||||| ||||||| ||||| |||||||| || || |||||  |||| |||||
Sbjct: 434 cttgattattggtgtctacgacgagccaatgactccagggcaatgcaacatggtggtgga 493

                                                
Query: 471 gaggcttggcgactacctggtcgagcagggtttctaa 507
           |||||| ||||| |||||| |||||||||| ||||||
Sbjct: 494 gaggctcggcgattacctgatcgagcagggcttctaa 530



to top

>gb|AF032370.1|AF032370 Zea mays profilin (PRO4) mRNA, complete cds
          Length = 798

 Score =  367 bits (185), Expect = 3e-98
 Identities = 344/397 (86%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||| ||||||||||||| ||||||   ||||||||||| || ||||| ||
Sbjct: 82  gatgtcgtggcaggcgtacgtcgacgagcacctgatgtgcgagatcgaaggacagcatct 141

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           || | ||||||||||| |||| |||||||||||||| ||||| ||||||   | ||||||
Sbjct: 142 cagcgccgccgccatcgtcggtcacgacggcagcgtttgggcgcagtccgagagcttccc 201

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
           | |||| |||||||||||| ||||||| ||||| ||||||||||| ||||| ||   |||
Sbjct: 202 cgagttaaagcctgaggaggttgctggtatcataaaggactttgatgaacctggtactct 261

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
           ||||||||||||||||||| ||||||| ||||| |||||||| |||||||||||||||||
Sbjct: 262 tgcaccaactggtcttttcgttggaggtacaaagtacatggtgatccaaggtgaacctgg 321

                                                                       
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggc 410
            |||||||||||||||||||||||||| || ||||||||||||||||| || |||||| |
Sbjct: 322 agttgtcatccgaggaaagaagggcactgggggcattactatcaagaaaaccggcatgtc 381

                                                                       
Query: 411 cctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtgga 470
           | ||||| ||||| ||||||| ||||| |||||||| || || |||||  |||| |||||
Sbjct: 382 cttgattattggtgtctacgacgagccaatgactccagggcaatgcaacatggtggtgga 441

                                                
Query: 471 gaggcttggcgactacctggtcgagcagggtttctaa 507
           |||||| ||||| |||||| |||||||||| ||||||
Sbjct: 442 gaggctcggcgattacctgatcgagcagggcttctaa 478



to top

>gb|BT018328.1| Zea mays clone EL01T0208F04.c mRNA sequence
          Length = 958

 Score =  323 bits (163), Expect = 4e-85
 Identities = 298/343 (86%)
 Strand = Plus / Plus

                                                                       
Query: 166 cacctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaac 225
           ||||||| | ||||||||||| ||||||||||||||||||||||||| ||||||   |||
Sbjct: 77  cacctcagcgccgccgccatcgtcggccacgacggcagcgtctgggcacagtccgagaac 136

                                                                       
Query: 226 ttcccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccgga 285
           |||||| |||| |||||||||||| ||||||| || || |||||||| || ||||| |||
Sbjct: 137 ttccccgagttaaagcctgaggaggttgctgggatgataaaggacttcgatgaacctgga 196

                                                                       
Query: 286 catcttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaa 345
             |||||||||||||||||||||  ||||||| || || |||||||| ||||||||||||
Sbjct: 197 actcttgcaccaactggtctttttgttggaggtacgaagtacatggtgatccaaggtgaa 256

                                                                       
Query: 346 cctggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggc 405
           ||||| |||||||||||||||||||||||||| || ||||||||||||||||| || |||
Sbjct: 257 cctggagttgtcatccgaggaaagaagggcactggaggcattactatcaagaaaactggc 316

                                                                       
Query: 406 atggccctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtc 465
           ||| || ||||| | |||||||| |||||||| |||||||| || || |||||| |||| 
Sbjct: 317 atgtccttgattatcggtatctatgatgagccaatgactccagggcaatgcaatatggtg 376

                                                      
Query: 466 gtggagaggcttggcgactacctggtcgagcagggtttctaag 508
           ||||||||||| ||||| |||||| |||| ||||| |||||||
Sbjct: 377 gtggagaggctcggcgattacctgatcgaacagggcttctaag 419



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 112 atgtcgtggcagacgtacgtcgacgaccacct 143
           |||||||||||| |||||||||| ||||||||
Sbjct: 50  atgtcgtggcaggcgtacgtcgatgaccacct 81



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  194 bits (98), Expect = 2e-46
 Identities = 131/142 (92%)
 Strand = Plus / Plus

                                                                           
Query: 232     cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
               |||| |||||||||||||||| |||||||||| ||||||||||| ||||||||   ||| 
Sbjct: 2690594 cagtacaagcctgaggagattactggcatcatgaaggactttgatgaacccggcagtctc 2690653

                                                                           
Query: 292     gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
               ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||
Sbjct: 2690654 gcaccaactggtcttttccttgggggcacaaaatacatggtgatccaaggtgaaccaggg 2690713

                                     
Query: 352     gttgtcatccgaggaaagaagg 373
               ||||||||||||||||||||||
Sbjct: 2690714 gttgtcatccgaggaaagaagg 2690735



 Score =  159 bits (80), Expect = 1e-35
 Identities = 110/120 (91%)
 Strand = Plus / Plus

                                                                           
Query: 111     gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
               ||||||||||||| ||||||||||||||||||||   |||||||| |||||| | |||||
Sbjct: 2689316 gatgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgagattgacggcaaccacct 2689375

                                                                           
Query: 171     cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
               |||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 2689376 caccgccgccgccatcgtcggccacgacggcagcgtctgggcgcagtcccccaacttccc 2689435



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 99/117 (84%)
 Strand = Plus / Plus

                                                                           
Query: 392     tcaagaagacgggcatggccctgattcttggtatctacgatgagcccatgactcctggcc 451
               |||||||||| ||| || |  |||||||||| ||||| |||||||| ||||| || ||||
Sbjct: 2691635 tcaagaagactggcctgtcgttgattcttggaatctatgatgagccgatgaccccaggcc 2691694

                                                                        
Query: 452     agtgcaatttggtcgtggagaggcttggcgactacctggtcgagcagggtttctaag 508
               |||||||  || | ||||||||||||||||| || ||| |||||||||||| |||||
Sbjct: 2691695 agtgcaacatgattgtggagaggcttggcgattatctgatcgagcagggttgctaag 2691751



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 82      gggaggaggaggagcgggaggc 103
               ||||||||||||||||||||||
Sbjct: 5541212 gggaggaggaggagcgggaggc 5541233



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 79       agggggaggaggaggagcgg 98
                ||||||||||||||||||||
Sbjct: 20778258 agggggaggaggaggagcgg 20778239



to top

>dbj|AP004806.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0710H01
          Length = 187107

 Score =  194 bits (98), Expect = 2e-46
 Identities = 131/142 (92%)
 Strand = Plus / Plus

                                                                          
Query: 232    cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
              |||| |||||||||||||||| |||||||||| ||||||||||| ||||||||   ||| 
Sbjct: 145935 cagtacaagcctgaggagattactggcatcatgaaggactttgatgaacccggcagtctc 145994

                                                                          
Query: 292    gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
              ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||
Sbjct: 145995 gcaccaactggtcttttccttgggggcacaaaatacatggtgatccaaggtgaaccaggg 146054

                                    
Query: 352    gttgtcatccgaggaaagaagg 373
              ||||||||||||||||||||||
Sbjct: 146055 gttgtcatccgaggaaagaagg 146076



 Score =  159 bits (80), Expect = 1e-35
 Identities = 110/120 (91%)
 Strand = Plus / Plus

                                                                          
Query: 111    gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
              ||||||||||||| ||||||||||||||||||||   |||||||| |||||| | |||||
Sbjct: 144657 gatgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgagattgacggcaaccacct 144716

                                                                          
Query: 171    cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
              |||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 144717 caccgccgccgccatcgtcggccacgacggcagcgtctgggcgcagtcccccaacttccc 144776



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 99/117 (84%)
 Strand = Plus / Plus

                                                                          
Query: 392    tcaagaagacgggcatggccctgattcttggtatctacgatgagcccatgactcctggcc 451
              |||||||||| ||| || |  |||||||||| ||||| |||||||| ||||| || ||||
Sbjct: 146976 tcaagaagactggcctgtcgttgattcttggaatctatgatgagccgatgaccccaggcc 147035

                                                                       
Query: 452    agtgcaatttggtcgtggagaggcttggcgactacctggtcgagcagggtttctaag 508
              |||||||  || | ||||||||||||||||| || ||| |||||||||||| |||||
Sbjct: 147036 agtgcaacatgattgtggagaggcttggcgattatctgatcgagcagggttgctaag 147092



to top

>dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0529C07
          Length = 174011

 Score =  194 bits (98), Expect = 2e-46
 Identities = 131/142 (92%)
 Strand = Plus / Plus

                                                                          
Query: 232    cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
              |||| |||||||||||||||| |||||||||| ||||||||||| ||||||||   ||| 
Sbjct: 102341 cagtacaagcctgaggagattactggcatcatgaaggactttgatgaacccggcagtctc 102400

                                                                          
Query: 292    gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
              ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||
Sbjct: 102401 gcaccaactggtcttttccttgggggcacaaaatacatggtgatccaaggtgaaccaggg 102460

                                    
Query: 352    gttgtcatccgaggaaagaagg 373
              ||||||||||||||||||||||
Sbjct: 102461 gttgtcatccgaggaaagaagg 102482



 Score =  159 bits (80), Expect = 1e-35
 Identities = 110/120 (91%)
 Strand = Plus / Plus

                                                                          
Query: 111    gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
              ||||||||||||| ||||||||||||||||||||   |||||||| |||||| | |||||
Sbjct: 101063 gatgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgagattgacggcaaccacct 101122

                                                                          
Query: 171    cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
              |||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 101123 caccgccgccgccatcgtcggccacgacggcagcgtctgggcgcagtcccccaacttccc 101182



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 99/117 (84%)
 Strand = Plus / Plus

                                                                          
Query: 392    tcaagaagacgggcatggccctgattcttggtatctacgatgagcccatgactcctggcc 451
              |||||||||| ||| || |  |||||||||| ||||| |||||||| ||||| || ||||
Sbjct: 103382 tcaagaagactggcctgtcgttgattcttggaatctatgatgagccgatgaccccaggcc 103441

                                                                       
Query: 452    agtgcaatttggtcgtggagaggcttggcgactacctggtcgagcagggtttctaag 508
              |||||||  || | ||||||||||||||||| || ||| |||||||||||| |||||
Sbjct: 103442 agtgcaacatgattgtggagaggcttggcgattatctgatcgagcagggttgctaag 103498



to top

>emb|Y09458.1|PPPROFIL4 P.pratense mRNA for profilin 4
          Length = 396

 Score =  172 bits (87), Expect = 8e-40
 Identities = 147/167 (88%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||||||||||| ||||| ||||||   ||||||||||| ||||| ||||||
Sbjct: 1   atgtcgtggcagacgtacgtggacgagcacctgatgtgcgagatcgagggccaccacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
            ||||||| |||||||||||||||||||||| |||||||||||||  | || ||||||||
Sbjct: 61  gcctccgcggccatcctcggccacgacggcaccgtctgggcccagagcgccgacttcccc 120

                                                          
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacga 278
           ||||||||||||||||||||  | |||||||| ||||| || |||||
Sbjct: 121 cagttcaagcctgaggagatcaccggcatcatgaaggatttcgacga 167



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 137/165 (83%), Gaps = 2/165 (1%)
 Strand = Plus / Plus

                                                                       
Query: 325 tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggc 384
           |||||||||||||| |||||||| || |  |||||||| || ||||||||  | || |||
Sbjct: 214 tacatggtcatccagggtgaacccggcgcggtcatccgtggcaagaagggagcaggaggc 273

                                                                       
Query: 385 attactatcaagaagac-gggcatggccctgattcttggtatctacgatgagcccatgac 443
           || || || |||||||| ||||| ||| ||| |  | || |||||||| |||||||||||
Sbjct: 274 atcaccataaagaagaccgggca-ggcgctggtcgtcggcatctacgacgagcccatgac 332

                                                        
Query: 444 tcctggccagtgcaatttggtcgtggagaggcttggcgactacct 488
            ||||| ||||||||  |||| |||||||||||||||||||||||
Sbjct: 333 ccctgggcagtgcaacatggtggtggagaggcttggcgactacct 377



to top

>emb|Y09456.1|PPPROFIL2 P.pratense mRNA for profilin 2
          Length = 396

 Score =  172 bits (87), Expect = 8e-40
 Identities = 147/167 (88%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||||||||||| ||||| ||||||   ||||||||||| ||||| ||||||
Sbjct: 1   atgtcgtggcagacgtacgtggacgagcacctgatgtgcgagatcgagggccaccacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
            ||||||| |||||||||||||||||||||| |||||||||||||  | || ||||||||
Sbjct: 61  gcctccgcggccatcctcggccacgacggcaccgtctgggcccagagcgccgacttcccc 120

                                                          
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacga 278
           ||||||||||||||||||||  | |||||||| ||||| || |||||
Sbjct: 121 cagttcaagcctgaggagatcaccggcatcatgaaggatttcgacga 167



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 136/165 (82%), Gaps = 2/165 (1%)
 Strand = Plus / Plus

                                                                       
Query: 325 tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggc 384
           |||||||||||||| |||||||| || |  |||||||| || ||||||||  | || |||
Sbjct: 214 tacatggtcatccagggtgaacccggcgcggtcatccgtggcaagaagggagcaggaggc 273

                                                                       
Query: 385 attactatcaagaagac-gggcatggccctgattcttggtatctacgatgagcccatgac 443
           || || || |||||||| ||||| ||| ||| |  | || ||||| || |||||||||||
Sbjct: 274 atcaccataaagaagaccgggca-ggcgctggtcgtcggcatctatgacgagcccatgac 332

                                                        
Query: 444 tcctggccagtgcaatttggtcgtggagaggcttggcgactacct 488
            ||||| ||||||||  |||| |||||||||||||||||||||||
Sbjct: 333 ccctgggcagtgcaacatggtggtggagaggcttggcgactacct 377



to top

>emb|X73279.1|ZMPRO1MR Z.mays ZmPRO1 mRNA for profilin 1
          Length = 1048

 Score =  172 bits (87), Expect = 8e-40
 Identities = 317/391 (81%), Gaps = 2/391 (0%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||||||||||| ||||| ||||||   ||||||||||| ||||| |||||
Sbjct: 127 gatgtcgtggcagacgtacgtggacgagcacctgatgtgcgagatcgagggccaccacct 186

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           ||| || || |||||| ||||||||||||||  |  |||||| |||  | ||   |||||
Sbjct: 187 cacgtcggcggccatcgtcggccacgacggcgccacctgggctcagagcaccgcattccc 246

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
           | |||||||||| |||||||| |||| |||||| ||||| || ||||| || || || ||
Sbjct: 247 cgagttcaagcccgaggagatggctgccatcatgaaggatttcgacgagccggggcacct 306

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
            || || || || ||  |||| |||||||| || ||||||||||||||||| ||||||||
Sbjct: 307 cgccccgaccggcctgatcctgggaggcaccaagtacatggtcatccaaggcgaacctgg 366

                                                                       
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagac-gggcatgg 409
            | ||||||||| || ||||||||  |||| ||||| ||| | ||||| || ||||| | 
Sbjct: 367 agctgtcatccgtggcaagaagggatccgggggcatcactgtgaagaaaacagggca-gt 425

                                                                       
Query: 410 ccctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtgg 469
           | || ||  |||| |||||||| ||||| |||||||| || ||||||||  |||| ||||
Sbjct: 426 cactcatcattggcatctacgacgagccgatgactcccgggcagtgcaacctggtggtgg 485

                                          
Query: 470 agaggcttggcgactacctggtcgagcaggg 500
           | ||||| |||||||||||| |||| |||||
Sbjct: 486 aaaggctgggcgactacctgctcgaacaggg 516



to top

>gb|AY049013.1| Litchi chinensis profilin mRNA, complete cds
          Length = 396

 Score =  172 bits (87), Expect = 8e-40
 Identities = 219/263 (83%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||||||||||||||||| |||||    |||||||  |||||||||||||||
Sbjct: 1   atgtcgtggcagacgtacgtcgacgatcacctcatgtgcgagactgacggccagcacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||  ||||||||||| |||||||||||||||||||||||||||||  | |||||||||| 
Sbjct: 61  actgccgccgccatcatcggccacgacggcagcgtctgggcccagagcgccaacttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           |||||||||||||  |||||||| |  ||||| || ||||| || ||||| ||    |||
Sbjct: 121 cagttcaagcctgctgagattgcagcgatcatgaaagacttcgatgaacctggttccctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||  |   ||| || |||||||| |||||||| ||||| ||||| ||||| 
Sbjct: 181 gccccaactgggttgcacctcggtggcacaaagtacatggttatccagggtgagcctgga 240

                                  
Query: 352 gttgtcatccgaggaaagaaggg 374
           | ||||||||| ||||| |||||
Sbjct: 241 gctgtcatccgtggaaaaaaggg 263



to top

>emb|Y09457.1|PPPROFIL3 P.pratense mRNA for profilin 3
          Length = 396

 Score =  165 bits (83), Expect = 2e-37
 Identities = 146/167 (87%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||||||||||| ||||| ||||||   ||||||||||| ||||| ||||||
Sbjct: 1   atgtcgtggcagacgtacgtggacgagcacctgatgtgcgagatcgagggccatcacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
            ||||||| |||||| ||||||||||||||| |||||||||||||  | || ||||||||
Sbjct: 61  gcctccgcggccatcttcggccacgacggcaccgtctgggcccagagcgccgacttcccc 120

                                                          
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacga 278
           ||||||||||||||||||||  | |||||||| ||||| || |||||
Sbjct: 121 cagttcaagcctgaggagatcaccggcatcatgaaggatttggacga 167



 Score =  105 bits (53), Expect = 2e-19
 Identities = 139/165 (84%), Gaps = 2/165 (1%)
 Strand = Plus / Plus

                                                                       
Query: 325 tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggc 384
           |||||||||||||| |||||||| || |  |||||||| || ||||||||  | || |||
Sbjct: 214 tacatggtcatccagggtgaacccggcgcggtcatccgtggcaagaagggagcaggaggc 273

                                                                       
Query: 385 attactatcaagaagac-gggcatggccctgattcttggtatctacgatgagcccatgac 443
           || || || |||||||| ||||| ||| ||| || | || ||||||||||||||||||||
Sbjct: 274 atcaccataaagaagacagggca-ggcgctggttgtcggcatctacgatgagcccatgac 332

                                                        
Query: 444 tcctggccagtgcaatttggtcgtggagaggcttggcgactacct 488
            ||||| ||||||||  |||| |||||||||||||||||||||||
Sbjct: 333 ccctgggcagtgcaacatggtggtggagaggcttggcgactacct 377



to top

>emb|X77583.1|PPPROPXI P.pratense mRNA for profilin-Phl p XI
          Length = 396

 Score =  165 bits (83), Expect = 2e-37
 Identities = 146/167 (87%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||||||||||| ||||| ||||||   ||||||||||| ||||| ||||||
Sbjct: 1   atgtcgtggcagacgtacgtggacgagcacctgatgtgcgagatcgagggccaccacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
            |||| || |||||||||||||||||||||| |||||||||||||  | || ||||||||
Sbjct: 61  gcctcggcggccatcctcggccacgacggcaccgtctgggcccagagcgccgacttcccc 120

                                                          
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacga 278
           ||||||||||||||||||||  | |||||||| ||||| || |||||
Sbjct: 121 cagttcaagcctgaggagatcaccggcatcatgaaggatttcgacga 167



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 424 atctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgac 483
           ||||| || ||||||||||| ||||| ||||||||  |||| ||||||||||||||||||
Sbjct: 313 atctatgacgagcccatgacccctgggcagtgcaacatggtggtggagaggcttggcgac 372

                
Query: 484 tacct 488
           |||||
Sbjct: 373 tacct 377



to top

>gb|AF377949.1|AF377949 Ananas comosus profilin mRNA, complete cds
          Length = 396

 Score =  165 bits (83), Expect = 2e-37
 Identities = 218/263 (82%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||| || |||   ||||||||||||||||| || |||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgatcatctgatgtgcgagatcgacggccaacatctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
            ||||||||||||| |||||||||||  | | ||| ||||| |||  ||| || ||||| 
Sbjct: 61  tcctccgccgccattctcggccacgatagtaccgtatgggctcagagccctaatttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           |||||||||||||| ||||||  || |||  | || ||||||||  | || |||  ||||
Sbjct: 121 cagttcaagcctgaagagattagtgccattttgaatgactttgaaaaccctggatctctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||| | | |||||| || ||||||||||||||||||||||| || || |||
Sbjct: 181 gctccaactggtttataccttggcggtacaaaatacatggtcatccaaggagagccaggg 240

                                  
Query: 352 gttgtcatccgaggaaagaaggg 374
           |||||||| ||||||||||||||
Sbjct: 241 gttgtcattcgaggaaagaaggg 263



to top

>gb|AF200185.1|AF200185 Lilium longiflorum profilin 2 mRNA, complete cds
          Length = 614

 Score =  155 bits (78), Expect = 2e-34
 Identities = 99/106 (93%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||||||||||||||||| ||||||   |||||||||||||||||||||||
Sbjct: 42  gatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgacggccagcacct 101

                                                         
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccag 216
           |||| ||||||||||| ||||||||||||||||| |||||||||||
Sbjct: 102 caccgccgccgccatcatcggccacgacggcagcatctgggcccag 147



to top

>emb|AJ507459.1|MDO507459 Malus x domestica mRNA for apple allergen profilin (pf-3 gene),
           clone 3
          Length = 683

 Score =  151 bits (76), Expect = 3e-33
 Identities = 316/396 (79%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||||||||||   ||||| ||||||||| | | ||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgatatcgacggctaccgcctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||| ||||||| ||||||||||| ||||||||||| ||| | |||  | ||   ||||| 
Sbjct: 61  accgccgccgctatcctcggccaagacggcagcgtttggtctcagagcgcctctttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
             ||| |||||||||||||||||||  ||  | || || || ||  ||||||||   || 
Sbjct: 121 gcgtttaagcctgaggagattgctgcaattctgaaagatttcgatcaacccggaacactg 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||  | |||||||| || || || || ||||| ||||| |||||||| || 
Sbjct: 181 gccccaactggattattccttggtgggacgaagtatatggtgatccagggtgaacccggc 240

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           | |||||| ||||||||||||||| | || || |||||||||||||||||  ||  ||||
Sbjct: 241 gctgtcattcgaggaaagaagggctcgggcggaattactatcaagaagaccagccaggcc 300

                                                                       
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 471
           ||| |  | ||||| || ||||||||  |||||||||| ||||||||  | || || |||
Sbjct: 301 ctgttaatcggtatatatgatgagcctgtgactcctgggcagtgcaacatagttgttgag 360

                                               
Query: 472 aggcttggcgactacctggtcgagcagggtttctaa 507
           ||||| ||||| |||||  ||||||||||| |||||
Sbjct: 361 aggctgggcgattaccttatcgagcagggtctctaa 396



to top

>dbj|AK100089.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003I11, full
           insert sequence
          Length = 830

 Score =  151 bits (76), Expect = 3e-33
 Identities = 133/152 (87%)
 Strand = Plus / Plus

                                                                       
Query: 100 aggcgaccgaggatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgac 159
           |||||| ||| ||||||||||||||||||||||||||| ||||||   ||||||||||| 
Sbjct: 86  aggcgagcgaagatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgag 145

                                                                       
Query: 160 ggccagcacctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcc 219
           ||||| ||||||||||||||||||||| ||||||||||||||| ||||||||| |||  |
Sbjct: 146 ggccaccacctcacctccgccgccatcgtcggccacgacggcaccgtctgggcacagagc 205

                                           
Query: 220 cccaacttcccccagttcaagcctgaggagat 251
            ||  |||||| |||||||| || ||||||||
Sbjct: 206 gccgccttccctcagttcaaaccggaggagat 237



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Plus

                                                                       
Query: 325 tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggc 384
           |||||||||||||||||||||||||| | |||||| || || ||||||||  | || |||
Sbjct: 311 tacatggtcatccaaggtgaacctggcgctgtcattcgtggcaagaagggatcaggaggc 370

                                                                       
Query: 385 attactatcaagaaga-cgggcatggccctgattcttggtatctacgatgagcccatgac 443
           || ||  | ||||||| |||||| ||| ||| |  | || |||||||| |||||||||||
Sbjct: 371 atcacagtgaagaagaccgggca-ggcgctggtggtcggcatctacgacgagcccatgac 429

                                                                    
Query: 444 tcctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcaggg 500
            || || ||||||||  |||| || |||||||| || |||||||| || ||||||||
Sbjct: 430 cccggggcagtgcaacatggtggttgagaggctcggtgactacctcgtagagcaggg 486



to top

>gb|DQ309464.1| Litchi chinensis profilin mRNA, complete cds
          Length = 689

