>ref|XM_469831.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1374

 Score =  159 bits (80), Expect = 1e-35
 Identities = 221/268 (82%)
 Strand = Plus / Plus

                                                                       
Query: 265 catcatctgtaacacgttcgagcagatcgagtcggaggagctggatctcgtccccaacgc 324
           ||||||||| ||||||||| || | |||||| ||| || |||||  ||||||||||||| 
Sbjct: 648 catcatctgcaacacgttccaggacatcgagccgggggcgctggccctcgtccccaacgt 707

                                                                       
Query: 325 gctgcccgtcggacccctggaagcgccggctgcgtcgaggtctgccggccaactctggca 384
           |||||| || ||||| || |||||||||||  |||||||||  ||||||||  |||||| 
Sbjct: 708 gctgccggttggaccgctcgaagcgccggcgacgtcgaggttagccggccatttctggcc 767

                                                                       
Query: 385 agaagactcggcctgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgt 444
            || ||| || |||||||  | ||||||||||  |||| |  | |||| ||| |||||||
Sbjct: 768 ggaggacacgacctgcctggcatggctcgacgaacaggacgcctgctccgtcgtctacgt 827

                                                                       
Query: 445 ggcgtttgggagcttcaccgtcttcgacgcggcgcggttcctggagctcgccgatgggct 504
           ||||||||||||||||||||||||||||  ||||||| |||  |||||||||||||||||
Sbjct: 828 ggcgtttgggagcttcaccgtcttcgacatggcgcgggtccaagagctcgccgatgggct 887

                                       
Query: 505 ggagctcaccggccggcccttcctgtgg 532
            | |||  | |||||||| |||||||||
Sbjct: 888 agtgctttctggccggccattcctgtgg 915

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  159 bits (80), Expect = 1e-35
 Identities = 221/268 (82%)
 Strand = Plus / Plus

                                                                            
Query: 265      catcatctgtaacacgttcgagcagatcgagtcggaggagctggatctcgtccccaacgc 324
                ||||||||| ||||||||| || | |||||| ||| || |||||  ||||||||||||| 
Sbjct: 30996085 catcatctgcaacacgttccaggacatcgagccgggggcgctggccctcgtccccaacgt 30996144

                                                                            
Query: 325      gctgcccgtcggacccctggaagcgccggctgcgtcgaggtctgccggccaactctggca 384
                |||||| || ||||| || |||||||||||  |||||||||  ||||||||  |||||| 
Sbjct: 30996145 gctgccggttggaccgctcgaagcgccggcgacgtcgaggttagccggccatttctggcc 30996204

                                                                            
Query: 385      agaagactcggcctgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgt 444
                 || ||| || |||||||  | ||||||||||  |||| |  | |||| ||| |||||||
Sbjct: 30996205 ggaggacacgacctgcctggcatggctcgacgaacaggacgcctgctccgtcgtctacgt 30996264

                                                                            
Query: 445      ggcgtttgggagcttcaccgtcttcgacgcggcgcggttcctggagctcgccgatgggct 504
                ||||||||||||||||||||||||||||  ||||||| |||  |||||||||||||||||
Sbjct: 30996265 ggcgtttgggagcttcaccgtcttcgacatggcgcgggtccaagagctcgccgatgggct 30996324

                                            
Query: 505      ggagctcaccggccggcccttcctgtgg 532
                 | |||  | |||||||| |||||||||
Sbjct: 30996325 agtgctttctggccggccattcctgtgg 30996352



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 123/148 (83%)
 Strand = Plus / Minus

                                                                            
Query: 406      ctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagcttcaccgt 465
                |||||||||||||||| ||  |||||| ||| | |||||||| || || ||| |  || |
Sbjct: 30991392 ctggctcgacgcgcagcccgacggctccgtcgtgtacgtggccttcggcagcatggccat 30991333

                                                                            
Query: 466      cttcgacgcggcgcggttcctggagctcgccgatgggctggagctcaccggccggccctt 525
                ||||||||||  || ||||| |||||||||||  ||||||||||||||||||||||| ||
Sbjct: 30991332 cttcgacgcgaggcagttccaggagctcgccgtggggctggagctcaccggccggccgtt 30991273

                                            
Query: 526      cctgtggacggtccggacgaacttcacc 553
                |||||||   |||||| || ||||||||
Sbjct: 30991272 cctgtgggttgtccggccggacttcacc 30991245



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 122/148 (82%)
 Strand = Plus / Plus

                                                                            
Query: 406      ctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagcttcaccgt 465
                |||||||||||||||| ||  |||||| ||| | |||||||| || || ||| |  || |
Sbjct: 30980017 ctggctcgacgcgcagcccgacggctccgtcgtgtacgtggccttcggcagcctggccat 30980076

