>emb|AL590103.12| Human DNA sequence from clone RP11-132G19 on chromosome 1 Contains a
novel gene, the 3' end of the HSPG2 gene for heparan
sulfate proteoglycan 2 (perlecan), the 5' end of the
USP31 gene for ubiquitin specific protease 31 and a CpG
island, complete sequence
Length = 175162
Score = 40.1 bits (20), Expect = 7.6
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 104 ttcaaaaagaaaaggcttta 123
||||||||||||||||||||
Sbjct: 14595 ttcaaaaagaaaaggcttta 14614
>emb|AL603711.6| Mouse DNA sequence from clone RP23-381B19 on chromosome 11 Contains the
3' end of the Slfn3 gene for schlafen 3, a novel gene, two
schlafen (Slfn) pseudogenes, the Pex12 gene for
peroxisomal biogenesis factor 12 and the Ap2b1 gene for
adaptor-related protein complex 2 beta 1 subunit, complete
sequence
Length = 204523
Score = 40.1 bits (20), Expect = 7.6
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 313 aaagaataccatgtaggatg 332
||||||||||||||||||||
Sbjct: 98841 aaagaataccatgtaggatg 98860
>emb|AL713883.1|CNS07YP0 Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
clone 179H3 of library Caltech CITB-BAC from chromosome 11
of Mus musculus (mouse)
Length = 168835
Score = 40.1 bits (20), Expect = 7.6
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 313 aaagaataccatgtaggatg 332
||||||||||||||||||||
Sbjct: 111112 aaagaataccatgtaggatg 111093
>emb|AL713880.1|CNS07YOW Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
clone 366M1 of library Caltech CITB-BAC from chromosome 11
of Mus musculus (mouse)
Length = 111702
Score = 40.1 bits (20), Expect = 7.6
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 104 ttcaaaaagaaaaggctttagcag 127
|||||||||||||||||| |||||
Sbjct: 47402 ttcaaaaagaaaaggcttaagcag 47425
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,271,042
Number of Sequences: 3902068
Number of extensions: 6271042
Number of successful extensions: 96143
Number of sequences better than 10.0: 40
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 95982
Number of HSP's gapped (non-prelim): 157
length of query: 557
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 534
effective length of database: 17,143,297,704
effective search space: 9154520973936
effective search space used: 9154520973936
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)