 Score =  149 bits (75), Expect = 1e-32
 Identities = 207/251 (82%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||| |||||    |||||||  |||||||||||||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgatcacctcatgtgcgagactgacggccagcacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||  ||||||||||| |||||||||||||||||||||||||||||  | |||||||||| 
Sbjct: 61  actgccgccgccatcatcggccacgacggcagcgtctgggcccagagcgccaacttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           |||||||||||||  |||||| | |  ||||| || |||||||| ||||| ||    |||
Sbjct: 121 cagttcaagcctgttgagattacagcgatcatgaaagactttgatgaacctggttccctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || || |||||  |   ||| || |||||||| |||||||| ||||| ||||| ||||| 
Sbjct: 181 gcccccactgggttgcacctcggtggcacaaagtacatggttatccagggtgagcctgga 240

                      
Query: 352 gttgtcatccg 362
           | |||||||||
Sbjct: 241 gctgtcatccg 251



to top

>gb|AC074354.8|AC074354 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0065C16, from Chromosome 10, complete sequence
          Length = 146391

 Score =  145 bits (73), Expect = 2e-31
 Identities = 103/113 (91%)
 Strand = Plus / Plus

                                                                         
Query: 100   aggcgaccgaggatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgac 159
             |||||| ||| ||||||||||||||||||||||||||| ||||||   ||||||||||| 
Sbjct: 58913 aggcgagcgaagatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgag 58972

                                                                  
Query: 160   ggccagcacctcacctccgccgccatcctcggccacgacggcagcgtctgggc 212
             ||||| ||||||||||||||||||||| ||||||||||||||| |||||||||
Sbjct: 58973 ggccaccacctcacctccgccgccatcgtcggccacgacggcaccgtctgggc 59025



 Score =  139 bits (70), Expect = 1e-29
 Identities = 94/102 (92%)
 Strand = Plus / Minus

                                                                         
Query: 111   gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
             ||||||||||||||||||||||||||| ||||||   ||||||||||| ||||| |||||
Sbjct: 69116 gatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgagggccaccacct 69057

                                                       
Query: 171   cacctccgccgccatcctcggccacgacggcagcgtctgggc 212
             |||||||||||||||| ||||||||||||||| |||||||||
Sbjct: 69056 cacctccgccgccatcgtcggccacgacggcaccgtctgggc 69015



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 325   tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
             |||||||||||||||||||||||||| | |||||| || || |||||||
Sbjct: 68799 tacatggtcatccaaggtgaacctggcgctgtcattcgtggcaagaagg 68751



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                         
Query: 424   atctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgac 483
             |||||||| ||||| ||||| || || ||||||||  |||| || |||||||| ||||||
Sbjct: 68576 atctacgacgagccgatgaccccagggcagtgcaacatggtggtcgagaggctcggcgac 68517

                              
Query: 484   tacctggtcgagcaggg 500
             ||||| || ||||||||
Sbjct: 68516 tacctcgtagagcaggg 68500



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                         
Query: 424   atctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgac 483
             |||||||| ||||||||||| || || ||||||||  |||| || |||||||| || |||
Sbjct: 59473 atctacgacgagcccatgaccccggggcagtgcaacatggtggttgagaggctcggtgac 59532

                              
Query: 484   tacctggtcgagcaggg 500
             ||||| || ||||||||
Sbjct: 59533 tacctcgtagagcaggg 59549



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                              
Query: 325   tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
             |||||||||||||||||||||||||| | |||||| || || |||||||
Sbjct: 59241 tacatggtcatccaaggtgaacctggcgctgtcattcgtggcaagaagg 59289



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score =  145 bits (73), Expect = 2e-31
 Identities = 103/113 (91%)
 Strand = Plus / Minus

                                                                           
Query: 100     aggcgaccgaggatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgac 159
               |||||| ||| ||||||||||||||||||||||||||| ||||||   ||||||||||| 
Sbjct: 8461877 aggcgagcgaagatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgag 8461818

                                                                    
Query: 160     ggccagcacctcacctccgccgccatcctcggccacgacggcagcgtctgggc 212
               ||||| ||||||||||||||||||||| ||||||||||||||| |||||||||
Sbjct: 8461817 ggccaccacctcacctccgccgccatcgtcggccacgacggcaccgtctgggc 8461765



 Score =  139 bits (70), Expect = 1e-29
 Identities = 94/102 (92%)
 Strand = Plus / Plus

                                                                           
Query: 111     gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
               ||||||||||||||||||||||||||| ||||||   ||||||||||| ||||| |||||
Sbjct: 8451674 gatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgagggccaccacct 8451733

                                                         
Query: 171     cacctccgccgccatcctcggccacgacggcagcgtctgggc 212
               |||||||||||||||| ||||||||||||||| |||||||||
Sbjct: 8451734 cacctccgccgccatcgtcggccacgacggcaccgtctgggc 8451775



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                                
Query: 325     tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
               |||||||||||||||||||||||||| | |||||| || || |||||||
Sbjct: 8461549 tacatggtcatccaaggtgaacctggcgctgtcattcgtggcaagaagg 8461501



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                           
Query: 424     atctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgac 483
               |||||||| ||||||||||| || || ||||||||  |||| || |||||||| || |||
Sbjct: 8461317 atctacgacgagcccatgaccccggggcagtgcaacatggtggttgagaggctcggtgac 8461258

                                
Query: 484     tacctggtcgagcaggg 500
               ||||| || ||||||||
Sbjct: 8461257 tacctcgtagagcaggg 8461241



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                           
Query: 424     atctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgac 483
               |||||||| ||||| ||||| || || ||||||||  |||| || |||||||| ||||||
Sbjct: 8452214 atctacgacgagccgatgaccccagggcagtgcaacatggtggtcgagaggctcggcgac 8452273

                                
Query: 484     tacctggtcgagcaggg 500
               ||||| || ||||||||
Sbjct: 8452274 tacctcgtagagcaggg 8452290



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                
Query: 325     tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
               |||||||||||||||||||||||||| | |||||| || || |||||||
Sbjct: 8451991 tacatggtcatccaaggtgaacctggcgctgtcattcgtggcaagaagg 8452039



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 79       agggggaggaggaggagcgg 98
                ||||||||||||||||||||
Sbjct: 21166329 agggggaggaggaggagcgg 21166310



to top

>gb|AF310253.1|AF310253 Oryza sativa profilin A mRNA, complete cds
          Length = 812

 Score =  145 bits (73), Expect = 2e-31
 Identities = 124/141 (87%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||||||||||||||||| ||||||   ||||||||||| ||||| |||||
Sbjct: 117 gatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgagggccaccacct 176

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||||||||||||||| ||||||||||||||| ||||||||| |||  | ||  ||||||
Sbjct: 177 cacctccgccgccatcgtcggccacgacggcaccgtctgggcacagagcgccgccttccc 236

                                
Query: 231 ccagttcaagcctgaggagat 251
            |||||||| || ||||||||
Sbjct: 237 gcagttcaaaccggaggagat 257



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Plus

                                                                       
Query: 325 tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggc 384
           |||||||||||||||||||||||||| | |||||| || || ||||||||  | || |||
Sbjct: 331 tacatggtcatccaaggtgaacctggcgctgtcattcgtggcaagaagggatcaggaggc 390

                                                                       
Query: 385 attactatcaagaaga-cgggcatggccctgattcttggtatctacgatgagcccatgac 443
           || ||  | ||||||| |||||| ||| ||| |  | || |||||||| ||||| |||||
Sbjct: 391 atcacggtgaagaagaccgggca-ggcgctggtggtcggcatctacgacgagccgatgac 449

                                                                    
Query: 444 tcctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcaggg 500
            || || ||||||||  |||| || |||||||| ||||||||||| || ||||||||
Sbjct: 450 cccagggcagtgcaacatggtggtcgagaggctcggcgactacctcgtagagcaggg 506



to top

>dbj|AK070595.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023058I07, full
           insert sequence
          Length = 880

 Score =  145 bits (73), Expect = 2e-31
 Identities = 124/141 (87%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||||||||||||||||| ||||||   ||||||||||| ||||| |||||
Sbjct: 117 gatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgagggccaccacct 176

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||||||||||||||| ||||||||||||||| ||||||||| |||  | ||  ||||||
Sbjct: 177 cacctccgccgccatcgtcggccacgacggcaccgtctgggcacagagcgccgccttccc 236

                                
Query: 231 ccagttcaagcctgaggagat 251
            |||||||| || ||||||||
Sbjct: 237 gcagttcaaaccggaggagat 257



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 143/177 (80%), Gaps = 2/177 (1%)
 Strand = Plus / Plus

                                                                       
Query: 325 tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggc 384
           ||||||||||||| |||||||||||| | |||||| || || ||||||||  | || |||
Sbjct: 331 tacatggtcatccgaggtgaacctggcgctgtcattcgtggcaagaagggatcaggaggc 390

                                                                       
Query: 385 attactatcaagaagac-gggcatggccctgattcttggtatctacgatgagcccatgac 443
           || ||  | |||||||| ||||| ||| ||| |  | || |||||||| ||||| |||||
Sbjct: 391 atcacggtgaagaagaccgggca-ggcgctggtggtcggcatctacgacgagccgatgac 449

                                                                    
Query: 444 tcctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcaggg 500
            || || ||||||||  |||| || |||||||| ||||||||||| || ||||||||
Sbjct: 450 cccagggcagtgcaacatggtggtcgagaggctcggcgactacctcgtagagcaggg 506



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  145 bits (73), Expect = 2e-31
 Identities = 103/113 (91%)
 Strand = Plus / Minus

                                                                           
Query: 100     aggcgaccgaggatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgac 159
               |||||| ||| ||||||||||||||||||||||||||| ||||||   ||||||||||| 
Sbjct: 8466976 aggcgagcgaagatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgag 8466917

                                                                    
Query: 160     ggccagcacctcacctccgccgccatcctcggccacgacggcagcgtctgggc 212
               ||||| ||||||||||||||||||||| ||||||||||||||| |||||||||
Sbjct: 8466916 ggccaccacctcacctccgccgccatcgtcggccacgacggcaccgtctgggc 8466864



 Score =  139 bits (70), Expect = 1e-29
 Identities = 94/102 (92%)
 Strand = Plus / Plus

                                                                           
Query: 111     gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
               ||||||||||||||||||||||||||| ||||||   ||||||||||| ||||| |||||
Sbjct: 8456773 gatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgagggccaccacct 8456832

                                                         
Query: 171     cacctccgccgccatcctcggccacgacggcagcgtctgggc 212
               |||||||||||||||| ||||||||||||||| |||||||||
Sbjct: 8456833 cacctccgccgccatcgtcggccacgacggcaccgtctgggc 8456874



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                                
Query: 325     tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
               |||||||||||||||||||||||||| | |||||| || || |||||||
Sbjct: 8466648 tacatggtcatccaaggtgaacctggcgctgtcattcgtggcaagaagg 8466600



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                           
Query: 424     atctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgac 483
               |||||||| ||||||||||| || || ||||||||  |||| || |||||||| || |||
Sbjct: 8466416 atctacgacgagcccatgaccccggggcagtgcaacatggtggttgagaggctcggtgac 8466357

                                
Query: 484     tacctggtcgagcaggg 500
               ||||| || ||||||||
Sbjct: 8466356 tacctcgtagagcaggg 8466340



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                           
Query: 424     atctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgac 483
               |||||||| ||||| ||||| || || ||||||||  |||| || |||||||| ||||||
Sbjct: 8457313 atctacgacgagccgatgaccccagggcagtgcaacatggtggtcgagaggctcggcgac 8457372

                                
Query: 484     tacctggtcgagcaggg 500
               ||||| || ||||||||
Sbjct: 8457373 tacctcgtagagcaggg 8457389



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                
Query: 325     tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
               |||||||||||||||||||||||||| | |||||| || || |||||||
Sbjct: 8457090 tacatggtcatccaaggtgaacctggcgctgtcattcgtggcaagaagg 8457138



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 79       agggggaggaggaggagcgg 98
                ||||||||||||||||||||
Sbjct: 21177593 agggggaggaggaggagcgg 21177574



to top

>ref|NM_195688.1| Oryza sativa (japonica cultivar-group) Profilin A
           (OSJNBa0065C16.11), mRNA
          Length = 396

 Score =  143 bits (72), Expect = 7e-31
 Identities = 123/140 (87%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||||||||||||||||| ||||||   ||||||||||| ||||| ||||||
Sbjct: 1   atgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgagggccaccacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||||||||||||||| ||||||||||||||| ||||||||| |||  | ||  |||||| 
Sbjct: 61  acctccgccgccatcgtcggccacgacggcaccgtctgggcacagagcgccgccttccct 120

                               
Query: 232 cagttcaagcctgaggagat 251
           |||||||| || ||||||||
Sbjct: 121 cagttcaaaccggaggagat 140



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Plus

                                                                       
Query: 325 tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggc 384
           |||||||||||||||||||||||||| | |||||| || || ||||||||  | || |||
Sbjct: 214 tacatggtcatccaaggtgaacctggcgctgtcattcgtggcaagaagggatcaggaggc 273

                                                                       
Query: 385 attactatcaagaaga-cgggcatggccctgattcttggtatctacgatgagcccatgac 443
           || ||  | ||||||| |||||| ||| ||| |  | || |||||||| |||||||||||
Sbjct: 274 atcacagtgaagaagaccgggca-ggcgctggtggtcggcatctacgacgagcccatgac 332

                                                                    
Query: 444 tcctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcaggg 500
            || || ||||||||  |||| || |||||||| || |||||||| || ||||||||
Sbjct: 333 cccggggcagtgcaacatggtggttgagaggctcggtgactacctcgtagagcaggg 389



to top

>ref|NM_195685.1| Oryza sativa (japonica cultivar-group) Profilin A
           (OSJNBa0065C16.14), mRNA
          Length = 396

 Score =  143 bits (72), Expect = 7e-31
 Identities = 123/140 (87%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||||||||||||||||| ||||||   ||||||||||| ||||| ||||||
Sbjct: 1   atgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgagggccaccacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||||||||||||||| ||||||||||||||| ||||||||| |||  | ||  |||||| 
Sbjct: 61  acctccgccgccatcgtcggccacgacggcaccgtctgggcacagagcgccgccttcccg 120

                               
Query: 232 cagttcaagcctgaggagat 251
           |||||||| || ||||||||
Sbjct: 121 cagttcaaaccggaggagat 140



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Plus

                                                                       
Query: 325 tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggc 384
           |||||||||||||||||||||||||| | |||||| || || ||||||||  | || |||
Sbjct: 214 tacatggtcatccaaggtgaacctggcgctgtcattcgtggcaagaagggatcaggaggc 273

                                                                       
Query: 385 attactatcaagaaga-cgggcatggccctgattcttggtatctacgatgagcccatgac 443
           || ||  | ||||||| |||||| ||| ||| |  | || |||||||| ||||| |||||
Sbjct: 274 atcacggtgaagaagaccgggca-ggcgctggtggtcggcatctacgacgagccgatgac 332

                                                                    
Query: 444 tcctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcaggg 500
            || || ||||||||  |||| || |||||||| ||||||||||| || ||||||||
Sbjct: 333 cccagggcagtgcaacatggtggtcgagaggctcggcgactacctcgtagagcaggg 389



to top

>dbj|AK121412.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132P11, full
           insert sequence
          Length = 880

 Score =  143 bits (72), Expect = 7e-31
 Identities = 132/152 (86%)
 Strand = Plus / Plus

                                                                       
Query: 100 aggcgaccgaggatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgac 159
           |||||| ||| ||||||||||||||||||||||||||| ||||||   |||||| |||| 
Sbjct: 93  aggcgagcgaagatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgaggtcgag 152

                                                                       
Query: 160 ggccagcacctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcc 219
           ||||| ||||||||||||||||||||| ||||||||||||||| ||||||||| |||  |
Sbjct: 153 ggccaccacctcacctccgccgccatcgtcggccacgacggcaccgtctgggcacagagc 212

                                           
Query: 220 cccaacttcccccagttcaagcctgaggagat 251
            ||  |||||| |||||||| || ||||||||
Sbjct: 213 gccgccttccctcagttcaaaccggaggagat 244



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 144/177 (81%), Gaps = 2/177 (1%)
 Strand = Plus / Plus

                                                                       
Query: 325 tacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggc 384
           |||||||||||||||||||||||||| | |||||| || || ||||||||  | || |||
Sbjct: 318 tacatggtcatccaaggtgaacctggcgctgtcattcgtggcaagaagggatcaggaggc 377

                                                                       
Query: 385 attactatcaagaaga-cgggcatggccctgattcttggtatctacgatgagcccatgac 443
           || ||  | ||||||| |||||| ||| ||| |  | || |||||||| |||||||||||
Sbjct: 378 atcacagtgaagaagaccgggca-ggcgctggtggtcggcatctacgacgagcccatgac 436

                                                                    
Query: 444 tcctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcaggg 500
            || || ||||||||  |||| || |||||||| || |||||||| || ||||||||
Sbjct: 437 cccggggcagtgcaacatggtggttgagaggctcggtgactacctcgtagagcaggg 493



to top

>gb|AF129428.1|AF129428 Malus domestica GD4-5 profilin mRNA, complete cds
          Length = 396

 Score =  143 bits (72), Expect = 7e-31
 Identities = 315/396 (79%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||||||||||   ||||| ||||||||| | | ||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgatatcgacggcaaccgcctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||| ||||||| ||||||||||| ||||||||||| ||| | |||  | ||   ||||| 
Sbjct: 61  accgccgccgctatcctcggccaagacggcagcgtttggtctcagagcgcctctttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
             ||| |||||||||||||||||||  ||  | || || || ||  ||||||||   || 
Sbjct: 121 gcgtttaagcctgaggagattgctgcaattctgaaagatttcgatcaacccggaacactg 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||  | |||||||| || || || || ||||| ||||| |||||||| || 
Sbjct: 181 gccccaactggattattccttggtgggacgaagtatatggtgatccagggtgaacccggc 240

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           | |||||| ||||||||||||||  | || || |||||||||||||||||  ||  ||||
Sbjct: 241 gctgtcattcgaggaaagaagggttcgggcggaattactatcaagaagaccagccaggcc 300

                                                                       
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 471
           ||| |  | ||||| || ||||||||  |||||||||| ||||||||  | || || |||
Sbjct: 301 ctgttaatcggtatatatgatgagcctgtgactcctgggcagtgcaacatagttgttgag 360

                                               
Query: 472 aggcttggcgactacctggtcgagcagggtttctaa 507
           ||||| ||||| |||||  ||||||||||| |||||
Sbjct: 361 aggctgggcgattaccttatcgagcagggtctctaa 396



to top

>gb|AY109559.1| Zea mays CL2097_1 mRNA sequence
          Length = 983

 Score =  141 bits (71), Expect = 3e-30
 Identities = 313/391 (80%), Gaps = 2/391 (0%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||| ||||||| ||||| ||||||   ||||||||||| ||||| |||||
Sbjct: 124 gatgtcgtggcaggcgtacgtggacgagcacctgatgtgcgagatcgagggccaccacct 183

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           | |  | || |||||| |||||||||||||   || |||||| |||  | |    |||||
Sbjct: 184 cgcggcggcggccatcgtcggccacgacggtgccgcctgggcgcagagcacggcgttccc 243

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
           | |||||||||| |||||||| |||| |||||| ||||| || ||||| || || || ||
Sbjct: 244 cgagttcaagcccgaggagatggctgccatcatgaaggatttcgacgagccggggcacct 303

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
            || || || || ||  |||| |||||||| || ||||||||||||||||| ||||||||
Sbjct: 304 cgccccgaccggcctgatcctgggaggcaccaagtacatggtcatccaaggcgaacctgg 363

                                                                       
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagac-gggcatgg 409
            | ||||||||| || ||||||||  |||| ||||| ||| | ||||| || ||||| | 
Sbjct: 364 agctgtcatccgtggcaagaagggatccggaggcatcactgtgaagaaaacagggca-gt 422

                                                                       
Query: 410 ccctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtgg 469
           | || ||  |||| |||||||| ||||| |||||||| || ||||||||  |||| ||||
Sbjct: 423 cactcatcattggcatctacgacgagccgatgactcccgggcagtgcaacctggtggtgg 482

                                          
Query: 470 agaggcttggcgactacctggtcgagcaggg 500
           | ||||| |||||||||||| |||| |||||
Sbjct: 483 aaaggctgggcgactacctgctcgaacaggg 513



to top

>emb|Y08390.1|CDY08390 C.dactylon mRNA for profilin 1
          Length = 396

 Score =  133 bits (67), Expect = 7e-28
 Identities = 214/263 (81%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||| |||||||||||    ||||||||||| || || ||||||
Sbjct: 1   atgtcgtggcaggcgtacgtggacgaccacctcatgtgcgagatcgagggacatcacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||||||||||||||| ||||||| ||||||| ||||||||| |||  | ||  |||||| 
Sbjct: 61  acctccgccgccatcatcggccatgacggcaccgtctgggctcagagcgccgccttcccg 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
             |||||||||||||||||| ||   |||||| |||||||| ||||| |||||   ||||
Sbjct: 121 gcgttcaagcctgaggagatggccaacatcatgaaggacttcgacgagcccgggtttctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           ||||| || || || ||||| ||   ||| || |||||||||||||| || || || || 
Sbjct: 181 gcacccaccggcctcttcctcggccccaccaagtacatggtcatccagggcgagcccggc 240

                                  
Query: 352 gttgtcatccgaggaaagaaggg 374
           |  |||||||| |||||||||||
Sbjct: 241 gccgtcatccgcggaaagaaggg 263



to top

>emb|AJ491881.1|PPE491881 Prunus persica mRNA for profilin, allergen Pru p 4.01
          Length = 396

 Score =  131 bits (66), Expect = 3e-27
 Identities = 309/390 (79%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||| |||||| ||   ||||| || |||||| | | ||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgatgaccacttgatgtgcgatattgacggcaaccgcctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||| |||| || ||||||||||| ||||||||||| ||| | |||  | ||| ||| || 
Sbjct: 61  accgccgcggcaatcctcggccaagacggcagcgtttggtctcagagcgccacctttcct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
             ||| |||||||| ||||| |||| |||  | || || || ||| ||||||||   |||
Sbjct: 121 gcgtttaagcctgaagagatagctgccattctgaaagatttcgaccaacccggaacgctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||| | |||||||| || ||||| || ||||| |||||||||||| | || 
Sbjct: 181 gccccaactggtttattccttggtgggacaaagtatatggtgatccaaggtgaagccggt 240

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           | |||||| ||||||||||||||| | |||||||||||| | ||||||||      ||||
Sbjct: 241 gctgtcattcgaggaaagaagggctctggtggcattactgttaagaagaccaatcaggcc 300

                                                                       
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 471
           || ||  ||||||| || ||||||||  ||||||| || ||||||||  || | || || 
Sbjct: 301 ctcatcattggtatatatgatgagcctttgactccagggcagtgcaacatgattgtcgaa 360

                                         
Query: 472 aggcttggcgactacctggtcgagcagggt 501
           ||||||||||| |||||  |||||||||||
Sbjct: 361 aggcttggcgattaccttatcgagcagggt 390



to top

>gb|AF129425.1|AF129425 Prunus avium profilin mRNA, complete cds
          Length = 396

 Score =  131 bits (66), Expect = 3e-27
 Identities = 309/390 (79%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||| |||||| ||   ||||| || |||||| | | ||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgatgaccacttgatgtgcgatattgacggcaaccgcctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||| |||| || ||||||||||| ||||||||||| ||| | |||  | ||| ||| || 
Sbjct: 61  accgccgcggcaatcctcggccaagacggcagcgtttggtctcagagcgccacctttcct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
             ||| |||||||| ||||| |||| |||  | || || || ||| ||||||||   |||
Sbjct: 121 gcgtttaagcctgaagagatagctgccattctgaaagatttggaccaacccggaacgctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||  | |||||||| || |||||||| ||||| |||||||||||| | || 
Sbjct: 181 gccccaactgggttattccttggtgggacaaaatatatggtgatccaaggtgaagccggt 240

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           | |||||| ||||||||||||||| | |||||||||||| | ||||||||      ||||
Sbjct: 241 gctgtcattcgaggaaagaagggctctggtggcattactgttaagaagaccaatcaggcc 300

                                                                       
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 471
           || ||  ||||||| || ||||||||  ||||||| || ||||||||  || | || || 
Sbjct: 301 ctcatcattggtatatatgatgagcctttgactccagggcagtgcaacatgattgttgaa 360

                                         
Query: 472 aggcttggcgactacctggtcgagcagggt 501
           ||||||||||| |||||  |||||||||||
Sbjct: 361 aggcttggcgattaccttatcgagcagggt 390



to top

>gb|DQ400579.1| Mangifera indica profilin 2 mRNA, complete cds
          Length = 660

 Score =  127 bits (64), Expect = 4e-26
 Identities = 279/348 (80%), Gaps = 2/348 (0%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||| ||||| |||   ||||| || || ||| | ||||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgatgaccatctgatgtgcgatattgagggcaaccacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
            |  | || |||||||||||||| |||||||||||  ||||||||  | |||||||||| 
Sbjct: 61  gctgctgctgccatcctcggccaggacggcagcgttcgggcccagagcgccaacttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccgg-acatct 290
           ||||| |||||||| ||  || ||||||||| ||| |||||  | ||||| || ||| ||
Sbjct: 121 cagttgaagcctgaagaagttactggcatcaataatgacttcaatgaacctggtaca-ct 179

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
           |||||||||||| || |  ||||| || || || || ||||| |||||||| || || ||
Sbjct: 180 tgcaccaactggactatatcttggtggtacgaagtatatggtgatccaaggggagccagg 239