                                                                            
Query: 466      cttcgacgcggcgcggttcctggagctcgccgatgggctggagctcaccggccggccctt 525
                ||||||||||  || ||||| |||||||||||  ||||||||||||||||||||||| ||
Sbjct: 30980077 cttcgacgcgaggcagttccaggagctcgccgtggggctggagctcaccggccggccgtt 30980136

                                            
Query: 526      cctgtggacggtccggacgaacttcacc 553
                ||| |||   |||||| || ||||||||
Sbjct: 30980137 cctctgggttgtccggccggacttcacc 30980164



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                            
Query: 398      tgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagc 457
                |||||| ||||||||||| | ||||||| |||||| || ||||| ||||| |||||||||
Sbjct: 30999679 tgcctcacctggctcgacacacaggcccccggctccgttatctatgtggcctttgggagc 30999738

                           
Query: 458      ttcaccgtctt 468
                | |||| ||||
Sbjct: 30999739 tccaccatctt 30999749

>gb|AC079887.17| Oryza sativa (japonica cultivar-group) chromosome 3 BAC OSJNBa0040E01
             genomic sequence, complete sequence
          Length = 168759

 Score =  159 bits (80), Expect = 1e-35
 Identities = 221/268 (82%)
 Strand = Plus / Minus

                                                                         
Query: 265   catcatctgtaacacgttcgagcagatcgagtcggaggagctggatctcgtccccaacgc 324
             ||||||||| ||||||||| || | |||||| ||| || |||||  ||||||||||||| 
Sbjct: 99979 catcatctgcaacacgttccaggacatcgagccgggggcgctggccctcgtccccaacgt 99920

                                                                         
Query: 325   gctgcccgtcggacccctggaagcgccggctgcgtcgaggtctgccggccaactctggca 384
             |||||| || ||||| || |||||||||||  |||||||||  ||||||||  |||||| 
Sbjct: 99919 gctgccggttggaccgctcgaagcgccggcgacgtcgaggttagccggccatttctggcc 99860

                                                                         
Query: 385   agaagactcggcctgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgt 444
              || ||| || |||||||  | ||||||||||  |||| |  | |||| ||| |||||||
Sbjct: 99859 ggaggacacgacctgcctggcatggctcgacgaacaggacgcctgctccgtcgtctacgt 99800

                                                                         
Query: 445   ggcgtttgggagcttcaccgtcttcgacgcggcgcggttcctggagctcgccgatgggct 504
             ||||||||||||||||||||||||||||  ||||||| |||  |||||||||||||||||
Sbjct: 99799 ggcgtttgggagcttcaccgtcttcgacatggcgcgggtccaagagctcgccgatgggct 99740

                                         
Query: 505   ggagctcaccggccggcccttcctgtgg 532
              | |||  | |||||||| |||||||||
Sbjct: 99739 agtgctttctggccggccattcctgtgg 99712



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 123/148 (83%)
 Strand = Plus / Plus

                                                                          
Query: 406    ctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagcttcaccgt 465
              |||||||||||||||| ||  |||||| ||| | |||||||| || || ||| |  || |
Sbjct: 104672 ctggctcgacgcgcagcccgacggctccgtcgtgtacgtggccttcggcagcatggccat 104731

                                                                          
Query: 466    cttcgacgcggcgcggttcctggagctcgccgatgggctggagctcaccggccggccctt 525
              ||||||||||  || ||||| |||||||||||  ||||||||||||||||||||||| ||
Sbjct: 104732 cttcgacgcgaggcagttccaggagctcgccgtggggctggagctcaccggccggccgtt 104791

                                          
Query: 526    cctgtggacggtccggacgaacttcacc 553
              |||||||   |||||| || ||||||||
Sbjct: 104792 cctgtgggttgtccggccggacttcacc 104819



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 122/148 (82%)
 Strand = Plus / Minus

                                                                          
Query: 406    ctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagcttcaccgt 465
              |||||||||||||||| ||  |||||| ||| | |||||||| || || ||| |  || |
Sbjct: 116047 ctggctcgacgcgcagcccgacggctccgtcgtgtacgtggccttcggcagcctggccat 115988

                                                                          
Query: 466    cttcgacgcggcgcggttcctggagctcgccgatgggctggagctcaccggccggccctt 525
              ||||||||||  || ||||| |||||||||||  ||||||||||||||||||||||| ||
Sbjct: 115987 cttcgacgcgaggcagttccaggagctcgccgtggggctggagctcaccggccggccgtt 115928

                                          
Query: 526    cctgtggacggtccggacgaacttcacc 553
              ||| |||   |||||| || ||||||||
Sbjct: 115927 cctctgggttgtccggccggacttcacc 115900



