ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd14f22
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC128646.5| Oryza sativa chromosome 3 BAC OSJNBb0029I19 genom... 96 2e-16
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 96 2e-16
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 96 2e-16
4gb|AC157319.2| Zea mays clone ZMMBBb-136E2, complete sequence 82 2e-12
5emb|AL133355.13| Human DNA sequence from clone RP11-541N10 on ch... 42 2.0
6emb|AL591064.11| Mouse DNA sequence from clone RP23-395E18 on ch... 42 2.0
7gb|AC068058.12| Homo sapiens chromosome 10 clone RP11-285A18, co... 42 2.0
8gb|AC124353.5| Mus musculus BAC clone RP24-481I14 from chromosom... 40 7.9
9gb|AC163746.5| Mus musculus BAC clone RP23-394B5 from chromosome... 40 7.9
10ref|XM_803482.1| Trypanosoma cruzi strain CL Brener mucin-associ... 40 7.9
11ref|XM_806028.1| Trypanosoma cruzi strain CL Brener mucin-associ... 40 7.9
12ref|XM_810905.1| Trypanosoma cruzi strain CL Brener mucin-associ... 40 7.9
13gb|AC136921.8| Mus musculus chromosome 17, clone RP23-210D4, com... 40 7.9
14gb|U00096.2| Escherichia coli K-12 MG1655, complete genome 40 7.9
15emb|CR387919.7| Zebrafish DNA sequence from clone DKEY-120I24, c... 40 7.9
16dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome 40 7.9
17gb|AC153361.5| Mus musculus BAC clone RP23-291L20 from chromosom... 40 7.9
18emb|Y08743.1|ECMDFA E.coli mdfA gene 40 7.9
19gb|U44900.1|ECU44900 Escherichia coli chloramphenicol resistance... 40 7.9
20gb|AC126039.3| Mus musculus BAC clone RP24-234N22 from 12, compl... 40 7.9
21gb|AC138459.3| Mus musculus BAC clone RP23-335K20 from 10, compl... 40 7.9 
>gb|AC128646.5| Oryza sativa chromosome 3 BAC OSJNBb0029I19 genomic sequence, complete
             sequence
          Length = 120254

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 90/104 (86%)
 Strand = Plus / Minus

                                                                         
Query: 274   taacctttttggttatattaatcaggagtctggatctcaagtgatggaaattatcgacac 333
             |||||||||||| |||||||||||||| ||||| || |||||||||||| |||| || ||
Sbjct: 54240 taacctttttggctatattaatcaggaatctgggtcccaagtgatggaagttattgagac 54181

                                                         
Query: 334   ttcaaggtccaaagctaaaacgatggttgatgtcgctattcagg 377
             ||| ||||||  ||| |||  |||||||||||| ||||||||||
Sbjct: 54180 ttcgaggtcccgagcaaaattgatggttgatgttgctattcagg 54137



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 123/147 (83%), Gaps = 1/147 (0%)
 Strand = Plus / Minus

                                                                         
Query: 375   aggcaatgtgcaaagtaagtgaaggagagaacgcatttgccaaaataggggaagcactag 434
             ||||||||||||  || |||||||||||| | || | ||||||| ||||||| ||||| |
Sbjct: 52991 aggcaatgtgcagtgtgagtgaaggagaggatgcttatgccaaagtaggggaggcactcg 52932

                                                                         
Query: 435   acaatctgaacctccgtggcaccggcttctggttccagcatactaggcataaggcggata 494
             | |||||||||   ||  |||| |||| | |||||||| |||||||||||||| ||||||
Sbjct: 52931 ataatctgaacaatcgcagcactggct-cgggttccagtatactaggcataagacggata 52873

                                        
Query: 495   ccacctgattccggacaggcaaattca 521
             || |||||||| |||||||| ||||||
Sbjct: 52872 cctcctgattctggacaggccaattca 52846



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 63/70 (90%)
 Strand = Plus / Minus

                                                                         
Query: 152   gtggcttcggccttgctttgtctgcggcaacggaacacatttcatgggcatccagcacag 211
             |||||||| |||||||||| |||||||||||| ||||| | |||||||||||||||||| 
Sbjct: 54353 gtggcttcagccttgctttctctgcggcaacgcaacacgtatcatgggcatccagcacaa 54294

                       
Query: 212   ccatatccta 221
              |||||||||
Sbjct: 54293 tcatatccta 54284