                                                                       
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggc 410
            | |||||| ||||||||||||||  | |||||  ||||| |||| |||||  |||||||
Sbjct: 240 agctgtcattcgaggaaagaagggacctggtggtgttactgtcaaaaagaccagcatggc 299

                                                           
Query: 411 cctgattcttggtatctacgatgagcccatgactcctggccagtgcaa 458
           | |  |  |||||||||| |||||||| ||||||||||| ||||||||
Sbjct: 300 ctttgtcattggtatctatgatgagccaatgactcctggacagtgcaa 347



to top

>emb|Y08389.1|CDY08389 C.dactylon mRNA for profilin 2
          Length = 396

 Score =  125 bits (63), Expect = 2e-25
 Identities = 213/263 (80%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||| |||||||||||    ||||||||||| || || ||||||
Sbjct: 1   atgtcgtggcaggcgtacgtggacgaccacctcatgtgcgagatcgagggacaccacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||||||||||||||| ||||||| ||||||| ||||||||| |||  | ||  |||||| 
Sbjct: 61  acctccgccgccatcatcggccatgacggcaccgtctgggctcagagcgccgccttcccg 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
             |||||||||||||||||| ||   |||||| |||||||| ||||| || ||   ||||
Sbjct: 121 gcgttcaagcctgaggagatggccaacatcatgaaggacttcgacgagcctgggtttctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || || || || || ||||||||   ||| || |||||||||||||| || || || || 
Sbjct: 181 gcccccaccggcctcttccttggccccaccaagtacatggtcatccagggcgagcccggc 240

                                  
Query: 352 gttgtcatccgaggaaagaaggg 374
           |  |||||||| |||||||||||
Sbjct: 241 gccgtcatccgcggaaagaaggg 263



to top

>emb|AJ507458.1|MDO507458 Malus x domestica mRNA for apple allergen profilin (pf-2 gene),
           clone 2
          Length = 593

 Score =  123 bits (62), Expect = 7e-25
 Identities = 119/138 (86%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||||||||| |||   ||||| ||||| ||| | ||||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccatctgatgtgcgaaatcgaaggcaaccacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
            || ||||||||||| |||||||||||||||||||||||||||||    ||| |||||| 
Sbjct: 61  tccgccgccgccatcatcggccacgacggcagcgtctgggcccagagtgccaccttccct 120

                             
Query: 232 cagttcaagcctgaggag 249
           ||||| ||||||||||||
Sbjct: 121 cagttgaagcctgaggag 138



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 79/91 (86%)
 Strand = Plus / Plus

                                                                       
Query: 310 cttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaag 369
           |||||||| || ||||||||||||||||| |||||||| || ||||| || |||||||||
Sbjct: 199 cttggagggaccaaatacatggtcatccagggtgaaccaggagttgtgattcgaggaaag 258

                                          
Query: 370 aagggcaccggtggcattactatcaagaaga 400
           |||||| | |||||  ||||| |||||||||
Sbjct: 259 aagggccctggtggtgttactgtcaagaaga 289



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 430 gatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttgg 479
           |||||||| |||||||||||||| |||||  |||| || |||||||||||
Sbjct: 319 gatgagccgatgactcctggccaatgcaacatggttgttgagaggcttgg 368



to top

>emb|X73281.1|ZMPRO3MR Z.mays ZmPRO3 mRNA for profilin 3
          Length = 777

 Score =  121 bits (61), Expect = 3e-24
 Identities = 307/389 (78%)
 Strand = Plus / Plus

                                                                       
Query: 109 aggatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcac 168
           |||||||||||||||||||||||||| || |||||    ||||||||||| ||||| |||
Sbjct: 121 aggatgtcgtggcagacgtacgtcgatgagcacctcatgtgcgagatcgagggccaccac 180

                                                                       
Query: 169 ctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttc 228
           || | ||| ||||||||  ||||||||||||||  ||| |||||||||  | ||   |||
Sbjct: 181 ctgagctctgccgccatagtcggccacgacggcgccgtttgggcccagagcaccgcattc 240

                                                                       
Query: 229 ccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacat 288
           || ||||||||||| ||||||||  |   ||||||||||||||| ||||| || ||   |
Sbjct: 241 ccacagttcaagccagaggagatgaccaacatcattaaggacttcgacgagcctgggttt 300

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           || || || |  || || ||||||||   ||| || ||||||||||||||||| || || 
Sbjct: 301 ctggccccgatcggcctcttccttggccccaccaagtacatggtcatccaaggcgagccc 360

                                                                       
Query: 349 ggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatg 408
           || | ||||||||| || ||||||||  | || ||||| ||| | |||||||| ||   |
Sbjct: 361 ggcgctgtcatccgcgggaagaagggatctggaggcataactgtgaagaagaccggacag 420

                                                                       
Query: 409 gccctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtg 468
           || ||| |  | || |||||||| ||||||||||| ||||| ||||||||  |||| || 
Sbjct: 421 gcgctggtgatcggcatctacgacgagcccatgacccctggacagtgcaacatggtggtt 480

                                        
Query: 469 gagaggcttggcgactacctggtcgagca 497
           |||||||| || |||||||| || |||||
Sbjct: 481 gagaggctcggtgactacctcgtagagca 509



to top

>emb|AJ132397.1|HBR132397 Hevea brasiliensis mRNA for hevea brasiliensis profilin (Hev b 8)
          Length = 396

 Score =  117 bits (59), Expect = 4e-23
 Identities = 248/311 (79%)
 Strand = Plus / Plus

                                                                       
Query: 178 gccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccccagttc 237
           ||||||||| ||||||| ||||||||||| |||||||||  | |||||||||| ||||||
Sbjct: 67  gccgccatcatcggccaagacggcagcgtttgggcccagagcgccaacttccctcagttc 126

                                                                       
Query: 238 aagcctgaggagattgctggcatcattaaggactttgacgaacccggacatcttgcacca 297
           ||| |||| || ||  ||||||| || |  || ||| ||||||| |||   ||||| |||
Sbjct: 127 aagtctgaagaaatcactggcattatgagtgattttcacgaacctggaacgcttgctcca 186

                                                                       
Query: 298 actggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtc 357
           |||||  | | | |||| ||||||||||||||||| |||||||| || || || | ||||
Sbjct: 187 actggattgtacattggtggcacaaaatacatggtgatccaaggcgagccaggagctgtc 246

                                                                       
Query: 358 atccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggccctgatt 417
           || || || ||||||||| | |||||  ||||| | ||||||||      |||| | || 
Sbjct: 247 attcgggggaagaagggccctggtggtgttactgttaagaagactaatcaggccttaata 306

                                                                       
Query: 418 cttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggctt 477
            ||||||||||||||||||| |||||||| || ||||||||  || | || || ||||||
Sbjct: 307 attggtatctacgatgagccaatgactccagggcagtgcaacatgattgttgaaaggctt 366

                      
Query: 478 ggcgactacct 488
           |||||||||||
Sbjct: 367 ggcgactacct 377



to top

>gb|AF377948.1|AF377948 Musa acuminata profilin mRNA, complete cds
          Length = 396

 Score =  117 bits (59), Expect = 4e-23
 Identities = 212/263 (80%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||| ||||||||  |||  ||||| ||||| ||||||   |||
Sbjct: 1   atgtcgtggcaggcgtacgttgacgaccatttgttgtgcgacatcgatggccagtgtctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||  ||||||||||| |||||||||| ||||||||||||||||||  |  |  |||||| 
Sbjct: 61  acggccgccgccatcgtcggccacgatggcagcgtctgggcccagagcgacgccttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           |||| ||||||||| ||||||||||  || || || ||||| || ||||| ||   ||||
Sbjct: 121 cagtgcaagcctgaagagattgctgcaattatgaaagacttcgatgaacctgggtctctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||| | | |||||| || || || |||||||| |||||||| ||||| || 
Sbjct: 181 gctccaactggtttataccttggtgggacgaagtacatggttatccaaggggaaccagga 240

                                  
Query: 352 gttgtcatccgaggaaagaaggg 374
           | ||| || ||||| ||||||||
Sbjct: 241 gctgttattcgagggaagaaggg 263



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 431 atgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgacta 485
           ||||||||||||| ||||| || |||||| |||| ||||||||||||||||||||
Sbjct: 320 atgagcccatgacgcctggtcaatgcaatatggtagtggagaggcttggcgacta 374



to top

>gb|AF129427.1|AF129427 Malus domestica GD4-2 profilin mRNA, complete cds
          Length = 396

 Score =  115 bits (58), Expect = 2e-22
 Identities = 118/138 (85%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||||||||| |||   ||||| ||||| ||| | ||||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccatctgatgtgcgaaatcgaaggcaaccacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
            || ||||||||||| |||||||| ||||||||||||||||||||    ||| |||||| 
Sbjct: 61  tccgccgccgccatcatcggccacaacggcagcgtctgggcccagagtgccaccttccct 120

                             
Query: 232 cagttcaagcctgaggag 249
           ||||| ||||||||||||
Sbjct: 121 cagttgaagcctgaggag 138



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 139/170 (81%)
 Strand = Plus / Plus

                                                                       
Query: 310 cttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaag 369
           |||||||| || ||||||||||||||||| |||||||| || ||||| || |||||||||
Sbjct: 199 cttggagggaccaaatacatggtcatccagggtgaaccaggagttgtgattcgaggaaag 258

                                                                       
Query: 370 aagggcaccggtggcattactatcaagaagacgggcatggccctgattcttggtatctac 429
           |||||| | |||||  ||||| |||||||||     |||||  || |  |||| || || 
Sbjct: 259 aagggcccaggtggtgttactgtcaagaagagcacaatggctttgctgattgggatttat 318

                                                             
Query: 430 gatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttgg 479
           |||||||| |||||||||||||| |||||  |||| || |||||||||||
Sbjct: 319 gatgagccgatgactcctggccaatgcaacatggttgttgagaggcttgg 368



to top

>gb|AY792613.1| Malus x domestica clone M4-2-FS8 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 863

 Score =  113 bits (57), Expect = 7e-22
 Identities = 93/105 (88%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||||||||| |||   ||||| ||||| ||| | ||||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccatctgatgtgcgaaatcgaaggcaaccacctc 60

                                                        
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccag 216
            || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 61  tccgccgccgccatcatcggccacgacggcagcgtctgggcccag 105



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 310 cttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaag 369
           |||||||| || ||||||||||||||||| |||||||| || ||||| || |||||||||
Sbjct: 447 cttggagggaccaaatacatggtcatccagggtgaaccaggagttgtgattcgaggaaag 506

               
Query: 370 aagg 373
           ||||
Sbjct: 507 aagg 510



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 433 gagcccatgactcctggccagtgcaatttggtcgtggagaggcttgg 479
           ||||| |||||||||||||| |||||  |||| || |||||||||||
Sbjct: 789 gagccgatgactcctggccaatgcaacatggttgttgagaggcttgg 835



to top

>gb|AY792612.1| Malus x domestica clone M4-2-PM2 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 863

 Score =  113 bits (57), Expect = 7e-22
 Identities = 93/105 (88%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||||||||| |||   ||||| ||||| ||| | ||||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccatctgatgtgcgaaatcgaaggcaaccacctc 60

                                                        
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccag 216
            || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 61  tccgccgccgccatcatcggccacgacggcagcgtctgggcccag 105



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 310 cttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaag 369
           |||||||| || ||||||||||||||||| |||||||| || ||||| || |||||||||
Sbjct: 447 cttggagggaccaaatacatggtcatccagggtgaaccaggagttgtgattcgaggaaag 506

               
Query: 370 aagg 373
           ||||
Sbjct: 507 aagg 510



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 433 gagcccatgactcctggccagtgcaatttggtcgtggagaggcttgg 479
           ||||| |||||||||||||| |||||  |||| || |||||||||||
Sbjct: 789 gagccgatgactcctggccaatgcaacatggttgttgagaggcttgg 835



to top

>gb|AY792611.1| Malus x domestica clone M4-2-FS10 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 863

 Score =  113 bits (57), Expect = 7e-22
 Identities = 93/105 (88%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||||||||| |||   ||||| ||||| ||| | ||||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccatctgatgtgcgaaatcgaaggcaaccacctc 60

                                                        
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccag 216
            || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 61  tccgccgccgccatcatcggccacgacggcagcgtctgggcccag 105



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 310 cttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaag 369
           |||||||| || ||||||||||||||||| |||||||| || ||||| || |||||||||
Sbjct: 447 cttggagggaccaaatacatggtcatccagggtgaaccaggagttgtgattcgaggaaag 506

               
Query: 370 aagg 373
           ||||
Sbjct: 507 aagg 510



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 433 gagcccatgactcctggccagtgcaatttggtcgtggagaggcttgg 479
           ||||| |||||||||||||| |||||  |||| || |||||||||||
Sbjct: 789 gagccgatgactcctggccaatgcaacatggttgttgagaggcttgg 835



to top

>gb|AY792610.1| Malus x domestica clone M4-2-PM7 profilin 2 (Mal d 4.02) gene,
           complete cds
          Length = 862

 Score =  113 bits (57), Expect = 7e-22
 Identities = 93/105 (88%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||||||||| |||   ||||| ||||| ||| | ||||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccatctgatgtgcgaaatcgaaggcaaccacctc 60

                                                        
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccag 216
            || ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 61  tccgccgccgccatcatcggccacgacggcagcgtctgggcccag 105



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 310 cttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaag 369
           |||||||| || ||||||||||||||||| |||||||| || ||||| || |||||||||
Sbjct: 447 cttggagggaccaaatacatggtcatccagggtgaaccaggagttgtgattcgaggaaag 506

               
Query: 370 aagg 373
           ||||
Sbjct: 507 aagg 510



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 430 gatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttgg 479
           |||||||| |||||||||||||| |||||  |||| || |||||||||||
Sbjct: 785 gatgagccgatgactcctggccaatgcaacatggttgttgagaggcttgg 834



to top

>gb|AF119365.1|AF119365 Hevea brasiliensis clone hevb 8.2 latex profilin Hev b 8 mRNA,
           complete cds
          Length = 396

 Score =  113 bits (57), Expect = 7e-22
 Identities = 288/365 (78%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||||||||||| || || |||||    ||||| ||||||||||| || |||
Sbjct: 1   atgtcgtggcagacgtacgtggatgagcaccttatgtgcgacatcgacggccaccatctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||  ||||||| ||| |||||||||| |||||||| |||||||||  | ||| |||||| 
Sbjct: 61  acggccgccgctatcatcggccacgatggcagcgtgtgggcccagagctccagcttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           ||||| ||||| || ||| ||||||  ||||| || || ||||| || || |||   |||
Sbjct: 121 cagtttaagccagaagaggttgctgctatcatgaaagattttgatgagcctggatccctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||| |   |||||| |||||||| |||||||| ||||| || || || || 
Sbjct: 181 gccccaactggtttgcaccttggtggcacaaagtacatggtgatccagggagagcccgga 240

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           | ||| || || |||||||||||  | |||||||| ||| | ||||| || |||   || 
Sbjct: 241 gctgtgattcgtggaaagaagggttctggtggcatcactgtgaagaaaaccggccaagct 300

                                                                       
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 471
           || ||| ||||||| |||||||| ||  ||||||| || ||||||||  || |||| |||
Sbjct: 301 ctcattattggtatttacgatgaaccattgactccaggacagtgcaacatgatcgtagag 360

                
Query: 472 aggct 476
           |||||
Sbjct: 361 aggct 365



to top

>gb|AY081850.1| Prunus dulcis profilin (pru du 4.1) mRNA, complete cds
          Length = 924

 Score =  109 bits (55), Expect = 1e-20
 Identities = 307/391 (78%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           |||||||||||||  ||||||||| |||||| ||   ||||| || |||||| | | |||
Sbjct: 136 gatgtcgtggcagcagtacgtcgatgaccacttgatgtgcgatattgacggcaaccgcct 195

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||| | || || ||||||||||| ||||||||||| ||| | |||  | ||| ||| ||
Sbjct: 196 caccgcggcggcaatcctcggccaagacggcagcgtttggtctcagagcgccacctttcc 255

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
              ||| |||||||| ||||| |||| |||  | || || || ||| ||||||||   ||
Sbjct: 256 tgcgtttaagcctgaagagatagctgccattctgaaagatttcgaccaacccggaacgct 315

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
           ||| ||||||||  | |||||||| || ||||| || ||||| |||||||||||| | ||
Sbjct: 316 tgccccaactgggttattccttggtgggacaaagtatatggtgatccaaggtgaagccgg 375

                                                                       
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggc 410
            | |||||| ||||||||||||||| | |||||||||||| | ||||||||      |||
Sbjct: 376 tgctgtcattcgaggaaagaagggctctggtggcattactgttaagaagaccaatcaggc 435

                                                                       
Query: 411 cctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtgga 470
           ||| ||  ||||||| || ||||||||  ||||||| || ||||||||  || | || ||
Sbjct: 436 cctcatcattggtatatatgatgagcctttgactccagggcagtgcaacatgattgtcga 495

                                          
Query: 471 gaggcttggcgactacctggtcgagcagggt 501
            ||||||||||| |||||  |||||||||||
Sbjct: 496 aaggcttggcgattaccttatcgagcagggt 526



to top

>gb|DQ335252.1| Cinnamomum camphora profilin-like protein (Cin c 1) mRNA, complete
           cds
          Length = 697

 Score =  109 bits (55), Expect = 1e-20
 Identities = 274/347 (78%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||| |||||||| |||   ||||| |||||||||||||| |||
Sbjct: 1   atgtcgtggcaggcgtacgtagacgaccatctgatgtgcgacatcgacggccagcatctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||  ||||||| ||| ||||||||||||| |||||||||||||||  |      || || 
Sbjct: 61  acagccgccgcgatcgtcggccacgacggaagcgtctgggcccagagcgattcttttcct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           ||||| ||||||||||||||   ||| ||||| || || ||| | ||||| ||| | |||
Sbjct: 121 cagtttaagcctgaggagatcaatggtatcatgaacgattttaatgaaccaggatacctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || || |||||| | | |||||| || ||||| || ||||| || ||||| || ||||| 
Sbjct: 181 gcccctactggtttataccttgggggtacaaagtatatggttattcaaggagagcctggt 240

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           | ||| ||||| |||||||||||  | ||||| || ||||| ||||| || |||   || 
Sbjct: 241 gctgttatccgtggaaagaagggatctggtggtatcactattaagaaaaccggccaagct 300

                                                          
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaa 458
            | ||| | |||||||| ||||||||| |||| || |||||||||||
Sbjct: 301 ttaattttcggtatctatgatgagcccttgaccccaggccagtgcaa 347



to top

>gb|AF129424.1|AF129424 Pyrus communis profilin mRNA, complete cds
          Length = 396

 Score =  105 bits (53), Expect = 2e-19
 Identities = 119/141 (84%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||| ||| ||   ||||| ||||||||||| || || 
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgatcacttgatgtgcgacatcgacggccaccatctg 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||| |||| |||||||||||||||||||| || || |||||||||  | ||| |||||||
Sbjct: 61  accgccgcggccatcctcggccacgacggtagtgtgtgggcccagagctccaccttcccc 120

                                
Query: 232 cagttcaagcctgaggagatt 252
            |||||||||| || ||||||
Sbjct: 121 aagttcaagccggaagagatt 141



to top

>gb|AY726606.1| Arachis hypogaea profilin (PROF) mRNA, complete cds
          Length = 604

 Score =  103 bits (52), Expect = 6e-19
 Identities = 230/290 (79%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| | |||||||| || |||||   |||||| ||||| ||  | || |||
Sbjct: 106 atgtcgtggcaggcctacgtcgatgagcaccttatctgcgacatcgagggtaatcagctc 165

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           || || ||||||||||||||||| ||||||||||| ||||| |||  | |||| ||||| 
Sbjct: 166 acgtctgccgccatcctcggccaagacggcagcgtttgggctcagagctccaatttccct 225

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           ||||||||||||||||| ||  |||  ||||| || || || |  || ||||||   |||
Sbjct: 226 cagttcaagcctgaggaaatcactgctatcatgaatgatttcgcggagcccggaacactt 285

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || || ||||| |||| ||| || || |||||||| ||||| ||||||||||| || || 
Sbjct: 286 gctcctactggactttacctcggtggaacaaaatatatggtaatccaaggtgagcccgga 345

                                                             
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagac 401
           | |||||||| | |||| |||||  | |||||  ||||||| ||||||||
Sbjct: 346 gctgtcatccaangaaanaagggtcctggtggtgttactattaagaagac 395



to top

>gb|AY792617.1| Malus x domestica clone M4-5-FS4 profilin 3 (Mal d 4.03) gene,
           complete cds
          Length = 1033

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||||||||||   ||||| ||||||||| | | ||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgatatcgacggcaaccgcctc 60

                                              
Query: 172 acctccgccgccatcctcggccacgacggcagcgt 206
           ||| ||||||| ||||||||||| |||||||||||
Sbjct: 61  accgccgccgctatcctcggccaagacggcagcgt 95



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Plus

                                                                        
Query: 385  attactatcaagaagacgggcatggccctgattcttggtatctacgatgagcccatgact 444
            |||||||||||||||||  ||  ||||||| |  | ||||| || ||||||||  |||||
Sbjct: 911  attactatcaagaagaccagccaggccctgttaatcggtatatatgatgagcctgtgact 970

                                                                        
Query: 445  cctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcagggtttc 504
            ||||| ||||||||  | || || |||||||| ||||| |||||  ||||||||||| ||
Sbjct: 971  cctgggcagtgcaacatagttgttgagaggctgggcgattaccttatcgagcagggtctc 1030

               
Query: 505  taa 507
            |||
Sbjct: 1031 taa 1033



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 112/141 (79%)
 Strand = Plus / Plus

                                                                       
Query: 233 agttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatcttg 292
           |||| |||||||||||||||||||  ||  | || || || ||  ||||||||   ||||
Sbjct: 511 agtttaagcctgaggagattgctgcaattctgaaagatttcgatcaacccggaacacttg 570

                                                                       
Query: 293 caccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgggg 352
           | ||||||||  | |||||||| || || || || ||||| ||||| |||||||| || |
Sbjct: 571 ccccaactggattattccttggtgggacgaagtatatggtgatccagggtgaacccggcg 630

                                
Query: 353 ttgtcatccgaggaaagaagg 373
            |||||| |||||||||||||
Sbjct: 631 ctgtcattcgaggaaagaagg 651



to top

>gb|AY792616.1| Malus x domestica clone M4-5-FS5 profilin 3 (Mal d 4.03) gene,
           complete cds
          Length = 1032

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||||||||||   ||||| ||||||||| | | ||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgatatcgacggcaaccgcctc 60

                                              
Query: 172 acctccgccgccatcctcggccacgacggcagcgt 206
           ||| ||||||| ||||||||||| |||||||||||
Sbjct: 61  accgccgccgctatcctcggccaagacggcagcgt 95



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Plus

                                                                        
Query: 385  attactatcaagaagacgggcatggccctgattcttggtatctacgatgagcccatgact 444
            |||||||||||||||||  ||  ||||||| |  | ||||| || ||||||||  |||||
Sbjct: 910  attactatcaagaagaccagccaggccctgttaatcggtatatatgatgagcctgtgact 969

                                                                        
Query: 445  cctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcagggtttc 504
            ||||| ||||||||  | || || |||||||| ||||| |||||  ||||||||||| ||
Sbjct: 970  cctgggcagtgcaacatagttgttgagaggctgggcgattaccttatcgagcagggtctc 1029

               
Query: 505  taa 507
            |||
Sbjct: 1030 taa 1032



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 112/141 (79%)
 Strand = Plus / Plus

                                                                       
Query: 233 agttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatcttg 292
           |||| |||||||||||||||||||  ||  | || || || ||  ||||||||   ||||
Sbjct: 510 agtttaagcctgaggagattgctgcaattctgaaagatttcgatcaacccggaacacttg 569

                                                                       
Query: 293 caccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgggg 352
           | ||||||||  | |||||||| || || || || ||||| ||||| |||||||| || |
Sbjct: 570 ccccaactggattattccttggtgggacgaagtatatggtgatccagggtgaacccggcg 629

                                
Query: 353 ttgtcatccgaggaaagaagg 373
            |||||| |||||||||||||
Sbjct: 630 ctgtcattcgaggaaagaagg 650



to top

>gb|AY792615.1| Malus x domestica clone M4-5-PM2 profilin 3 (Mal d 4.03) gene,
           complete cds
          Length = 1032

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||||||||||   ||||| ||||||||| | | ||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgatatcgacggcaaccgcctc 60

                                              
Query: 172 acctccgccgccatcctcggccacgacggcagcgt 206
           ||| ||||||| ||||||||||| |||||||||||
Sbjct: 61  accgccgccgctatcctcggccaagacggcagcgt 95



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Plus

                                                                        
Query: 385  attactatcaagaagacgggcatggccctgattcttggtatctacgatgagcccatgact 444
            |||||||||||||||||  ||  ||||||| |  | ||||| || ||||||||  |||||
Sbjct: 910  attactatcaagaagaccagccaggccctgttaatcggtatatatgatgagcctgtgact 969

                                                                        
Query: 445  cctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcagggtttc 504
            ||||| ||||||||  | || || |||||||| ||||| |||||  ||||||||||| ||
Sbjct: 970  cctgggcagtgcaacatagttgttgagaggctgggcgattaccttatcgagcagggtctc 1029