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                         
Query: 398   tgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagc 457
             |||||| ||||||||||| | ||||||| |||||| || ||||| ||||| |||||||||
Sbjct: 96385 tgcctcacctggctcgacacacaggcccccggctccgttatctatgtggcctttgggagc 96326

                        
Query: 458   ttcaccgtctt 468
             | |||| ||||
Sbjct: 96325 tccaccatctt 96315

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  159 bits (80), Expect = 1e-35
 Identities = 221/268 (82%)
 Strand = Plus / Plus

                                                                            
Query: 265      catcatctgtaacacgttcgagcagatcgagtcggaggagctggatctcgtccccaacgc 324
                ||||||||| ||||||||| || | |||||| ||| || |||||  ||||||||||||| 
Sbjct: 31086608 catcatctgcaacacgttccaggacatcgagccgggggcgctggccctcgtccccaacgt 31086667

                                                                            
Query: 325      gctgcccgtcggacccctggaagcgccggctgcgtcgaggtctgccggccaactctggca 384
                |||||| || ||||| || |||||||||||  |||||||||  ||||||||  |||||| 
Sbjct: 31086668 gctgccggttggaccgctcgaagcgccggcgacgtcgaggttagccggccatttctggcc 31086727

                                                                            
Query: 385      agaagactcggcctgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgt 444
                 || ||| || |||||||  | ||||||||||  |||| |  | |||| ||| |||||||
Sbjct: 31086728 ggaggacacgacctgcctggcatggctcgacgaacaggacgcctgctccgtcgtctacgt 31086787

                                                                            
Query: 445      ggcgtttgggagcttcaccgtcttcgacgcggcgcggttcctggagctcgccgatgggct 504
                ||||||||||||||||||||||||||||  ||||||| |||  |||||||||||||||||
Sbjct: 31086788 ggcgtttgggagcttcaccgtcttcgacatggcgcgggtccaagagctcgccgatgggct 31086847

                                            
Query: 505      ggagctcaccggccggcccttcctgtgg 532
                 | |||  | |||||||| |||||||||
Sbjct: 31086848 agtgctttctggccggccattcctgtgg 31086875



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 123/148 (83%)
 Strand = Plus / Minus

                                                                            
Query: 406      ctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagcttcaccgt 465
                |||||||||||||||| ||  |||||| ||| | |||||||| || || ||| |  || |
Sbjct: 31081915 ctggctcgacgcgcagcccgacggctccgtcgtgtacgtggccttcggcagcatggccat 31081856

                                                                            
Query: 466      cttcgacgcggcgcggttcctggagctcgccgatgggctggagctcaccggccggccctt 525
                ||||||||||  || ||||| |||||||||||  ||||||||||||||||||||||| ||
Sbjct: 31081855 cttcgacgcgaggcagttccaggagctcgccgtggggctggagctcaccggccggccgtt 31081796

                                            
Query: 526      cctgtggacggtccggacgaacttcacc 553
                |||||||   |||||| || ||||||||
Sbjct: 31081795 cctgtgggttgtccggccggacttcacc 31081768



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 122/148 (82%)
 Strand = Plus / Plus

                                                                            
Query: 406      ctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagcttcaccgt 465
                |||||||||||||||| ||  |||||| ||| | |||||||| || || ||| |  || |
Sbjct: 31070540 ctggctcgacgcgcagcccgacggctccgtcgtgtacgtggccttcggcagcctggccat 31070599

                                                                            
Query: 466      cttcgacgcggcgcggttcctggagctcgccgatgggctggagctcaccggccggccctt 525
                ||||||||||  || ||||| |||||||||||  ||||||||||||||||||||||| ||
Sbjct: 31070600 cttcgacgcgaggcagttccaggagctcgccgtggggctggagctcaccggccggccgtt 31070659

                                            
Query: 526      cctgtggacggtccggacgaacttcacc 553
                ||| |||   |||||| || ||||||||
Sbjct: 31070660 cctctgggttgtccggccggacttcacc 31070687



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                            
Query: 398      tgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagc 457
                |||||| ||||||||||| | ||||||| |||||| || ||||| ||||| |||||||||
Sbjct: 31090202 tgcctcacctggctcgacacacaggcccccggctccgttatctatgtggcctttgggagc 31090261

                           
Query: 458      ttcaccgtctt 468
                | |||| ||||
Sbjct: 31090262 tccaccatctt 31090272

>dbj|AK105674.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-201-A10, full
           insert sequence
          Length = 1852

 Score =  159 bits (80), Expect = 1e-35
 Identities = 221/268 (82%)
 Strand = Plus / Minus

                                                                       
Query: 265 catcatctgtaacacgttcgagcagatcgagtcggaggagctggatctcgtccccaacgc 324
           ||||||||| ||||||||| || | |||||| ||| || |||||  ||||||||||||| 
Sbjct: 794 catcatctgcaacacgttccaggacatcgagccgggggcgctggccctcgtccccaacgt 735