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                         
Query: 58    ctctctcactgcttatcttcacgtttcctccggaggtggtgcatgtctgagtggttctat 117
             |||||||| ||||||||||||||||| ||||| || ||||||| || ||| |||||||||
Sbjct: 57077 ctctctcattgcttatcttcacgtttgctccgtagatggtgcacgtttgaatggttctat 57018

                  
Query: 118   agtgc 122
             |||||
Sbjct: 57017 agtgc 57013



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     aagagtgaatttgttgagta 23
             ||||||||||||||||||||
Sbjct: 56990 aagagtgaatttgttgagta 56971
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 90/104 (86%)
 Strand = Plus / Plus

                                                                            
Query: 274      taacctttttggttatattaatcaggagtctggatctcaagtgatggaaattatcgacac 333
                |||||||||||| |||||||||||||| ||||| || |||||||||||| |||| || ||
Sbjct: 24419717 taacctttttggctatattaatcaggaatctgggtcccaagtgatggaagttattgagac 24419776

                                                            
Query: 334      ttcaaggtccaaagctaaaacgatggttgatgtcgctattcagg 377
                ||| ||||||  ||| |||  |||||||||||| ||||||||||
Sbjct: 24419777 ttcgaggtcccgagcaaaattgatggttgatgttgctattcagg 24419820



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 123/147 (83%), Gaps = 1/147 (0%)
 Strand = Plus / Plus

                                                                            
Query: 375      aggcaatgtgcaaagtaagtgaaggagagaacgcatttgccaaaataggggaagcactag 434
                ||||||||||||  || |||||||||||| | || | ||||||| ||||||| ||||| |
Sbjct: 24420966 aggcaatgtgcagtgtgagtgaaggagaggatgcttatgccaaagtaggggaggcactcg 24421025

                                                                            
Query: 435      acaatctgaacctccgtggcaccggcttctggttccagcatactaggcataaggcggata 494
                | |||||||||   ||  |||| |||| | |||||||| |||||||||||||| ||||||
Sbjct: 24421026 ataatctgaacaatcgcagcactggct-cgggttccagtatactaggcataagacggata 24421084

                                           
Query: 495      ccacctgattccggacaggcaaattca 521
                || |||||||| |||||||| ||||||
Sbjct: 24421085 cctcctgattctggacaggccaattca 24421111



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                            
Query: 152      gtggcttcggccttgctttgtctgcggcaacggaacacatttcatgggcatccagcacag 211
                |||||||| |||||||||| |||||||||||| ||||| | |||||||||||||||||| 
Sbjct: 24419604 gtggcttcagccttgctttctctgcggcaacgcaacacgtatcatgggcatccagcacaa 24419663

                          
Query: 212      ccatatccta 221
                 |||||||||
Sbjct: 24419664 tcatatccta 24419673



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                            
Query: 58       ctctctcactgcttatcttcacgtttcctccggaggtggtgcatgtctgagtggttctat 117
                |||||||| ||||||||||||||||| ||||| || ||||||| || ||| |||||||||
Sbjct: 24416880 ctctctcattgcttatcttcacgtttgctccgtagatggtgcacgtttgaatggttctat 24416939

                     
Query: 118      agtgc 122
                |||||
Sbjct: 24416940 agtgc 24416944



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 4        aagagtgaatttgttgagta 23
                ||||||||||||||||||||
Sbjct: 24416967 aagagtgaatttgttgagta 24416986
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 90/104 (86%)
 Strand = Plus / Plus

                                                                            
Query: 274      taacctttttggttatattaatcaggagtctggatctcaagtgatggaaattatcgacac 333
                |||||||||||| |||||||||||||| ||||| || |||||||||||| |||| || ||
Sbjct: 24337186 taacctttttggctatattaatcaggaatctgggtcccaagtgatggaagttattgagac 24337245

                                                            
Query: 334      ttcaaggtccaaagctaaaacgatggttgatgtcgctattcagg 377
                ||| ||||||  ||| |||  |||||||||||| ||||||||||
Sbjct: 24337246 ttcgaggtcccgagcaaaattgatggttgatgttgctattcagg 24337289



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 123/147 (83%), Gaps = 1/147 (0%)
 Strand = Plus / Plus

                                                                            
Query: 375      aggcaatgtgcaaagtaagtgaaggagagaacgcatttgccaaaataggggaagcactag 434
                ||||||||||||  || |||||||||||| | || | ||||||| ||||||| ||||| |
Sbjct: 24338435 aggcaatgtgcagtgtgagtgaaggagaggatgcttatgccaaagtaggggaggcactcg 24338494