               
Query: 505  taa 507
            |||
Sbjct: 1030 taa 1032



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 112/141 (79%)
 Strand = Plus / Plus

                                                                       
Query: 233 agttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatcttg 292
           |||| |||||||||||||||||||  ||  | || || || ||  ||||||||   ||||
Sbjct: 510 agtttaagcctgaggagattgctgcaattctgaaagatttcgatcaacccggaacacttg 569

                                                                       
Query: 293 caccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgggg 352
           | ||||||||  | |||||||| || || || || ||||| ||||| |||||||| || |
Sbjct: 570 ccccaactggattattccttggtgggacgaagtatatggtgatccagggtgaacccggcg 629

                                
Query: 353 ttgtcatccgaggaaagaagg 373
            |||||| |||||||||||||
Sbjct: 630 ctgtcattcgaggaaagaagg 650



to top

>gb|AY792614.1| Malus x domestica clone M4-5-PM7 profilin 3 (Mal d 4.03) gene,
           complete cds
          Length = 1030

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||||||||||   ||||| ||||||||| | | ||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgaccacctgatgtgcgatatcgacggcaaccgcctc 60

                                              
Query: 172 acctccgccgccatcctcggccacgacggcagcgt 206
           ||| ||||||| ||||||||||| |||||||||||
Sbjct: 61  accgccgccgctatcctcggccaagacggcagcgt 95



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 100/123 (81%)
 Strand = Plus / Plus

                                                                        
Query: 385  attactatcaagaagacgggcatggccctgattcttggtatctacgatgagcccatgact 444
            |||||||||||||||||  ||  ||||||| |  | ||||| || ||||||||  |||||
Sbjct: 908  attactatcaagaagaccagccaggccctgttaatcggtatatatgatgagcctgtgact 967

                                                                        
Query: 445  cctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcagggtttc 504
            ||||| ||||||||  | || || |||||||| ||||| |||||  ||||||||||| ||
Sbjct: 968  cctgggcagtgcaacatagttgttgagaggctgggcgattaccttatcgagcagggtctc 1027

               
Query: 505  taa 507
            |||
Sbjct: 1028 taa 1030



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                       
Query: 307 ttccttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgagga 366
           |||||||| || || || || ||||| ||||| |||||||| || | |||||| ||||||
Sbjct: 582 ttccttggtgggacgaagtatatggtgatccagggtgaacccggcgctgtcattcgagga 641

                  
Query: 367 aagaagg 373
           |||||||
Sbjct: 642 aagaagg 648



to top

>gb|AY550179.1| Elaeis oleifera profilin mRNA, partial cds
          Length = 452

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 161/198 (81%)
 Strand = Plus / Plus

                                                                       
Query: 108 gaggatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagca 167
           ||||||||||||||| |||||||||||||| || |||   || |||||||||||||||| 
Sbjct: 51  gaggatgtcgtggcaaacgtacgtcgacgatcatctgatgtgtgagatcgacggccagcg 110

                                                                       
Query: 168 cctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaactt 227
            || ||  |||||||||||||||||||||| |||||| ||||||| |||  |     |||
Sbjct: 111 tcttacggccgccgccatcctcggccacgatggcagcatctgggcgcagagcgattcctt 170

                                                                       
Query: 228 cccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggaca 287
           ||||||| |||| || || |||||  |||||||||||||  |||||   ||||| |||  
Sbjct: 171 cccccaggtcaaacccgaagagatatctggcatcattaattacttttcagaacctggatt 230

                             
Query: 288 tcttgcaccaactggtct 305
           |||||| |||||||||||
Sbjct: 231 tcttgcgccaactggtct 248



to top

>gb|AF200186.1|AF200186 Lilium longiflorum profilin 3 mRNA, complete cds
          Length = 700

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 92/106 (86%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||||||||||||||||| ||||||   |||||||||||||| ||||||||
Sbjct: 37  gatgtcgtggcagacgtacgtcgacgagcacctgatgtgcgagatcgacgggcagcacct 96

                                                         
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccag 216
           |||| |||| || ||| |||| || || ||| || |||||||||||
Sbjct: 97  caccgccgcggcgatcatcggtcatgagggcggcatctgggcccag 142



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 427 tacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggct 476
           ||||| ||||| ||||||||||| ||||||||  |||| |||||||||||
Sbjct: 353 tacgacgagccaatgactcctggtcagtgcaacatggttgtggagaggct 402



to top

>emb|AJ565931.1|CME565931 Cucumis melo mRNA for profilin (cuc m 2 gene)
          Length = 396

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 172/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||||||| | |||||||| || ||||| || ||||| |||||||||||| | 
Sbjct: 178 cttgccccaactggtttattccttggtgggacaaagtatatggtgatccaaggtgaagcc 237

                                                                       
Query: 349 ggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatg 408
           || | |||||| ||||||||||||||| | |||||||||||| | ||||||||      |
Sbjct: 238 ggtgctgtcattcgaggaaagaagggctctggtggcattactgttaagaagaccaatcag 297

                                                                       
Query: 409 gccctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtg 468
           ||||| ||  ||||||| || ||||||||  ||||||| || ||||||||  || | || 
Sbjct: 298 gccctcatcattggtatatatgatgagcctttgactccagggcagtgcaacatgattgtc 357

                                            
Query: 469 gagaggcttggcgactacctggtcgagcagggt 501
           || ||||||||||| |||||  |||||||||||
Sbjct: 358 gaaaggcttggcgattaccttatcgagcagggt 390



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||| |||||| ||   ||||| || |||||| | | ||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgatgaccacttgatgtgcgatattgacggcaaccgcctc 60

                                              
Query: 172 acctccgccgccatcctcggccacgacggcagcgt 206
           ||| |||| || ||||||||||| |||||||||||
Sbjct: 61  accgccgcggcaatcctcggccaagacggcagcgt 95



to top

>emb|AJ417566.1|PDA417566 Phoenix dactylifera mRNA for profilin (pro gene)
          Length = 396

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||| |||||    ||||||||||| ||||| ||||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgagcacctcatgtgcgagatcgatggccatcacctc 60

                                                        
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccag 216
           ||| |||| || |||||||| || || ||||||||||||||||||
Sbjct: 61  accgccgcggcgatcctcgggcatgatggcagcgtctgggcccag 105



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 419 ttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttg 478
           |||| |||||||| |||||||||||||| |||||||||||  |||| || |||||| | |
Sbjct: 308 ttggcatctacgaagagcccatgactccaggccagtgcaacatggttgttgagaggttgg 367

                     
Query: 479 gcgactacct 488
           | ||||||||
Sbjct: 368 gtgactacct 377



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 319 acaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaaggg 374
           |||||||| ||||| |||||||| |||||||| | ||| ||||| |||||||||||
Sbjct: 208 acaaaatatatggttatccaaggagaacctggagctgttatccgtggaaagaaggg 263



to top

>gb|AY081852.1| Prunus dulcis profilin (pru du 4.2) mRNA, complete cds
          Length = 742

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 305/391 (78%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           |||||||||||||  ||||||||| |||||| ||   ||||| || |||||| | | |||
Sbjct: 14  gatgtcgtggcagcagtacgtcgatgaccacttgatgtgcgatattgacggcaaccgcct 73

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||| | || || ||||||||||| ||||||||||| ||| | |||  | ||| ||| ||
Sbjct: 74  caccgcggcggcaatcctcggccaagacggcagcgtttggtctcagagcgccacctttcc 133

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
              ||| |||||||| ||||| |||| |||  | || || || ||| |||||||    ||
Sbjct: 134 tgcgtttaagcctgaagagatagctgccattctgaaagatttcgaccaacccggtacgct 193

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
           ||| || |||||  | |||||||| || ||||| || ||||| |||||||||||| | ||
Sbjct: 194 tgccccgactgggttattccttggtgggacaaagtatatggtgatccaaggtgaagccgg 253

                                                                       
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggc 410
            | |||||| ||||||||||||||| | |||||||||||| | ||||||||      |||
Sbjct: 254 tgctgtcattcgaggaaagaagggctctggtggcattactgttaagaagaccaatcaggc 313

                                                                       
Query: 411 cctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtgga 470
           ||| ||  ||||||| || ||||||||  ||||||| || ||||||||  || | || ||
Sbjct: 314 cctcatcattggtatatatgatgagcctttgactccagggcagtgcaacatgattgtcga 373

                                          
Query: 471 gaggcttggcgactacctggtcgagcagggt 501
            ||||||||||| |||||  |||||||||||
Sbjct: 374 aaggcttggcgattaccttatcgagcagggt 404



to top

>gb|AF119366.1|AF119366 Hevea brasiliensis clone hevb 8.8 latex profilin Hev b 8 mRNA,
           complete cds
          Length = 396

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 209/263 (79%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||||||||||| || || |||||    ||||| ||||||||||| |  |||
Sbjct: 1   atgtcgtggcagacgtacgtggatgatcaccttatgtgcgatatcgacggccaccgtctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||  | ||||| ||| |||||||||| |||||||| |||||||||  | ||| |||||| 
Sbjct: 61  acggcggccgctatcatcggccacgatggcagcgtgtgggcccagagctccagcttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           ||||| ||| | || ||| ||||||  ||||| || || ||||| ||||| |||   |||
Sbjct: 121 cagtttaagtcagatgaggttgctgctatcatgaaagattttgatgaacctggatccctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||| |   ||||||  ||||||| |||||||| ||||| || || ||||||
Sbjct: 181 gccccaactggtttgcaccttggtagcacaaagtacatggtgatccagggagagcctggg 240

                                  
Query: 352 gttgtcatccgaggaaagaaggg 374
           | ||| || || |||||||||||
Sbjct: 241 gctgtgattcgtggaaagaaggg 263



to top

>gb|AY109853.1| Zea mays CL2096_2 mRNA sequence
          Length = 821

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 211/266 (79%)
 Strand = Plus / Plus

                                                                       
Query: 109 aggatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcac 168
           ||||||||||||||||| |||||||| || |||||    ||||||||||| ||||| |||
Sbjct: 90  aggatgtcgtggcagacatacgtcgatgagcacctcatgtgcgagatcgagggccaccac 149

                                                                       
Query: 169 ctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttc 228
           || |||||||| |||||  ||||||||||||||  ||| |||||||||  | ||   |||
Sbjct: 150 ctgacctccgctgccatagtcggccacgacggcgccgtttgggcccagagcaccgcattc 209

                                                                       
Query: 229 ccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacat 288
           || ||||||||| | ||||||||  |   |||||| |||||||| ||||| |||||    
Sbjct: 210 ccacagttcaagacagaggagatgaccaacatcatgaaggacttcgacgagcccgggttc 269

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| || || || || ||||| ||   ||| || ||||||||||||||||| || || 
Sbjct: 270 cttgccccgaccggcctcttcctcggccccaccaagtacatggtcatccaaggcgagccc 329

                                     
Query: 349 ggggttgtcatccgaggaaagaaggg 374
           || | ||||||||| || ||||||||
Sbjct: 330 ggcgctgtcatccgcgggaagaaggg 355



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 424 atctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgac 483
           |||||||| ||||||||||   | |||||||||||  |||| || |||||||| ||||||
Sbjct: 405 atctacgacgagcccatgangaccggccagtgcaacatggtggtcgagaggctcggcgac 464

                         
Query: 484 tacctggtcgagca 497
           ||||| || |||||
Sbjct: 465 tacctcgtagagca 478



to top

>emb|Y15042.1|HBY15042 Hevea brasiliensis mRNA for profilin
          Length = 396

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 132/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 181 gccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccccagttcaag 240
           |||||| ||||||| |||||||||||||||||||||  | |||||||||| |||||||||
Sbjct: 70  gccatcatcggccaagacggcagcgtctgggcccagagctccaacttccctcagttcaag 129

                                                                       
Query: 241 cctgaggagattgctggcatcattaaggactttgacgaacccggacatcttgcaccaact 300
            |||| || ||  ||| ||| || |  |||||||||||||| |||   || || ||||||
Sbjct: 130 tctgaagaaatcactgccattatgagtgactttgacgaacctggaacactagctccaact 189

                                                    
Query: 301 ggtcttttccttggaggcacaaaatacatggtcatccaagg 341
           ||| |   ||| || ||||||||||||||||| ||||||||
Sbjct: 190 ggtttgcacctgggtggcacaaaatacatggtgatccaagg 230



to top

>emb|X81982.1|PVPROFILN P.vulgaris mRNA for profilin
          Length = 759

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 87/101 (86%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           ||||||||||| ||||||||||||||||||||   ||| |||||||| ||  | ||||||
Sbjct: 51  atgtcgtggcaaacgtacgtcgacgaccaccttctctgtgagatcgaaggtaaccacctc 110

                                                    
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggc 212
           ||   |||||||||||||||||| ||||||||||| |||||
Sbjct: 111 actcacgccgccatcctcggccaagacggcagcgtttgggc 151



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                       
Query: 311 ttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaaga 370
           |||| ||||| ||||| |||||||||||||||||||| ||   |||||| ||||| ||||
Sbjct: 250 ttggtggcactaaatatatggtcatccaaggtgaacccggctctgtcattcgaggcaaga 309

               
Query: 371 aggg 374
           ||||
Sbjct: 310 aggg 313



to top

>emb|AJ865015.1| Citrus sinensis mRNA for profilin allergen Cit s 2.0102 (cit s
           2.0102 gene)
          Length = 396

 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 171/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||||||| | |||||||| || ||||| || ||||| |||||||||||| | 
Sbjct: 178 cttgccccaactggtttattccttggtgggacaaagtatatggtgatccaaggtgaagcc 237

                                                                       
Query: 349 ggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatg 408
           || | |||||| ||||||||||||||| | |||||||||| | | ||||||||      |
Sbjct: 238 ggtgctgtcattcgaggaaagaagggctctggtggcattattgttaagaagaccaatcag 297

                                                                       
Query: 409 gccctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtg 468
           ||||| ||  ||||||| || ||||||||  ||||||| || ||||||||  || | || 
Sbjct: 298 gccctcatcattggtatatatgatgagcctttgactccagggcagtgcaacatgattgtc 357

                                            
Query: 469 gagaggcttggcgactacctggtcgagcagggt 501
           || ||||||||||| |||||  |||||||||||
Sbjct: 358 gaaaggcttggcgattaccttatcgagcagggt 390



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||| |||||| ||   ||||| || |||||| | | ||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgatgaccacttgatgtgcgatattgacggcaaccgcctc 60

                                              
Query: 172 acctccgccgccatcctcggccacgacggcagcgt 206
           ||| |||| || ||||||||||| |||||||||||
Sbjct: 61  accgccgcggcaatcctcggccaagacggcagcgt 95



to top

>gb|AF200184.1|AF200184 Lilium longiflorum profilin 1 mRNA, complete cds
          Length = 752

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 146/180 (81%)
 Strand = Plus / Plus

                                                                       
Query: 322 aaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggt 381
           ||||| ||||| || ||||| || ||||| | ||| ||||| |||||||||||  | |||
Sbjct: 259 aaatatatggtgattcaaggagagcctggagctgttatccgtggaaagaagggatctggt 318

                                                                       
Query: 382 ggcattactatcaagaagacgggcatggccctgattcttggtatctacgatgagcccatg 441
           ||  | ||||| |||||||| |||  ||| || ||| | ||||||||||| || || |||
Sbjct: 319 ggtgtgactattaagaagacaggccaggctcttattttcggtatctacgaggaaccgatg 378

                                                                       
Query: 442 actcctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcagggt 501
           ||||| || ||||||||  |||||||||||||| | ||||||||||| ||||| ||||||
Sbjct: 379 actccagggcagtgcaacatggtcgtggagaggatgggcgactaccttgtcgatcagggt 438



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 229 ccccagttcaagcctgaggagat 251
           |||||||||||||||||||||||
Sbjct: 166 ccccagttcaagcctgaggagat 188



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacct 143
           ||||||||||||||| |||||||| || |||||
Sbjct: 48  gatgtcgtggcagacttacgtcgatgatcacct 80



to top

>emb|AJ870450.1| Fragaria x ananassa microsatellite DNA, locus UFFa09F09
          Length = 218

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 119/144 (82%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           |||||||||||||  |||||| ||||| ||| ||   ||||| ||||||||| |    ||
Sbjct: 75  gatgtcgtggcagcagtacgtggacgagcacttgatgtgcgatatcgacggcaactctct 134

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||| ||||||||||||||||||| ||||||||||||||| | |||  | ||||||||||
Sbjct: 135 caccgccgccgccatcctcggccaagacggcagcgtctggtctcagagctccaacttccc 194

                                   
Query: 231 ccagttcaagcctgaggagattgc 254
            ||||| ||||| || ||||||||
Sbjct: 195 tcagtttaagccggaagagattgc 218



to top

>gb|AY268422.1| Humulus scandens profilin-like protein (LCS13) mRNA, complete cds
          Length = 577

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 154/191 (80%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||| ||||| |||   ||||| ||||| || || || |||
Sbjct: 1   atgtcgtggcaggcgtacgtcgatgaccatctgatgtgcgaaatcgatggtcaacatctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||| | || |||||| ||||||||||||| || |||||||| |||  | ||| |||||| 
Sbjct: 61  accgcagcggccatcatcggccacgacggtagtgtctgggctcagagctccaccttcccg 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           ||||| |||||||| || |||||||  ||||| || || ||||| ||||| ||   ||||
Sbjct: 121 cagtttaagcctgaagaaattgctgctatcatgaaagattttgaagaacctgggtctctt 180

                      
Query: 292 gcaccaactgg 302
           || ||||||||
Sbjct: 181 gccccaactgg 191



to top

>gb|AY268423.1| Humulus scandens profilin-like protein (LCM20) mRNA, complete cds
          Length = 648

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 154/191 (80%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||| ||||| |||   ||||| ||||| || || || |||
Sbjct: 1   atgtcgtggcaggcgtacgtcgatgaccatctgatgtgcgaaatcgatggtcaacatctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||| | || |||||| ||||||||||||| || |||||||| |||  | ||| |||||| 
Sbjct: 61  accgcagcggccatcatcggccacgacggtagtgtctgggctcagagctccaccttcccg 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           ||||| |||||||| || |||||||  ||||| || || ||||| ||||| ||   ||||
Sbjct: 121 cagtttaagcctgaagaaattgctgctatcatgaaagattttgaagaacctgggtctctt 180

                      
Query: 292 gcaccaactgg 302
           || ||||||||
Sbjct: 181 gccccaactgg 191



to top

>emb|X93465.1|NTPRO2MR N.tabacum mRNA for profilin (clone NTPRO2)
          Length = 713

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 156/194 (80%)
 Strand = Plus / Plus

                                                                       
Query: 271 tttgacgaacccggacatcttgcaccaactggtcttttccttggaggcacaaaatacatg 330
           ||||| ||||| |||||||| || ||||||||| | |||||||| ||  |||||||||||
Sbjct: 222 tttgatgaacctggacatctagctccaactggtttattccttggcggggcaaaatacatg 281

                                                                       
Query: 331 gtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggcattact 390
           || |||||||| |||||||| | |||||| || || ||||||||  | ||||| || || 
Sbjct: 282 gtaatccaaggagaacctggcgctgtcattcgtgggaagaagggatctggtggaataacc 341

                                                                       
Query: 391 atcaagaagacgggcatggccctgattcttggtatctacgatgagcccatgactcctggc 450
           |||||||| ||   |  ||| |||||| |||||||||| || || ||  ||||||| || 
Sbjct: 342 atcaagaaaactaaccaggctctgatttttggtatctatgaggaaccagtgactccagga 401

                         
Query: 451 cagtgcaatttggt 464
           ||||||||| ||||
Sbjct: 402 cagtgcaatatggt 415



to top

>emb|X82120.1|NTPROFLN N.tabacum mRNA for profilin
          Length = 653

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 gaacccggacatcttgcaccaactggtcttttccttggaggcacaaaatacatggtcatc 336
           ||||| |||||||| || ||||||||| | |||||||| ||  ||||||||||||| |||
Sbjct: 212 gaacctggacatctagctccaactggtttattccttggcggggcaaaatacatggtaatc 271

                                                 
Query: 337 caaggtgaacctggggttgtcatccgaggaaagaaggg 374
           ||||| |||||||| | ||||||||| || ||||||||
Sbjct: 272 caaggagaacctggcgctgtcatccgtgggaagaaggg 309



to top

>emb|AJ491882.1|PPE491882 Prunus persica mRNA for profilin, allergen Pru p 4.02
          Length = 396

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||| |||||||| |||   ||||| || || ||| | ||||||
Sbjct: 1   atgtcgtggcaggcgtacgtagacgaccatctgatgtgcgaaattgaaggcaaccacctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
            |  ||||||||||| ||||||||||||||||||| |||||||||  | |||  ||||| 
Sbjct: 61  tctgccgccgccatcatcggccacgacggcagcgtttgggcccagagcgccactttccct 120

                         
Query: 232 cagttcaagcctga 245
           ||||| ||||||||
Sbjct: 121 cagttgaagcctga 134



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 77/91 (84%)
 Strand = Plus / Plus

                                                                       
Query: 310 cttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaag 369
           |||||||||||||| ||||||||||||||||| || || || | ||||||  ||||||||
Sbjct: 199 cttggaggcacaaagtacatggtcatccaaggagagccaggagctgtcattagaggaaag 258

                                          
Query: 370 aagggcaccggtggcattactatcaagaaga 400
           |||||  | |||||  ||||| |||||||||
Sbjct: 259 aagggaccaggtggtgttactgtcaagaaga 289



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 430 gatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgactacctg 489
           |||||||| |||||||||||||| |||||  || | || || |||||||| || || |||
Sbjct: 319 gatgagccaatgactcctggccaatgcaacatgattgttgaaaggcttggtgattatctg 378

                            
Query: 490 gtcgagcagggtttcta 506
           || ||||||||| ||||
Sbjct: 379 gttgagcagggtctcta 395



to top

>gb|AY792609.1| Malus x domestica clone M4.01FS12 profilin 1 (Mal d 4.01) gene,
           complete cds
          Length = 2017

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||| || ||| ||   ||||| ||||||||||| || || 
Sbjct: 1   atgtcgtggcaggcgtacgtcgatgatcacttgatgtgcgacatcgacggccaccatctg 60

                                                        
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccag 216
           ||| |||| |||||||||||||||||||| || || |||||||||
Sbjct: 61  accgccgcggccatcctcggccacgacggtagtgtgtgggcccag 105



to top

>gb|AY792608.1| Malus x domestica clone M4.01PM9 profilin 1 (Mal d 4.01) gene,
           complete cds
          Length = 2017

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 89/105 (84%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| |||||||||| || ||| ||   ||||| ||||||||||| || || 
Sbjct: 1   atgtcgtggcaggcgtacgtcgatgatcacttgatgtgcgacatcgacggccaccatctg 60

                                                        
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccag 216
           ||| |||| |||||||||||||||||||| || || |||||||||
Sbjct: 61  accgccgcggccatcctcggccacgacggtagtgtgtgggcccag 105



to top

>emb|AJ243325.1|HBR243325 Hevea brasiliensis mRNA for profilin (pro1 gene)
          Length = 800

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 284/365 (77%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           ||||||||||| |||||||| || || |||||    ||||| ||||||||||| |  |||
Sbjct: 83  atgtcgtggcaaacgtacgttgatgatcaccttatgtgcgatatcgacggccaccgtctc 142

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||  | ||||| ||| |||||||||| |||||||| |||||||||  | ||| |||||| 
Sbjct: 143 acggcggccgctatcatcggccacgatggcagcgtgtgggcccagagctccagcttccct 202

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           ||||| ||| | || ||| |||||| | |||| || || ||||| || || |||   |||
Sbjct: 203 cagtttaagtcagatgaggttgctgccgtcatgaaagattttgatgagcctggatccctt 262

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||| |   |||||| |||||||| |||||||| ||||| || || || || 
Sbjct: 263 gccccaactggtttgcaccttggtggcacaaagtacatggtgatccagggagagcccgga 322

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           | ||| || || |||||||||||  | |||||||| ||| | ||||| || |||   || 
Sbjct: 323 gctgtgattcgtggaaagaagggttctggtggcatcactgtgaagaaaaccggccaagct 382

                                                                       
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 471
           || ||| ||||||| |||||||| ||  ||||||| || ||||||||  || |||| |||
Sbjct: 383 ctcattattggtatttacgatgaaccattgactccaggacagtgcaacatgatcgtagag 442

                
Query: 472 aggct 476
           |||||
Sbjct: 443 aggct 447



to top

>gb|U50195.1|SLU50195 Solanum lycopersicum profilin (LePro1) mRNA, complete cds
          Length = 610

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 277 gaacccggacatcttgcaccaactggtcttttccttggaggcacaaaatacatggtcatc 336
           ||||| |||||||| || ||||||||||| |||||||  || ||||||||||||||||| 
Sbjct: 172 gaacctggacatctagctccaactggtctattccttgcgggtacaaaatacatggtcatt 231

                                                                       
Query: 337 caaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggcattactatcaag 396
           ||||| |||||||| | ||| ||||| || || |||||  | ||||| || ||||| |||
Sbjct: 232 caaggagaacctggtgctgttatccgcgggaaaaagggtcctggtggaataactattaag 291