                                                                       
Query: 325 gctgcccgtcggacccctggaagcgccggctgcgtcgaggtctgccggccaactctggca 384
           |||||| || ||||| || |||||||||||  |||||||||  ||||||||  |||||| 
Sbjct: 734 gctgccggttggaccgctcgaagcgccggcgacgtcgaggttagccggccatttctggcc 675

                                                                       
Query: 385 agaagactcggcctgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgt 444
            || ||| || |||||||  | ||||||||||  |||| |  | |||| ||| |||||||
Sbjct: 674 ggaggacacgacctgcctggcatggctcgacgaacaggacgcctgctccgtcgtctacgt 615

                                                                       
Query: 445 ggcgtttgggagcttcaccgtcttcgacgcggcgcggttcctggagctcgccgatgggct 504
           ||||||||||||||||||||||||||||  ||||||| |||  |||||||||||||||||
Sbjct: 614 ggcgtttgggagcttcaccgtcttcgacatggcgcgggtccaagagctcgccgatgggct 555

                                       
Query: 505 ggagctcaccggccggcccttcctgtgg 532
            | |||  | |||||||| |||||||||
Sbjct: 554 agtgctttctggccggccattcctgtgg 527

>dbj|AK069049.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003I23, full
           insert sequence
          Length = 1680

 Score =  159 bits (80), Expect = 1e-35
 Identities = 221/268 (82%)
 Strand = Plus / Plus

                                                                       
Query: 265 catcatctgtaacacgttcgagcagatcgagtcggaggagctggatctcgtccccaacgc 324
           ||||||||| ||||||||| || | |||||| ||| || |||||  ||||||||||||| 
Sbjct: 685 catcatctgcaacacgttccaggacatcgagccgggggcgctggccctcgtccccaacgt 744

                                                                       
Query: 325 gctgcccgtcggacccctggaagcgccggctgcgtcgaggtctgccggccaactctggca 384
           |||||| || ||||| || |||||||||||  |||||||||  ||||||||  |||||| 
Sbjct: 745 gctgccggttggaccgctcgaagcgccggcgacgtcgaggttagccggccatttctggcc 804

                                                                       
Query: 385 agaagactcggcctgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgt 444
            || ||| || |||||||  | ||||||||||  |||| |  | |||| ||| |||||||
Sbjct: 805 ggaggacacgacctgcctggcatggctcgacgaacaggacgcctgctccgtcgtctacgt 864

                                                                       
Query: 445 ggcgtttgggagcttcaccgtcttcgacgcggcgcggttcctggagctcgccgatgggct 504
           ||||||||||||||||||||||||||||  ||||||| |||  |||||||||||||||||
Sbjct: 865 ggcgtttgggagcttcaccgtcttcgacatggcgcgggtccaagagctcgccgatgggct 924

                                       
Query: 505 ggagctcaccggccggcccttcctgtgg 532
            | |||  | |||||||| |||||||||
Sbjct: 925 agtgctttctggccggccattcctgtgg 952

>gb|AF503433.1| Sorghum bicolor BAC 170F8, complete sequence
          Length = 142376

 Score =  117 bits (59), Expect = 4e-23
 Identities = 131/155 (84%)
 Strand = Plus / Plus

                                                                          
Query: 396    cctgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttggga 455
              ||||||||| |||||||||||||||||| | |||||| ||| ||||||||||||| ||||
Sbjct: 127804 cctgcctccgctggctcgacgcgcaggctcccggctccgtcgtctacgtggcgttcggga 127863

                                                                          
Query: 456    gcttcaccgtcttcgacgcggcgcggttcctggagctcgccgatgggctggagctcaccg 515
              || |||| || ||||||| ||  ||| ||| |||||| ||||| || |||| ||||||||
Sbjct: 127864 gcctcacggtgttcgacgtggaacggctccaggagctggccgacggcctggtgctcaccg 127923

                                                 
Query: 516    gccggcccttcctgtggacggtccggacgaacttc 550
              | ||||| |||||||||  ||||||| | ||||||
Sbjct: 127924 ggcggccgttcctgtgggtggtccggcccaacttc 127958



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 143/178 (80%)
 Strand = Plus / Plus

                                                                          
Query: 372    gccaactctggcaagaagactcggcctgcctcccctggctcgacgcgcaggcccgcggct 431
              |||| |||||||  ||||||  |||||||||| |||| |||||||| ||||| | | | |
Sbjct: 130283 gccatctctggcccgaagacatggcctgcctcgcctgcctcgacgcccaggcacccagat 130342