                                                                            
Query: 435      acaatctgaacctccgtggcaccggcttctggttccagcatactaggcataaggcggata 494
                | |||||||||   ||  |||| |||| | |||||||| |||||||||||||| ||||||
Sbjct: 24338495 ataatctgaacaatcgcagcactggct-cgggttccagtatactaggcataagacggata 24338553

                                           
Query: 495      ccacctgattccggacaggcaaattca 521
                || |||||||| |||||||| ||||||
Sbjct: 24338554 cctcctgattctggacaggccaattca 24338580



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 63/70 (90%)
 Strand = Plus / Plus

                                                                            
Query: 152      gtggcttcggccttgctttgtctgcggcaacggaacacatttcatgggcatccagcacag 211
                |||||||| |||||||||| |||||||||||| ||||| | |||||||||||||||||| 
Sbjct: 24337073 gtggcttcagccttgctttctctgcggcaacgcaacacgtatcatgggcatccagcacaa 24337132

                          
Query: 212      ccatatccta 221
                 |||||||||
Sbjct: 24337133 tcatatccta 24337142



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                            
Query: 58       ctctctcactgcttatcttcacgtttcctccggaggtggtgcatgtctgagtggttctat 117
                |||||||| ||||||||||||||||| ||||| || ||||||| || ||| |||||||||
Sbjct: 24334349 ctctctcattgcttatcttcacgtttgctccgtagatggtgcacgtttgaatggttctat 24334408

                     
Query: 118      agtgc 122
                |||||
Sbjct: 24334409 agtgc 24334413



 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 4        aagagtgaatttgttgagta 23
                ||||||||||||||||||||
Sbjct: 24334436 aagagtgaatttgttgagta 24334455
to top
>gb|AC157319.2| Zea mays clone ZMMBBb-136E2, complete sequence
          Length = 138186

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 65/73 (89%)
 Strand = Plus / Minus

                                                                          
Query: 50     aggacaagctctctcactgcttatcttcacgtttcctccggaggtggtgcatgtctgagt 109
              ||||||| |||||||||||||| || |||||||| || ||||||||||| |||| ||| |
Sbjct: 122995 aggacaaactctctcactgcttgtcctcacgtttgcttcggaggtggtgtatgtttgaat 122936

                           
Query: 110    ggttctatagtgc 122
              |||||||||||||
Sbjct: 122935 ggttctatagtgc 122923



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 120/145 (82%), Gaps = 1/145 (0%)
 Strand = Plus / Minus

                                                                          
Query: 374    caggcaatgtgcaaagtaagtgaaggagagaacgcatttgccaaaataggggaagcacta 433
              ||||| ||||||||||| || |||||||||||||| ||||| ||||| || |||||||||
Sbjct: 117642 caggcgatgtgcaaagtgagggaaggagagaacgcctttgctaaaatcggtgaagcacta 117583

                                                                          
Query: 434    gacaatctgaacctccgtggcaccggcttctggttccagcatactaggcataaggcggat 493
              ||  ||||  |    |||||||| ||| |||||||| ||||||||||| ||||| |||||
Sbjct: 117582 gatgatctcgatagtcgtggcacaggc-tctggttcaagcatactaggaataagacggat 117524

                                       
Query: 494    accacctgattccggacaggcaaat 518
              ||| || ||||| ||  ||||||||
Sbjct: 117523 acctcccgattcagggaaggcaaat 117499



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 88/104 (84%)
 Strand = Plus / Minus

                                                                          
Query: 274    taacctttttggttatattaatcaggagtctggatctcaagtgatggaaattatcgacac 333
              ||||| |||||||||||||||||  || || || || ||||| |||||| |||| || ||
Sbjct: 117908 taaccgttttggttatattaatccagaatccggttcccaagtaatggaagttattgagac 117849

                                                          
Query: 334    ttcaaggtccaaagctaaaacgatggttgatgtcgctattcagg 377
              |||||||| |||||| |||| |||||||||||| ||| ||||||
Sbjct: 117848 ttcaaggtgcaaagcaaaaatgatggttgatgttgctgttcagg 117805
to top
>emb|AL133355.13| Human DNA sequence from clone RP11-541N10 on chromosome 10 Contains the
             5' end of the SH3MD1 gene for SH3 multiple domains 1, a
             novel gene and two CpG islands, complete sequence
          Length = 190882

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 269   tctagtaacctttttggttat 289
             |||||||||||||||||||||
Sbjct: 66043 tctagtaacctttttggttat 66023
to top
>emb|AL591064.11| Mouse DNA sequence from clone RP23-395E18 on chromosome 2, complete
              sequence
          Length = 200078