                
Query: 397 aagac 401
           |||||
Sbjct: 292 aagac 296



to top

>gb|AY792607.1| Malus x domestica clone M4.01FS6 profilin 1 (Mal d 4.01) gene,
           complete cds
          Length = 2017

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||| ||| ||   ||||| ||||||||||| || || 
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgatcacttgatgtgcgacatcgacggccaccatctg 60

                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggccca 215
           ||  |||| |||||||||||||||||||| || || ||||||||
Sbjct: 61  acagccgcggccatcctcggccacgacggtagtgtgtgggccca 104



to top

>gb|AY792606.1| Malus x domestica clone M4.01PM7 profilin 1 (Mal d 4.01) gene,
           complete cds
          Length = 2017

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||| ||| ||   ||||| ||||||||||| || || 
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgatcacttgatgtgcgacatcgacggccaccatctg 60

                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggccca 215
           ||  |||| |||||||||||||||||||| || || ||||||||
Sbjct: 61  acagccgcggccatcctcggccacgacggtagtgtgtgggccca 104



to top

>gb|AY792605.1| Malus x domestica clone M4.01FS7 profilin 1 (Mal d 4.01) gene,
           complete cds
          Length = 2017

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||| ||| ||   ||||| ||||||||||| || || 
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgatcacttgatgtgcgacatcgacggccaccatctg 60

                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggccca 215
           ||  |||| |||||||||||||||||||| || || ||||||||
Sbjct: 61  acagccgcggccatcctcggccacgacggtagtgtgtgggccca 104



to top

>emb|AJ507457.1|MDO507457 Malus x domestica mRNA for apple allergen profilin (pf-1 gene),
           clone 1
          Length = 705

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 88/104 (84%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||| ||| ||   ||||| ||||||||||| || || 
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgatcacttgatgtgcgacatcgacggccaccatctg 60

                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggccca 215
           ||  |||| |||||||||||||||||||| || || ||||||||
Sbjct: 61  acagccgcggccatcctcggccacgacggtagtgtgtgggccca 104



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                           
Query: 439     atgactcctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcag 498
               ||||||||||||||||||||  |||| ||||||||||||||||| ||||| || || |||
Sbjct: 4868307 atgactcctggccagtgcaacatggttgtggagaggcttggcgattaccttgttgaacag 4868248

                      
Query: 499     ggtttct 505
               |||||||
Sbjct: 4868247 ggtttct 4868241



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 81       ggggaggaggaggagcgggagg 102
                ||||||||||||||||||||||
Sbjct: 32252767 ggggaggaggaggagcgggagg 32252746



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 79      agggggaggaggaggagcgggaggcg 104
               ||||||||||||||||| ||||||||
Sbjct: 8758548 agggggaggaggaggagggggaggcg 8758573



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 80      gggggaggaggaggagcgggaggcg 104
               |||||||||||||||| ||||||||
Sbjct: 8241851 gggggaggaggaggagtgggaggcg 8241875



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 79      agggggaggaggaggagcgg 98
               ||||||||||||||||||||
Sbjct: 3010814 agggggaggaggaggagcgg 3010833



to top

>dbj|AP002743.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0710E05
          Length = 179714

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                          
Query: 439    atgactcctggccagtgcaatttggtcgtggagaggcttggcgactacctggtcgagcag 498
              ||||||||||||||||||||  |||| ||||||||||||||||| ||||| || || |||
Sbjct: 112956 atgactcctggccagtgcaacatggttgtggagaggcttggcgattaccttgttgaacag 112897

                     
Query: 499    ggtttct 505
              |||||||
Sbjct: 112896 ggtttct 112890



to top

>ref|NM_127534.2| Arabidopsis thaliana PRF1 (PROFILIN 1); actin binding AT2G19760
           (PRF1) mRNA, complete cds
          Length = 783

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 164/206 (79%)
 Strand = Plus / Plus

                                                                       
Query: 169 ctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttc 228
           |||||| ||||||| || |||||||| |||||||| |||||||| |||  | |||| || 
Sbjct: 158 ctcaccgccgccgcaattctcggccaagacggcagtgtctgggctcagagcgccaaattt 217

                                                                       
Query: 229 ccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacat 288
           || ||||| |||||| | || || | ||| ||||  ||||||||||| || |||||   |
Sbjct: 218 cctcagttgaagcctcaagaaatcgatggaatcaagaaggactttgaggagcccgggttt 277

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||| || || || || || |||  |||||||||||| |||||||||||||  
Sbjct: 278 cttgccccaaccggactatttctcggtggcgaaaaatacatggttatccaaggtgaacaa 337

                                     
Query: 349 ggggttgtcatccgaggaaagaaggg 374
           || | ||| |||||||| ||||||||
Sbjct: 338 ggagctgtgatccgagggaagaaggg 363



to top

>gb|BT000264.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA, complete cds
          Length = 527

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 164/206 (79%)
 Strand = Plus / Plus

                                                                       
Query: 169 ctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttc 228
           |||||| ||||||| || |||||||| |||||||| |||||||| |||  | |||| || 
Sbjct: 58  ctcaccgccgccgcaattctcggccaagacggcagtgtctgggctcagagcgccaaattt 117

                                                                       
Query: 229 ccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacat 288
           || ||||| |||||| | || || | ||| ||||  ||||||||||| || |||||   |
Sbjct: 118 cctcagttgaagcctcaagaaatcgatggaatcaagaaggactttgaggagcccgggttt 177

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||| || || || || || |||  |||||||||||| |||||||||||||  
Sbjct: 178 cttgccccaaccggactatttctcggtggcgaaaaatacatggttatccaaggtgaacaa 237

                                     
Query: 349 ggggttgtcatccgaggaaagaaggg 374
           || | ||| |||||||| ||||||||
Sbjct: 238 ggagctgtgatccgagggaagaaggg 263



to top

>gb|AY072427.1| Arabidopsis thaliana profilin 1 (At2g19760) mRNA, complete cds
          Length = 717

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 164/206 (79%)
 Strand = Plus / Plus

                                                                       
Query: 169 ctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttc 228
           |||||| ||||||| || |||||||| |||||||| |||||||| |||  | |||| || 
Sbjct: 142 ctcaccgccgccgcaattctcggccaagacggcagtgtctgggctcagagcgccaaattt 201

                                                                       
Query: 229 ccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacat 288
           || ||||| |||||| | || || | ||| ||||  ||||||||||| || |||||   |
Sbjct: 202 cctcagttgaagcctcaagaaatcgatggaatcaagaaggactttgaggagcccgggttt 261

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||| || || || || || |||  |||||||||||| |||||||||||||  
Sbjct: 262 cttgccccaaccggactatttctcggtggcgaaaaatacatggttatccaaggtgaacaa 321

                                     
Query: 349 ggggttgtcatccgaggaaagaaggg 374
           || | ||| |||||||| ||||||||
Sbjct: 322 ggagctgtgatccgagggaagaaggg 347



to top

>gb|U43590.1|U43590 Arabidopsis thaliana profilin (PRF1) mRNA, complete cds
          Length = 710

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 164/206 (79%)
 Strand = Plus / Plus

                                                                       
Query: 169 ctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttc 228
           |||||| ||||||| || |||||||| |||||||| |||||||| |||  | |||| || 
Sbjct: 134 ctcaccgccgccgcaattctcggccaagacggcagtgtctgggctcagagcgccaaattt 193

                                                                       
Query: 229 ccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacat 288
           || ||||| |||||| | || || | ||| ||||  ||||||||||| || |||||   |
Sbjct: 194 cctcagttgaagcctcaagaaatcgatggaatcaagaaggactttgaggagcccgggttt 253

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||| || || || || || |||  |||||||||||| |||||||||||||  
Sbjct: 254 cttgccccaaccggactatttctcggtggcgaaaaatacatggttatccaaggtgaacaa 313

                                     
Query: 349 ggggttgtcatccgaggaaagaaggg 374
           || | ||| |||||||| ||||||||
Sbjct: 314 ggagctgtgatccgagggaagaaggg 339



to top

>gb|U43325.1|ATU43325 Arabidopsis thaliana profilin 1 mRNA, complete cds
          Length = 800

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 164/206 (79%)
 Strand = Plus / Plus

                                                                       
Query: 169 ctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttc 228
           |||||| ||||||| || |||||||| |||||||| |||||||| |||  | |||| || 
Sbjct: 158 ctcaccgccgccgcaattctcggccaagacggcagtgtctgggctcagagcgccaaattt 217

                                                                       
Query: 229 ccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacat 288
           || ||||| |||||| | || || | ||| ||||  ||||||||||| || |||||   |
Sbjct: 218 cctcagttgaagcctcaagaaatcgatggaatcaagaaggactttgaggagcccgggttt 277

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||| || || || || || |||  |||||||||||| |||||||||||||  
Sbjct: 278 cttgccccaaccggactatttctcggtggcgaaaaatacatggttatccaaggtgaacaa 337

                                     
Query: 349 ggggttgtcatccgaggaaagaaggg 374
           || | ||| |||||||| ||||||||
Sbjct: 338 ggagctgtgatccgagggaagaaggg 363



to top

>gb|AY268424.1| Humulus scandens profilin-like protein (LCM9) mRNA, complete cds
          Length = 633

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 100/121 (82%)
 Strand = Plus / Plus

                                                                       
Query: 254 ctggcatcattaaggactttgacgaacccggacatcttgcaccaactggtcttttccttg 313
           |||||||||| || |||||| ||||||| |||   ||||||||||||||  | |  ||||
Sbjct: 143 ctggcatcatgaatgactttaacgaacctggaacacttgcaccaactggcttgtatcttg 202

                                                                       
Query: 314 gaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
           | ||||||||||| ||||| |||||||| ||||| || | ||| ||| ||||||||||||
Sbjct: 203 gtggcacaaaatatatggtgatccaaggggaaccaggtgctgttatcagaggaaagaagg 262

            
Query: 374 g 374
           |
Sbjct: 263 g 263



to top

>emb|AJ130969.1|NTA130969 Nicotiana tabacum pronp1 gene, exons 1-3
          Length = 3797

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 82/97 (84%)
 Strand = Plus / Plus

                                                                        
Query: 277  gaacccggacatcttgcaccaactggtcttttccttggaggcacaaaatacatggtcatc 336
            ||||| |||||||| || ||||||||| | |||||||| ||  | ||||||||||| |||
Sbjct: 1679 gaacctggacatctagctccaactggtttattccttggcggggcgaaatacatggtaatc 1738

                                                 
Query: 337  caaggtgaacctggggttgtcatccgaggaaagaagg 373
            ||||| |||||||| | ||||||||| || |||||||
Sbjct: 1739 caaggagaacctggcgctgtcatccgtgggaagaagg 1775



to top

>gb|AF119367.1|AF119367 Hevea brasiliensis clone hevb 8.10 latex profilin Hev b 8 mRNA,
           complete cds
          Length = 396

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 283/365 (77%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||||||||||| || || |||||    || || ||||||||||| |  |||
Sbjct: 1   atgtcgtggcagacgtacgtggatgatcaccttatgtgtgatatcgacggccaccgtctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||  | ||||| ||| |||||||||| |||||||| |||||||||  | ||  |||||| 
Sbjct: 61  acggcggccgctatcatcggccacgatggcagcgtgtgggcccagagctccggcttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           ||||| ||| | || ||| |||||| | |||| || || ||||| || || |||   |||
Sbjct: 121 cagtttaagtcagatgaggttgctgccgtcatgaaagattttgatgagcctggatccctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||| |    ||||| |||||||| |||||||| ||||| || || || || 
Sbjct: 181 gccccaactggtttgcatcttggtggcacaaagtacatggtgatccagggagagcccgga 240

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           | ||| || || |||||||||||  | |||||||||||| | ||||| || |||   || 
Sbjct: 241 gctgtgattcgtggaaagaagggttctggtggcattactgtgaagaaaaccggccaagct 300

                                                                       
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 471
           || ||| ||||||| |||||||| ||  ||||||| || ||||||||  || |||| |||
Sbjct: 301 ctcattattggtatttacgatgaaccattgactccaggacagtgcaacatgatcgtagag 360

                
Query: 472 aggct 476
           |||||
Sbjct: 361 aggct 365



to top

>gb|M65179.1|BELPRFLN B.verrucosa profilin (BetvII) mRNA, complete cds
          Length = 660

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 142/177 (80%)
 Strand = Plus / Plus

                                                                       
Query: 225 cttcccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccgg 284
           |||||| ||||| |||||| |||| ||  |||| ||||| ||||||||||| || || ||
Sbjct: 199 cttcccacagtttaagcctcaggaaatcactggtatcatgaaggactttgaggagccggg 258

                                                                       
Query: 285 acatcttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtga 344
            |||||||| || || ||  |   |||||| |||| |||||||||||||||||| || ||
Sbjct: 259 tcatcttgctccgacgggcttacaccttgggggcataaaatacatggtcatccagggaga 318

                                                                    
Query: 345 acctggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagac 401
             |||| | ||||||||| |||||||||||  | || || |||||||| ||||||||
Sbjct: 319 ggctggtgctgtcatccgtggaaagaagggatctggaggtattactataaagaagac 375



to top

>gb|AF059616.1|AF059616 Arachis hypogaea profilin (Ara h 5) mRNA, complete cds
          Length = 743

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 132/164 (80%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           |||||||||||| || ||||||||  |||||||   |||||| || || ||| | |||||
Sbjct: 16  gatgtcgtggcaaacctacgtcgataaccaccttctctgcgaaattgaaggcgaccacct 75

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           | |||||||||| ||||||||||| |||||| | || ||||| |||  | |  | |||||
Sbjct: 76  ctcctccgccgcaatcctcggccaagacggcggtgtttgggctcagagctctcatttccc 135

                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttg 274
            ||||||||||||||||| ||| |||  ||||| || |||||||
Sbjct: 136 tcagttcaagcctgaggaaattactgctatcatgaacgactttg 179



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 316 ggcacaaaatacatggtcatccaaggtgaacc 347
           ||||| ||||||||||| ||||||||||||||
Sbjct: 221 ggcaccaaatacatggttatccaaggtgaacc 252



to top

>gb|AF129426.1|AF129426 Malus domestica GD4-1 profilin mRNA, complete cds
          Length = 396

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||||||||| | | ||   ||||| ||||||||||| || || 
Sbjct: 1   atgtcgtggcaggcgtacgtcgacgatcgcttgatgtgcgacatcgacggccaccatctg 60

                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggccca 215
           ||  |||| |||||||||||||||||||| || || ||||||||
Sbjct: 61  acagccgcggccatcctcggccacgacggtagtgtgtgggccca 104



to top

>ref|NM_119080.2| Arabidopsis thaliana PRF2 (PROFILIN 2); actin binding AT4G29350
           (PRF2) mRNA, complete cds
          Length = 760

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 227/291 (78%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||  | |||||||| ||||| ||    |||||| |||| ||| | |||||
Sbjct: 106 gatgtcgtggcaatcatacgtcgatgaccatctcatgtgcgaggtcgaaggcaaccacct 165

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||   |||||||||| ||||||| |||||||| |||||||| |||  | |    |||||
Sbjct: 166 cacacacgccgccatcttcggccaagacggcagtgtctgggctcagagctcagctttccc 225

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
            ||||| |||||||  ||||| || || ||||  || |||||||| ||| ||||||||||
Sbjct: 226 tcagttgaagcctgcagagatagcaggaatcaacaaagactttgaagaagccggacatct 285

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
           ||| ||||| || || |||||||| ||    || ||||||||  ||||||||||  ||||
Sbjct: 286 tgccccaaccgggctattccttggcggtgagaagtacatggttgtccaaggtgaggctgg 345

                                                              
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagac 401
            |  ||||||||||| || |||||  | |||||  | ||||||||||||||
Sbjct: 346 agccgtcatccgagggaaaaagggacctggtggagtcactatcaagaagac 396



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 454 tgcaatttggtcgtggagaggcttggcgactacct 488
           ||||| ||||||||||||||||| ||||| |||||
Sbjct: 449 tgcaacttggtcgtggagaggctcggcgattacct 483



to top

>gb|AY074350.1| Arabidopsis thaliana putative profilin 2 protein (At4g29350) mRNA,
           complete cds
          Length = 759

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 227/291 (78%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||  | |||||||| ||||| ||    |||||| |||| ||| | |||||
Sbjct: 93  gatgtcgtggcaatcatacgtcgatgaccatctcatgtgcgaggtcgaaggcaaccacct 152

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||   |||||||||| ||||||| |||||||| |||||||| |||  | |    |||||
Sbjct: 153 cacacacgccgccatcttcggccaagacggcagtgtctgggctcagagctcagctttccc 212

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
            ||||| |||||||  ||||| || || ||||  || |||||||| ||| ||||||||||
Sbjct: 213 tcagttgaagcctgcagagatagcaggaatcaacaaagactttgaagaagccggacatct 272

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
           ||| ||||| || || |||||||| ||    || ||||||||  ||||||||||  ||||
Sbjct: 273 tgccccaaccgggctattccttggcggtgagaagtacatggttgtccaaggtgaggctgg 332

                                                              
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagac 401
            |  ||||||||||| || |||||  | |||||  | ||||||||||||||
Sbjct: 333 agccgtcatccgagggaaaaagggacctggtggagtcactatcaagaagac 383



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 454 tgcaatttggtcgtggagaggcttggcgactacct 488
           ||||| ||||||||||||||||| ||||| |||||
Sbjct: 436 tgcaacttggtcgtggagaggctcggcgattacct 470



to top

>emb|AJ223982.1|GMPRO1 Glycine max mRNA for profilin, PRO1
          Length = 396

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 149/187 (79%)
 Strand = Plus / Plus

                                                                       
Query: 188 tcggccacgacggcagcgtctgggcccagtcccccaacttcccccagttcaagcctgagg 247
           ||||||| ||||||||||| ||||| |||    || ||||||| |||||||| |||||||
Sbjct: 77  tcggccaagacggcagcgtttgggctcagagtaccgacttccctcagttcaaacctgagg 136

                                                                       
Query: 248 agattgctggcatcattaaggactttgacgaacccggacatcttgcaccaactggtcttt 307
           ||||  ||| |||||| || |||||| | || || |||   ||||| ||||||||  | |
Sbjct: 137 agataactgccatcatgaatgactttaatgagcctggatcacttgctccaactggattgt 196

                                                                       
Query: 308 tccttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaa 367
             || || ||||| ||||| ||||||||||| |||||||| || | |||||| ||||| |
Sbjct: 197 atctcggtggcaccaaatatatggtcatccagggtgaacccggtgctgtcattcgaggga 256

                  
Query: 368 agaaggg 374
           |||||||
Sbjct: 257 agaaggg 263



to top

>gb|DQ270547.1| Mangifera indica profilin 1 (Man i 3.01) mRNA, complete cds
          Length = 656

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 269/347 (77%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||| || || || |||   ||||| ||||| || || || |||
Sbjct: 1   atgtcgtggcaggcgtacgttgatgagcatctgatgtgcgatatcgaaggtcatcatctc 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
           ||| |||| || ||| ||||||  || |||||||| ||||| |||  | |||||||||| 
Sbjct: 61  accgccgcggcgatcgtcggcctggatggcagcgtttgggcgcagagcgccaacttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
            || |||| ||||| |||||| | |  |||| ||| || ||||| ||||| ||   ||||
Sbjct: 121 aagctcaaccctgaagagattaccgctatcaataaagattttgatgaaccaggttctctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           || ||||||||  |   ||| || ||||| || |||||||| ||||| ||||| ||||| 
Sbjct: 181 gccccaactgggttgcacctcggtggcactaagtacatggtaatccagggtgagcctgga 240

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           | ||| || || |||||||||||  | |||||  ||||| |||| |||||   |||||||
Sbjct: 241 gctgtgattcgtggaaagaagggtcctggtggtgttactgtcaaaaagaccaacatggcc 300

                                                          
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaa 458
            |  |  |||||||||| |||||||| ||||||||||| ||||||||
Sbjct: 301 tttgtcattggtatctatgatgagccaatgactcctggacagtgcaa 347



to top

>gb|U43591.1|U43591 Arabidopsis thaliana profilin (PRF2) mRNA, complete cds
          Length = 644

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 227/291 (78%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||  | |||||||| ||||| ||    |||||| |||| ||| | |||||
Sbjct: 68  gatgtcgtggcaatcatacgtcgatgaccatctcatgtgcgaggtcgaaggcaaccacct 127

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||   |||||||||| ||||||| |||||||| |||||||| |||  | |    |||||
Sbjct: 128 cacacacgccgccatcttcggccaagacggcagtgtctgggctcagagctcagctttccc 187

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
            ||||| |||||||  ||||| || || ||||  || |||||||| ||| ||||||||||
Sbjct: 188 tcagttgaagcctgcagagatagcaggaatcaacaaagactttgaagaagccggacatct 247

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
           ||| ||||| || || |||||||| ||    || ||||||||  ||||||||||  ||||
Sbjct: 248 tgccccaaccgggctattccttggcggtgagaagtacatggttgtccaaggtgaggctgg 307

                                                              
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagac 401
            |  ||||||||||| || |||||  | |||||  | ||||||||||||||
Sbjct: 308 agccgtcatccgagggaaaaagggacctggtggagtcactatcaagaagac 358



to top

>gb|AY900014.1| Petroselinum crispum profilin 3 (PRF3) mRNA, complete cds
          Length = 790

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 143/179 (79%)
 Strand = Plus / Plus

                                                                       
Query: 163 cagcacctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtccccc 222
           ||||||||| || ||||||||||| |||| |||||||||||||| ||||| |||  | ||
Sbjct: 114 cagcacctctccgccgccgccatcatcggtcacgacggcagcgtttgggctcagagctcc 173

                                                                       
Query: 223 aacttcccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaaccc 282
              || ||| | || || ||||| ||||||||||| || || || |||||||| ||||| 
Sbjct: 174 tcttttcccaaatttaaacctgaagagattgctggtattatgaaagactttgatgaacct 233

                                                                      
Query: 283 ggacatcttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaagg 341
           || |||||||| || ||||| || | |||||| || ||||| || ||||| || |||||
Sbjct: 234 ggccatcttgctcccactggactgtaccttggtggaacaaagtatatggtgattcaagg 292



to top

>gb|AY082337.1| Chenopodium album pollen allergen Che a 2 mRNA, complete cds
          Length = 396

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                       
Query: 432 tgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgactacctggt 491
           |||||||||||||||||| ||||||||| |||| || || ||| |||| |||||||||||
Sbjct: 321 tgagcccatgactcctggtcagtgcaatatggttgttgaaaggattggtgactacctggt 380

              
Query: 492 cga 494
           |||
Sbjct: 381 cga 383



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 179/228 (78%)
 Strand = Plus / Plus

                                                                       
Query: 148 tgcgagatcgacggccagcacctcacctccgccgccatcctcggccacgacggcagcgtc 207
           ||||| ||||| ||| | |||||| ||||||| || ||||||||||||||||||| ||| 
Sbjct: 37  tgcgacatcgaaggcaaccacctctcctccgctgctatcctcggccacgacggcaccgtt 96

                                                                       
Query: 208 tgggcccagtcccccaacttcccccagttcaagcctgaggagattgctggcatcattaag 267
           ||||| ||   ||||   || || ||| | |||||||| ||| |   || |||||| |||
Sbjct: 97  tgggctcaaagcccctcttttcctcagcttaagcctgaagaggtaagtgccatcatgaag 156

                                                                       
Query: 268 gactttgacgaacccggacatcttgcaccaactggtcttttccttggaggcacaaaatac 327
           |||||| ||||||| |||  ||| || || |||||  |   |||||| ||||||||||| 
Sbjct: 157 gactttaacgaacctggatctctcgctcctactggcttacaccttggtggcacaaaatat 216

                                                           
Query: 328 atggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggc 375
           ||||| |||||||| || ||||| |  || ||| ||||||||||||||
Sbjct: 217 atggttatccaaggcgagcctggagacgtgatcagaggaaagaagggc 264



to top

>gb|U43326.1|ATU43326 Arabidopsis thaliana profilin 2 mRNA, complete cds
          Length = 712

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 227/291 (78%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||  | |||||||| ||||| ||    |||||| |||| ||| | |||||
Sbjct: 43  gatgtcgtggcaatcatacgtcgatgaccatctcatgtgcgaggtcgaaggcaaccacct 102

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||   |||||||||| ||||||| |||||||| |||||||| |||  | |    |||||
Sbjct: 103 cacacacgccgccatcttcggccaagacggcagtgtctgggctcagagctcagctttccc 162

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
            ||||| |||||||  ||||| || || ||||  || |||||||| ||| ||||||||||
Sbjct: 163 tcagttgaagcctgcagagatagcaggaatcaacaaagactttgaagaagccggacatct 222

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
           ||| ||||| || || |||||||| ||    || ||||||||  ||||||||||  ||||
Sbjct: 223 tgccccaaccgggctattccttggcggtgagaagtacatggttgtccaaggtgaggctgg 282

                                                              
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagac 401
            |  ||||||||||| || |||||  | |||||  | ||||||||||||||
Sbjct: 283 agccgtcatccgagggaaaaagggacctggtggagtcactatcaagaagac 333



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 454 tgcaatttggtcgtggagaggcttggcgactacct 488
           ||||| ||||||||||||||||| ||||| |||||
Sbjct: 386 tgcaacttggtcgtggagaggctcggcgattacct 420



to top

>gb|AY114048.1| Arabidopsis thaliana putative profilin 2 protein (At4g29350) mRNA,
           complete cds
          Length = 427