                                                                          
Query: 432    ctgtcatctacgtggcgtttgggagcttcaccgtcttcgacgcggcgcggttcctggagc 491
              | ||  |||| ||||| || |||||||| || ||||||||| | ||  || ||| |||||
Sbjct: 130343 cagttgtctatgtggcattcgggagctttacagtcttcgacactgcaaggctccaggagc 130402

                                                                        
Query: 492    tcgccgatgggctggagctcaccggccggcccttcctgtggacggtccggacgaactt 549
              ||||||| |||||||  |||||||| || || |||||||||  ||||||| |||||||
Sbjct: 130403 tcgccgacgggctggcactcaccggacgcccgttcctgtgggtggtccggccgaactt 130460



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                            
Query: 487    ggagctcgccgatgggctggagctcaccggccggcccttcctgtgg 532
              |||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 113810 ggagctcgccgaggggctggagctcaccggccggccgttcctgtgg 113855



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 119/147 (80%)
 Strand = Plus / Plus

                                                                          
Query: 407    tggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagcttcaccgtc 466
              ||||||||||||||||||  | |||| ||| | ||||||||||| || ||||||||||||
Sbjct: 120147 tggctcgacgcgcaggccgaccgctccgtcgtgtacgtggcgttcggcagcttcaccgtc 120206

                                                                          
Query: 467    ttcgacgcggcgcggttcctggagctcgccgatgggctggagctcaccggccggcccttc 526
              ||| || ||  || ||||  |||||| ||    |||||||||||| | |||||||| |||
Sbjct: 120207 ttcaacccgcggcagttcgaggagcttgcgctggggctggagctcgctggccggccgttc 120266

                                         
Query: 527    ctgtggacggtccggacgaacttcacc 553
              ||||||  ||| ||| || ||||||||
Sbjct: 120267 ctgtgggtggtgcggccggacttcacc 120293



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                          
Query: 396    cctgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttggga 455
              |||||||| ||||||| ||| |||| ||||  ||||| ||||| |||||||| |||||||
Sbjct: 133010 cctgcctcacctggcttgacacgcaagccccgggctccgtcatatacgtggcatttggga 133069

                                 
Query: 456    gcttcaccgtcttcgacgc 474
              |||  || |||||||||||
Sbjct: 133070 gctcgactgtcttcgacgc 133088

>ref|XM_469830.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1632

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 123/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 406 ctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagcttcaccgt 465
           |||||||||||||||| ||  |||||| ||| | |||||||| || || ||| |  || |
Sbjct: 817 ctggctcgacgcgcagcccgacggctccgtcgtgtacgtggccttcggcagcatggccat 876

                                                                       
Query: 466 cttcgacgcggcgcggttcctggagctcgccgatgggctggagctcaccggccggccctt 525
           ||||||||||  || ||||| |||||||||||  ||||||||||||||||||||||| ||
Sbjct: 877 cttcgacgcgaggcagttccaggagctcgccgtggggctggagctcaccggccggccgtt 936

                                       
Query: 526 cctgtggacggtccggacgaacttcacc 553
           |||||||   |||||| || ||||||||
Sbjct: 937 cctgtgggttgtccggccggacttcacc 964

>dbj|AK071136.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023078E19, full
           insert sequence
          Length = 1580

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 123/148 (83%)
 Strand = Plus / Plus

                                                                       
Query: 406 ctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagcttcaccgt 465
           |||||||||||||||| ||  |||||| ||| | |||||||| || || ||| |  || |
Sbjct: 834 ctggctcgacgcgcagcccgacggctccgtcgtgtacgtggccttcggcagcatggccat 893

                                                                       
Query: 466 cttcgacgcggcgcggttcctggagctcgccgatgggctggagctcaccggccggccctt 525
           ||||||||||  || ||||| |||||||||||  ||||||||||||||||||||||| ||
Sbjct: 894 cttcgacgcgaggcagttccaggagctcgccgtggggctggagctcaccggccggccgtt 953

                                       
Query: 526 cctgtggacggtccggacgaacttcacc 553
           |||||||   |||||| || ||||||||
Sbjct: 954 cctgtgggttgtccggccggacttcacc 981

>ref|XM_469828.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1389

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 122/148 (82%)
 Strand = Plus / Plus

                                                                       
Query: 406 ctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagcttcaccgt 465
           |||||||||||||||| ||  |||||| ||| | |||||||| || || ||| |  || |
Sbjct: 804 ctggctcgacgcgcagcccgacggctccgtcgtgtacgtggccttcggcagcctggccat 863

                                                                       
Query: 466 cttcgacgcggcgcggttcctggagctcgccgatgggctggagctcaccggccggccctt 525
           ||||||||||  || ||||| |||||||||||  ||||||||||||||||||||||| ||
Sbjct: 864 cttcgacgcgaggcagttccaggagctcgccgtggggctggagctcaccggccggccgtt 923