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 509    acaggcaaattcagataacag 529
              |||||||||||||||||||||
Sbjct: 146528 acaggcaaattcagataacag 146508
to top
>gb|AC068058.12| Homo sapiens chromosome 10 clone RP11-285A18, complete sequence
          Length = 168862

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 127   acagctgagagattcaaatga 147
             |||||||||||||||||||||
Sbjct: 21466 acagctgagagattcaaatga 21446
to top
>gb|AC124353.5| Mus musculus BAC clone RP24-481I14 from chromosome 12, complete sequence
          Length = 152881

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 201    atccagcacagccatatcct 220
              ||||||||||||||||||||
Sbjct: 150615 atccagcacagccatatcct 150634
to top
>gb|AC163746.5| Mus musculus BAC clone RP23-394B5 from chromosome 17, complete sequence
          Length = 199852

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 280    ttttggttatattaatcagg 299
              ||||||||||||||||||||
Sbjct: 124191 ttttggttatattaatcagg 124172
to top
>ref|XM_803482.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053510561.30) partial mRNA
          Length = 1092

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  tcaaggacaagctctctcac 66
           ||||||||||||||||||||
Sbjct: 213 tcaaggacaagctctctcac 232
to top
>ref|XM_806028.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053510557.60) partial mRNA
          Length = 1098

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  tcaaggacaagctctctcac 66
           ||||||||||||||||||||
Sbjct: 213 tcaaggacaagctctctcac 232
to top
>ref|XM_810905.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053507699.130) partial mRNA
          Length = 1092

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  tcaaggacaagctctctcac 66
           ||||||||||||||||||||
Sbjct: 213 tcaaggacaagctctctcac 232
to top
>gb|AC136921.8| Mus musculus chromosome 17, clone RP23-210D4, complete sequence
          Length = 244237

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 280    ttttggttatattaatcagg 299
              ||||||||||||||||||||
Sbjct: 192971 ttttggttatattaatcagg 192990
to top
>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 551    tgccgcagcagcgaccaata 570
              ||||||||||||||||||||
Sbjct: 883810 tgccgcagcagcgaccaata 883791
to top
>emb|CR387919.7| Zebrafish DNA sequence from clone DKEY-120I24, complete sequence
          Length = 110378

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 408   catttgccaaaataggggaa 427
             ||||||||||||||||||||
Sbjct: 67501 catttgccaaaataggggaa 67482
to top
>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 551    tgccgcagcagcgaccaata 570
              ||||||||||||||||||||
Sbjct: 885009 tgccgcagcagcgaccaata 884990
to top
>gb|AC153361.5| Mus musculus BAC clone RP23-291L20 from chromosome 10, complete
             sequence
          Length = 212761

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 61    tctcactgcttatcttcacgtttc 84
             |||||||||||||||||| |||||
Sbjct: 74025 tctcactgcttatcttcatgtttc 74002
to top
>emb|Y08743.1|ECMDFA E.coli mdfA gene
          Length = 1233

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 551 tgccgcagcagcgaccaata 570
           ||||||||||||||||||||
Sbjct: 915 tgccgcagcagcgaccaata 896
to top
>gb|U44900.1|ECU44900 Escherichia coli chloramphenicol resistance pump protein Cmr (cmr)
            gene, complete cds
          Length = 1572

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 551  tgccgcagcagcgaccaata 570
            ||||||||||||||||||||
Sbjct: 1203 tgccgcagcagcgaccaata 1184
to top
>gb|AC126039.3| Mus musculus BAC clone RP24-234N22 from 12, complete sequence
          Length = 154037

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 201   atccagcacagccatatcct 220
             ||||||||||||||||||||
Sbjct: 85002 atccagcacagccatatcct 84983
to top
>gb|AC138459.3| Mus musculus BAC clone RP23-335K20 from 10, complete sequence
          Length = 222461

 Score = 40.1 bits (20), Expect = 7.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 61    tctcactgcttatcttcacgtttc 84
             |||||||||||||||||| |||||
Sbjct: 61198 tctcactgcttatcttcatgtttc 61221


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,668,094
Number of Sequences: 3902068
Number of extensions: 4668094
Number of successful extensions: 77575
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77440
Number of HSP's gapped (non-prelim): 135
length of query: 581
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 558
effective length of database: 17,143,297,704
effective search space: 9565960118832
effective search space used: 9565960118832
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top