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 199/254 (78%)
 Strand = Plus / Plus

                                                                       
Query: 148 tgcgagatcgacggccagcacctcacctccgccgccatcctcggccacgacggcagcgtc 207
           |||||| |||| ||| | ||||||||   |||||||||| ||||||| |||||||| |||
Sbjct: 37  tgcgaggtcgaaggcaaccacctcacacacgccgccatcttcggccaagacggcagtgtc 96

                                                                       
Query: 208 tgggcccagtcccccaacttcccccagttcaagcctgaggagattgctggcatcattaag 267
           ||||| |||  | |    ||||| ||||| |||||||  ||||| || || ||||  || 
Sbjct: 97  tgggctcagagctcagctttccctcagttgaagcctgcagagatagcaggaatcaacaaa 156

                                                                       
Query: 268 gactttgacgaacccggacatcttgcaccaactggtcttttccttggaggcacaaaatac 327
           |||||||| ||| ||||||||||||| ||||| || || |||||||| ||    || |||
Sbjct: 157 gactttgaagaagccggacatcttgccccaaccgggctattccttggcggtgagaagtac 216

                                                                       
Query: 328 atggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggtggcatt 387
           |||||  ||||||||||  |||| |  ||||||||||| || |||||  | |||||  | 
Sbjct: 217 atggttgtccaaggtgaggctggagccgtcatccgagggaaaaagggacctggtggagtc 276

                         
Query: 388 actatcaagaagac 401
           ||||||||||||||
Sbjct: 277 actatcaagaagac 290



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 454 tgcaatttggtcgtggagaggcttggcgactacct 488
           ||||| ||||||||||||||||| ||||| |||||
Sbjct: 343 tgcaacttggtcgtggagaggctcggcgattacct 377



to top

>emb|X73280.1|ZMPRO2MR Z.mays ZmPRO2 mRNA for profilin 2
          Length = 830

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||| ||||||| ||||| ||||||   ||||||||||| ||||| |||||
Sbjct: 92  gatgtcgtggcaggcgtacgtggacgagcacctgatgtgcgagatcgagggccaccacct 151

                                         
Query: 171 cacctccgccgccatcctcggccacgacgg 200
           | |  | || |||||| |||||||||||||
Sbjct: 152 cgcggcggcggccatcgtcggccacgacgg 181



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 419 ttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttg 478
           |||| |||||||| ||||| ||||| ||||| ||||||||  |||| ||||| ||||| |
Sbjct: 400 ttggcatctacgacgagccgatgacgcctgggcagtgcaacatggtggtggaaaggctgg 459

                      
Query: 479 gcgactacctg 489
           |||||||||||
Sbjct: 460 gcgactacctg 470



to top

>emb|BX818797.1|CNS0A9XS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB14ZC01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 670

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 163/206 (79%)
 Strand = Plus / Plus

                                                                       
Query: 169 ctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttc 228
           |||||| ||||||| || |||||||| ||||||||  ||||||| |||  | |||| || 
Sbjct: 124 ctcaccgccgccgcaattctcggccaagacggcagtatctgggctcagagcgccaaattt 183

                                                                       
Query: 229 ccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacat 288
           || ||||| |||||| | || || | ||| ||||  ||||||||||| || |||||   |
Sbjct: 184 cctcagttgaagcctcaagaaatcgatggaatcaagaaggactttgaggagcccgggttt 243

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||| || || || || || |||  |||||||||||| |||||||||||||  
Sbjct: 244 cttgccccaaccggactatttctcggtggcgaaaaatacatggttatccaaggtgaacaa 303

                                     
Query: 349 ggggttgtcatccgaggaaagaaggg 374
           || | ||| |||||||| ||||||||
Sbjct: 304 ggagctgtgatccgagggaagaaggg 329



to top

>gb|AY086576.1| Arabidopsis thaliana clone 25886 mRNA, complete sequence
          Length = 754

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 226/291 (77%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||  | |||||||| ||||| ||    |||||| |||| ||| | |||||
Sbjct: 106 gatgtcgtggcaatcatacgtcgatgaccatctcatgtgcgaggtcgaaggcaaccacct 165

                                                                       
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttccc 230
           |||   |||||||||| ||||||| |||||||| |||||||| |||  | |    |||||
Sbjct: 166 cacacacgccgccatcttcggccaagacggcagtgtctgggctcagagctcagctttccc 225

                                                                       
Query: 231 ccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatct 290
            ||||| |||||||  ||||| || || ||||  || |||||||| ||| ||||||||||
Sbjct: 226 tcagttgaagcctgcagagatagcaggaatcaacaaagactttgaagaagccggacatct 285

                                                                       
Query: 291 tgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctgg 350
           ||| ||||| || || |||||||| ||    || ||||||||  ||||||||||  ||||
Sbjct: 286 tgccccaaccgggctattccttggcggtgagaagtacatggttgtccaaggtgaggctgg 345

                                                              
Query: 351 ggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagac 401
            |  ||||||||||| || || ||  | |||||  | ||||||||||||||
Sbjct: 346 agccgtcatccgagggaaaaasggacctggtggagtcactatcaagaagac 396



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 454 tgcaatttggtcgtggagaggcttggcgactacct 488
           ||||| ||||||||||||||||| ||||| |||||
Sbjct: 449 tgcaacttggtcgtggagaggctcggcgattacct 483



to top

>gb|AF126263.1|AF126263 Phalaenopsis sp. 'KCbutterfly' putative profilin mRNA, complete cds
          Length = 718

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 322 aaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccggt 381
           ||||| ||||| || |||||||||||||||| ||| || ||||| ||||||||  | || 
Sbjct: 353 aaatatatggttatacaaggtgaacctggggctgttattcgagggaagaagggttctgga 412

                            
Query: 382 ggcattactatcaagaa 398
           |||||||||||||||||
Sbjct: 413 ggcattactatcaagaa 429



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 82/102 (80%)
 Strand = Plus / Plus

                                                                       
Query: 111 gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
           ||||||||||||  ||||||| ||||| ||  ||   ||||||||||||||||| || ||
Sbjct: 142 gatgtcgtggcaagcgtacgttgacgaacatttgatgtgcgagatcgacggccaacatct 201

                                                     
Query: 171 cacctccgccgccatcctcggccacgacggcagcgtctgggc 212
            ||  |||| |||||| ||||| |||| ||| | ||||||||
Sbjct: 202 gacggccgctgccatcatcggcaacgaaggcggtgtctgggc 243



to top

>gb|AY898658.1| Crocus sativus profilin mRNA, complete cds
          Length = 396

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 135/169 (79%)
 Strand = Plus / Plus

                                                                       
Query: 320 caaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggcaccg 379
           |||| |||||||| |||||||| || || || ||||| || ||||| ||||||||  | |
Sbjct: 209 caaagtacatggttatccaaggcgagccaggtgttgttattcgagggaagaagggttctg 268

                                                                       
Query: 380 gtggcattactatcaagaagacgggcatggccctgattcttggtatctacgatgagccca 439
           ||||  ||||||||||||| |    ||||||  ||||  ||||  |||| ||||| || |
Sbjct: 269 gtggtgttactatcaagaaaagtaacatggctttgatctttgggctctatgatgaaccga 328

                                                            
Query: 440 tgactcctggccagtgcaatttggtcgtggagaggcttggcgactacct 488
           |||| |||||||||||||| ||||| || |||||||| ||||| |||||
Sbjct: 329 tgacccctggccagtgcaacttggttgttgagaggctcggcgattacct 377



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           ||||||||||| ||||||||||| || ||||||   ||||| || ||||||||     | 
Sbjct: 1   atgtcgtggcaaacgtacgtcgatgagcacctgatgtgcgatatggacggccatgttttg 60

                                                    
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggc 212
           || ||||| |||||||||||||| |||||||||||||||||
Sbjct: 61  acttccgctgccatcctcggccatgacggcagcgtctgggc 101



to top

>gb|AY268425.1| Ambrosia artemisiifolia profilin-like protein (A0418) mRNA,
           complete cds
          Length = 645

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 152/192 (79%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||| || |||||| |    ||||||||||| ||| | ||||| 
Sbjct: 1   atgtcgtggcaggcgtacgtggatgaccacttaatgtgcgagatcgagggcaaccacctt 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
            |  |||| |||||| ||||||||||||||  ||| ||||| |||||  ||| |||||| 
Sbjct: 61  tctgccgctgccatcatcggccacgacggcgtcgtttgggctcagtcagccaccttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           ||| ||||||| ||||| ||  |||| ||||| || |||||| | ||||| ||   ||||
Sbjct: 121 caggtcaagccagaggaaataactgggatcatgaatgactttaatgaacctggctctctt 180

                       
Query: 292 gcaccaactggt 303
           ||||| ||||||
Sbjct: 181 gcaccgactggt 192



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 82/102 (80%)
 Strand = Plus / Plus

                                                                       
Query: 406 atggccctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtc 465
           |||||| ||||  |||| ||||| |||||||| ||| |||| ||||| |||||  || | 
Sbjct: 295 atggccttgatcattggaatctatgatgagccaatggctccaggccaatgcaacatgatt 354

                                                     
Query: 466 gtggagaggcttggcgactacctggtcgagcagggtttctaa 507
           || || |||||||| ||||| ||  |||| ||||||||||||
Sbjct: 355 gttgaaaggcttggtgactatctcctcgaacagggtttctaa 396



to top

>gb|AY268426.1| Ambrosia artemisiifolia profilin-like protein (D106) mRNA, complete
           cds
          Length = 632

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 305/396 (77%)
 Strand = Plus / Plus

                                                                       
Query: 112 atgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacctc 171
           |||||||||||| ||||||| || |||||| |    ||||||||||| ||| | ||||| 
Sbjct: 1   atgtcgtggcaggcgtacgtggatgaccacttaatgtgcgagatcgagggcaaccacctt 60

                                                                       
Query: 172 acctccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccc 231
            |  |||| |||||| ||||||||||||||  ||| ||||| |||||  ||| |||||| 
Sbjct: 61  tctgccgctgccatcatcggccacgacggcgtcgtttgggctcagtcagccaccttccct 120

                                                                       
Query: 232 cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
           ||| ||||||| ||||| ||  |||| ||||| || |||||| | ||||| ||   ||||
Sbjct: 121 caggtcaagccagaggaaataactgggatcatgaatgactttaatgaacctggctctctt 180

                                                                       
Query: 292 gcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggg 351
           ||||| |||||| | | |||||| || || || || ||||| || ||||| || || || 
Sbjct: 181 gcaccgactggtttataccttggtggtaccaagtatatggttattcaaggcgagccagga 240

                                                                       
Query: 352 gttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggcc 411
           | ||| || ||||| || |||||  | || ||  ||||||| || |||||    ||| ||
Sbjct: 241 gctgtgattcgagggaaaaagggaccaggaggtgttactattaaaaagacaacaatgtcc 300

                                                                       
Query: 412 ctgattcttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggag 471
            ||||  |||||||||| ||||| ||||||||||| || || |||||  || | || |||
Sbjct: 301 ttgatcattggtatctatgatgaacccatgactccaggacaatgcaacatgcttgttgag 360

                                               
Query: 472 aggcttggcgactacctggtcgagcagggtttctaa 507
           |||| ||| ||||| ||  |||| ||||||||||||
Sbjct: 361 aggcctggtgactatctcctcgaacagggtttctaa 396



to top

>gb|AC149269.11| Medicago truncatula clone mth2-102b19, complete sequence
          Length = 128294

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                         
Query: 232   cagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatctt 291
             ||||| |||||||| |||||| |||| ||||| || || || |||||||| |||||||||
Sbjct: 15812 cagtttaagcctgatgagattactggtatcatgaaagatttcgacgaaccaggacatctt 15753

                        
Query: 292   gcaccaactgg 302
             ||||| |||||
Sbjct: 15752 gcacctactgg 15742



to top

>emb|AJ223981.1|GMPRO2 Glycine max mRNA for profilin, PRO2
          Length = 396

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 121/151 (80%)
 Strand = Plus / Plus

                                                                       
Query: 224 acttcccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaacccg 283
           ||||||| |||||||| |||||||||||  ||| |||||| || |||||| | || || |
Sbjct: 113 acttccctcagttcaaacctgaggagataactgccatcatgaatgactttaatgagcctg 172

                                                                       
Query: 284 gacatcttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtg 343
           ||   ||||| ||||||||  | |  || || ||||| ||||| ||||||||||| ||||
Sbjct: 173 gatcacttgctccaactggattgtatctcggtggcaccaaatatatggtcatccagggtg 232

                                          
Query: 344 aacctggggttgtcatccgaggaaagaaggg 374
           |||| || | |||||| ||||| ||||||||
Sbjct: 233 aacccggtgctgtcattcgagggaagaaggg 263



to top

>gb|AF456482.1| Daucus carota minor allergen Dau c 4 profilin mRNA, complete cds
          Length = 405

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 145/183 (79%)
 Strand = Plus / Plus

                                                                       
Query: 159 cggccagcacctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtc 218
           |||||| || ||| || ||||||||||| ||||||||||||||||||| ||||| ||   
Sbjct: 57  cggccaacaactctccgccgccgccatcatcggccacgacggcagcgtttgggctcaaag 116

                                                                       
Query: 219 ccccaacttcccccagttcaagcctgaggagattgctggcatcattaaggactttgacga 278
           | |||  || ||| |||| || ||||| |||||| |||| || || ||  ||||||| ||
Sbjct: 117 ctccacttttcccaagtttaaacctgaagagattactggtataatgaaaaactttgatga 176

                                                                       
Query: 279 acccggacatcttgcaccaactggtcttttccttggaggcacaaaatacatggtcatcca 338
            || || |||||||| || ||||| || | |||||| || ||||| |||||||| || ||
Sbjct: 177 gcctggccatcttgctcctactggactgtaccttggtggaacaaagtacatggtgataca 236

              
Query: 339 agg 341
           |||
Sbjct: 237 agg 239



to top

>gb|AF092547.1|AF092547 Ricinus communis profilin (pro1) mRNA, complete cds
          Length = 737

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 115/143 (80%)
 Strand = Plus / Plus

                                                                       
Query: 316 ggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagggc 375
           ||||| |||||||||||||||||||| || || || | |||||| ||||| |||||||| 
Sbjct: 282 ggcactaaatacatggtcatccaaggcgagccaggagctgtcattcgagggaagaaggga 341

                                                                       
Query: 376 accggtggcattactatcaagaagacgggcatggccctgattcttggtatctacgatgag 435
            | |||||  ||||| | ||||||||      |||| ||||  |||||||||| ||||||
Sbjct: 342 ccgggtggtgttactgttaagaagaccaatcaggccttgatcattggtatctatgatgag 401

                                  
Query: 436 cccatgactcctggccagtgcaa 458
           || |||||||| || ||||||||
Sbjct: 402 ccaatgactccagggcagtgcaa 424



to top

>gb|AY900012.1| Petroselinum crispum profilin 1 (PRF1) mRNA, complete cds
          Length = 811

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 145/183 (79%)
 Strand = Plus / Plus

                                                                       
Query: 159 cggccagcacctcacctccgccgccatcctcggccacgacggcagcgtctgggcccagtc 218
           |||||| |||||| |  ||||||||||| |||| || ||||| ||||| ||||| |||  
Sbjct: 110 cggccaacacctctcagccgccgccatcatcggtcatgacggtagcgtttgggctcagag 169

                                                                       
Query: 219 ccccaacttcccccagttcaagcctgaggagattgctggcatcattaaggactttgacga 278
           | ||   |||||| | || || ||||| ||||||||||| || || || |||||||| ||
Sbjct: 170 ctcctcattccccaactttaaacctgaagagattgctggtattatgaaagactttgatga 229

                                                                       
Query: 279 acccggacatcttgcaccaactggtcttttccttggaggcacaaaatacatggtcatcca 338
           ||| || |||||||| || ||||| || | |||||| || ||||| |||||||| || ||
Sbjct: 230 acctggccatcttgctcctactggactgtaccttggtggaacaaagtacatggtgattca 289

              
Query: 339 agg 341
           |||
Sbjct: 290 agg 292



to top

>emb|Y15209.1|PJPROFIL2 Parietaria judaica mRNA for profilin 2
          Length = 396

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 175 tccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccccag 234
           |||||||||||| |||||||||| |||||||| ||||| |||  | | |||||||| |||
Sbjct: 67  tccgccgccatcatcggccacgatggcagcgtttgggctcagagcgctaacttccctcag 126

                                        
Query: 235 ttcaagcctgaggagattgctggcatcat 263
           || ||||| || ||| || |||| |||||
Sbjct: 127 ttgaagccagaagaggttactggaatcat 155



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 112 atgtcgtggcagacgtacgtcgacgaccacct 143
           |||||||||||| |||||||||| ||||||||
Sbjct: 1   atgtcgtggcaggcgtacgtcgatgaccacct 32



to top

>emb|Y13271.1|MAPROFILN Mercurialis annua mRNA for profilin
          Length = 402

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                        
Query: 112 atgtcgtggcagacgtacgtcgacgacca 140
           |||||||||||||||||||||||||||||
Sbjct: 1   atgtcgtggcagacgtacgtcgacgacca 29



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 315 aggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaaggg 374
           |||||||||||| ||||| ||||| || |||  ||| | ||| ||||| |||||||||||
Sbjct: 210 aggcacaaaatatatggttatccagggcgaaagtggcgctgtaatccgtggaaagaaggg 269



to top

>emb|Y12425.1|OEPROFIL1 Olea europaea mRNA for profilin 1
          Length = 405

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 146/185 (78%)
 Strand = Plus / Plus

                                                                       
Query: 310 cttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaag 369
           |||||||| ||||| || ||||| || ||||| ||  |||| | ||||||||| ||||||
Sbjct: 208 cttggaggaacaaagtatatggtgattcaaggagaggctggagctgtcatccgtggaaag 267

                                                                       
Query: 370 aagggcaccggtggcattactatcaagaagacgggcatggccctgattcttggtatctac 429
           |||||  | ||||| ||||| || |||||||| |||   || ||  || |||||||||||
Sbjct: 268 aagggatctggtggtattaccattaagaagactggccaagcactagtttttggtatctac 327

                                                                       
Query: 430 gatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttggcgactacctg 489
           || |||||  | ||||| || || |||||  |||| || |||||| | || |||||||||
Sbjct: 328 gaggagcctgtaactccaggacaatgcaacatggttgtcgagaggttgggagactacctg 387

                
Query: 490 gtcga 494
           |||||
Sbjct: 388 gtcga 392



to top

>emb|AJ421030.1|AVU421030 Artemisia vulgaris mRNA for profilin, isoallergen 1
          Length = 676

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 307 ttccttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgagga 366
           |||||||| ||  ||||||||||||| |||||||||||  |||| | |||||| || |||
Sbjct: 234 ttccttggtggtgcaaaatacatggttatccaaggtgaggctggagctgtcattcgtgga 293

                   
Query: 367 aagaaggg 374
           ||||||||
Sbjct: 294 aagaaggg 301



to top

>gb|AF327623.1|AF327623 Corylus avellana clone 7 minor allergen hazelnut profilin mRNA,
           complete cds
          Length = 396

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 157/200 (78%)
 Strand = Plus / Plus

                                                                       
Query: 176 ccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccccagt 235
           |||| |||||| ||||||| ||||||||||| ||||| |||  | | |  ||||| ||| 
Sbjct: 65  ccgcggccatcatcggccatgacggcagcgtttgggctcagagctctactttccctcagc 124

                                                                       
Query: 236 tcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatcttgcac 295
           |||||||||| || ||  ||||| | || || |||||| | || ||||||   ||||| |
Sbjct: 125 tcaagcctgaagaaataactggcgttatgaatgactttaatgagcccggatcacttgctc 184

                                                                       
Query: 296 caactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggggttg 355
           |||| || || | |||||| |||||||| |||||||| |||||||| || || || | ||
Sbjct: 185 caaccggactgtaccttggtggcacaaagtacatggtgatccaaggcgagccgggagctg 244

                               
Query: 356 tcatccgaggaaagaagggc 375
           | || ||||| |||||||||
Sbjct: 245 ttattcgagggaagaagggc 264



to top

>gb|AY292385.2| Cucumis melo var. reticulatus profilin (Cu m2) mRNA, complete cds
          Length = 634

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 135/171 (78%)
 Strand = Plus / Plus

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||||||| | | | |||| || |||||||| ||||| |||||||| || |||
Sbjct: 178 cttgctccaactggtttgtacattggtggtacaaaatatatggtaatccaaggggagcct 237

                                                                       
Query: 349 ggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatg 408
           || | ||| || || || ||||||||| | |||||  ||||| | |||||||| || |||
Sbjct: 238 ggagctgttattcgtgggaagaagggcccaggtggggttactgttaagaagactggtatg 297

                                                              
Query: 409 gccctgattcttggtatctacgatgagcccatgactcctggccagtgcaat 459
           ||  |  |  |||||||||| ||||| || ||||||||||| || ||||||
Sbjct: 298 gctttagtcattggtatctatgatgaaccaatgactcctggtcaatgcaat 348



to top

>gb|AY292386.3| Cucumis melo var. reticulatus cultivar Mashadi profilin (Cuc m2)
           mRNA, complete cds; alternatively polyadenylated 2
          Length = 655

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 135/171 (78%)
 Strand = Plus / Plus

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||||||| | | | |||| || |||||||| ||||| |||||||| || |||
Sbjct: 178 cttgctccaactggtttgtacattggtggtacaaaatatatggtaatccaaggggagcct 237

                                                                       
Query: 349 ggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatg 408
           || | ||| || || || ||||||||| | |||||  ||||| | |||||||| || |||
Sbjct: 238 ggagctgttattcgtgggaagaagggcccaggtggggttactgttaagaagactggtatg 297

                                                              
Query: 409 gccctgattcttggtatctacgatgagcccatgactcctggccagtgcaat 459
           ||  |  |  |||||||||| ||||| || ||||||||||| || ||||||
Sbjct: 298 gctttagtcattggtatctatgatgaaccaatgactcctggtcaatgcaat 348



to top

>gb|AY292387.3| Cucumis melo var. reticulatus cultivar Mashadi profilin (Cuc m2)
           mRNA, complete cds; alternatively polyadenylated 3
          Length = 779

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 135/171 (78%)
 Strand = Plus / Plus

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||||||| | | | |||| || |||||||| ||||| |||||||| || |||
Sbjct: 178 cttgctccaactggtttgtacattggtggtacaaaatatatggtaatccaaggggagcct 237

                                                                       
Query: 349 ggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatg 408
           || | ||| || || || ||||||||| | |||||  ||||| | |||||||| || |||
Sbjct: 238 ggagctgttattcgtgggaagaagggcccaggtggggttactgttaagaagactggtatg 297

                                                              
Query: 409 gccctgattcttggtatctacgatgagcccatgactcctggccagtgcaat 459
           ||  |  |  |||||||||| ||||| || ||||||||||| || ||||||
Sbjct: 298 gctttagtcattggtatctatgatgaaccaatgactcctggtcaatgcaat 348



to top

>gb|AY271295.2| Cucumis melo var. reticulatus profilin (Cuc m2) mRNA, complete cds
          Length = 396

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 135/171 (78%)
 Strand = Plus / Plus

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||||||| | | | |||| || |||||||| ||||| |||||||| || |||
Sbjct: 178 cttgctccaactggtttgtacattggtggtacaaaatatatggtaatccaaggggagcct 237

                                                                       
Query: 349 ggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatg 408
           || | ||| || || || ||||||||| | |||||  ||||| | |||||||| || |||
Sbjct: 238 ggagctgttattcgtgggaagaagggcccaggtggggttactgttaagaagactggtatg 297

                                                              
Query: 409 gccctgattcttggtatctacgatgagcccatgactcctggccagtgcaat 459
           ||  |  |  |||||||||| ||||| || ||||||||||| || ||||||
Sbjct: 298 gctttagtcattggtatctatgatgaaccaatgactcctggtcaatgcaat 348



to top

>gb|DQ228336.1| Solanum tuberosum clone 145G03 profilin-like protein mRNA, complete
           cds
          Length = 645

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 186/239 (77%)
 Strand = Plus / Plus

                                                                       
Query: 221 ccaacttcccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaac 280
           |||| ||||| ||||||||||| || || ||  | |||||||| || |||||||  ||||
Sbjct: 145 ccaatttccctcagttcaagccagaagaaatatcaggcatcatgaatgactttgcggaac 204

                                                                       
Query: 281 ccggacatcttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaag 340
           | |||   ||||| ||||||||| | |  ||||| || |||||||||||||| || ||||
Sbjct: 205 cgggaacacttgctccaactggtttgtatcttgggggaacaaaatacatggtgattcaag 264

                                                                       
Query: 341 gtgaacctggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaaga 400
           | || || || | ||| |||||||| ||||||||  | ||||| || || || |||||||
Sbjct: 265 gagagccaggagctgtgatccgagggaagaagggtccaggtggtatcaccattaagaaga 324

                                                                      
Query: 401 cgggcatggccctgattcttggtatctacgatgagcccatgactcctggccagtgcaat 459
           |   |  |||  ||||  |||| || || |||||||| ||||||||||| |||||||||
Sbjct: 325 ccaaccaggctttgatcattggaatatatgatgagccgatgactcctggacagtgcaat 383



to top

>emb|Y15208.1|PJPROFIL1 Parietaria judaica mRNA for profilin 1
          Length = 399