                                       
Query: 526 cctgtggacggtccggacgaacttcacc 553
           ||| |||   |||||| || ||||||||
Sbjct: 924 cctctgggttgtccggccggacttcacc 951

>ref|XM_469832.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1347

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 398 tgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagc 457
           |||||| ||||||||||| | ||||||| |||||| || ||||| ||||| |||||||||
Sbjct: 754 tgcctcacctggctcgacacacaggcccccggctccgttatctatgtggcctttgggagc 813

                      
Query: 458 ttcaccgtctt 468
           | |||| ||||
Sbjct: 814 tccaccatctt 824

>dbj|AK110280.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-E03, full
           insert sequence
          Length = 1922

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 398 tgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagc 457
           |||||| ||||||||||| | ||||||| |||||| || ||||| ||||| |||||||||
Sbjct: 296 tgcctcacctggctcgacacacaggcccccggctccgttatctatgtggcctttgggagc 355

                      
Query: 458 ttcaccgtctt 468
           | |||| ||||
Sbjct: 356 tccaccatctt 366

>dbj|AK102229.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P16, full
           insert sequence
          Length = 1502

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 398 tgcctcccctggctcgacgcgcaggcccgcggctctgtcatctacgtggcgtttgggagc 457
           |||||| ||||||||||| | ||||||| |||||| || ||||| ||||| |||||||||
Sbjct: 797 tgcctcacctggctcgacacacaggcccccggctccgttatctatgtggcctttgggagc 856

                      
Query: 458 ttcaccgtctt 468
           | |||| ||||
Sbjct: 857 tccaccatctt 867

>ref|NM_195766.1| Oryza sativa (japonica cultivar-group) hypothetical protein
           (OSJNAb0008A05.23), mRNA
          Length = 867

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 68/79 (86%), Gaps = 2/79 (2%)
 Strand = Plus / Plus

                                                                       
Query: 455 agcttcaccgtcttcgacgcggcg-cggttcctggagctcgccgatgggctggagctcac 513
           ||||||||||| |||||| ||||| |  |||| ||||||||||   ||||| ||||||||
Sbjct: 313 agcttcaccgtgttcgac-cggcgccaattccaggagctcgccctggggctcgagctcac 371

                              
Query: 514 cggccggcccttcctgtgg 532
           ||||||||| |||||||||
Sbjct: 372 cggccggcctttcctgtgg 390

>gb|AC131374.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAb0008A05,
              complete sequence
          Length = 124366

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 68/79 (86%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                          
Query: 455    agcttcaccgtcttcgacgcggcg-cggttcctggagctcgccgatgggctggagctcac 513
              ||||||||||| |||||| ||||| |  |||| ||||||||||   ||||| ||||||||
Sbjct: 114460 agcttcaccgtgttcgac-cggcgccaattccaggagctcgccctggggctcgagctcac 114402

                                 
Query: 514    cggccggcccttcctgtgg 532
              ||||||||| |||||||||
Sbjct: 114401 cggccggcctttcctgtgg 114383



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                  
Query: 481    gttcctggagctcgccgatgggctggagctcaccggccggcccttcctgtgg 532
              ||||| ||||||||||   ||||| ||||||||||||||||| ||| |||||
Sbjct: 121966 gttccaggagctcgccctggggctcgagctcaccggccggcctttcttgtgg 121915

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
               sequence
          Length = 22685906

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 68/79 (86%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                           
Query: 455     agcttcaccgtcttcgacgcggcg-cggttcctggagctcgccgatgggctggagctcac 513
               ||||||||||| |||||| ||||| |  |||| ||||||||||   ||||| ||||||||
Sbjct: 8909853 agcttcaccgtgttcgac-cggcgccaattccaggagctcgccctggggctcgagctcac 8909795

                                  
Query: 514     cggccggcccttcctgtgg 532
               ||||||||| |||||||||
Sbjct: 8909794 cggccggcctttcctgtgg 8909776



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 79/94 (84%), Gaps = 2/94 (2%)
 Strand = Plus / Minus

                                                                           
Query: 440     tacgtggcgtttgggagcttcaccgtcttcgacgcggcgcg-gttcctggagctcgccga 498
               ||||| || ||||| ||||||||||| |||||| ||||||  ||||| |||||||||   
Sbjct: 8923758 tacgtcgcctttggcagcttcaccgtgttcgac-cggcgccagttccaggagctcgcact 8923700

                                                 
Query: 499     tgggctggagctcaccggccggcccttcctgtgg 532
                || || ||||||||||||||||| |||||||||
Sbjct: 8923699 gggtctcgagctcaccggccggcctttcctgtgg 8923666



