>ref|XM_359735.1| Magnaporthe grisea 70-15 hypothetical protein (MG05042.4) partial
           mRNA
          Length = 2283

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 343 cgctcgtacagaggcaggaaat 364
           ||||||||||||||||||||||
Sbjct: 836 cgctcgtacagaggcaggaaat 815

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 209     gctgctggtggtgagcgtcgcg 230
               ||||||||||||||||||||||
Sbjct: 3347557 gctgctggtggtgagcgtcgcg 3347536

>gb|AF390440.1| Pseudomonas putida major facilitator subfamily transporter protein
           (mfsA), and periplasmic metal-binding protein (copP)
           genes, complete cds; cueAR operon, complete sequence;
           integral membrane efflux protein (imeA) gene, complete
           cds; and unknown gene
          Length = 6333

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 211 tgctggtggtgagcgtcgcg 230
           ||||||||||||||||||||
Sbjct: 74  tgctggtggtgagcgtcgcg 55

>gb|AE005122.1| Halobacterium sp. NRC-1 section 153 of 170 of the complete genome
          Length = 10655

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 328  cggtgacgtacaccgcgctc 347
            ||||||||||||||||||||
Sbjct: 8869 cggtgacgtacaccgcgctc 8850

>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome
          Length = 3551823

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 283     ttcggctcgccgtcatctcg 302
               ||||||||||||||||||||
Sbjct: 1583783 ttcggctcgccgtcatctcg 1583802

>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 328     cggtgacgtacaccgcgctc 347
               ||||||||||||||||||||
Sbjct: 6828070 cggtgacgtacaccgcgctc 6828089

>gb|AC002375.1|AC002375 Homo sapiens 12q24 PAC RPCI1-74B13 (Roswell Park Cancer Institute
            Human PAC library) complete sequence
          Length = 102579

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 401  aatcgcccaaagttgatgtc 420
            ||||||||||||||||||||
Sbjct: 6594 aatcgcccaaagttgatgtc 6575


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,462,983
Number of Sequences: 3902068
Number of extensions: 2462983
Number of successful extensions: 53240
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53113
Number of HSP's gapped (non-prelim): 127
length of query: 425
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 403
effective length of database: 17,147,199,772
effective search space: 6910321508116
effective search space used: 6910321508116
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)