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 132/167 (79%)
 Strand = Plus / Plus

                                                                       
Query: 175 tccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccccag 234
           |||||||| ||| ||||||| || |||||||| ||||| |||  | | |||||||| |||
Sbjct: 67  tccgccgctatcatcggccatgatggcagcgtttgggctcagagcgctaacttccctcag 126

                                                                       
Query: 235 ttcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatcttgca 294
           || ||||| || ||| || |||| ||||| || || ||| | ||| | |||  |||||| 
Sbjct: 127 ttgaagccagaagaggttactggaatcatgaatgattttaatgaagctggatttcttgcc 186

                                                          
Query: 295 ccaactggtcttttccttggaggcacaaaatacatggtcatccaagg 341
           ||||| ||  | ||||||||||| ||||| || ||||| ||||||||
Sbjct: 187 ccaaccgggttgttccttggaggtacaaagtatatggtgatccaagg 233



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 112 atgtcgtggcagacgtacgtcgacgaccacct 143
           |||||||||||| ||||||| || ||||||||
Sbjct: 1   atgtcgtggcaggcgtacgttgatgaccacct 32



to top

>gb|AF129423.1|AF129423 Apium graveolens profilin mRNA, complete cds
          Length = 405

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 93/115 (80%)
 Strand = Plus / Plus

                                                                       
Query: 188 tcggccacgacggcagcgtctgggcccagtcccccaacttcccccagttcaagcctgagg 247
           ||||||||||||||||||| ||||| |||  | |||  || || ||| | |||||||| |
Sbjct: 86  tcggccacgacggcagcgtttgggctcagagctccacttttcctcagattaagcctgaag 145

                                                                  
Query: 248 agattgctggcatcattaaggactttgacgaacccggacatcttgcaccaactgg 302
           |||||||||| || || || ||||| ||||| || || || |||||||| |||||
Sbjct: 146 agattgctggtattatgaaagacttcgacgagcctggccaccttgcacctactgg 200



to top

>gb|AF327622.1|AF327622 Corylus avellana clone 6 minor allergen hazelnut profilin mRNA,
           complete cds
          Length = 396

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 219/283 (77%)
 Strand = Plus / Plus

                                                                       
Query: 176 ccgccgccatcctcggccacgacggcagcgtctgggcccagtcccccaacttcccccagt 235
           |||| |||||| ||||||| ||||||||||| ||||| |||  | | |  ||||| ||| 
Sbjct: 65  ccgcggccatcatcggccatgacggcagcgtttgggctcagagctctactttccctcagc 124

                                                                       
Query: 236 tcaagcctgaggagattgctggcatcattaaggactttgacgaacccggacatcttgcac 295
           |||||||||| || ||  ||||| | || || |||||| | || ||||||   ||||| |
Sbjct: 125 tcaagcctgaagaaataactggcgttatgaatgactttaatgagcccggatcacttgctc 184

                                                                       
Query: 296 caactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacctggggttg 355
           |||| || || | |||||| |||||||| |||||||| |||||||| || || || | ||
Sbjct: 185 caaccggactgtaccttggtggcacaaagtacatggtgatccaaggcgagccgggagctg 244

                                                                       
Query: 356 tcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatggccctga 415
           | || ||| | ||||||||| | |||||  ||||  |||| |||||  |   |||| |||
Sbjct: 245 ttattcgaaggaagaagggccctggtggtgttaccgtcaaaaagactagtcaggccttga 304

                                                      
Query: 416 ttcttggtatctacgatgagcccatgactcctggccagtgcaa 458
           |  ||||||| || ||||| || ||||||||||| ||||||||
Sbjct: 305 tcattggtatatatgatgaaccaatgactcctgggcagtgcaa 347



to top

>gb|AY900015.1| Petroselinum crispum profilin 4 (PRF4) mRNA, complete cds
          Length = 708

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 75/91 (82%)
 Strand = Plus / Plus

                                                                       
Query: 188 tcggccacgacggcagcgtctgggcccagtcccccaacttcccccagttcaagcctgagg 247
           ||||||||||||||||||| ||||| |||  | |||  || || ||| | |||||||| |
Sbjct: 147 tcggccacgacggcagcgtttgggctcagagctccacttttcctcaggttaagcctgaag 206

                                          
Query: 248 agattgctggcatcattaaggactttgacga 278
           |||||||||| || || || |||||||||||
Sbjct: 207 agattgctggtattatgaaagactttgacga 237



to top

>ref|NM_125043.2| Arabidopsis thaliana PRF3 (PROFILIN 3); actin binding AT5G56600
           (PRF3) mRNA, complete cds
          Length = 701

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 419 ttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggaga 472
           |||||||||| ||||| || ||||||||||| || |||||| |||| |||||||
Sbjct: 419 ttggtatctatgatgaaccaatgactcctggacaatgcaatatggttgtggaga 472



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 168 cctcacctccgccgccatcctcggccacgacggcagcgtctgggc 212
           ||||||| ||||||| || |||||||| ||||| |||||||||||
Sbjct: 168 cctcaccgccgccgcaattctcggccaagacggtagcgtctgggc 212



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 112 atgtcgtggcagacgtacgtcgacga 137
           |||||||||||||| |||||||||||
Sbjct: 112 atgtcgtggcagacttacgtcgacga 137



to top

>gb|AY730591.1| Citrullus lanatus profilin mRNA, partial cds
          Length = 393

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 419 ttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggagaggcttg 478
           |||| ||||| ||||| || ||||||||||| ||||||||| || | || || |||||||
Sbjct: 308 ttggcatctatgatgaaccaatgactcctggtcagtgcaatatgattgttgaaaggcttg 367

                                 
Query: 479 gcgactacctggtcgagcaggg 500
           | || |||||  ||||||||||
Sbjct: 368 gggattaccttatcgagcaggg 389



to top

>gb|BT000885.1| Arabidopsis thaliana clone C105361 putative profilin protein
           (At5g56600) mRNA, complete cds
          Length = 538

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 419 ttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggaga 472
           |||||||||| ||||| || ||||||||||| || |||||| |||| |||||||
Sbjct: 419 ttggtatctatgatgaaccaatgactcctggacaatgcaatatggttgtggaga 472



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 168 cctcacctccgccgccatcctcggccacgacggcagcgtctgggc 212
           ||||||| ||||||| || |||||||| ||||| |||||||||||
Sbjct: 168 cctcaccgccgccgcaattctcggccaagacggtagcgtctgggc 212



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 112 atgtcgtggcagacgtacgtcgacga 137
           |||||||||||||| |||||||||||
Sbjct: 112 atgtcgtggcagacttacgtcgacga 137



to top

>gb|AY034989.1| Arabidopsis thaliana putative profilin protein (At5g56600) mRNA,
           partial cds
          Length = 675

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 419 ttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggaga 472
           |||||||||| ||||| || ||||||||||| || |||||| |||| |||||||
Sbjct: 410 ttggtatctatgatgaaccaatgactcctggacaatgcaatatggttgtggaga 463



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 168 cctcacctccgccgccatcctcggccacgacggcagcgtctgggc 212
           ||||||| ||||||| || |||||||| ||||| |||||||||||
Sbjct: 159 cctcaccgccgccgcaattctcggccaagacggtagcgtctgggc 203



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 112 atgtcgtggcagacgtacgtcgacga 137
           |||||||||||||| |||||||||||
Sbjct: 103 atgtcgtggcagacttacgtcgacga 128



to top

>emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 70
          Length = 198429

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Plus

                                                                          
Query: 111    gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
              ||||||||||||  | |||||||| ||||| ||    |||||| |||| ||| | |||||
Sbjct: 178214 gatgtcgtggcaatcatacgtcgatgaccatctcatgtgcgaggtcgaaggcaaccacct 178273

                                                        
Query: 171    cacctccgccgccatcctcggccacgacggcagcgtctgggc 212
              |||   |||||||||| ||||||| |||||||| ||||||||
Sbjct: 178274 cacacacgccgccatcttcggccaagacggcagtgtctgggc 178315



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 454    tgcaatttggtcgtggagaggcttggcgactacct 488
              ||||| ||||||||||||||||| ||||| |||||
Sbjct: 179146 tgcaacttggtcgtggagaggctcggcgattacct 179180



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                             
Query: 268    gactttgacgaacccggacatcttgcaccaactggtcttttccttgg 314
              |||||||| ||| ||||||||||||| ||||| || || ||||||||
Sbjct: 178849 gactttgaagaagccggacatcttgccccaaccgggctattccttgg 178895



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                    
Query: 320    caaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
              |||| |||||||| ||||||||||| || |||| ||| ||||| || |||||||
Sbjct: 176275 caaagtacatggtgatccaaggtgagcccggggctgtaatccgtggcaagaagg 176328



to top

>gb|U43592.1|U43592 Arabidopsis thaliana profilin (PRF3) mRNA, complete cds
          Length = 584

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 419 ttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggaga 472
           |||||||||| ||||| || ||||||||||| || |||||| |||| |||||||
Sbjct: 349 ttggtatctatgatgaaccaatgactcctggacaatgcaatatggttgtggaga 402



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 168 cctcacctccgccgccatcctcggccacgacggcagcgtctgggc 212
           ||||||| ||||||| || |||||||| ||||| |||||||||||
Sbjct: 98  cctcaccgccgccgcaattctcggccaagacggtagcgtctgggc 142



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 112 atgtcgtggcagacgtacgtcgacga 137
           |||||||||||||| |||||||||||
Sbjct: 42  atgtcgtggcagacttacgtcgacga 67



to top

>emb|BX833469.1|CNS0A0EA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL57ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 633

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 419 ttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggaga 472
           |||||||||| ||||| || ||||||||||| || |||||| |||| |||||||
Sbjct: 392 ttggtatctatgatgaaccaatgactcctggacaatgcaatatggttgtggaga 445



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 168 cctcacctccgccgccatcctcggccacgacggcagcgtctgggc 212
           ||||||| ||||||| || |||||||| ||||| |||||||||||
Sbjct: 141 cctcaccgccgccgcaattctcggccaagacggtagcgtctgggc 185



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 112 atgtcgtggcagacgtacgtcgacga 137
           |||||||||||||| |||||||||||
Sbjct: 85  atgtcgtggcagacttacgtcgacga 110



to top

>gb|AY084285.1| Arabidopsis thaliana clone 102364 mRNA, complete sequence
          Length = 686

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 419 ttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggaga 472
           |||||||||| ||||| || ||||||||||| || |||||| |||| |||||||
Sbjct: 404 ttggtatctatgatgaaccaatgactcctggacaatgcaatatggttgtggaga 457



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 168 cctcacctccgccgccatcctcggccacgacggcagcgtctgggc 212
           ||||||| ||||||| || |||||||| ||||| |||||||||||
Sbjct: 153 cctcaccgccgccgcaattctcggccaagacggtagcgtctgggc 197



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 112 atgtcgtggcagacgtacgtcgacga 137
           |||||||||||||| |||||||||||
Sbjct: 97  atgtcgtggcagacttacgtcgacga 122



to top

>dbj|AB013392.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MIK19
          Length = 84129

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                  
Query: 419  ttggtatctacgatgagcccatgactcctggccagtgcaatttggtcgtggaga 472
            |||||||||| ||||| || ||||||||||| || |||||| |||| |||||||
Sbjct: 8175 ttggtatctatgatgaaccaatgactcctggacaatgcaatatggttgtggaga 8122



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 168  cctcacctccgccgccatcctcggccacgacggcagcgtctgggc 212
            ||||||| ||||||| || |||||||| ||||| |||||||||||
Sbjct: 8859 cctcaccgccgccgcaattctcggccaagacggtagcgtctgggc 8815



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 112  atgtcgtggcagacgtacgtcgacga 137
            |||||||||||||| |||||||||||
Sbjct: 8915 atgtcgtggcagacttacgtcgacga 8890



to top

>gb|U43323.1|ATU43323 Arabidopsis thaliana profilin 2 and profilin 3 genes, complete cds
          Length = 5329

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Plus

                                                                        
Query: 111  gatgtcgtggcagacgtacgtcgacgaccacctgtgctgcgagatcgacggccagcacct 170
            ||||||||||||  | |||||||| ||||| ||    |||||| |||| ||| | |||||
Sbjct: 4028 gatgtcgtggcaatcatacgtcgatgaccatctcatgtgcgaggtcgaaggcaaccacct 4087

                                                      
Query: 171  cacctccgccgccatcctcggccacgacggcagcgtctgggc 212
            |||   |||||||||| ||||||| |||||||| ||||||||
Sbjct: 4088 cacacacgccgccatcttcggccaagacggcagtgtctgggc 4129



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 454  tgcaatttggtcgtggagaggcttggcgactacct 488
            ||||| ||||||||||||||||| ||||| |||||
Sbjct: 4961 tgcaacttggtcgtggagaggctcggcgattacct 4995



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 268  gactttgacgaacccggacatcttgcaccaactggtcttttccttgg 314
            |||||||| ||| ||||||||||||| ||||| || || ||||||||
Sbjct: 4664 gactttgaagaagccggacatcttgccccaaccgggctattccttgg 4710



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                  
Query: 320  caaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
            |||| |||||||| ||||||||||| || |||| ||| ||||| || |||||||
Sbjct: 2089 caaagtacatggtgatccaaggtgagcccggggctgtaatccgtggcaagaagg 2142



to top

>gb|AC005169.3| Arabidopsis thaliana chromosome 2 clone F6F22 map mi148, complete
              sequence
          Length = 126386

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                   
Query: 321    aaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
              |||||||||||| |||||||||||||  || | ||| |||||||| |||||||
Sbjct: 106043 aaaatacatggttatccaaggtgaacaaggagctgtgatccgagggaagaagg 106095



to top

>gb|U43593.1|U43593 Arabidopsis thaliana profilin (PRF1) gene, complete cds
          Length = 1833

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 321  aaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
            |||||||||||| |||||||||||||  || | ||| |||||||| |||||||
Sbjct: 1276 aaaatacatggttatccaaggtgaacaaggagctgtgatccgagggaagaagg 1328



to top

>gb|U43322.1|ATU43322 Arabidopsis thaliana profilin 1 gene, complete cds
          Length = 3113

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                 
Query: 321  aaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
            |||||||||||| |||||||||||||  || | ||| |||||||| |||||||
Sbjct: 2397 aaaatacatggttatccaaggtgaacaaggagctgtgatccgagggaagaagg 2449



to top

>emb|Y12430.1|OEPROFIL3 Olea europaea mRNA for profilin 3
          Length = 405

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 102/128 (79%)
 Strand = Plus / Plus

                                                                       
Query: 310 cttggaggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaag 369
           |||||||| ||||| || ||||| || ||||| ||  |||| | ||||||||| ||||||
Sbjct: 208 cttggaggaacaaagtatatggtgattcaaggagaggctggagctgtcatccgtggaaag 267

                                                                       
Query: 370 aagggcaccggtggcattactatcaagaagacgggcatggccctgattcttggtatctac 429
           |||||  | ||||| ||||| || |||||||| |||   || ||  || |||||||||||
Sbjct: 268 aagggatctggtggtattaccattaagaagactggccaagcactagtttttggtatctac 327

                   
Query: 430 gatgagcc 437
           || |||||
Sbjct: 328 gaggagcc 335



to top

>gb|AF049936.1|AF049936 Petunia x hybrida PGPS/NH20 (PGPS/NH20) mRNA, partial cds
          Length = 629

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                       
Query: 271 tttgacgaacccggacatcttgcaccaactggtcttttccttggaggcacaaaatacatg 330
           ||||| ||||| |||  |||||| || |||||||| |||||||  ||  ||||||| |||
Sbjct: 140 tttgatgaacctggatttcttgctcccactggtctattccttgctggggcaaaatatatg 199

                               
Query: 331 gtcatccaaggtgaacctgg 350
           || || ||||||||||||||
Sbjct: 200 gtaattcaaggtgaacctgg 219



to top

>ref|NM_119079.3| Arabidopsis thaliana PRF4; actin binding AT4G29340 (PRF4) mRNA,
           complete cds
          Length = 707

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 320 caaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaaggg 374
           |||| |||||||| ||||||||||| || |||| ||| ||||| || ||||||||
Sbjct: 289 caaagtacatggtgatccaaggtgagcccggggctgtaatccgtggcaagaaggg 343



to top

>gb|DQ207877.1| Solanum tuberosum clone 092D10 profilin-like mRNA, complete cds
          Length = 750

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 185/239 (77%)
 Strand = Plus / Plus

                                                                       
Query: 221 ccaacttcccccagttcaagcctgaggagattgctggcatcattaaggactttgacgaac 280
           |||| ||||| ||||||||||| || || ||  | ||| |||| || |||||||  ||||
Sbjct: 247 ccaatttccctcagttcaagcccgaagaaataacaggcgtcatgaatgactttgcggaac 306

                                                                       
Query: 281 ccggacatcttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaag 340
           | |||   ||||| ||||||||| | |  ||||| || |||||||||||||| || ||||
Sbjct: 307 ctggaacacttgctccaactggtttgtatcttgggggaacaaaatacatggtgattcaag 366

                                                                       
Query: 341 gtgaacctggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaaga 400
           | || || || | ||| |||||||| ||||||||  | ||||| || || || |||||||
Sbjct: 367 gagagccaggagctgtgatccgagggaagaagggtccaggtggtatcaccattaagaaga 426

                                                                      
Query: 401 cgggcatggccctgattcttggtatctacgatgagcccatgactcctggccagtgcaat 459
           |   |  |||  ||||  |||| || || |||||||| ||||||||||| |||||||||
Sbjct: 427 ccaaccaggctttgatcattggaatatatgatgagccgatgactcctggacagtgcaat 485



to top

>gb|AY496123.1| Capsicum annuum profilin mRNA, complete cds
          Length = 647

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 134/171 (78%)
 Strand = Plus / Plus

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||||||| | |  ||||| || |||||||||||||| || ||||| || || 
Sbjct: 209 cttgctccaactggtttgtatcttgggggaacaaaatacatggtgattcaaggagagcca 268

                                                                       
Query: 349 ggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatg 408
           || || || |||||||| ||||||||  | ||||| || || || ||||||||   |  |
Sbjct: 269 ggagtggtgatccgagggaagaagggtccaggtggtatcaccattaagaagaccaaccag 328

                                                              
Query: 409 gccctgattcttggtatctacgatgagcccatgactcctggccagtgcaat 459
           ||  ||||  |||| || || |||||||| ||||||||||| |||||||||
Sbjct: 329 gctttgatcattggaatatatgatgagccaatgactcctgggcagtgcaat 379



to top

>gb|AC093530.2| Homo sapiens chromosome 5 clone RP11-401N6, complete sequence
          Length = 115015

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 80     gggggaggaggaggagcgggagg 102
              |||||||||||||||||||||||
Sbjct: 107197 gggggaggaggaggagcgggagg 107219



to top

>gb|BT024816.1| Arabidopsis thaliana At4g29340 gene, complete cds
          Length = 405

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 320 caaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaaggg 374
           |||| |||||||| ||||||||||| || |||| ||| ||||| || ||||||||
Sbjct: 218 caaagtacatggtgatccaaggtgagcccggggctgtaatccgtggcaagaaggg 272



to top

>gb|AF414696.1|AF414696 Acanthamoeba castellanii profilin 1B mRNA, complete cds
          Length = 484

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 112 atgtcgtggcagacgtacgtcga 134
           |||||||||||||||||||||||
Sbjct: 36  atgtcgtggcagacgtacgtcga 58



to top

>gb|AC099554.2| Homo sapiens chromosome 5 clone RP11-61G23, complete sequence
          Length = 164920

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 80     gggggaggaggaggagcgggagg 102
              |||||||||||||||||||||||
Sbjct: 147808 gggggaggaggaggagcgggagg 147786



to top

>gb|AY894660.1| Ambrosia artemisiifolia profilin isoallergen 1 mRNA, complete cds
          Length = 791

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 320 caaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaaggg 374
           |||| |||||||| ||||||||||| ||||| | ||| || || |||||||||||
Sbjct: 221 caaagtacatggtaatccaaggtgagcctggagctgttattcgtggaaagaaggg 275



to top

>gb|BT003946.1| Arabidopsis thaliana clone RAFL15-14-D07 (R20752) putative profilin
           3 (At4g29340) mRNA, complete cds
          Length = 723

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 320 caaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaaggg 374
           |||| |||||||| ||||||||||| || |||| ||| ||||| || ||||||||
Sbjct: 289 caaagtacatggtgatccaaggtgagcccggggctgtaatccgtggcaagaaggg 343



to top

>gb|AY085179.1| Arabidopsis thaliana clone 13601 mRNA, complete sequence
          Length = 705

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 320 caaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaaggg 374
           |||| |||||||| ||||||||||| || |||| ||| ||||| || ||||||||
Sbjct: 287 caaagtacatggtgatccaaggtgagcccggggctgtaatccgtggcaagaaggg 341



to top

>gb|AY900016.1| Petroselinum crispum profilin 5 (PRF5) mRNA, complete cds
          Length = 764

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 316 ggcacaaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaaggg 374
           |||||||| || ||||| || ||||||||||||   | |||||| ||||||||||||||
Sbjct: 389 ggcacaaagtatatggtgattcaaggtgaacctaatgctgtcatacgaggaaagaaggg 447



to top

>gb|AY879597.1| Cucumis melo profilin (m2) mRNA, complete cds and 3' UTR
          Length = 576

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 134/171 (78%)
 Strand = Plus / Plus

                                                                       
Query: 289 cttgcaccaactggtcttttccttggaggcacaaaatacatggtcatccaaggtgaacct 348
           ||||| ||||||||| | | | |||| || |||||||| ||||| |||||||| || |||
Sbjct: 178 cttgctccaactggtttgtacattggtggtacaaaatatatggtaatccaaggggagcct 237

                                                                       
Query: 349 ggggttgtcatccgaggaaagaagggcaccggtggcattactatcaagaagacgggcatg 408
           || | ||| || || || ||||||||| | |||||   |||| | |||||||| || |||
Sbjct: 238 ggagctgttattcgtgggaagaagggcccaggtggggctactgttaagaagactggtatg 297

                                                              
Query: 409 gccctgattcttggtatctacgatgagcccatgactcctggccagtgcaat 459
           ||  |  |  |||||||||| ||||| || ||||||||||| || ||||||
Sbjct: 298 gctttagtcattggtatctatgatgaaccaatgactcctggtcaatgcaat 348



to top

>gb|AC142106.4| Mus musculus BAC clone RP24-180L10 from 1, complete sequence
          Length = 194634

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 79    agggggaggaggaggagcgggaggcga 105
             ||||||||||||||||| |||||||||
Sbjct: 46167 agggggaggaggaggagggggaggcga 46141



to top

>ref|NM_187950.1| Oryza sativa (japonica cultivar-group), Ozsa8370 predicted mRNA
          Length = 927

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 79  agggggaggaggaggagcgggaggcg 104
           ||||||||||||||||| ||||||||
Sbjct: 63  agggggaggaggaggagggggaggcg 88



to top

>ref|XM_466029.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1206

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 83  ggaggaggaggagcgggaggcg 104
           ||||||||||||||||||||||
Sbjct: 51  ggaggaggaggagcgggaggcg 30



to top

>ref|NM_191374.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 663

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 81  ggggaggaggaggagcgggagg 102
           ||||||||||||||||||||||
Sbjct: 442 ggggaggaggaggagcgggagg 463



to top

>ref|XM_420896.1| PREDICTED: Gallus gallus nuclear protein NP220 (LOC395593), partial
            mRNA
          Length = 2991

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 79   agggggaggaggaggagcgggaggcg 104
            ||||||||||||||||| ||||||||
Sbjct: 2308 agggggaggaggaggagggggaggcg 2333



to top

>gb|AY499654.1| Capsicum annuum profilin mRNA, partial cds
          Length = 329

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 430 gatgagcccatgactcctggccagtgcaat 459
           |||||||| ||||||||||| |||||||||
Sbjct: 89  gatgagccaatgactcctgggcagtgcaat 118



to top

>ref|XM_862186.1| PREDICTED: Canis familiaris similar to LIM domain only 4
           (predicted), transcript variant 2 (LOC479962), mRNA
          Length = 1946

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 83  ggaggaggaggagcgggaggcg 104
           ||||||||||||||||||||||
Sbjct: 132 ggaggaggaggagcgggaggcg 153



to top

>ref|XM_537086.2| PREDICTED: Canis familiaris similar to LIM domain only 4
           (predicted), transcript variant 1 (LOC479962), mRNA
          Length = 2210

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 83  ggaggaggaggagcgggaggcg 104
           ||||||||||||||||||||||
Sbjct: 336 ggaggaggaggagcgggaggcg 357



to top

>gb|AC101882.14| Mus musculus chromosome 10, clone RP23-394M6, complete sequence
          Length = 209838

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 393  caagaagacgggcatggccctg 414
            ||||||||||||||||||||||
Sbjct: 3364 caagaagacgggcatggccctg 3385



to top

>emb|AJ417553.1|LES417553 Lycopersicon esculentum mRNA for profilin, allergen Lyc e 1
          Length = 581