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                   
Query: 481     gttcctggagctcgccgatgggctggagctcaccggccggcccttcctgtgg 532
               ||||| ||||||||||   ||||| ||||||||||||||||| ||| |||||
Sbjct: 8917359 gttccaggagctcgccctggggctcgagctcaccggccggcctttcttgtgg 8917308

>dbj|AK060146.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-B01, full
           insert sequence
          Length = 1105

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 68/79 (86%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                       
Query: 455 agcttcaccgtcttcgacgcggcg-cggttcctggagctcgccgatgggctggagctcac 513
           ||||||||||| |||||| ||||| |  |||| ||||||||||   ||||| ||||||||
Sbjct: 564 agcttcaccgtgttcgac-cggcgccaattccaggagctcgccctggggctcgagctcac 506

                              
Query: 514 cggccggcccttcctgtgg 532
           ||||||||| |||||||||
Sbjct: 505 cggccggcctttcctgtgg 487

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 68/79 (86%), Gaps = 2/79 (2%)
 Strand = Plus / Minus

                                                                           
Query: 455     agcttcaccgtcttcgacgcggcg-cggttcctggagctcgccgatgggctggagctcac 513
               ||||||||||| |||||| ||||| |  |||| ||||||||||   ||||| ||||||||
Sbjct: 8914992 agcttcaccgtgttcgac-cggcgccaattccaggagctcgccctggggctcgagctcac 8914934

                                  
Query: 514     cggccggcccttcctgtgg 532
               ||||||||| |||||||||
Sbjct: 8914933 cggccggcctttcctgtgg 8914915



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 79/94 (84%), Gaps = 2/94 (2%)
 Strand = Plus / Minus

                                                                           
Query: 440     tacgtggcgtttgggagcttcaccgtcttcgacgcggcgcg-gttcctggagctcgccga 498
               ||||| || ||||| ||||||||||| |||||| ||||||  ||||| |||||||||   
Sbjct: 8928897 tacgtcgcctttggcagcttcaccgtgttcgac-cggcgccagttccaggagctcgcact 8928839

                                                 
Query: 499     tgggctggagctcaccggccggcccttcctgtgg 532
                || || ||||||||||||||||| |||||||||
Sbjct: 8928838 gggtctcgagctcaccggccggcctttcctgtgg 8928805



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                   
Query: 481     gttcctggagctcgccgatgggctggagctcaccggccggcccttcctgtgg 532
               ||||| ||||||||||   ||||| ||||||||||||||||| ||| |||||
Sbjct: 8922498 gttccaggagctcgccctggggctcgagctcaccggccggcctttcttgtgg 8922447

>ref|NM_195769.1| Oryza sativa (japonica cultivar-group) putative glucosyltransferase
           (OSJNBa0027A14.3), mRNA
          Length = 834

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 79/94 (84%), Gaps = 2/94 (2%)
 Strand = Plus / Plus

                                                                       
Query: 440 tacgtggcgtttgggagcttcaccgtcttcgacgcggcgcg-gttcctggagctcgccga 498
           ||||| || ||||| ||||||||||| |||||| ||||||  ||||| |||||||||   
Sbjct: 298 tacgtcgcctttggcagcttcaccgtgttcgac-cggcgccagttccaggagctcgcact 356

                                             
Query: 499 tgggctggagctcaccggccggcccttcctgtgg 532
            || || ||||||||||||||||| |||||||||
Sbjct: 357 gggtctcgagctcaccggccggcctttcctgtgg 390

>gb|AC119147.3| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0027A14, from chromosome 10, complete sequence
          Length = 175667

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 79/94 (84%), Gaps = 2/94 (2%)
 Strand = Plus / Minus

                                                                         
Query: 440   tacgtggcgtttgggagcttcaccgtcttcgacgcggcgcg-gttcctggagctcgccga 498
             ||||| || ||||| ||||||||||| |||||| ||||||  ||||| |||||||||   
Sbjct: 11981 tacgtcgcctttggcagcttcaccgtgttcgac-cggcgccagttccaggagctcgcact 11923

                                               
Query: 499   tgggctggagctcaccggccggcccttcctgtgg 532
              || || ||||||||||||||||| |||||||||
Sbjct: 11922 gggtctcgagctcaccggccggcctttcctgtgg 11889



 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                                
Query: 481  gttcctggagctcgccgatgggctggagctcaccggccggcccttcctgtgg 532
            ||||| ||||||||||   ||||| ||||||||||||||||| ||| |||||
Sbjct: 5582 gttccaggagctcgccctggggctcgagctcaccggccggcctttcttgtgg 5531

>ref|NM_195768.1| Oryza sativa (japonica cultivar-group) putative glucosyltransferase
            (OSJNBa0027A14.2), mRNA
          Length = 1479

 Score = 48.1 bits (24), Expect = 0.031
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                
Query: 481  gttcctggagctcgccgatgggctggagctcaccggccggcccttcctgtgg 532
            ||||| ||||||||||   ||||| ||||||||||||||||| ||| |||||
Sbjct: 951  gttccaggagctcgccctggggctcgagctcaccggccggcctttcttgtgg 1002

>ref|XM_466915.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1560

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 488  gagctcgccgatgggctggagctcaccggccggcccttcctgtgg 532
            ||||||||||  || ||||||  |||||||||||| |||||||||
Sbjct: 1063 gagctcgccgtcggcctggaggccaccggccggccgttcctgtgg 1107

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 505     ggagctcaccggccggcccttcctg 529
               |||||||||||||||||||| ||||
Sbjct: 1183678 ggagctcaccggccggccctgcctg 1183702

>emb|CR665668.2|CNS0FCLM Tetraodon nigroviridis full-length cDNA
          Length = 734

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 408 ggctcgacgcgcaggcccgcggctc 432
           |||||||||||||| ||||||||||
Sbjct: 3   ggctcgacgcgcagccccgcggctc 27

>emb|CR658306.2|CNS0F6X4 Tetraodon nigroviridis full-length cDNA
          Length = 740

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 408 ggctcgacgcgcaggcccgcggctc 432
           |||||||||||||| ||||||||||
Sbjct: 12  ggctcgacgcgcagccccgcggctc 36

>emb|CR657416.2|CNS0F68E Tetraodon nigroviridis full-length cDNA
          Length = 740

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 408 ggctcgacgcgcaggcccgcggctc 432
           |||||||||||||| ||||||||||
Sbjct: 12  ggctcgacgcgcagccccgcggctc 36

>emb|BX572606.1| Rhodopseudomonas palustris CGA009 complete genome; segment 14/16
          Length = 349841

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 416   gcgcaggcccgcggctctgtc 436
             |||||||||||||||||||||
Sbjct: 82296 gcgcaggcccgcggctctgtc 82276

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                             
Query: 488      gagctcgccgatgggctggagctcaccggccggcccttcctgtgg 532
                ||||||||||  || ||||||  |||||||||||| |||||||||
Sbjct: 25442683 gagctcgccgtcggcctggaggccaccggccggccgttcctgtgg 25442639

>dbj|AP004192.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1643_A10
          Length = 130037

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                          
Query: 488   gagctcgccgatgggctggagctcaccggccggcccttcctgtgg 532
             ||||||||||  || ||||||  |||||||||||| |||||||||
Sbjct: 98345 gagctcgccgtcggcctggaggccaccggccggccgttcctgtgg 98301

>ref|XM_471504.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1296

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 503 ctggagctcaccggccggcc 522
           ||||||||||||||||||||
Sbjct: 922 ctggagctcaccggccggcc 941

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 459     tcaccgtcttcgacgcggcg 478
               ||||||||||||||||||||
Sbjct: 2374455 tcaccgtcttcgacgcggcg 2374436

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 470     gacgcggcgcggttcctgga 489
               ||||||||||||||||||||
Sbjct: 3451610 gacgcggcgcggttcctgga 3451591

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 503      ctggagctcaccggccggcc 522
                ||||||||||||||||||||
Sbjct: 11461834 ctggagctcaccggccggcc 11461815

>gb|DQ018795.1| Uncultured anaerobic bacterium clone C-52 16S ribosomal RNA gene,
           partial sequence
          Length = 994

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 363 ggtctgccggccaactctgg 382
           ||||||||||||||||||||
Sbjct: 899 ggtctgccggccaactctgg 918

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 395     gcctgcctcccctggctcga 414
               ||||||||||||||||||||
Sbjct: 1368034 gcctgcctcccctggctcga 1368015

>emb|BX927187.7| Zebrafish DNA sequence from clone DKEY-44L17 in linkage group 19,
              complete sequence
          Length = 127280

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 491    ctcgccgatgggctggagct 510
              ||||||||||||||||||||
Sbjct: 115694 ctcgccgatgggctggagct 115713

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 181     ctgcctgagcagcttgccggacag 204
               |||| |||||||||||||||||||
Sbjct: 4261515 ctgcttgagcagcttgccggacag 4261538

>emb|AL606602.2|OSJN00067 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0056F09,
             complete sequence
          Length = 148191

 Score = 40.1 bits (20), Expect = 7.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 503   ctggagctcaccggccggcc 522
             ||||||||||||||||||||
Sbjct: 87447 ctggagctcaccggccggcc 87428


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,949,739
Number of Sequences: 3902068
Number of extensions: 2949739
Number of successful extensions: 57841
Number of sequences better than 10.0: 38
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56967
Number of HSP's gapped (non-prelim): 864
length of query: 560
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 537
effective length of database: 17,143,297,704
effective search space: 9205950867048
effective search space used: 9205950867048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)