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 430 gatgagcccatgactcctggccagtgcaat 459
           |||||||| ||||||||||| |||||||||
Sbjct: 319 gatgagccgatgactcctggacagtgcaat 348



to top

>emb|AL773519.5| Mouse DNA sequence from clone RP23-42C15 on chromosome 4 Contains
             mitochondrial NADH dehydrogenase 5 and 6 (mt-Nd5, mt-Nd6)
             pseudogenes and a mitochondrial cytochrome b (Cytb)
             pseudogene, complete sequence
          Length = 204189

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 79    agggggaggaggaggagcggga 100
             ||||||||||||||||||||||
Sbjct: 65610 agggggaggaggaggagcggga 65631



to top

>gb|AC136191.5| Rattus norvegicus  BAC CH230-52I17 (Children's Hospital Oakland
            Research Institute Rat (BN/SsNHsd/MCW) BAC library)
            complete sequence
          Length = 221923

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 78   aagggggaggaggaggagcgggaggc 103
            |||||||||||||||||| |||||||
Sbjct: 1462 aagggggaggaggaggagggggaggc 1437



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 83       ggaggaggaggagcgggaggcg 104
                ||||||||||||||||||||||
Sbjct: 19186019 ggaggaggaggagcgggaggcg 19185998



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 83       ggaggaggaggagcgggagg 102
                ||||||||||||||||||||
Sbjct: 24178139 ggaggaggaggagcgggagg 24178158



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 79       agggggaggaggaggagcgg 98
                ||||||||||||||||||||
Sbjct: 21825908 agggggaggaggaggagcgg 21825927



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 79       agggggaggaggaggagcgg 98
                ||||||||||||||||||||
Sbjct: 21816196 agggggaggaggaggagcgg 21816215



to top

>dbj|AP003239.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0403C05
          Length = 151085

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 81     ggggaggaggaggagcgggagg 102
              ||||||||||||||||||||||
Sbjct: 123520 ggggaggaggaggagcgggagg 123499



to top

>gb|U43594.1|U43594 Arabidopsis thaliana profilin (PRF4) gene, complete cds
          Length = 1792

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                  
Query: 320  caaaatacatggtcatccaaggtgaacctggggttgtcatccgaggaaagaagg 373
            |||| |||||||| ||||||||||| || |||| ||| ||||| || |||||||
Sbjct: 1231 caaagtacatggtgatccaaggtgagcccggggctgtaatccgtggcaagaagg 1284



to top

>dbj|AP002817.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0699D11
          Length = 140825

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 79    agggggaggaggaggagcgggaggcg 104
             ||||||||||||||||| ||||||||
Sbjct: 76005 agggggaggaggaggagggggaggcg 76030



to top

>gb|AC155286.8| Mus musculus 10 BAC RP23-213N17 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 219072

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 393   caagaagacgggcatggccctg 414
             ||||||||||||||||||||||
Sbjct: 78893 caagaagacgggcatggccctg 78872



to top

>dbj|AP004758.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0664C05
          Length = 165354

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 82    gggaggaggaggagcgggaggc 103
             ||||||||||||||||||||||
Sbjct: 88120 gggaggaggaggagcgggaggc 88141



to top

>dbj|AP004772.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0415B12
          Length = 157419

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 83    ggaggaggaggagcgggaggcg 104
             ||||||||||||||||||||||
Sbjct: 84268 ggaggaggaggagcgggaggcg 84247



to top

>dbj|AK108944.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-B10, full
           insert sequence
          Length = 1112

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 81  ggggaggaggaggagcgggagg 102
           ||||||||||||||||||||||
Sbjct: 518 ggggaggaggaggagcgggagg 539



to top

>gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome 17, complete sequence
          Length = 199737

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 82     gggaggaggaggagcgggagg 102
              |||||||||||||||||||||
Sbjct: 179237 gggaggaggaggagcgggagg 179217



to top

>gb|AC144926.6| Mus musculus chromosome 8, clone RP23-8E24, complete sequence
          Length = 214694

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 552    tgctcctgtgggctttgcatc 572
              |||||||||||||||||||||
Sbjct: 118858 tgctcctgtgggctttgcatc 118838



to top

>ref|NM_187849.1| Oryza sativa (japonica cultivar-group), Ozsa8293 predicted mRNA
          Length = 1209

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 80  gggggaggaggaggagcgggaggcg 104
           |||||||||||||||| ||||||||
Sbjct: 195 gggggaggaggaggagtgggaggcg 219



to top

>gb|AC161528.14| Mus musculus chromosome 8, clone RP23-369H18, complete sequence
          Length = 206302

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 78    aagggggaggaggaggagcgggagg 102
             |||||||||||||||||| ||||||
Sbjct: 33167 aagggggaggaggaggagggggagg 33143



to top

>gb|AY652590.1| Oryza sativa (japonica cultivar-group) cell death-related protein
           SPL11 (Spl11) gene, complete cds
          Length = 4760

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 79  agggggaggaggaggagcggg 99
           |||||||||||||||||||||
Sbjct: 236 agggggaggaggaggagcggg 256



to top

>gb|AY652589.1| Oryza sativa (japonica cultivar-group) cell death-related protein
           SPL11 (Spl11) mRNA, complete cds
          Length = 2518

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 79  agggggaggaggaggagcggg 99
           |||||||||||||||||||||
Sbjct: 316 agggggaggaggaggagcggg 336



to top

>gb|AY657883.1| Synthetic construct Peudomonas aeruginosa clone FLH045602.01F
           PA0403 gene, partial cds
          Length = 513

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 150 cgagatcgacggccagcacct 170
           |||||||||||||||||||||
Sbjct: 249 cgagatcgacggccagcacct 269



to top

>gb|AC125028.8| Mus musculus chromosome 16, clone RP24-85G10, complete sequence
          Length = 269788

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 78    aagggggaggaggaggagcgggagg 102
             |||||||||||||||||| ||||||
Sbjct: 46743 aagggggaggaggaggagggggagg 46719



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 106     ccgaggatgtcgtggcagacg 126
               |||||||||||||||||||||
Sbjct: 2119155 ccgaggatgtcgtggcagacg 2119135



to top

>gb|AF254983.3| Homo sapiens chromosome 21 clone RP11-589M2 map p11-q21.1, complete
              sequence
          Length = 190711

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 78     aagggggaggaggaggagcgggagg 102
              |||| ||||||||||||||||||||
Sbjct: 169044 aaggaggaggaggaggagcgggagg 169020



to top

>gb|AC113110.17| Mus musculus chromosome 16, clone RP23-328A9, complete sequence
          Length = 240173

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 78    aagggggaggaggaggagcgggagg 102
             |||||||||||||||||| ||||||
Sbjct: 24036 aagggggaggaggaggagggggagg 24060



to top

>gb|AC125056.3| Mus musculus BAC clone RP23-398G2 from chromosome 14, complete sequence
          Length = 204350

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 78     aagggggaggaggaggagcgggagg 102
              |||||||||||||||||| ||||||
Sbjct: 123251 aagggggaggaggaggagggggagg 123227



to top

>gb|AC163618.4| Mus musculus BAC clone RP24-158G13 from chromosome 3, complete sequence
          Length = 198108

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 78    aagggggaggaggaggagcgggagg 102
             |||||||||||||||||| ||||||
Sbjct: 20700 aagggggaggaggaggagggggagg 20724



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 106    ccgaggatgtcgtggcagacg 126
              |||||||||||||||||||||
Sbjct: 280866 ccgaggatgtcgtggcagacg 280846



to top

>emb|AL939125.1|SCO939125 Streptomyces coelicolor A3(2) complete genome; segment 22/29
          Length = 295150

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 152    agatcgacggccagcacctca 172
              |||||||||||||||||||||
Sbjct: 112001 agatcgacggccagcacctca 111981



to top

>emb|AL163201.2|HS21C001 Homo sapiens chromosome 21 segment HS21C001
          Length = 281116

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 78     aagggggaggaggaggagcgggagg 102
              |||| ||||||||||||||||||||
Sbjct: 217180 aaggaggaggaggaggagcgggagg 217156



to top

>emb|CR354591.13| Zebrafish DNA sequence from clone DKEY-18L4 in linkage group 24,
             complete sequence
          Length = 218314

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 79    agggggaggaggaggagcgggaggc 103
             ||||||||||||||||| |||||||
Sbjct: 94297 agggggaggaggaggagggggaggc 94273



to top

>gb|AC069366.8| Homo sapiens chromosome 17, clone RP11-720N19, complete sequence
          Length = 180754

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 78    aagggggaggaggaggagcgggagg 102
             |||||||||||||||||| ||||||
Sbjct: 80055 aagggggaggaggaggagggggagg 80079



to top

>gb|AC091682.26| Mus musculus strain C57BL/6J chromosome 3 clone rp23-135c10, complete
              sequence
          Length = 206957

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 78     aagggggaggaggaggagcgggagg 102
              |||||||||||||||||| ||||||
Sbjct: 137496 aagggggaggaggaggagggggagg 137520



to top

>gb|AC154913.4| Ornithorhynchus anatinus BAC clone OABb-535A1 from chromosome unknown,
              complete sequence
          Length = 199332

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 83     ggaggaggaggagcgggaggc 103
              |||||||||||||||||||||
Sbjct: 145447 ggaggaggaggagcgggaggc 145427



to top

>dbj|AK133754.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
            enriched library, clone:5730406J02 product:pericentriolar
            material 1, full insert sequence
          Length = 2634

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 552  tgctcctgtgggctttgcatc 572
            |||||||||||||||||||||
Sbjct: 1700 tgctcctgtgggctttgcatc 1720



to top

>ref|XM_688822.1| PREDICTED: Danio rerio similar to RING finger protein 6 (RING-H2
           protein) (LOC565543), mRNA
          Length = 2091

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 79  agggggaggaggaggagcgggaggc 103
           ||||||||||||||||| |||||||
Sbjct: 516 agggggaggaggaggagggggaggc 492



to top

>gb|AC158222.6| Mus musculus chromosome 8, clone RP23-117M15, complete sequence
          Length = 207233

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 552  tgctcctgtgggctttgcatc 572
            |||||||||||||||||||||
Sbjct: 8795 tgctcctgtgggctttgcatc 8815



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 106     ccgaggatgtcgtggcagacg 126
               |||||||||||||||||||||
Sbjct: 2044118 ccgaggatgtcgtggcagacg 2044138



to top

>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome
          Length = 5751492

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 79      agggggaggaggaggagcgggaggc 103
               ||||||||||||||||| |||||||
Sbjct: 1424355 agggggaggaggaggagggggaggc 1424331



to top

>gb|AF352180.1|AF352180 Mus musculus pericentriolar material gene 1 protein (Pcm1) mRNA,
            alternatively spliced, partial cds
          Length = 6010

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 552  tgctcctgtgggctttgcatc 572
            |||||||||||||||||||||
Sbjct: 1348 tgctcctgtgggctttgcatc 1368



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 79       agggggaggaggaggagcggg 99
                |||||||||||||||||||||
Sbjct: 23506799 agggggaggaggaggagcggg 23506779



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 79       agggggaggaggaggagcgg 98
                ||||||||||||||||||||
Sbjct: 22940673 agggggaggaggaggagcgg 22940654



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 79      agggggaggaggaggagcgg 98
               ||||||||||||||||||||
Sbjct: 4811733 agggggaggaggaggagcgg 4811714



to top

>gb|AC004596.2| Homo sapiens chromosome 17, clone CTB-175E5, complete sequence
          Length = 92000

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 82   gggaggaggaggagcgggagg 102
            |||||||||||||||||||||
Sbjct: 2033 gggaggaggaggagcgggagg 2013



to top

>gb|AC102022.8| Mus musculus chromosome 8, clone RP24-67K5, complete sequence
          Length = 156728

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 78     aagggggaggaggaggagcgggagg 102
              |||||||||||||||||| ||||||
Sbjct: 121135 aagggggaggaggaggagtgggagg 121159



to top

>gb|AC010686.9| Homo sapiens BAC clone RP11-504L12 from 2, complete sequence
          Length = 177536

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 78     aagggggaggaggaggagcgggagg 102
              ||||||||||||||||||| |||||
Sbjct: 160612 aagggggaggaggaggagcaggagg 160636



to top

>gb|AE004477.1| Pseudomonas aeruginosa PAO1, section 38 of 529 of the complete genome
          Length = 11988

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 150  cgagatcgacggccagcacct 170
            |||||||||||||||||||||
Sbjct: 9547 cgagatcgacggccagcacct 9527



to top

>dbj|AP001278.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0434D08
          Length = 161266

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 80    gggggaggaggaggagcgggaggcg 104
             |||||||||||||||| ||||||||
Sbjct: 35782 gggggaggaggaggagtgggaggcg 35806



to top

>gb|AC098718.5| Mus musculus BAC clone RP23-2K11 from chromosome 14, complete sequence
          Length = 199906

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 78     aagggggaggaggaggagcgggagg 102
              |||||||||||||||||| ||||||
Sbjct: 114512 aagggggaggaggaggagggggagg 114536



to top

>emb|BX897672.1| Neurospora crassa DNA linkage group III BAC clone B2H10
          Length = 66518

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 277   gaacccggacatcttgcacca 297
             |||||||||||||||||||||
Sbjct: 16079 gaacccggacatcttgcacca 16099



to top

>emb|AL929009.5| Zebrafish DNA sequence from clone CH211-202A8 in linkage group 24,
             complete sequence
          Length = 208279

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 79    agggggaggaggaggagcgggaggc 103
             ||||||||||||||||| |||||||
Sbjct: 74428 agggggaggaggaggagggggaggc 74452



to top

>gb|AY900013.1| Petroselinum crispum profilin 2 (PRF2) mRNA, complete cds
          Length = 649

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 188 tcggccacgacggcagcgtctgggc 212
           ||||||||||||||||||| |||||
Sbjct: 140 tcggccacgacggcagcgtttgggc 164



to top

>gb|AF148692.1|AF148692 Pseudomonas aeruginosa pyrimidine regulatory protein PyrR (pyrR)
           gene, complete cds; and aspartate transcarbamoylase
           catalytic subunit PyrB (pyrB) gene, partial cds
          Length = 740

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 150 cgagatcgacggccagcacct 170
           |||||||||||||||||||||
Sbjct: 360 cgagatcgacggccagcacct 380



to top

>emb|AJ308589.1|HSA308589 Homo sapiens partial UBTF for upstream binding transcription factor,
            RNA polymerase I, promoter region and exon 1
          Length = 2398

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 82   gggaggaggaggagcgggagg 102
            |||||||||||||||||||||
Sbjct: 1971 gggaggaggaggagcgggagg 1951



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 106     ccgaggatgtcgtggcagacg 126
               |||||||||||||||||||||
Sbjct: 2687576 ccgaggatgtcgtggcagacg 2687596



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 79       agggggaggaggaggagcggg 99
                |||||||||||||||||||||
Sbjct: 23434990 agggggaggaggaggagcggg 23434970



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 79       agggggaggaggaggagcgg 98
                ||||||||||||||||||||
Sbjct: 22868864 agggggaggaggaggagcgg 22868845



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 79      agggggaggaggaggagcgg 98
               ||||||||||||||||||||
Sbjct: 4811714 agggggaggaggaggagcgg 4811695



to top

>emb|AL845346.4|CNS08CB8 Oryza sativa chromosome 12, . BAC OSJNBa0018E22 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 69273

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 79    agggggaggaggaggagcggg 99
             |||||||||||||||||||||
Sbjct: 27347 agggggaggaggaggagcggg 27327



to top

>emb|AL954730.15| Mouse DNA sequence from clone RP23-461C4 on chromosome 11, complete
              sequence
          Length = 193721

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 82     gggaggaggaggagcgggagg 102
              |||||||||||||||||||||
Sbjct: 151488 gggaggaggaggagcgggagg 151508



to top

>emb|CT030251.8| Mouse DNA sequence from clone RP24-284K11 on chromosome 16, complete
             sequence
          Length = 186902

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 78    aagggggaggaggaggagcgggagg 102
             |||||||||||||||||| ||||||
Sbjct: 65254 aagggggaggaggaggagggggagg 65278



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    agggggaggaggaggagcgggagg 102
             ||||||||||||||||| ||||||
Sbjct: 65291 agggggaggaggaggagggggagg 65314



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    agggggaggaggaggagcgggagg 102
             ||||||||||||||||| ||||||
Sbjct: 65270 agggggaggaggaggagggggagg 65293



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    agggggaggaggaggagcgggagg 102
             ||||||||||||||||| ||||||
Sbjct: 65187 agggggaggaggaggagggggagg 65210



to top

>ref|NM_023662.1| Mus musculus pericentriolar material 1 (Pcm1), mRNA
          Length = 6674

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 552  tgctcctgtgggctttgcatc 572
            |||||||||||||||||||||
Sbjct: 1565 tgctcctgtgggctttgcatc 1585



to top

>emb|AL670114.17| Mouse DNA sequence from clone RP23-7C19 on chromosome X, complete
             sequence
          Length = 128978

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 78    aagggggaggaggaggagcgggagg 102
             |||| ||||||||||||||||||||
Sbjct: 85646 aaggaggaggaggaggagcgggagg 85670



to top

>emb|CT010571.7| Mouse DNA sequence from clone RP23-300L8 on chromosome 16, complete
              sequence
          Length = 218760

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 78     aagggggaggaggaggagcgggagg 102
              |||||||||||||||||| ||||||
Sbjct: 182017 aagggggaggaggaggagggggagg 182041



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 79     agggggaggaggaggagcgggagg 102
              ||||||||||||||||| ||||||
Sbjct: 182054 agggggaggaggaggagggggagg 182077



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 79     agggggaggaggaggagcgggagg 102
              ||||||||||||||||| ||||||
Sbjct: 182033 agggggaggaggaggagggggagg 182056



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 79     agggggaggaggaggagcgggagg 102
              ||||||||||||||||| ||||||
Sbjct: 181950 agggggaggaggaggagggggagg 181973



to top

>gb|U14937.1|RNU14937 Rattus norvegicus S-adenosyl-L-homocysteine hydrolase gene, complete
             cds
          Length = 16951

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 81    ggggaggaggaggagcgggag 101
             |||||||||||||||||||||
Sbjct: 12582 ggggaggaggaggagcgggag 12602



to top

>emb|AL844149.4| Mouse DNA sequence from clone RP23-194D5 on chromosome 4, complete
             sequence
          Length = 199774

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 78    aagggggaggaggaggagcgggagg 102
             |||||||||||||||||| ||||||
Sbjct: 59270 aagggggaggaggaggagggggagg 59246



to top

>dbj|AB029291.1| Mus musculus pcm-1 mRNA for pericentriolar material-1, complete cds
          Length = 6674

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 552  tgctcctgtgggctttgcatc 572
            |||||||||||||||||||||
Sbjct: 1565 tgctcctgtgggctttgcatc 1585



to top

>emb|AL671877.15| Mouse DNA sequence from clone RP23-214E3 on chromosome 3, complete
             sequence
          Length = 146015

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 78    aagggggaggaggaggagcgggagg 102
             |||||||||||||||||| ||||||
Sbjct: 47195 aagggggaggaggaggagggggagg 47219



to top

>emb|AL359399.3|CNS05TEV Human chromosome 14 DNA sequence BAC C-2223O18 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 134213

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 78    aagggggaggaggaggagcgggagg 102
             |||||||||||||||||| ||||||
Sbjct: 48902 aagggggaggaggaggagggggagg 48926



to top

>gb|AC102324.9| Mus musculus chromosome 1, clone RP24-476A18, complete sequence
          Length = 129634

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    agggggaggaggaggagcgggagg 102
             ||||||||||||||||| ||||||
Sbjct: 69896 agggggaggaggaggagggggagg 69919



to top

>gb|AC116384.9| Mus musculus chromosome 3, clone RP23-20L19, complete sequence
          Length = 203580

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 79     agggggaggaggaggagcgggagg 102
              ||||||||||||||||| ||||||
Sbjct: 197653 agggggaggaggaggagagggagg 197676



to top

>gb|AC171406.3| Mus musculus  BAC RP24-475O6 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 192548

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 79     agggggaggaggaggagcgggagg 102
              ||||||||||||||||| ||||||
Sbjct: 121118 agggggaggaggaggagggggagg 121095



to top

>gb|AC131995.14| Mus musculus chromosome 1, clone RP24-338G10, complete sequence
          Length = 153731

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     agggggaggaggaggagcgg 98
              ||||||||||||||||||||
Sbjct: 107266 agggggaggaggaggagcgg 107285



to top

>gb|AC108413.4| Mus musculus chromosome 8, clone RP23-472M11, complete sequence
          Length = 174540

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 79   agggggaggaggaggagcgggagg 102
            ||||||||||||||||| ||||||
Sbjct: 9655 agggggaggaggaggagggggagg 9632



to top

>gb|AC152944.2| Mus musculus 10 BAC RP23-427I4 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 179149

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 79     agggggaggaggaggagcgggagg 102
              ||||||||||||||||| ||||||
Sbjct: 133298 agggggaggaggaggagggggagg 133275



to top

>gb|AC164079.11| Mus musculus chromosome 1, clone RP23-15E12, complete sequence
          Length = 215135

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 79     agggggaggaggaggagcgggagg 102
              ||||||||||||||||| ||||||
Sbjct: 190230 agggggaggaggaggagggggagg 190207



to top

>gb|AC169036.3| Mus musculus BAC clone RP23-382O15 from chromosome 5, complete sequence
          Length = 215306

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    agggggaggaggaggagcgggagg 102
             ||||||||||||||||| ||||||
Sbjct: 77567 agggggaggaggaggagggggagg 77590



to top

>gb|AC116671.14| Mus musculus chromosome 3, clone RP23-111L16, complete sequence
          Length = 207768

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 79    agggggaggaggaggagcgggagg 102
             ||||||||||||||||| ||||||
Sbjct: 95059 agggggaggaggaggagagggagg 95036



to top

>gb|AC151958.2| Homo sapiens chromosome X clone RP11-76K17 map q28, complete sequence
          Length = 43290

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 79    agggggaggaggaggagcgggagg 102
             ||||||||||||||||| ||||||
Sbjct: 20298 agggggaggaggaggagggggagg 20275



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 79   agggggaggaggaggagcgggagg 102
            ||||||||||||||||| ||||||
Sbjct: 7225 agggggaggaggaggagggggagg 7248



to top

>ref|XM_466698.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1711

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  ggaggaggaggagcgggagg 102
           ||||||||||||||||||||
Sbjct: 312 ggaggaggaggagcgggagg 331



to top

>ref|XM_466344.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 186

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 79 agggggaggaggaggagcgg 98
          ||||||||||||||||||||
Sbjct: 59 agggggaggaggaggagcgg 78



to top

>ref|NM_006769.2| Homo sapiens LIM domain only 4 (LMO4), mRNA
          Length = 2126

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  ggaggaggaggagcgggagg 102
           ||||||||||||||||||||
Sbjct: 327 ggaggaggaggagcgggagg 346



to top

>gb|AC166985.4| Mus musculus chromosome 1, clone RP23-14I20, complete sequence
          Length = 191452

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 79   agggggaggaggaggagcgggagg 102
            ||||||||||||||||| ||||||
Sbjct: 3434 agggggaggaggaggagggggagg 3411



to top

>gb|AC166986.4| Mus musculus chromosome 1, clone RP24-184H22, complete sequence
          Length = 164014

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 79    agggggaggaggaggagcgggagg 102
             ||||||||||||||||| ||||||
Sbjct: 27258 agggggaggaggaggagggggagg 27235



to top

>gb|AC164075.4| Mus musculus chromosome 7, clone RP24-259P13, complete sequence
          Length = 159578

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 79     agggggaggaggaggagcgggagg 102
              ||||||||||||||||| ||||||
Sbjct: 145068 agggggaggaggaggagggggagg 145091



to top

>gb|AC152006.1| Homo sapiens chromosome X clone RP11-76K17 map q28, complete sequence
          Length = 66067

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    agggggaggaggaggagcgggagg 102
             ||||||||||||||||| ||||||
Sbjct: 25829 agggggaggaggaggagggggagg 25852



to top

>gb|AC123645.7| Mus musculus chromosome 15, clone RP23-99N19, complete sequence
          Length = 192973

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 79     agggggaggaggaggagcgggagg 102
              ||||||||||||||||| ||||||
Sbjct: 102666 agggggaggaggaggagggggagg 102689



to top

>gb|AY591643.1| Mus musculus clone IgK24-113 immunoglobulin kappa-like gene, partial
            sequence
          Length = 4762

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 79   agggggaggaggaggagcgggagg 102
            ||||||||||||||||| ||||||
Sbjct: 3023 agggggaggaggaggagggggagg 3046



to top

>gb|AC135460.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0091I11, complete sequence
          Length = 135993

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    agggggaggaggaggagcgggagg 102
             ||||||||||||||||| ||||||
Sbjct: 21270 agggggaggaggaggagggggagg 21293



to top

>gb|AC166331.5| Mus musculus chromosome 3, clone RP23-277D9, complete sequence
          Length = 187537

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 79    agggggaggaggaggagcgggagg 102
             ||||||||||||||||| ||||||
Sbjct: 13284 agggggaggaggaggagagggagg 13307


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,789,417
Number of Sequences: 3902068
Number of extensions: 4789417
Number of successful extensions: 148709
Number of sequences better than 10.0: 503
Number of HSP's better than 10.0 without gapping: 514
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 143954
Number of HSP's gapped (non-prelim): 4698
length of query: 577
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 554
effective length of database: 17,143,297,704
effective search space: 9497386928016
effective search space used: 9497386928016
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top